July 2000
Volume 41, Issue 8
Free
Retina  |   July 2000
Somatostatin Receptor 2A Expression in Choroidal Neovascularization Secondary to Age-Related Macular Degeneration
Author Affiliations
  • Antoinette C. Lambooij
    From the Departments of Ophthalmology,
  • Robert W. A. M. Kuijpers
    From the Departments of Ophthalmology,
  • Elgin G. R. van Lichtenauer–Kaligis
    Immunology and Internal Medicine III, and
  • Mike Kliffen
    Pathology, Erasmus University Rotterdam;
  • G. Seerp Baarsma
    The Eye Hospital, Rotterdam; and the
  • P. Martin van Hagen
    Immunology and Internal Medicine III, and
  • Cornelia M. Mooy
    From the Departments of Ophthalmology,
    Pathology, Erasmus University Rotterdam;
    Pathology Laboratory, Dordrecht, The Netherlands.
Investigative Ophthalmology & Visual Science July 2000, Vol.41, 2329-2335. doi:
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Antoinette C. Lambooij, Robert W. A. M. Kuijpers, Elgin G. R. van Lichtenauer–Kaligis, Mike Kliffen, G. Seerp Baarsma, P. Martin van Hagen, Cornelia M. Mooy; Somatostatin Receptor 2A Expression in Choroidal Neovascularization Secondary to Age-Related Macular Degeneration. Invest. Ophthalmol. Vis. Sci. 2000;41(8):2329-2335.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

purpose. The growth of ocular neovascularization is regulated by a balance between stimulating and inhibiting growth factors. Somatostatin affects angiogenesis by inhibiting the growth hormone–insulin-like growth factor axis and also has a direct antiproliferative effect on human retinal endothelial cells. The purpose of our study is to investigate the expression of somatostatin receptor (sst) subtypes and particularly sst subtype 2A (sst2A) in normal human macula, and to study sst2A in different stages of age-related maculopathy (ARM), because of the potential anti-angiogenic effect of somatostatin analogues.

methods. Sixteen eyes (10 enucleated eyes, 4 donor eyes, and 2 surgically removed choroidal neovascular [CNV] membranes) of 15 patients with eyes at different stages of ARM were used for immunohistochemistry. Formaldehyde-fixed paraffin-embedded slides were incubated with a polyclonal anti-human sst2A antibody. mRNA expression of five ssts and somatostatin was determined in the posterior pole of three normal human eyes by reverse transcriptase–polymerase chain reaction.

results. The immunohistochemical expression of sst2A in newly formed endothelial cells and fibroblast-like cells was strong in fibrovascular CNV membranes. mRNA of sst subtypes 1, 2A, and 3, as well as somatostatin, was present in the normal posterior pole; sst subtypes 4 and 5 were not detectable.

conclusions. Most early-formed CNV in ARM express sst2A. The presence of mRNA of sst subtype 2A was observed in normal human macula, and subtypes 1 and 3 and somatostatin are also present. sst2A receptors bind potential anti-angiogenic somatostatin analogues such as octreotide. Therefore, somatostatin analogues may be an effective therapy in early stages of CNV in ARM.

Age-related maculopathy (ARM) is the major cause of blindness in people more than 65 years of age in the Western world. The prevalence of ARM is up to 14% in people aged more than 85 years. 1 Late stages of ARM, also called age-related macular degeneration (AMD), include geographic atrophy and exudative macular degeneration. The exudative form is characterized by choroidal neovascularization (CNV) and is responsible for 80% of cases of severe vision loss. 1 These numbers will increase because of the increasing age of the population. In CNV, newly formed vessels from the underlying choroid grow beneath the retinal pigment epithelium (RPE) and the retina. 2 Although the morphology of angiogenesis in CNV secondary to AMD has been described in detail, the pathogenesis is still poorly understood. A balance between a number of stimulating and inhibiting growth factors regulates the growth of neovascularization. 2 Vascular endothelial growth factor (VEGF), an endothelium-specific mitogen, is regarded as one of the most important ocular angiogenic factors, especially in ischemic disease. 2 3 4 5 6 7 8 Other regulating growth factors include fibroblast growth factors (FGFs), transforming growth factor (TGF)-β and insulin-like growth factor (IGF)-I. Most of these growth factors are shown to be upregulated in a diversity of cells (RPE, fibroblasts, capillary endothelial cells) involved in CNV. 4 5 9 10 11 12 13  
Recently, it has been shown in a transgenic mouse model that inhibition of growth hormone (GH), mediated by IGF-I, can inhibit ischemia-induced retinal neovascularization in vivo. 14 GH secretion is inhibited by somatostatin and somatostatin analogues. Systemic treatment with a somatostatin analogue diminished the level of ocular neovascularization in mice. 14  
Somatostatin binds with high affinity to five subtype receptors (sst types 1 to 5). These receptors were identified in various animal retinas. 15 16 17 The exact role of a direct receptor-mediated effect by somatostatin analogues is still unknown. To date, information about sst2 receptor expression in CNV is not available, and until now sst subtype expression has not been described in normal human retina. 
The purpose of our study was to investigate the expression of sst2A in different stages of ARM and the expression of sst subtypes and somatostatin in normal human macula. 
Materials and Methods
The study was performed according to the tenets of the Declaration of Helsinki. Enucleation or surgical excision of subfoveal CNVs was performed after obtaining informed consent of the patient. 
Patients
All eyes were retrieved from the files from the Ophthalmic Pathology Department of the University Hospital of Rotterdam. Sixteen eyes (10 enucleated eyes, 4 donor eyes, and 2 surgically removed subretinal neovascular membranes) of 15 patients with eyes at different stages of ARM were used for immunohistochemistry. The description of each eye is given in Table 1 . Eight eyes (of seven patients) had clinical diagnoses of AMD. In eight other eyes, ARM was diagnosed histopathologically according to the following criteria: Early stages of ARM (n = 3) were characterized by the presence of basal laminar deposits, basal linear deposits (BLD), soft drusen, and thickening of Bruch’s membrane. 18 Exudative AMD (n = 12) was classified as sub-RPE CNV, subretinal CNV (between neuroretina and RPE) or mixed sub-RPE and subretinal CNV. 19 20 Photoreceptors, Bruch’s membrane, and BLD were helpful in the orientation of the specimens. 19 Sub-RPE CNV and mixed CNV, or subretinal CNV in elderly patients in the presence of BLD or soft drusen were classified as CNV secondary to AMD. 19 In CNV, we recorded the presence of fibrovascular or fibrocellular tissue, hemorrhage, vascular endothelium, BLD, and RPE. 19 One eye was classified as having nonneovascular (geographic) AMD. Eight enucleated eyes without ARM (donor eyes or enucleated for other reasons) were used as controls (Table 2) . The eyes were processed for routine diagnostic procedures by fixation in formaldehyde and were embedded in paraffin. 
Immunohistochemistry
Rabbit antihuman sst2A polyclonal antibody (R2-88) was kindly provided by Agnes Schonbrunn (Department of Integrative Biology and Pharmacology, University of Texas Houston Medical School). The antibody was raised against a 22-amino acid peptide located at the C-terminal region of the sst2 receptor. The sst2A antibody had been characterized and tested before by Western blot analysis and peptide binding. 21 22 Mouse monoclonal antibody against smooth muscle actin (SMA) was obtained from Biogenex (San Ramon, CA) and mouse monoclonal antibody against macrophages (CD68) from Dako (Glastrup, Denmark). Five-micrometer sections were prepared. The sections were deparaffinated, rehydrated, and (for sst2A and CD68) microwave heated for 10 minutes. After the slides were blocked with normal goat serum (Dako, 1:10) for 15 minutes, they were incubated with the sst2A antibody (1:1000) or CD68 antibody (1:2000) overnight at 4°C or with anti-SMA (1:150) for 1 hour at room temperature. The sections were further incubated with biotinylated multilink antibodies for 30 minutes, followed by alkaline phosphatase–labeled anti-biotin (both from Biogenex) for 30 minutes. The bound antibodies were visualized by incubating the sections with new fuchsin for 30 minutes in the dark. The slides were counterstained with Mayer’s hematoxylin, mounted, and examined by light microscopy. We determined the sst2A expression quantitatively in endothelial cells of CNV by counting the proportion of positive vessels in randomly selected sections. The total number of counted vessels was pooled, and the proportions of positive cells in fibrovascular and fibrocellular CNV were compared by χ2 analysis. For other tissue components, we semiquantitatively graded sst2A expression in three categories: 0 (0%–10% positive cells), 1 (11%–50% positive cells), and 2 (51%–100% positive cells). Negative controls for immunohistochemistry included omission of the primary antibody, use of an irrelevant antibody of the same isotype, and preabsorption of the sst2A antibodies with the immunizing receptor peptide for 4 hours at a concentration of 3 μg/ml. 
Reverse Transcriptase-Polymerase Chain Reaction
To study the mRNA expression of sst subtypes in normal human eyes, posterior poles from three eyes (Table 2) were dissected directly after enucleation. A sample of approximately 0.2 mm2 located in the macula, including retina, RPE, choroid, and sclera, was snap frozen in liquid nitrogen. Reverse transcriptase–polymerase chain reaction (RT-PCR) was performed as described before 23 but with different primers (Table 3)
Several controls were included in the RT-PCR experiments. To ascertain that no detectable genomic DNA was present in the polyA+ mRNA preparation (because the sst genes are intronless), the cDNA reactions were also performed without reverse transcriptase and amplified with each primer pair. Amplification of the cDNA samples with the hypoxanthine-guanine phosphoribosyl transferase (HPRT)–specific primers served as positive control for the quality of the cDNA. To exclude contamination of the PCR reaction mixtures, the reactions were also performed in the absence of DNA template in parallel with cDNA samples. As a positive control for the PCR reactions of the sst receptor subtypes, 0.1 to 0.001 μg of human genomic DNA, representing approximately 30.000 to 300 copies of sst-template, was amplified in parallel with the cDNA samples. As a positive control for the PCR of HPRT and somatostatin cDNA, aliquots of a cDNA sample known to contain somatostatin and HPRT mRNA were amplified, because these primer pairs enclosed introns in the genomic DNA. 
Results
Immunohistochemistry
In normal retina (n = 8) we found strong sst2A expression in the inner plexiform layer and moderate expression in the outer plexiform layer, the cellular membrane of the inner nuclear layer (Fig. 1A ), and the RPE. RPE stained most frequently at the apical side in a membranous pattern (Fig. 1B) , which was also noted in tangentially cut sections. Thick-walled choroidal vessels stained mostly positive, but choriocapillaris only sporadically (Table 1) . In negative controls, no staining was detected. 
In the eyes with early ARM (n = 3), sst2A expression of the neuroretina, choroidal vessels, and choriocapillaris was similar to normal controls (Table 1) . The RPE stained positive in all cases. BLD were negative (Fig. 1C)
In eyes with exudative AMD (n = 12), Bruch’s membrane and BLD did not show sst2A expression (Table 1) . The choriocapillaris showed focal expression in only two eyes. Approximately 50% to 75% of thick-walled choroidal vessels stained positive, which was similar to normal controls. The CNV, both surgically excised and in enucleated eyes, could be subdivided in three groups, according to the activity of neovascularization. The first group consisted of fibrovascular tissue with inflammatory cells, fibroblast-like cells, and sparse fibrosis (n = 2). The second group consisted of fibrocellular scar tissue (n = 2), and the third group consisted of a mixture of both fibrovascular and fibrocellular tissue (n = 8). 19  
In the CNV, monolayers of pigmented cells adjacent to BLD were scored as RPE cells. Approximately half of these morphologically RPE cells showed sst2A expression. The expression of sst2A in newly formed endothelial cells was strong in fibrovascular membranes. Similarly, sst2A was strongly expressed in endothelial cells of mixed fibrovascular and fibrocellular membranes (Fig. 1E 1F 1G) . Fibroblast-like cells and macrophages stained strongly positive in young membranes and less strongly in older scars (Fig. 1E 1G 1H) . Little or negative staining was observed in old hypocellular scars (Fig. 1H) . Expression in endothelial cells in fibrovascular membranes (61.5%) was statistically significant more often than in fibrocellular membranes (29.5%; χ2 analysis, P < 0.001). Staining in CNV was considered specific, because peptide blocking significantly decreased staining of all structures mentioned (Fig. 1D)
In one eye with a mixed fibrovascular and fibrocellular membrane (eye 12), we found positive staining of myofibroblasts in a hypercellular area of the underlying choroid in the posterior pole. This area also stained positively with antibodies directed against SMA and CD68, confirming the presence of myofibroblasts and macrophages. 
In the eye with nonneovascular AMD, the staining pattern was similar to control tissue. The RPE stained positively. No staining was seen in the choriocapillaris, and vessels in the choroid were mostly positive. 
Reverse Transcriptase-Polymerase Chain Reaction
RT-PCR analysis of three posterior poles, including retina, RPE, choroid, and sclera, revealed that mRNA encoding for sst1, sst2A, sst3, and somatostatin is expressed in the posterior pole of normal human eyes. No mRNA encoding for sst4 or sst5 was detected (Fig. 2 , Table 2 ). 
Discussion
In the present study normal human eyes and eyes with early and late stages of ARM expressed sst2A. The localization of sst2A expression in the neuroretina is consistent with findings in rabbit 15 and rat 16 retina and reflects the assumed physiological neuromodulator function of somatostatin. 24 25 In early stages of ARM, the choroidal vasculature and neuroretinal tissue stained identically with control tissue. We found no expression of sst2A in BLD or drusen, which is in contrast with findings for other angiogenic growth factors such as VEGF. 3  
In eyes with exudative AMD, we found strong expression of sst2A in endothelial cells and fibroblast-like cells in early CNV. The expression of sst2A in newly formed capillaries was abundant in fibrovascular CNV membranes. Similarly, in the active component of mixed fibrovascular–fibrocellular CNV, sst2A was strongly expressed in endothelial cells. Grant et al. 26 demonstrated the presence of somatostatin receptors on cultured human retinal endothelial cells. They showed a direct inhibitory action of a somatostatin analogue on proliferation of these endothelial cells. Therefore, the angiogenic cells of CNV membranes may be capable of receiving angiogenic inhibition, directly receptor mediated or indirectly through inhibition of GH and IGF-I by somatostatin. In mice retina, somatostatin analogues have an inhibitory effect on neovascularization. 14 Somatostatin analogues, such as the long-acting octreotide, which binds to somatostatin receptor subtypes 2 and 5, are used as experimental treatment in neovascular eye diseases such as diabetic retinopathy. 27 28 29  
We found strong sst2A expression in fibroblast-like cells and macrophages in fibrovascular CNV and in intrachoroidal myofibroblasts. sst2A staining in myofibroblasts may be due to cross-reactivity to myosin, 30 but macrophages have been shown to express sst2A. 31 Macrophages and choroidal fibroblasts are thought to be one of the main sources of VEGF in the early stage of the disease. 6 10 32 Both macrophages and choroidal fibroblasts are also capable of releasing other angiogenic factors such as tumor necrosis factor (TNF)-α and IGF-I. 33 Somatostatin analogues have been shown to inhibit the release of macrophage and monocyte products such as TNF-α, interleukin (IL)-1β, IL-6 and IL-8 in vitro, 34 35 although there are also conflicting data. 36 The functional role of somatostatin with regard to the angiogenic factor synthesis and release has to be established. 
In the overlying neuroretina of eyes with CNV, we found no obvious change of sst2A expression and localization in comparison to normal eyes. This is in contrast to VEGF expression in neuronal tissue, which is upregulated under hypoxic circumstances. 3 8 This may indicate that the function of somatostatin on neuronal tissue is not influenced by hypoxic retinal disease. However, some care should be taken when interpreting these results, because they are semiquantitatively determined. It has recently been shown in a transgenic mouse model that inhibition of GH, mediated by IGF-I, can inhibit ischemia-induced retinal neovascularization in vivo, but it does not reduce hypoxia-induced VEGF mRNA or protein levels. It has been postulated that GH-IGF-I and VEGF have distinct functions in the control of angiogenesis: VEGF may control acute oxygen regulation, whereas IGF-I may control neovascularization on the basis of availability of nutrients for cell division. 14 Our findings support the hypothesis that somatostatin and VEGF have distinct functions in the control of angiogenesis. 
We confirmed local synthesis of sst2A in the macula of normal human eyes with RT-PCR. We also demonstrated the expression of mRNA encoding for sst subtypes 1 and 3. In rats, sst2 appeared to be the major subtype in the retina, but all other subtypes were expressed in retina and posterior pole as well. 17 Differential expression of sst has also been described previously in the immune system. 37 We also found mRNA expression of the neuropeptide somatostatin in the human macula. Production of somatostatin in the retina has been shown in rats with Northern blot analysis hybridization and mRNA in situ hybridization. 38 39 40 The production of both somatostatin and its receptors simultaneously suggests an autocrine action of somatostatin in the human retina. 
From our findings we conclude that the sst2A receptor in choroid and retina of early ARM and nonneovascular AMD is localized similar to normal controls. In eyes with CNV, the sst2A receptor is strongly expressed in the fibrovascular phase of CNV, as well as in intrachoroidal myofibroblasts. mRNA of sst subtypes 1, 2A, and 3, as well as mRNA of somatostatin are expressed in the macula of the normal human eye. The functional role of somatostatin with regard to the synthesis and release of angiogenic factors has to be established. Because of the sst expression in CNV, somatostatin analogues may be an effective therapy in early stages of CNV in AMD. 
 
Table 1.
 
Patient Data and sst2A Receptor Expression in Eyes with ARM
Table 1.
 
Patient Data and sst2A Receptor Expression in Eyes with ARM
Age/Sex Eye Clinical Description Histological Classification sst2A Expression in Preexistent Tissue* sst2A Expression in Neovascular Tissue
Fibro- vascular Fibro- cellular
RPE CC CH EC, † FBL EC, † FBL
1 85/M OS Necrotising sclerokeratomalacia Early ARM: BLD ++ 0 ++ NA NA NA NA
2 98/F OS Corneal ulcer Early ARM: confluent soft drusen ++ + ++ NA NA NA NA
3 96/F OD Staphyloma, suspected ciliary body melanoma Early ARM: BLD; glaucoma; corneal ulcer ++ 0 + NA NA NA NA
4 77/M OS Neovascular glaucoma Nonneovascular AMD, early geographic atrophy; occlusion central retinal artery; ischemic retinal disease ++ 0 + NA NA NA NA
5 73/M OD Disciform MD, after irradiation Subretinal CNV, FV + 0 ++ 2/3 + NA NA
6 85/F OS Postsurgical endophthalmitis Subretinal CNV, FV, endophthalmitis, uveitis + 0 + 2/2 + NA NA
7 79/M U Surgically excised CNV Mixed CNV, FV and FC, HEM NP NP NP 37/48 ++ NP 0
8 79/F U Surgically excised CNV Subretinal CNV, FV and FC, HEM NP NP NP 15/18 ++ NP ++
9 72/M OS Disciform MD Mixed CNV, BLD, FV and FC, HEM + 0 + 28/50 + 0/7 0
10 86/M OS Disciform MD, acute glaucoma Sub-RPE CNV, BLD, FV and FC, HEM; retinal detachment; posterior uveitis ++ + ++ NP NP 2/4 ++
11 87/M OS Donor eye Disciform MD, mixed CNV, BLD, FV and FC ++ + ++ 11/16 + 3/5 +
12 83/M OD Painful eye, suspected uveal melanoma Ischemic retinal disease; disciform MD, mixed CNV, BLD, FV and FC, HEM ++ 0 + 26/64 ++ 0/3 ++
13 73/M OS Disciform MD Subretinal CNV, FC and FV ++ 0 + 13/15 ++ NC +
14 84/F OS Disciform MD Mixed CNV, FV and FC, HEM + 0 + 0/2 + NC 0
15 91/M OS Donor eye Disciform MD, mixed CNV, BLD, FC NC 0 NC NA NA 0/6 +
16 82/M OD Disciform MD Mixed CNV, confluent soft drusen, FC + 0 0 NA NA 13/36 0
Table 2.
 
Patient Data and sst Receptor Subtype Expression in Normal Eyes
Table 2.
 
Patient Data and sst Receptor Subtype Expression in Normal Eyes
Age/Sex Eye Clinical Description sst Receptor Subtype Expression* (RT-PCR) sst2A Expression, † (Immuno- histochemistry)
sst1 sst2A sst3 sst4 sst5 SS14 HPRT RPE CC CH
1 71/U OD Donor eye ND ND ND ND ND ND ND ++ + ++
2 51/M OD Ciliary body melanoma ND ND ND ND ND ND ND + 0 +
3 78/M OS Choroidal melanoma ND ND ND ND ND ND ND ++ 0 +
4 81/M OS Tarsal squamous cell carcinoma ND ND ND ND ND ND ND + + ++
5 42/M OS Choroidal melanoma ND ND ND ND ND ND ND ++ 0 ++
6 76/F OS Choroidal melanoma ND ND ND ND ND ND ND ++ 0 ++
7 57/M OS Recurrent conjunctival melanoma ND ND ND ND ND ND ND + 0 +
8 60/M OS Choroidal melanoma ND ND ND ND ND ND ND ++ 0 ++
9 69/M OD Ciliary body adenoma + + + + + ND ND ND
10 78/M OS Spindle cell nevus + + + + + ND ND ND
11 26/M OS Choroidal melanoma + + + + + ND ND ND
Table 3.
 
Primers Used for RT-PCR Analysis
Table 3.
 
Primers Used for RT-PCR Analysis
Receptor Primer Sequence (5′–3′)* Product Size (base pair)
sst1 Forward ATGGTGGCCCTCAAGGCCGG 318
Reverse CGCGGTGGCGTAATAGTCAA
sst2A Forward GCCAAGATGAAGACCATCAC 414
Reverse GATGAACCCTGTGTACCAAGC
sst3 Forward CCAACGTCTACATCCTCAACC 314
Reverse TCCCGAGAAGACCACCAC
sst4 Forward ATCTTCGCAGACACCAGACC 321
Reverse ATCAAGGCTGGTCACGACGA
sst5 Forward CGTCTTCATCATCTACACGG 226
Reverse CCGTCTTCATCATCTACACGG
SS14 Forward GATGCTGTCCTGCCGCCTCCAG 349
Reverse ACAGGATGTGAAAGTCTTCCA
HPRT Forward CAGGACTGAACGTCTTGCTC 413
Reverse CAAATCCAACAAAGTCTGGC
Figure 1.
 
Immunolocalization of sst2A in posterior pole of normal eyes and eyes with different stages of ARM. Immunohistochemistry was performed on paraffin-embedded tissue, and visualized with an alkaline phosphatase detection system using a red chromogen. (A) Positive staining of normal neuroretina, with strong sst2A expression in the inner plexiform layer (IPL) and moderate expression in the outer plexiform layer and the cellular membrane of the inner nuclear layer (INL). (B) sst2A staining of normal RPE, showing the membranous staining pattern on the apical side. (C) sst2A staining of an eye with early ARM, showing negative staining BLD and soft drusen (#). (D) Negative control staining of CNV (∗) in eye 13 with peptide blocking. (E through H) sst2A staining of CNV (∗) in eyes with AMD. Upper pictures are overviews; lower pictures are details. (E) sst2A staining of a surgically excised fibrovascular CNV (eye 7), with many positive fibroblast-like cells. (F) sst2A staining of a fibrovascular CNV (eye 5) and (G) of a mixed fibrovascular and fibrocellular CNV (eye 13). Long arrows: Positive endothelium of newly formed vessels; short arrows: positive fibroblast-like cells; ∗: CNV. (H) Staining of a fibrocellular CNV (eye 16), with negative endothelial cells (white arrow) and fibroblast-like cells. ONL, outer nuclear layer; PR, photoreceptor layer; RPE, retinal pigment epithelium; CH, choroid; BM, Bruch’s membrane; NR, overlying neuroretina. Original magnification, (A) ×200; (B through H) ×400; (E, overview) ×100; (F through H, overviews) ×200.
Figure 1.
 
Immunolocalization of sst2A in posterior pole of normal eyes and eyes with different stages of ARM. Immunohistochemistry was performed on paraffin-embedded tissue, and visualized with an alkaline phosphatase detection system using a red chromogen. (A) Positive staining of normal neuroretina, with strong sst2A expression in the inner plexiform layer (IPL) and moderate expression in the outer plexiform layer and the cellular membrane of the inner nuclear layer (INL). (B) sst2A staining of normal RPE, showing the membranous staining pattern on the apical side. (C) sst2A staining of an eye with early ARM, showing negative staining BLD and soft drusen (#). (D) Negative control staining of CNV (∗) in eye 13 with peptide blocking. (E through H) sst2A staining of CNV (∗) in eyes with AMD. Upper pictures are overviews; lower pictures are details. (E) sst2A staining of a surgically excised fibrovascular CNV (eye 7), with many positive fibroblast-like cells. (F) sst2A staining of a fibrovascular CNV (eye 5) and (G) of a mixed fibrovascular and fibrocellular CNV (eye 13). Long arrows: Positive endothelium of newly formed vessels; short arrows: positive fibroblast-like cells; ∗: CNV. (H) Staining of a fibrocellular CNV (eye 16), with negative endothelial cells (white arrow) and fibroblast-like cells. ONL, outer nuclear layer; PR, photoreceptor layer; RPE, retinal pigment epithelium; CH, choroid; BM, Bruch’s membrane; NR, overlying neuroretina. Original magnification, (A) ×200; (B through H) ×400; (E, overview) ×100; (F through H, overviews) ×200.
Figure 2.
 
Expression of sst receptor subtype mRNA in the posterior pole of a normal human eye, detected by RT-PCR. sst1, sst2A, and sst3 were detected. Signals for sst4 and sst5 were too low to detect or absent. mRNA for somatostatin (SS14) was also detected. HPRT was used as internal control. Marker, 100 bp.
Figure 2.
 
Expression of sst receptor subtype mRNA in the posterior pole of a normal human eye, detected by RT-PCR. sst1, sst2A, and sst3 were detected. Signals for sst4 and sst5 were too low to detect or absent. mRNA for somatostatin (SS14) was also detected. HPRT was used as internal control. Marker, 100 bp.
The authors thank Frieda van der Ham and Diana Mooij for technical assistance, Frank van der Panne and Huib de Bruin for photography, and Carolien Klaver for statistical analysis. 
Vingerling JR, Dielemans I, Hofman A, et al. Prevalence of age-related maculopathy in the Rotterdam Study. Ophthalmology. 1995;102:205–210. [CrossRef] [PubMed]
D’Amore PA. Mechanisms of retinal and choroidal neovascularization. Invest Ophthalmol Vis Sci. 1994;35:3974–3979. [PubMed]
Kliffen M, Sharma HS, Mooy CM, et al. Increased expression of angiogenic growth factors in age-related maculopathy. Br J Ophthalmol. 1997;81:154–162. [CrossRef] [PubMed]
Frank RN, Amin RH, Eliott D, et al. Basic fibroblast growth factor and vascular endothelial growth factor are present in epiretinal and choroidal neovascular membranes. Am J Ophthalmol. 1996;122:393–403. [CrossRef] [PubMed]
Kvanta A, Algvere PV, Berglin L, et al. Subfoveal fibrovascular membranes in age-related macular degeneration express vascular endothelial growth factor. Invest Ophthalmol Vis Sci. 1996;37:1929–1934. [PubMed]
Yi X, Ogata N, Komada M, et al. Vascular endothelial growth factor expression in choroidal neovascularization in rats. Graefes Arch Clin Exp Ophthalmol. 1997;235:313–319. [CrossRef] [PubMed]
Pe’er J, Folberg R, Itin A, et al. Vascular endothelial growth factor upregulation in human central retinal vein occlusion. Ophthalmology. 1998;105:412–426. [CrossRef] [PubMed]
Pe’er J, Shweiki D, Itin A, et al. Hypoxia-induced expression of vascular endothelial growth factor by retinal cells is a common factor in neovascularizing ocular diseases. Lab Invest. 1995;72:638–644. [PubMed]
Lopez PF, Sippy BD, Lambert HM, et al. Transdifferentiated retinal pigment epithelial cells are immunoreactive for vascular endothelial growth factor in surgically excised age-related macular degeneration-related choroidal neovascular membranes. Invest Ophthalmol Vis Sci. 1996;37:855–868. [PubMed]
Ishibashi T, Hata Y, Yoshikawa H, et al. Expression of vascular endothelial growth factor in experimental choroidal neovascularization. Graefes Arch Clin Exp Ophthalmol. 1997;235:159–167. [CrossRef] [PubMed]
Amin R, Puklin JE, Frank RN. Growth factor localization in choroidal neovascular membranes of age-related macular degeneration. Invest Ophthalmol Vis Sci. 1994;35:3178–3188. [PubMed]
Kitaoka T, Morse LS, Schneeberger S, et al. Expression of FGF5 in choroidal neovascular membranes associated with ARMD. Curr Eye Res. 1997;16:396–399. [CrossRef] [PubMed]
Reddy VM, Zamora RL, Kaplan HJ. Distribution of growth factors in subfoveal neovascular membranes in age-related macular degeneration and presumed ocular histoplasmosis syndrome. Am J Ophthalmol. 1995;120:291–301. [CrossRef] [PubMed]
Smith LEH, Kopchick JJ, Chen W, et al. Essential role of growth hormone in ischemia-induced retinal neovascularization. Science. 1997;276:1706–1709. [CrossRef] [PubMed]
Johnson J, Wong H, Walsh JH, Brecha NC. Expression of the somatostatin subtype 2A receptor in the rabbit retina. J Comp Neurol. 1998;393:93–101. [CrossRef] [PubMed]
Helboe L, Moller M. Immunohistochemical localization of somatostatin receptor subtypes sst1 and sst2 in the rat retina. Invest Ophthalmol Vis Sci. 1999;40:2376–2382. [PubMed]
Mori M, Aihara M, Shimizu T. Differential expression of somatostatin receptors in the rat eye: sstR4 is intensely expressed in the iris/ciliary body. Neurosci Lett. 1997;223:185–188. [CrossRef] [PubMed]
van der Schaft TL, de Bruijn WC, Mooy CM, et al. Histologic features of the early stages of age-related macular degeneration: a statistical analysis. Ophthalmology. 1992;99:278–286. [CrossRef] [PubMed]
Grossniklaus HE, Gass JDM. Clinicopathologic correlations of surgically excised type 1 and type 2 submacular choroidal neovascular membranes. Am J Ophthalmol. 1998;126:59–69. [CrossRef] [PubMed]
Grossniklaus HE, Green R. Histopathologic and ultrastructural findings of surgically excised choroidal neovascularization. Submacular Surgery Trials Research Group. Arch Ophthalmol. 1998;116:745–749. [CrossRef] [PubMed]
Gu Y-Z, Schonbrunn A. Coupling specificity between somatostatin receptor sst2A and G proteins: isolation of the receptor-G protein complex with a receptor antibody. Mol Endocrinol. 1997;11:527–537. [CrossRef] [PubMed]
Hofland LJ, Liu Q, Van Koetsveld PM, et al. Immunohistochemical detection of somatostatin receptor subtypes sst1 and sst2A in human somatostatin receptor positive tumors. J Clin Endocrinol Metab.. 1999;84:775–780. [CrossRef] [PubMed]
Ferone D, van Hagen PM, van Koetsveld PM, et al. In vitro characterization of somatostatin receptors in the human thymus and effects of somatostatin and octreotide on cultured thymic epithelial cells. Endocrinology. 1999;140:373–380. [CrossRef] [PubMed]
Sagar SM, Marshall PE, Onesti ST, et al. Somatostatin immunoreactivity in the rabbit retina. Invest Ophthalmol Vis Sci. 1986;27:316–322. [PubMed]
Zalutsky RA, Miller RF. The physiology of somatostatin in the rabbit retina. J Neurosci. 1990;10:383–393. [PubMed]
Grant MB, Caballero S, Millard WJ. Inhibition of IGF-I and b-FGF stimulated growth of human retinal endothelial cells by the somatostatin analogue, octreotide: a potential treatment for ocular neovascularization. Regul Pept. 1993;48:267–278. [CrossRef] [PubMed]
Mallet B, Vialettes B, Haroche S, et al. Stabilization of severe proliferative diabetic retinopathy by long-term treatment with SMS 201–995. Diabetes Metab.. 1992;18:438–444.
Shumack SL, Grossman LD, Chew E, et al. Growth hormone suppression and nonproliferative diabetic retinopathy: a preliminary feasibility study. Clin Invest Med. 1990;5:287–292.
Kirkegaard C, Norgaard K, Snorgaard O, et al. Effect of one year continuous subcutaneous infusion of a somatostatin analogue, octreotide, on early retinopathy, metabolic control and thyroid function in type I (insulin-dependent) diabetes mellitus. Acta Endocrinol (Copenh). 1990;122:766–772. [PubMed]
Reubi JC, Laissue JA, Waser B, et al. Immunohistochemical detection of somatostatin sst2A receptors in the lymphatic, smooth muscular, and peripheral nervous systems of the human gastrointestinal tract: facts and artifacts. J Clin Endocrinol Metab.. 1999;84:2942–2950. [PubMed]
Ten Bokum AMC, Hofland LJ, de Jong G, et al. Immunohistochemical localization of somatostatin receptor sst2A in sarcoid granulomas. Eur J Clin Invest. 1999;29:630–636. [CrossRef] [PubMed]
Kvanta A. Expression and regulation of vascular endothelial growth factor in choroidal fibroblasts. Curr Eye Res. 1995;14:1015–1020. [CrossRef] [PubMed]
Sunderkotter C, Goebeler M, Schulze–Osthoff K, et al. Macrophage-derived angiogenesis factors. Rev Pharmacol Ther. 1991;51:195–216. [CrossRef]
Chao TC, Cheng HP, Walter RJ. Somatostatin and macrophage function: modulation of hydrogen peroxide, nitric oxide and tumor necrosis factor release. Regul Pept. 1995;58:1–10. [CrossRef] [PubMed]
Peluso G, Petillo O, Melone MA, et al. Modulation of cytokine production in activated human monocytes by somatostatin. Neuropeptides. 1996;30:443–451. [CrossRef] [PubMed]
Komorowski J, Stepien H. Somatostatin stimulates the release of interleukin-6 from human peripheral blood monocytes in vitro. Neuropeptides. 1995;29:77–81. [CrossRef] [PubMed]
Ten Bokum AMC, Lichtenauer–Kaligis EGR , Melief MJ, et al. Somatostatin receptor subtype expression in cells of the rat immune system during adjuvant arthritis. J Endocrinol. 1999;161:167–175. [CrossRef] [PubMed]
Ferriero DM, Head VA, Edwards RH, Sagar SM. Somatostatin mRNA and molecular forms during development of the rat retina. Brain Res Dev Brain Res. 1990;57:15–19. [CrossRef] [PubMed]
Larsen JN, Bersani M, Olcese J, Holst JJ, Moller M. Somatostatin and prosomatostatin in the retina of the rat: an immunohistochemical, in-situ hybridization, and chromatographic study. Vis Neurosci. 1990;5:441–452. [CrossRef] [PubMed]
Yamaguchi K, Gaur VP, Spira AW, Turner JE. Cellular localization of somatostatin mRNA in rat retina. Neuropeptides. 1990;17:13–16. [CrossRef] [PubMed]
Wulfsen I, Meyerhof W, Fehr S, Richter D. Expression pattern of rat somatostatin receptor genes in pre- and postnatal brain and pituitary. J Neurochem. 1993;61:1549–1552. [CrossRef] [PubMed]
Kubota A, Yamada Y, Kagimoto S, et al. Identification of somatostatin receptor subtypes and an implication for the efficacy of somatostatin analogue SMS 201–995 in treatment of human endocrine tumors. J Clin Invest. 1994;93:1321–1325. [CrossRef] [PubMed]
Figure 1.
 
Immunolocalization of sst2A in posterior pole of normal eyes and eyes with different stages of ARM. Immunohistochemistry was performed on paraffin-embedded tissue, and visualized with an alkaline phosphatase detection system using a red chromogen. (A) Positive staining of normal neuroretina, with strong sst2A expression in the inner plexiform layer (IPL) and moderate expression in the outer plexiform layer and the cellular membrane of the inner nuclear layer (INL). (B) sst2A staining of normal RPE, showing the membranous staining pattern on the apical side. (C) sst2A staining of an eye with early ARM, showing negative staining BLD and soft drusen (#). (D) Negative control staining of CNV (∗) in eye 13 with peptide blocking. (E through H) sst2A staining of CNV (∗) in eyes with AMD. Upper pictures are overviews; lower pictures are details. (E) sst2A staining of a surgically excised fibrovascular CNV (eye 7), with many positive fibroblast-like cells. (F) sst2A staining of a fibrovascular CNV (eye 5) and (G) of a mixed fibrovascular and fibrocellular CNV (eye 13). Long arrows: Positive endothelium of newly formed vessels; short arrows: positive fibroblast-like cells; ∗: CNV. (H) Staining of a fibrocellular CNV (eye 16), with negative endothelial cells (white arrow) and fibroblast-like cells. ONL, outer nuclear layer; PR, photoreceptor layer; RPE, retinal pigment epithelium; CH, choroid; BM, Bruch’s membrane; NR, overlying neuroretina. Original magnification, (A) ×200; (B through H) ×400; (E, overview) ×100; (F through H, overviews) ×200.
Figure 1.
 
Immunolocalization of sst2A in posterior pole of normal eyes and eyes with different stages of ARM. Immunohistochemistry was performed on paraffin-embedded tissue, and visualized with an alkaline phosphatase detection system using a red chromogen. (A) Positive staining of normal neuroretina, with strong sst2A expression in the inner plexiform layer (IPL) and moderate expression in the outer plexiform layer and the cellular membrane of the inner nuclear layer (INL). (B) sst2A staining of normal RPE, showing the membranous staining pattern on the apical side. (C) sst2A staining of an eye with early ARM, showing negative staining BLD and soft drusen (#). (D) Negative control staining of CNV (∗) in eye 13 with peptide blocking. (E through H) sst2A staining of CNV (∗) in eyes with AMD. Upper pictures are overviews; lower pictures are details. (E) sst2A staining of a surgically excised fibrovascular CNV (eye 7), with many positive fibroblast-like cells. (F) sst2A staining of a fibrovascular CNV (eye 5) and (G) of a mixed fibrovascular and fibrocellular CNV (eye 13). Long arrows: Positive endothelium of newly formed vessels; short arrows: positive fibroblast-like cells; ∗: CNV. (H) Staining of a fibrocellular CNV (eye 16), with negative endothelial cells (white arrow) and fibroblast-like cells. ONL, outer nuclear layer; PR, photoreceptor layer; RPE, retinal pigment epithelium; CH, choroid; BM, Bruch’s membrane; NR, overlying neuroretina. Original magnification, (A) ×200; (B through H) ×400; (E, overview) ×100; (F through H, overviews) ×200.
Figure 2.
 
Expression of sst receptor subtype mRNA in the posterior pole of a normal human eye, detected by RT-PCR. sst1, sst2A, and sst3 were detected. Signals for sst4 and sst5 were too low to detect or absent. mRNA for somatostatin (SS14) was also detected. HPRT was used as internal control. Marker, 100 bp.
Figure 2.
 
Expression of sst receptor subtype mRNA in the posterior pole of a normal human eye, detected by RT-PCR. sst1, sst2A, and sst3 were detected. Signals for sst4 and sst5 were too low to detect or absent. mRNA for somatostatin (SS14) was also detected. HPRT was used as internal control. Marker, 100 bp.
Table 1.
 
Patient Data and sst2A Receptor Expression in Eyes with ARM
Table 1.
 
Patient Data and sst2A Receptor Expression in Eyes with ARM
Age/Sex Eye Clinical Description Histological Classification sst2A Expression in Preexistent Tissue* sst2A Expression in Neovascular Tissue
Fibro- vascular Fibro- cellular
RPE CC CH EC, † FBL EC, † FBL
1 85/M OS Necrotising sclerokeratomalacia Early ARM: BLD ++ 0 ++ NA NA NA NA
2 98/F OS Corneal ulcer Early ARM: confluent soft drusen ++ + ++ NA NA NA NA
3 96/F OD Staphyloma, suspected ciliary body melanoma Early ARM: BLD; glaucoma; corneal ulcer ++ 0 + NA NA NA NA
4 77/M OS Neovascular glaucoma Nonneovascular AMD, early geographic atrophy; occlusion central retinal artery; ischemic retinal disease ++ 0 + NA NA NA NA
5 73/M OD Disciform MD, after irradiation Subretinal CNV, FV + 0 ++ 2/3 + NA NA
6 85/F OS Postsurgical endophthalmitis Subretinal CNV, FV, endophthalmitis, uveitis + 0 + 2/2 + NA NA
7 79/M U Surgically excised CNV Mixed CNV, FV and FC, HEM NP NP NP 37/48 ++ NP 0
8 79/F U Surgically excised CNV Subretinal CNV, FV and FC, HEM NP NP NP 15/18 ++ NP ++
9 72/M OS Disciform MD Mixed CNV, BLD, FV and FC, HEM + 0 + 28/50 + 0/7 0
10 86/M OS Disciform MD, acute glaucoma Sub-RPE CNV, BLD, FV and FC, HEM; retinal detachment; posterior uveitis ++ + ++ NP NP 2/4 ++
11 87/M OS Donor eye Disciform MD, mixed CNV, BLD, FV and FC ++ + ++ 11/16 + 3/5 +
12 83/M OD Painful eye, suspected uveal melanoma Ischemic retinal disease; disciform MD, mixed CNV, BLD, FV and FC, HEM ++ 0 + 26/64 ++ 0/3 ++
13 73/M OS Disciform MD Subretinal CNV, FC and FV ++ 0 + 13/15 ++ NC +
14 84/F OS Disciform MD Mixed CNV, FV and FC, HEM + 0 + 0/2 + NC 0
15 91/M OS Donor eye Disciform MD, mixed CNV, BLD, FC NC 0 NC NA NA 0/6 +
16 82/M OD Disciform MD Mixed CNV, confluent soft drusen, FC + 0 0 NA NA 13/36 0
Table 2.
 
Patient Data and sst Receptor Subtype Expression in Normal Eyes
Table 2.
 
Patient Data and sst Receptor Subtype Expression in Normal Eyes
Age/Sex Eye Clinical Description sst Receptor Subtype Expression* (RT-PCR) sst2A Expression, † (Immuno- histochemistry)
sst1 sst2A sst3 sst4 sst5 SS14 HPRT RPE CC CH
1 71/U OD Donor eye ND ND ND ND ND ND ND ++ + ++
2 51/M OD Ciliary body melanoma ND ND ND ND ND ND ND + 0 +
3 78/M OS Choroidal melanoma ND ND ND ND ND ND ND ++ 0 +
4 81/M OS Tarsal squamous cell carcinoma ND ND ND ND ND ND ND + + ++
5 42/M OS Choroidal melanoma ND ND ND ND ND ND ND ++ 0 ++
6 76/F OS Choroidal melanoma ND ND ND ND ND ND ND ++ 0 ++
7 57/M OS Recurrent conjunctival melanoma ND ND ND ND ND ND ND + 0 +
8 60/M OS Choroidal melanoma ND ND ND ND ND ND ND ++ 0 ++
9 69/M OD Ciliary body adenoma + + + + + ND ND ND
10 78/M OS Spindle cell nevus + + + + + ND ND ND
11 26/M OS Choroidal melanoma + + + + + ND ND ND
Table 3.
 
Primers Used for RT-PCR Analysis
Table 3.
 
Primers Used for RT-PCR Analysis
Receptor Primer Sequence (5′–3′)* Product Size (base pair)
sst1 Forward ATGGTGGCCCTCAAGGCCGG 318
Reverse CGCGGTGGCGTAATAGTCAA
sst2A Forward GCCAAGATGAAGACCATCAC 414
Reverse GATGAACCCTGTGTACCAAGC
sst3 Forward CCAACGTCTACATCCTCAACC 314
Reverse TCCCGAGAAGACCACCAC
sst4 Forward ATCTTCGCAGACACCAGACC 321
Reverse ATCAAGGCTGGTCACGACGA
sst5 Forward CGTCTTCATCATCTACACGG 226
Reverse CCGTCTTCATCATCTACACGG
SS14 Forward GATGCTGTCCTGCCGCCTCCAG 349
Reverse ACAGGATGTGAAAGTCTTCCA
HPRT Forward CAGGACTGAACGTCTTGCTC 413
Reverse CAAATCCAACAAAGTCTGGC
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×