May 2004
Volume 45, Issue 5
Free
Retina  |   May 2004
Apoptosis in Proliferative Vitreoretinopathy
Author Affiliations
  • Ibraheem El Ghrably
    From the Divisions of Ophthalmology and Visual Sciences, and
  • Des G. Powe
    Histopathology, University Hospital, Nottingham, United Kingdom; and
  • Gavin Orr
    From the Divisions of Ophthalmology and Visual Sciences, and
  • David Fischer
    Wills Eye Hospital, Philadelphia, Pennsylvania.
  • Richard McIntosh
    From the Divisions of Ophthalmology and Visual Sciences, and
  • Harminder S. Dua
    From the Divisions of Ophthalmology and Visual Sciences, and
  • Patrick J. Tighe
    From the Divisions of Ophthalmology and Visual Sciences, and
Investigative Ophthalmology & Visual Science May 2004, Vol.45, 1473-1479. doi:10.1167/iovs.03-0060
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Ibraheem El Ghrably, Des G. Powe, Gavin Orr, David Fischer, Richard McIntosh, Harminder S. Dua, Patrick J. Tighe; Apoptosis in Proliferative Vitreoretinopathy. Invest. Ophthalmol. Vis. Sci. 2004;45(5):1473-1479. doi: 10.1167/iovs.03-0060.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

Purpose. To study the involvement of apoptosis using different apoptosis markers in PVR pathogenesis.

Methods. The presence of mRNA coding for Fas, Fas ligand (FasL), and TNF-related apoptosis inducing ligand (TRAIL) was investigated in vitreous samples from 46 consecutive patients—25 with PVR, 11 with retinal detachment (RD) not complicated by PVR, and 10 with macular hole (MH)—using RT-PCR. From previously examined vitreous samples, 21 PVR, 9 RD, and 10 MH were examined for their levels of TGF-β2 protein with sandwich ELISA kits. Five epiretinal membranes excised from five patients with PVR were also examined for apoptotic cell death using the terminal deoxytransferase (TdT) mediated dUTP-biotin nick end labeling (TUNEL) technique.

Results. FAS mRNA was detected in 72% of patients with PVR, 55% of patients with RD and 20% of patients with MH. TRAIL mRNA was detected in 67% of patients with PVR, 89% of patients with RD, and 20% of patients with MH. FasL mRNA was detected in 20% of patients with PVR, 9% of patients with RD, and 10% of patients with MH. The median levels of Fas and TRAIL mRNA were significantly higher (P < 0.05) in patients with PVR than in those with MH hole but between patients with PVR and those with RD the difference was not significant (P > 0.05). A significant difference was detected between RD and MH for TRAIL mRNA levels (P = 0.008). For FasL, no significant difference between groups was found. TGF-β2 was detected in all investigated vitreous samples. A significant difference was found between the PVR and MH groups (P = 0.001) and between the RD and MH groups (P = 0.004), but not between the PVR and RD groups (P < 0.05). The level of TGF-β2 was significantly correlated to the level of TRAIL mRNA (r = 0.86), but no correlation was found between TGF-β2 and Fas mRNA levels (r = 0.21). Four of five examined PVR epiretinal membranes showed positive staining for apoptotic cells using the TUNEL technique.

Conclusions. Apoptosis is one of the mechanisms that is involved in PVR pathogenesis. Different apoptosis markers suggest different pathways occur in PVR, including Fas/FasL, TRAIL, and TGF-β2 mediated processes.

Apoptosis is a morphologically defined type of cell death that is commonly observed during development—for example, in the immune and central nervous systems. It has emerged as playing a central role in the regulation of cell proliferation and loss in normal and pathologic tissue formation. Apoptosis involves a sequence of morphologic events resulting in cell death, including shrinkage, condensation of nuclear chromatin and cytoplasm, and fragmentation of the cell into apoptotic bodies. Apoptosis allows for the safe disposal of cellular remnants without causing damage to the adjacent tissue. Apoptotic cell death may play an important role in the development of some pathologic conditions. 1 These include ophthalmic diseases, such as retinal degeneration, 2 3 4 glaucoma, 5 6 uveitis, 7 and corneal diseases. 8  
Apoptosis may be induced by a variety of signals. Fas (CD95) and its ligand FasL (CD95 ligand) are cell surface proteins of the tumor necrosis factor (TNF)-α receptor and TNFα superfamilies, respectively. Fas, on binding FasL, initiates intracellular signaling, leading to apoptosis. Significant expression of Fas is limited to a few tissues, including the thymus, heart, liver, and ovary. 9 Another apoptosis marker, TNF-related apoptosis inducing ligand (TRAIL), has also been identified as a member of the TNF superfamily of death-inducing ligands. 10 Like FasL, TRAIL induces rapid apoptosis in a variety of lymphoid and myeloid malignancies. 10 11 12 Transforming growth factor (TGF)-β, a pleiotropic cytokine thought to be involved in the induction of fibrosis, has been detected in the vitreous of pathologic samples 13 14 and induces apoptosis in various types of cells, including epithelial cells. 15 16  
Because massive cellular proliferation at the vitreoretinal interface is a key feature of proliferative vitreoretinal disorders, 17 18 investigators have sought to identify apoptosis in epiretinal membranes from patients with traumatic and idiopathic PVR, PDR, and macular pucker. Previous work has shown that apoptotic cell death occurs in vitreoretinal traction membranes of patients with PVR. 19 In addition, the cytokine receptor protein Fas has been shown to be expressed in proliferative vitreoretinal traction membranes 20 from such patients. However, it was not possible to display functional FasL on in vitro cultured cells, 21 which has made the study of constitutive FasL expression difficult. Current literature is therefore not conclusive as to the role of apoptosis and apoptosis markers in PVR. The few available studies do not address the role of TRAIL and its receptor(s) pathways in apoptosis disease mechanisms occurring in PVR, or how constitutive FasL expression is regulated in vivo during inflammation and immune reactions. 19 20 22  
In this study we have detected and quantified mRNA expression for Fas, FasL, and TRAIL in vitreous samples from patients with PVR, RD, and MH by using a semiquantitative RT-PCR technique. TGF-β levels were assayed in the vitreous samples from patients with PVR and compared with the mRNA levels of the other apoptosis markers studied. Epiretinal membranes excised from five patients with PVR were also examined for apoptotic cell death using the terminal deoxytransferase (TdT) mediated dUTP-biotin nick-end labeling (TUNEL) technique. 
Materials and Methods
Patients
Forty-six consecutive patients (25 with PVR, 11 with RD not complicated by PVR, and 10 with MH) in whom vitrectomy was considered necessary, were investigated in the Ophthalmology Department Queens Medical Center (Nottingham, UK). Of the 46 patients, 31 were men, and 15 were women. The mean age was 49 years (range, 30–87 years). Indications for vitrectomy in eyes with RD were failure of retinal reattachment by conventional methods (buckling and cryo), giant breaks, very posterior breaks, and multiple breaks not suitable for buckle. Patients with a history of recent trauma (3 months); concurrent eye conditions such as infection, vitreous hemorrhage, or uveitis; and current treatment with topical or systemic steroids were excluded. The severity of PVR was graded according to the criteria of the Retina Society Terminology committee. 23 Patients admitted into the study gave informed consent, and the study complied with the Declaration of Helsinki. 
Vitreous Specimens
Samples were obtained through the conventional three-port, closed vitrectomy technique. They were collected undiluted by manual suction into a syringe through the aspiration line of the vitrectome before the infusion line was opened. Intraocular pressure was maintained by indentation. When a sample of approximately 0.75 to 1 mL was obtained, the ocutome was withdrawn and infusion commenced to restore ocular volume. Samples were then transferred to 1.8 mL polypropylene tubes and processed immediately after surgery. Cells were pelleted by centrifugation at 2500 rpm for 10 to 15 minutes. Supernatants were divided into aliquots and stored at −70°C until used for enzyme-linked immunosorbent assays (ELISAs). Cellular pellets were processed rapidly to prevent RNA degradation. Total RNA was extracted with a kit (RNeasy; Qiagen, Crawley, UK), according to the manufacturer’s procedure. RNA was stored at −70°C until cDNA synthesis and PCR were performed. cDNA was prepared from all the RNA extracted from each sample using Oligo-(dT) priming in ready-to-go cDNA synthesis tubes (Pharmacia Biotech, St. Albans,UK), according to the manufacturer’s procedure. 
Quantitative PCR Reactions
Vitreous samples were investigated for their levels of Fas, FasL, and TRAIL mRNA. Because of limited sample size, only 21 PVR, 9 RD, and 10 MH vitreous samples were investigated for TRAIL. Primers were designed using the program Primer 3 (http://www.genome.wi.mit.edu/cgi-bin/primer/primer3.cgi/; provided in the public domain by the Whitehead Institute, Massachusetts Institute of Technology, Cambridge, MA). All primers were cross-checked against the GenBank database to ensure no cross reactivity with other known human sequences (http://www.ncbi.nlm.nih.gov/Genbank; provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD). Primer pairs, one of which was fluorescent-dye–labeled, were synthesized by MWG Biotech (Ebersberg, Germany). All primer pairs were validated by sequencing of PCR products generated under the conditions stated. Primer sequences are detailed in 1
To correct for variation in amplification efficiency between individual reactions, target cDNA was coamplified with an internal competitor (mimic) of known concentration, using the same fluorescence-labeled primers. These mimics were prepared by PCR mutagenesis to delete 5 bases of sequence, 5 bp 3′ of the primer binding site, resulting in a PCR product 5 bases shorter than that of the original template cDNA. The mimic PCR products were cloned into pT7 blue (Novagen, Nottingham, UK) and verified by sequencing. 
PCR amplification was performed by adding 1 μL of each cDNA sample to a final reaction mixture of 25 μL containing 60 mM Tris-Cl (pH 8.0), 15 mM (NH4)2SO4, 2 mM MgCl2, 0.2 mM each dNTP, 0.01% Tween 20, 0.5 U Taq polymerase (AmpliTaq Gold; Perkin Elmer, Warrington, UK), and 0.2 μM each primer; 103 single strands per reaction of appropriate mimic was added. Amplification cycles (performed on a Progene instrument; Techne, Cambridge, UK) were 94°C for 10 minutes, then 37 cycles of 94°C for 1 minute, 54°C for 1 minute, 72°C for 1 minute 30 seconds followed by 72°C for 15 minutes. Hypoxanthine phosphoribosyl transferase (HPRT), a constitutively expressed housekeeping gene was used to normalize the amount of mRNA present in each sample. Fluorescent-labeled PCR products were separated and analyzed by capillary electrophoresis under denaturing conditions (POP4 polymer) on a gene analyzer (Prism model 310; Applied Biosystems [ABI], Foster City, CA). Run conditions were a 5-second injection at 15 kV, run 24 minutes at 15 kV, at 60°C, on a 36-cm capillary (length to detection). Size and area of DNA peaks were obtained using standard software (Genescan version 2.0 and Genotyper v1.1.1; ABI). The amount of each cytokine mRNA in the samples was calibrated by the known concentration of mimic, using the following formula: Unknown concentration = (area of unknown/area of mimic) × mimic concentration. 
TGF-β2 Protein Analysis
The same samples (21 PVR, 9 RD, and 10 MH) were examined for their levels of TGF-β2, using sandwich enzyme-linked immunoassay kits (R&D Systems, Oxon, UK). Before the procedure was started, the latent TGF-β2 was activated to the immunoreactive form, according to the manufacturer’s procedures. A trial run was made on several vitreous samples before assay to determine the appropriate sample dilution. A dilution of 1:3 was used to ensure that the factor level in the samples was within the detectable range of the kits. 
TUNEL Technique
After excision, membranes were directly fixed in 10% formal saline and processed into paraffin wax. Four-micrometer-thick sections were cut onto silane-coated slides and subjected to the TUNEL technique. 24 Briefly, sections were dewaxed and blocked in 6% hydrogen peroxide before digestion in 10 μg/mL proteinase K (Sigma-Aldrich, Poole, UK) at 37°C for 15 minutes. Sections were incubated in TdT buffer containing 0.01 nM biotin-11-dUTP (Sigma-Aldrich), 0.5 U/μL TdT for 60 minutes at 37°C. After sections were blocked in 2% bovine serum albumin (Sigma-Aldrich), they were incubated with a streptavidin-biotin complex conjugated with horseradish peroxidase (Dako Ltd., High Wycombe, UK) followed by visualization using diaminobenzidine tetrahydrochloride (Sigma-Aldrich). Sections were counterstained with hematoxylin. 
Sections of tonsil and normal colonic mucosa were used as positive control tissue. Replicate negative control test sections had the TdT incubation omitted. 
Statistical Analysis
Nonparametric tests were used for statistical analysis of the data, which was not normally distributed. Samples were divided into three groups: PVR, RD, and MH. Vitreous cytokine levels between groups were analyzed with the Kruskal-Wallis test, and the levels between two groups were compared with a Mann-Whitney test. The Spearman correlation test was used to test any association between mRNA and cytokine protein levels. Statistical calculations were performed with commercial software (Prism ver. 2.01; ABI). 
Results
Cytokine mRNA
Typical electropherogram plots showing the size and area of peaks for mimic and unknown are shown in 1 . mRNA levels for Fas, FasL, and TRAIL in vitreous samples from patients with PVR, RD, and MH normalized to HPRT are shown in 2 . The median levels of Fas and TRAIL mRNA were significantly higher (P < 0.05) in patients with PVR than in those with MH. When patients with PVR were compared with those with RD, there was no statistically significant difference between the two groups in mRNA levels of Fas and TRAIL (P > 0.05). However, a significant difference was present between RD and MH for TRAIL mRNA (P < 0.05). 
There were very few samples with detectable mRNA levels of FasL, and no significant difference between groups was found using the Kruskal-Wallis test. The mRNA data results for different cytokines are summarized in 2
TGF-β2 Protein Levels
Levels of TGF-β2 protein in vitreous samples from patients with PVR, RD, and MH normalized to HPRT are shown in 3 . TGF-β2 was detected in all vitreous samples tested. A statistically significant difference was found between PVR and MH groups (P < 0.05) and between the RD and MH groups (P < 0.05) but not between RD and MH groups (P > 0.05). Levels of TGF-β2 significantly correlated to TRAIL mRNA levels (r = 0.86) but no correlation was found between TGF-β2 and Fas mRNA levels (r = 0.21; 3 3 ). No correlation was observed between the severity and duration of the disease and Fas and TRAIL mRNA levels or TGF-β2 protein levels (data not shown). 
Apoptosis in Epiretinal Membranes
With the TUNEL technique, four of five examined epiretinal membranes showed positive staining for apoptotic cells. The morphology of the apoptotic and proliferating stained cells could not be determined for all cell types. RPE cells and macrophages were the predominant cells stained for TUNEL 4 . Four of the corresponding vitreous samples were positive for TRAIL mRNA, three were positive for Fas mRNA and two were positive for FasL mRNA, indicating possible involvement of these apoptotic signals in the apoptosis taking place. The results obtained for TUNEL-treated positive cells and negative control sections were as predicted. 
Discussion
Abnormal regulation of apoptosis has been implicated in cancer and proliferative, autoimmune, and degenerative conditions. Therefore, an understanding of the cellular mediators involved in apoptosis would facilitate the development of new therapies for pathologic conditions resulting from inappropriate regulation of cell death. 
The finding of apoptotic cells in PVR is yet another example of the heterogeneity of this disease, with proliferative processes and healing processes occurring simultaneously. 
Previous work has shown that a subpopulation of cells in traction membranes of patients with PVR undergo apoptotic cell death, as defined by in situ DNA end labeling and acridine orange nuclear staining. 19 The present study, using the TUNEL technique, confirms these previous findings. Although the cellular origin of the apoptotic positively stained cells was not identified in all membranes, macrophages and a few RPE cells were the predominant stained cells in two of the cases. 
The present study of Fas/FasL and TRAIL was performed to explore the possible endogenous pathways for spontaneous apoptosis in human PVR. RT-PCR with internal competitors is a sensitive technique especially appropriate when a limited amount of tissue is available, such was the case with PVR. 
Fas mRNA was detected in the majority of the PVR and RD samples (72% and 55%, respectively), indicating expression of this cytokine in retinal detachment cases whether or not complicated by PVR. However, Fas mRNA levels were significantly different only in PVR samples compared with MH, indicating higher expression of these mediators in RD cases complicated by PVR. Previously, Fas has been shown to be expressed in proliferative vitreoretinal traction membranes from such patients. 20  
FasL was not detected to the same extent as Fas (20% in PVR and 9% in RD). It is not known what regulates constitutive expression of FasL in the eye. Cells of the immune system display FasL only after activation. In contrast, cells expressing FasL in the eye (e.g., RPE and corneal endothelium) are nonproliferating. When these cells proliferate in vitro, they downregulate functional FasL expression and, in some cases, express Fas. 21  
FasL mRNA has been detected in eyes of mice, rats, and humans, showing that it is widely distributed. Immunostaining shows that FasL is abundantly expressed in strategic locations throughout the eye, including the cornea, retina, iris, and ciliary body, at or near areas that comprise the blood–ocular barrier, as well as in locations where there is an opportunity for interaction between ocular tissue and inflammatory cells. In the retina, FasL is expressed on the RPE cells and is prominently expressed on the photoreceptors and throughout the neurosensory retina. 21 The induction of apoptosis by Fas-FasL interactions is a potent mechanism of immune surveillance. Defective FasL expression may contribute to the spread of dangerous inflammatory reactions such as PVR. Through the expression of FasL, activated immune cells could be terminated that might otherwise reduce vision by triggering inflammatory damage. Thus, immune privilege is not simply a passive process involving physical barriers; rather, our data provide evidence suggesting that it is an active process that uses an important proapoptotic mechanism to induce cell death in potentially dangerous infiltrating lymphoid and myeloid cells. 
Human RPE cells, which form the major component of epiretinal membranes, are a potential target of Fas-mediated apoptosis in PVR, since these cells express Fas in vitro, as assessed by immunohistochemistry and flow cytometry. However, in normal conditions, RPE cells were found to be resistant to apoptosis induced by Fas antibodies, but in some conditions (for example exposure to TNFα) a concentration-dependent sensitization to Fas-mediated apoptosis occurs. 25  
An important finding in our study was the detection of high concentrations of TRAIL mRNA in RD vitreous samples, whether or not complicated by PVR. TRAIL mRNA levels were significantly increased in PVR and RD vitreous samples compared with MH samples. Although a wide distribution of TRAIL in normal tissues and cells has been reported, 10 26 there have been no previous studies about its presence in the eye. Ours is the first report of TRAIL mRNA in RD and PVR vitreous samples. The presence of TRAIL does not in itself guarantee the occurrence of apoptosis. Whereas many human lymphoid and nonlymphoid tumor cell lines were sensitive to cell-surface or soluble TRAIL, normal cells, such as freshly isolated mouse thymocytes or primary T or B cells, were not. 11 Compared with the Fas/FasL and TNF/TNF-R systems, the TRAIL/TRAIL-R system is much more complex, involving multiple receptors able to transduce different signals; decoy receptors that bind the ligand but do not transduce a signal; a complex of intracellular signaling adaptors; and activation of inhibitory molecules. 27 28 Two of the TRAIL receptors, TRAIL-R1 and −R2, induce apoptosis, whereas TRAIL-R3 and -R4 appear to confer resistance to TRAIL-mediated cell death. A fifth receptor for TRAIL, OPG, has altogether different functions, having been shown to play a role in the regulation of bone density. 29 Further clarification of the role of each component in the TRAIL/TRAIL-R system is necessary to understand fully its significance in PVR. 
TGF-β is a multifunctional cytokine that regulates cell growth, adhesion, and differentiation in a wide variety of cell types. 30 TGF-β isoforms 1, 2, and 3 are expressed in the human retina, 31 with TGF-β2 being the major isoform found in PVR. 13 TGF-β has been implicated in the pathogenesis of PVR. 14 22 The results of our study confirms these observations, with a significant difference seen between PVR and MH groups (P < 0.05), and between RD and MH groups (P < 0.05) but not between RD and MH groups (P > 0.05). 
Although the precise role of TGF-β in PVR pathogenesis is not currently understood, TGF-β is a negative regulator of RPE cell proliferation and activation. 32 Its synthesis by cultured RPE cells 33 indicates a possible suicidal negative feedback mechanism limiting RPE cell proliferation by TGF-β–mediated apoptosis. 22 In contrast, TGF-β may contribute to cellular proliferation by blocking apoptosis, seen in T cells, 34 through the selective inhibition of activation-induced FasL expression. 35 In contrast to its effect on FasL expression, TGF-β1 does not significantly affect activation-induced Fas expression in T cell hybridomas. 35 Our data support previous findings showing that increased levels of TGF-β2 are associated with very low or no FasL expression in pathologic vitreous samples. No significant correlation was found between the levels of TGF-β2 and Fas mRNA (r = 0.2). 
Although the source of TGF-β in PVR is not known, cells that are involved in PVR (macrophages, fibroblasts, microglial cells, glial cells, and RPE cells) have been shown to both secrete TGF-β and express TGF-β receptors. 18 36 37  
In summary, our study is supportive of an important role of apoptosis in the pathogenesis of PVR. In showing upregulated apoptosis markers including Fas/FasL, TRAIL, and TGF-β2, we propose that a number of apoptosis pathways operate simultaneously in PVR. 
Table 1.
 
PCR Target and Deletion Sites and Primer Sequences
Table 1.
 
PCR Target and Deletion Sites and Primer Sequences
Target Accession No. PCR Product Deletion Site Primer Sequence (5′–3′) Fluorophore
HPRT M31642 407–566 537–541 (a) GACCAGTCAACAGGGGACAT Hex
(b) CGACCTTGACCATCTTTGGA
Fas E05336 252–441 276–280 (a) CTGCCAAGAAGGGAAGGAGT Hex
(b) GGTGCAAGGGTCACAGTGTT
FasL U08137 401–560 531–535 (a) CACCTACAGAAGGAGCTGGC Tet
(b) GCATGGACCTTGAGTTGGAC
TRAIL U37518 466–594 492–496 (a) ACTGGGACCAGAGGAAGAAGC Hex
(b) CAAGTGCAAGTTGCTCAGGA
Figure 1.
 
Typical electrophero-grams showing peaks obtained from Fas, FasL, and TRAIL.
Figure 1.
 
Typical electrophero-grams showing peaks obtained from Fas, FasL, and TRAIL.
Figure 2.
 
mRNA levels of TRAIL, Fas, and FasL normalized to HPRT in vitreous aspirates obtained from patients with PVR, RD, and MH. N, number of investigated samples.
Figure 2.
 
mRNA levels of TRAIL, Fas, and FasL normalized to HPRT in vitreous aspirates obtained from patients with PVR, RD, and MH. N, number of investigated samples.
Table 2.
 
Cytokine mRNA Levels Normalized to HPRT in Vitreous Samples with Summary of Statistical Data Analysis
Table 2.
 
Cytokine mRNA Levels Normalized to HPRT in Vitreous Samples with Summary of Statistical Data Analysis
Cytokine mRNA n n (%) Median IQR P *
PVR vs. MH PVR vs. RD
PVR
 FAS/HPRT 25 18 (72) 0.46 0.0–3.47 0.01 0.43
 Trail/HPRT 21 14 (67) 0.25 0.0–8.2 0.01 0.60
 FASL 25 5 (20) 0.0 0.0–0.0 , † , †
RD
 FAS/HPRT 11 6 (55) 0.07 0.0–2.37 0.14
 Trail/HPRT 9 8 (89) 0.89 0.31–1.44 0.008
 FASL 11 1 (9) 0.0 0.0–0.0 , †
MH
 FAS/HPRT 10 2 (20) 0.0 0.0–0.0
 Trail/HPRT 10 2 (20) 0.0 0.0–0.0
 FASL 10 1 (10) 0.0 0.0–0.0
Figure 3.
 
(A) Levels of TGF-β2 in vitreous aspirates obtained from patients with PVR, RD or MH. (B, C) Correlation between TGF-β2 protein levels and mRNA for TRAIL and Fas. Spearman r = 0.86 and 0.21, respectively.
Figure 3.
 
(A) Levels of TGF-β2 in vitreous aspirates obtained from patients with PVR, RD or MH. (B, C) Correlation between TGF-β2 protein levels and mRNA for TRAIL and Fas. Spearman r = 0.86 and 0.21, respectively.
Figure 4.
 
TUNEL staining showing cells undergoing apoptosis, as indicated by intense (brown) staining in condensed nuclei (arrows). Paraffin sections of (A) colon (positive control) and (B) PVR epithelial membranes.
Figure 4.
 
TUNEL staining showing cells undergoing apoptosis, as indicated by intense (brown) staining in condensed nuclei (arrows). Paraffin sections of (A) colon (positive control) and (B) PVR epithelial membranes.
 
Thompson CB. Apoptosis in the pathogenesis and treatment of disease. Science. 1995;267:1456–1462.
Tso MO, Zhang C, Abler AS, et al. Apoptosis leads to photoreceptor degeneration in inherited retinal dystrophy of RCS rats. Invest Ophthalmol Vis Sci. 1994;35:2693–2699.
Papermaster DS, Windle J. Death at an early age: apoptosis in inherited retinal degenerations. Invest Ophthalmol Vis Sci. 1995;36:977–983.
Gregory CY, Bird AC. Cell loss in retinal dystrophies by apoptosis: death by informed consent!. Br J Ophthalmol. 1995;79:186–190.
Li WC, Kuszak JR, Dunn K, et al. Lens epithelial cell apoptosis appears to be a common cellular basis for non-congenital cataract development in humans and animals. J Cell Biol. 1995;130:169–181.
Quigley HA, Nickells RW, Kerrigan LA, Pease ME, Thibault DJ, Zack DJ. Retinal ganglion cell death in experimental glaucoma and after axotomy occurs by apoptosis. Invest Ophthalmol Vis Sci. 1995;36:774–786.
Chan CC, Matteson DM, Li Q, Whitcup SM, Nussenblatt RB. Apoptosis in patients with posterior uveitis. Arch Ophthalmol. 1997;115:1559–1567.
Wilson SE, Li Q, Weng J, et al. The Fas-Fas ligand system and other modulators of apoptosis in the cornea. Invest Ophthalmol Vis Sci. 1996;37:1582–1592.
Leithauser F, Dhein J, Mechtersheimer G, et al. Constitutive and induced expression of APO-1, a new member of the nerve growth factor/tumor necrosis factor receptor superfamily, in normal and neoplastic cells. Lab Invest. 1993;69:415–429.
Wiley SR, Schooley K, Smolak PJ, et al. Identification and characterization of a new member of the TNF family that induces apoptosis. Immunity. 1995;3:673–682.
Pitti RM, Marsters SA, Ruppert S, Donahue CJ, Moore A, Ashkenazi A. Induction of apoptosis by Apo-2 ligand, a new member of the tumor necrosis factor cytokine family. J Biol Chem. 1996;271:12687–12690.
Degli-Esposti M. To die or not to die: the quest of the TRAIL receptors. J Leukoc Biol. 1999;65:535–542.
Connor TB, Jr, Roberts AB, Sporn MB, et al. Correlation of fibrosis and transforming growth factor-beta type 2 levels in the eye. J Clin Invest. 1989;83:1661–1666.
Limb GA, Little BC, Meager A, et al. Cytokines in proliferative vitreoretinopathy. Eye. 1991;5:686–693.
Weller M, Fontana A. The failure of current immunotherapy for malignant glioma: tumor-derived TGF-beta, T-cell apoptosis, and the immune privilege of the brain. Brain Res Brain Res Rev. 1995;21:128–151.
Oberhammer F, Wilson JW, Dive C, et al. Apoptotic death in epithelial cells: cleavage of DNA to 300 and/or 50 kb fragments prior to or in the absence of internucleosomal fragmentation. EMBO J. 1993;12:3679–3684.
Machemer R, Laqua H. Pigment epithelium proliferation in retinal detachment (massive periretinal proliferation). Am J Ophthalmol. 1975;80:1–23.
Hiscott PS, Grierson I, McLeod D. Natural history of fibrocellular epiretinal membranes: a quantitative, autoradiographic, and immunohistochemical study. Br J Ophthalmol. 1985;69:810–823.
Esser P, Bartz-Schmidt KU, Walter P, Kaszli F, Heimann K, Weller M. Apoptotic cell death in proliferative vitreoretinopathy [in German]. Ger J Ophthalmol. 1996;5:73–78.
Weller M, Heimann K, Bartz-Schmidt KU, Fontana A, Esser P. CD 95 expression in traumatic proliferative vitreoretinopathy: a target for the induction of apoptosis [in German]. Ger J Ophthalmol. 1996;5:332–337.
Ferguson TA, Griffith TS. A vision of cell death: insights into immune privilege. Immunol Rev. 1997;156:167–184.
Esser P, Heimann K, Bartz-schmidt KU, et al. Apoptosis in proliferative vitreoretinal disorders: possible involvement of TGF-beta-induced RPE cell apoptosis. Exp Eye Res. 1997;65:365–378.
Retina Society Terminology Committee. The classification of retinal detachment with proliferative vitreoretinopathy. Ophthalmology. 1983;90:121–125.
Gavrieli Y, Sherman Y, Ben-Sasson SA. Identification of programmed cell death in situ via specific labeling of nuclear DNA fragmentation. J Cell Biol. 1992;119:493–501.
Esser P, Heimann K, Abts H, Fontana A, Weller M. CD95 (Fas/APO-1) antibody-mediated apoptosis of human retinal pigment epithelial cells. Biochem Biophys Res Commun. 1995;213:1026–1034.
Golstein P. Cell death: TRAIL and its receptors. Curr Biol. 1997;7:R750–R753.
Pan G, Ni J, Wei YF, Yu G, Gentz R, Dixit VM. An antagonist decoy receptor and a death domain-containing receptor for TRAIL. Science. 1997;277:815–818.
Sheridan JP, Marsters SA, Pitti RM, et al. Control of TRAIL-induced apoptosis by a family of signaling and decoy receptors. Science. 1997;277:818–821.
Emery JG, McDonnell P, Burke MB, et al. Osteoprotegerin is a receptor for the cytotoxic ligand TRAIL. J Biol Chem. 1998;273:14363–14367.
Massague J. The transforming growth factor-beta family. Annu Rev Cell Biol. 1990;6:597–641.
Lyons RM, Gentry LE, Purchio AF, Moses HL. Mechanism of activation of latent recombinant transforming growth factor beta 1 by plasmin. J Cell Biol. 1990;110:1361–1367.
Gabrielian K, Osusky R, Sippy BD, Ryan SJ, Hinton DR. Effect of TGF-beta on interferon-gamma-induced HLA-DR expression in human retinal pigment epithelial cells. Invest Ophthalmol Vis Sci. 1994;35:4253–4259.
Tanihara H, Yoshida M, Matsumoto M, Yoshimura N. Identification of transforming growth factor-beta expressed in cultured human retinal pigment epithelial cells. Invest Ophthalmol Vis Sci. 1993;34:413–419.
Cerwenka A, Kovar H, Majdic O, Holter W. Fas- and activation-induced apoptosis are reduced in human T cells preactivated in the presence of TGF-beta 1. J Immunol. 1996;156:459–464.
Genestier L, Kasibhatla S, Brunner T, Green DR. Transforming growth factor beta1 inhibits Fas ligand expression and subsequent activation-induced cell death in T cells via downregulation of c-Myc. J Exp Med. 1999;189:231–239.
Esser P, Heimann K, Wiedemann P. Macrophages in proliferative vitreoretinopathy and proliferative diabetic retinopathy: differentiation of subpopulations. Br J Ophthalmol. 1993;77:731–733.
Weller M, Esser P, Heimann K, Wiedemann P. Retinal microglia: a new cell in idiopathic proliferative vitreoretinopathy?. Exp Eye Res. 1991;53:275–281.
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×