July 2004
Volume 45, Issue 7
Free
Biochemistry and Molecular Biology  |   July 2004
Changes in Retinal Pigment Epithelial Gene Expression Induced by Rod Outer Segment Uptake
Author Affiliations
  • Itay Chowers
    From the Guerrieri Center for Genetic Engineering and Molecular Ophthalmology at the Wilmer Institute and the
  • Yoonhee Kim
    The Margaret M. Dyson Vision Research Institute and the
    Departments of Ophthalmology and
    Cell and Developmental Biology, Weill Medical College of Cornell University, New York, New York.
  • Ronald H. Farkas
    From the Guerrieri Center for Genetic Engineering and Molecular Ophthalmology at the Wilmer Institute and the
  • Tushara L. Gunatilaka
    From the Guerrieri Center for Genetic Engineering and Molecular Ophthalmology at the Wilmer Institute and the
  • Abigail S. Hackam
    From the Guerrieri Center for Genetic Engineering and Molecular Ophthalmology at the Wilmer Institute and the
  • Peter A. Campochiaro
    From the Guerrieri Center for Genetic Engineering and Molecular Ophthalmology at the Wilmer Institute and the
    Departments of Neuroscience and
  • Silvia C. Finnemann
    The Margaret M. Dyson Vision Research Institute and the
    Departments of Ophthalmology and
    Cell and Developmental Biology, Weill Medical College of Cornell University, New York, New York.
  • Donald J. Zack
    From the Guerrieri Center for Genetic Engineering and Molecular Ophthalmology at the Wilmer Institute and the
    Departments of Neuroscience and
    Molecular Biology and Genetics, and the
    McKusick-Nathans Institute of Genetic Medicine, The Johns Hopkins University School of Medicine, Baltimore, Maryland; and
Investigative Ophthalmology & Visual Science July 2004, Vol.45, 2098-2106. doi:10.1167/iovs.03-0863
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to Subscribers Only
      Sign In or Create an Account ×
    • Get Citation

      Itay Chowers, Yoonhee Kim, Ronald H. Farkas, Tushara L. Gunatilaka, Abigail S. Hackam, Peter A. Campochiaro, Silvia C. Finnemann, Donald J. Zack; Changes in Retinal Pigment Epithelial Gene Expression Induced by Rod Outer Segment Uptake. Invest. Ophthalmol. Vis. Sci. 2004;45(7):2098-2106. doi: 10.1167/iovs.03-0863.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

purpose. Rod outer segment (ROS) uptake, a crucial function of the retinal pigment epithelium (RPE), probably involve multiple proteins, yet only a small number have so far been identified. The goal of this study was to find additional genes involved in ROS uptake and degradation by identifying ROS-induced gene expression changes.

methods. Human RPE-derived ARPE-19 cells were harvested 3 and 12 hours after addition of bovine ROS. Gene expression profiles were compared with control cultures by using a custom human retina cDNA microarray and were validated by quantitative real-time RT-PCR (QPCR). ROS binding and internalization were quantitated with a fluorescence assay.

results. Alterations in the expression levels of multiple genes (especially ones involved in transcriptional regulation, signal transduction, or protein modification) were detected 3 hours after ROS challenge, whereas by 12 hours most had returned to baseline. QPCR results corroborated the microarray results for seven of the eight genes tested. Time-course QPCR experiments on an independent sample set demonstrated characteristic temporal expression changes for each gene. Protein levels of one of these, plasminogen activator inhibitor-1 (PAI-1), were tested and found to parallel the mRNA changes. In addition, exogenous PAI-1 inhibited ROS uptake by RPE cells in vitro, consistent with its putative function in integrin receptor regulation.

conclusions. ROS uptake is associated with regulation of multiple RPE genes in a gene-specific temporal pattern. These genes are candidates for involvement in ROS uptake and degradation, particularly PAI-1, for which the study provided evidence suggesting that it may participate in the negative feedback of ROS uptake.

The importance of prompt daily clearance of shed rod outer segments (ROS) by the retinal pigment epithelium (RPE) in maintaining normal retina function is underscored by the association of photoreceptor death and retinal degeneration with perturbation in this process. 1 2 3 4 Furthermore, histologic and experimental findings suggest that in age-related macular degeneration (AMD), the most common cause of irreversible blindness in the Western world, there may be alterations in ROS degradation by RPE cells. 5 6 The relation between the disease process and these alterations is still unclear. 
To date, four RPE plasma membrane receptor proteins have been described to be involved in ROS uptake (uptake including both ROS binding and internalization). These are a mannose receptor, 7 the lipid scavenger receptor CD36, 8 the integrin αvβ5, 9 10 and the receptor tyrosine kinase Mertk. 11 In in vitro assays, αvβ5 integrin mediates ROS binding to the RPE surface, whereas both CD36 and Mertk are involved in internalization of bound ROS. 10 12 13 CD36 and Mertk probably activate signaling pathways to enable ROS internalization, but the pathway(s) involved have not yet been identified. After internalization, ROS are degraded in RPE lysosomes. 14  
Despite these exciting discoveries, much remains to be learned of ROS uptake by the RPE. For example, yet to be identified are additional genes involved in ROS uptake, related intracellular signal transduction, cellular preparation for subsequent cycles of ROS uptake, and modulating the RPE ROS uptake rhythm. It seems likely that the expression of at least some of the genes involved in ROS uptake are altered during the process. However, few studies have focused on RPE gene expression after ROS uptake. Ershov et al. 15 16 reported that levels of early response genes including c-fos, zif-268, nur77, and cyclooxygenase-2 (COX2) peaked within an hour after ROS challenge to RPE cells in vitro, whereas levels of the peroxisome proliferator-activated receptor (PPAR)-γ peaked after several hours. These investigators also described differential regulation of some of these genes, as well as increased levels of enzymes involved in prostaglandin synthesis and inhibition of ROS uptake on addition of prostaglandins to the culture medium. 17 These findings suggest that ROS phagocytic challenge may regulate RPE phagocytic activity, at least in part, by altering RPE gene expression. 
Herein, we describe use of a high-throughput approach to characterizing alterations in RPE gene expression specifically associated with ROS phagocytosis. A human RPE cell line (ARPE-19) that has been shown to phagocytize isolated ROS was studied. 10 We used a custom human retina cDNA microarray that includes sequences representing more than 10,000 retina- and RPE-expressed genes. 18 To validate and explore further the results of the microarray experiments, we followed the time course of mRNA level changes of several genes induced by ROS uptake using real-time quantitative PCR (QPCR). We also demonstrated for one of the genes, plasminogen activator inhibitor-1 (PAI-1), that its corresponding protein level correlated well with the mRNA changes. In addition, to begin exploration of the biological meaning of these findings, we tested the effect of exogenous PAI-1 on RPE-mediated ROS uptake. 
Methods
Tissue Culture
The human retinal pigment epithelium cell line ARPE-19 was used in all experiments. 19 Cells were cultured in DMEM supplemented with 10% fetal calf serum (FCS), 100 U/mL penicillin, and 100 μg/mL streptomycin (all from Invitrogen Corp., Carlsbad, CA), in 75-cm2 polystyrene flasks (Corning, Corning, NY) or 24-well polystyrene plates (Falcon, Franklin Lake, NJ) for the microarray and time-response experiments, respectively. Cultures were maintained for 6 weeks before ROS uptake experiments. 
ROS were isolated from fresh bovine eyes in a dark room, as previously described, 20 and stored in 2.5% sucrose in DMEM at −80°C. For uptake experiments, the culture medium was replaced with DMEM supplemented with 3% FCS and ROS (at a ratio of 10 ROS to 1 RPE cell) for 3 hours. Medium in control culture plates was also replaced with DMEM supplemented with 3% FCS and the same volume of 2.5% sucrose as that added to the study plates. For the longer time points (see the following sections), medium containing ROS was removed after 3 hours, cells were washed with PBS, and medium without ROS was added to the flasks. 
Monitoring ROS Uptake by Immunostaining and Fluorescence Labeling
For validation of ROS phagocytosis by the ARPE-19 cells, cells were grown on chamber slides (Laboratory-Tek II; Nalge Nunc International, Naperville, IL). ROS were labeled with 1 mg/mL of fluorescein isothiocyanate (FITC; Molecular Probes, Eugene, OR), as previously described 10 and added to the medium. After 3 hours, the incubation medium was removed, and cells were washed with PBS and were either incubated with the same medium without ROS for an additional 9 hours (total of 12 hours) or fixed with cold methanol for 20 minutes followed by a 1-hour incubation at room temperature with a mouse anti-bovine rhodopsin antibody. 21 Secondary sheep anti-mouse IgG antibody conjugated to Cy3 (Sigma-Aldrich, St. Louis, MO) was then used to label the primary antibody. Images were recorded with a confocal system (Model TSP2; Leica, Bannockburn, IL). 
Microarray Study Design
We studied gene expression changes in ARPE-19 cells 3 and 12 hours after ROS challenge using a retina and RPE custom cDNA microarray. The slide was constructed in our laboratory and contained sequences from more than 10,000 expressed sequence tags (ESTs) and genes that were selected to reflect the predicted human retina gene expression profile based on EST databases. A detailed description of array construction, probe labeling technique, and hybridization conditions, has recently been reported. 18 Briefly, PCR products (fragments size average, roughly 0.9–1.0 kb) were spotted on coated slides (SuperAmine coating; TeleChem, Sunnyvale, CA) using an arrayer (MicroGrid II; BioRobotics, Cambridge, MA). 
The 3- and 12-hour time points were selected in an attempt to identify genes that show changes in expression level during binding and internalization of ROS and during ROS degradation, respectively. Five replicates of control (only ROS medium with no ROS added) and study (ROS and medium added) plate pairs were studied at each time point (a total of 20 plates). 
Duplicate microarray experiments were performed comparing each experimental versus control flask pair (20 microarray slides). In the first microarray reaction for each pair, the study sample was labeled with Cy3 and the control with Cy5, and in the second labeling reaction, dye assignment was exchanged between the samples. This design controls for dye-specific differences in the labeling and hybridization reactions, as well as for slide-specific bias. 
Microarray Procedure
At either the 3- or 12-hour time point, the media were was removed, cells were washed with PBS, and RNA was extracted (TRIzol; Invitrogen) according to the manufacturer’s protocol. Twenty micrograms of total RNA from each flask was used for each labeling reaction. RNA was treated with a DNase (DNAfree; Ambion, Austin, TX) followed by a purification step (RNesy kit; Qiagen, Valencia, CA) and indirect Cy3 or Cy5 (Amersham Biosciences, Inc., Piscataway, NJ) dye incorporation, according to an established protocol. 22 Prehybridization and hybridization were preformed as previously described. 18 Briefly, slides were incubated for 40 minutes in 1% bovine serum albumin (BSA), 5× SSC, and 0.1% SDS at 42°C; washed in water and isopropanol; and dried using compressed air. Cy3- and Cy5-labeled probes were combined in 40 μL hybridization buffer (50% formamide, 5× SSC, 0.1% SDS buffer, 10 μg poly(dA), and 10 μg Cot-1 DNA) and heated at 95°C for 3 minutes. Hybridization was performed under a coverslip (Fisher Scientific, Suwanee, GA) in a humidified hybridization chamber (GeneMachine, San Carlos, CA) for 18 hours in a water bath at 42°C. After hybridization, slides were washed in 1× SSC/0.2% SDS at 42°C, followed by washes in 0.1× SSC/0.2% SDS, and 0.1× SSC both at room temperature. Each wash lasted for 4 minutes, and then the slides were dried with compressed air. Slides were scanned using a confocal laser scanner (ScanArray 5000; Perkin Elmer, Wellesley, MA). Spot finding and quantification were performed on computer (Imagene; Biodiscovery Inc., Marina Del Rey, CA). 
Image files generated from the highest laser power settings that did not include saturated spots were used for further analyses. Background subtraction, normalization, omission of data from noninformative spots (according to the Imagene software empty spot flag function), and combining data from duplicate experiments of each experimental/control flask pair were performed using another software package (Genesight; Biodiscovery). The normalized experimental/control sample ratios were then analyzed using the Significance Analyses of Microarray (SAM) software, 23 and a one-class response analysis was applied. SAM calculates a score for each gene based on the multiple of the expression level change between the study and the control samples and the consistency of this change multiple (estimated by the SD of the expression ratios). SAM then assesses a false discovery rate (FDR), which is the median percentage of genes from a list of genes (sorted according to the SAM score) that are likely to be mistakenly identified as differentially expressed. This estimation is based on comparison of the SAM score distribution between the actual experimental data and the results of random permutations of the same data. 23  
Real-Time Quantitative RT-PCR
Array results were confirmed using real-time QPCR on both the same sample set used for array experiments and on a second independent set of samples. The independent sample set was also used to assess the time course of mRNA level changes after ROS challenge for selected genes. In addition, to validate that transcripts identified in RPE culture are also expressed by in vivo RPE, we performed QPCR using as a template cDNA from a human retinal pigment epithelium sample. The RPE was dissected from a cadaveric human eye (70-year-old white male) without known eye disease and with normal gross appearance of the retina and RPE. The eye was obtained through the National Disease Research Interchange (IRB exemption 4; NDRI, Philadelphia, PA), and was obtained in accordance with the provisions of the Declaration of Helsinki for research involving human tissue. The death to tissue preservation time interval was 3 hours and 15 minutes, and the death to RNA extraction time interval was 39 hours. 
To validate array results, equal amounts of RNA were pooled from the five replicates used for each study and control microarray experimental group. For the time-course experiments, duplicate samples were studied from each time point: RNA was extracted before addition of ROS and 15 and 30 minutes and 1, 3, 6, and 12 hours after addition of ROS, and prepared as described earlier. One-microgram aliquots of RNA from each pooled array experiment sample and time-course sample, and from human RPE, were then reverse transcribed (Superscript II transcriptase; Invitrogen) and used as template for QPCR reactions. 
Reactions were performed using the thermocycler (Light-Cycler PCR machine; Roche, Nutley, NJ). Five serial twofold dilutions of one of the samples were defined as the standard for all the reactions. PCR products were quantified using the second derivate maximum values as calculated by the thermocycler analysis software. The second derivate maximum corresponds to the point at which the rate of change of fluorescence is the fastest, and it is a point at which the sample fluorescence can often be clearly distinguished from the background fluorescence. This value can be used to calculate the starting concentration of the cDNA of interest. 
Expression levels were normalized to ribosomal phosphoprotein P0 mRNA levels. 24 The primers used for real time PCR are listed in Table 1 . For each sample, each gene was tested in duplicate PCR reactions, and the mean of the two reactions was used to calculate expression levels. Reaction products were tested by agarose gel electrophoresis to confirm that there was only one PCR product and that it was of the expected size. As another quality control measure, we monitored the melting curves of PCR reactions to ensure that a reasonable curve was obtained and that the melting curve showed significant separation from that of primer dimers alone. 
Quantification of ROS Binding and Internalization
ARPE-19 cells were challenged in the presence or absence of 1 μM recombinant human PAI-1 (Molecular Innovations, Southfield, MI) with 10 FITC-ROS per cell in DMEM with 3% FCS for the duration of the experiment, chilled, washed three times with PBS containing 1 mM MgCl2 and 0.2 mM CaCl2 (PBS-CM) to remove excess ROS, and fixed in ice-cold methanol. In some cases, fluorescence derived from externally bound particles was quenched before fixation by using trypan blue to distinguish bound and internalized ROS from internalized ROS only. 10 Fluorescence emission by fixed and mounted samples was quantified (Storm 860 Imager and ImageQuant 1.2; Molecular Dynamics, Sunnyvale, CA). The uptake index (representing bound and internalized particles) or the internalization index was calculated by dividing particle counts by nuclei counts of each area, thereby normalizing for phagocyte numbers. The binding index was calculated as the difference between uptake and internalization index. The correlation of phagocytic indices with phagosome numbers has been discussed in detail previously. 25  
Cell Lysis and Immunoblotting
After phagocytic challenge with OS, supernatants of ARPE-19 cells were collected, cleared by centrifugation, and denatured by boiling in reducing SDS-PAGE sample buffer for 3 minutes. Cells were rinsed with cold PBS-CM and solubilized by agitation for 30 minutes at 4°C in 50 mM HEPES (pH 7.4); 150 mM NaCl; 10% glycerol; 1.5 mM MgCl2; 1 mM EGTA; 1% Triton X-100; 1% sodium deoxycholate; 0.1% SDS; freshly supplemented with 2 mM each of aprotinin, leupeptin, and pepstatin; and 1 mM PMSF (all from Sigma-Aldrich). Whole-cell extracts representing equal numbers of cells (∼30,000/lane) were separated on a 12% SDS-polyacrylamide gel under reducing conditions and transferred to nitrocellulose. Blots were incubated as indicated in the figure with primary polyclonal antibodies to actin (Sigma-Aldrich) or human PAI-1 (Molecular Innovations) and appropriate horseradish peroxidase–conjugated secondary antibodies followed by chemiluminescence detection (ECL; NEN, Boston, MA). X-ray films were scanned and signals quantified using NIH Image 1.61 (available by ftp at zippy.nimh.nih.gov/ or at http://rsb.info.nih.gov/nih-image; developed by Wayne Rasband, National Institutes of Health, Bethesda, MD). 
Results
Validation of Outer Segment Uptake by ARPE-19 Cells
Previous studies showed that ARPE-19 cells phagocytose isolated ROS. 10 19 In our study, after phagocytic challenge with isolated FITC-labeled ROS for 3 hours, most of the ARPE-19 cells had taken up ROS particles (data not shown). The identity of the FITC-labeled particles was also confirmed by rhodopsin immunostaining that showed a perinuclear colocalization with the FITC-labeled particles. No staining was evident when the primary antibody was omitted or when no ROS were added to the media (data not shown). 
Microarray Studies
Initial evaluation of the data revealed that 6,620 and 7,130 of the 10,034 spots on the microarray were informative for the 3- and 12-hour time points, respectively. At a false-discovery rate (FDR) of 25% (25% of the genes in the list are predicted to be identified by chance alone and are not related to ROS uptake), based on SAM analysis, 41 genes with increased expression levels 3 hours after ROS uptake were identified (Table 2A) . The mean expression level increase of these genes was 1.4- to 4.1-fold compared with ARPE-19 cells challenged by media alone. Twenty-nine of these upregulated genes had been characterized, 1 gene was cloned but its function is still unknown, and 11 were expressed sequence tags (ESTs) from novel genes. Molecular function annotation showed that 10 of the genes with known function are involved in transcriptional regulation, 7 in signal transduction, and 6 in protein modification or interaction with other proteins; 2 are adhesion molecules, and the remaining 4 have a variety of other functions. Two of the genes, thioredoxin reductase 1, and dual specificity phosphatase 1, are involved in oxidative stress response (Fig. 1) . The expression levels of the four genes downregulated at the 3-hour time point were reduced 2.5- to 17.1-fold compared with the control group (Table 2A) . At a more stringent FDR of 10%, only the top six upregulated and two downregulated genes from Table 2A were predicted to be differentially expressed in ARPE cells 3 hours after ROS challenge. 
Twelve hours after ROS challenge, 10 genes were upregulated, whereas none was downregulated at 20% FDR. All 10 genes showed less than twofold increased expression. Six of these genes are characterized and four are ESTs of novel genes (Table 2B)
QPCR Experiments
Eight genes that were identified by the array experiments as having an ROS uptake–associated expression pattern were also assessed by QPCR. These genes were selected based on the magnitude of expression level change associated with ROS uptake as well as on their known function, which make them potential candidates for involvement in the process. QPCR on the same samples used for microarray experiments confirmed the array results for seven of the eight genes tested. The amount of expression level change detected by the two methods correlated well in most cases, ranging from 1.9- to 4-fold according to the arrays and 1.3- to 4.2-fold, according to QPCR (Table 2A) . In one case (leukotriene A4 hydrolase) the array results indicated downregulation of the gene, whereas QPCR indicated no change in the expression level. 
Expanded Time-Course Expression Level Analysis
We performed a more detailed time-course analysis of the expression levels of five of the genes that were indicated by the microarray analysis to be upregulated 3 hours after ROS challenge. The purpose of this experiment was both to validate the microarray results on an independent set of samples and to obtain more information about expression level changes associated with ROS challenge. We also evaluated two genes, early growth response 1 (EGR1) and Fos, that were reported by Ershov et al. 15 to be upregulated after ROS uptake. 
Although five of these seven genes showed expression level changes comparable to those identified by the microarrays or to those reported by Ershov et al., two genes, thioredoxin reductase 1 and activating transcription factor 4, showed fluctuating expression levels (Fig. 2) . These may result from large expression level variation of the two genes between different ARPE-19 cell populations that are not necessarily related to ROS uptake. Alternatively, these genes may show altered expression levels after ROS uptake that were missed by the time points that were tested. Indeed, QPCR experiments showed that the temporal pattern of transcription activation after ROS challenge is gene specific (Fig. 2) . Early growth response 1 levels peaked 15 minutes after ROS challenge, whereas DNA-damage–inducible transcript 3 mRNA levels increased gradually and peaked at 3 hours. FOS-like antigen 1 (Fosl1) mRNA levels also increased after 15 minutes, but the transcript level plateaued for several hours and declined after only 3 to 6 hours. By contrast, PAI-1 levels reached a plateau after 1 hour and maintained an increased level throughout the 12-hour experimental period. 
All five transcripts that were identified by our array experiments and that were evaluated in these time-response experiments also showed detectable mRNA levels in RPE cells dissected from a donor human eye. 
PAI-1 Production and Its Effect on ROS Uptake
We next evaluated the correlation between PAI-1 mRNA and protein level changes, as well as the functional significance of the increased PAI-1 expression level that is associated with ROS uptake. PAI-1 was selected for these experiments because of its known function as an integrin regulator. 26 We found that PAI-1 is constitutively produced by ARPE-19 cells; furthermore, PAI-1 protein levels increased significantly 5 and 6 hours after ROS challenge (Fig. 3A) . To assess the possible function of PAI-1 in ROS uptake, we quantified ROS uptake in the presence of exogenous recombinant PAI-1 at a physiologic concentration. PAI-1 decreased ROS binding to ARPE-19 cells by 57% 2.5 hours after ROS challenge (Fig. 3B) , further suggesting that PAI-1 may play a role in RPE-mediated ROS uptake. 
Discussion
We found that ROS uptake is associated with expression level changes of multiple known and novel genes in ARPE-19 cells. We further demonstrated that these expression changes occur in a gene-specific manner in terms of timing and expression level changes. Expression level changes can occur within minutes after ROS challenge, with some genes returning to pre-ROS exposure levels within an hour, whereas other genes maintain high expression levels for several hours. Different challenges to RPE cells are likely to illicit not only distinct changes in patterns of gene expression, but also distinct kinetic patterns. Thus, the time points chosen for a particular experiment are likely to affect significantly the results that are obtained. In our experiments, genes from several functional classes showed differential expression—among them several that are involved in transcriptional regulation, signal transduction, and protein modification. 
Based on their known function, some of the differentially expressed genes associated with ROS uptake are of particular interest. We selected one of these genes for study in further detail. PAI-1 has been shown to be produced by human RPE, 27 28 29 30 is implicated in choroidal neovascularization, 31 and has been reported to be downregulated in an in vitro model of RPE replication senescence. 32 It has been shown to regulate adipocyte motility through the interaction of vitronectin with its receptor, the integrin αvβ3. 26 As integrin αvβ5, another vitronectin receptor, plays a role in ROS binding by RPE cells, 9 10 we speculated that PAI-1 may regulate the interaction of RPE and ROS. 
We first confirmed previous reports demonstrating that RPE cells in culture constitutively produce PAI-1. We then showed that PAI-1 mRNA and protein levels increase after ROS challenge. Further experiments showed that addition of recombinant PAI-1 to the culture medium results in decreased ROS uptake by ARPE-19 cells. These observations support our hypothesis that PAI-1 is involved in ROS uptake regulation. Conceivably, PAI-1 serves in a negative feedback pathway decreasing continuous ROS uptake by RPE cells after initial phagocytosis. Tripathi et al. 33 have described increased secretion of tissue plasminogen activator (tPA) from cultured porcine RPE cells in response to outer segment challenge; however, the functional significance of this finding is still unclear. 
CD81 antigen, another gene of potential functional significance in ROS uptake, also showed increased expression levels after ROS challenge. This transmembrane protein belongs to the tetraspanin family, which is known to be associated with receptors and in particular, integrins. 34 CD81 was shown to be involved in glial cell phagocytosis 35 but its potential role in ROS uptake by the RPE has not been suggested previously. 
We also found that coagulation factor III (F3) expression is upregulated in association with ROS uptake. F3 is also known to be upregulated in macrophages after phagocytosis, 36 but this has not been described in RPE cells. This finding adds to published data indicating similarities in the phagocytosis process between RPE and macrophages. In particular, all known phagocytic receptors of RPE cells also mediate phagocytosis in macrophages. 7 10  
Our findings demonstrate the feasibility of using expression data to study the mechanisms of RPE-mediated ROS uptake and degradation. The findings indicate that multiple genes, in addition to the ones previously identified, are regulated by and potentially involved in ROS uptake. These genes should be interesting targets for additional studies designed to obtain a more comprehensive view of the mechanisms regulating ROS metabolism, and such increased understanding should provide insights into both normal retinal/RPE physiology and how it is altered in disease. 
 
Table 1.
 
Primers Used for QPCR Experiments
Table 1.
 
Primers Used for QPCR Experiments
Gene Name Accession No. Forward Primer Backward Primer Experiment
Leukotriene A4 hydrolase (LTA4) AA465366 CTTTTAAGTCTTTCCCCACCAG GTCTGGCATTCAAATCCAAGTG V
Copper chaperone for superoxide dismutase (CCS) N30404 GTACTGAGCTCTCCAAAGACTGG TATCCAAAGATCACAGGGAACTC V
Fos-like antigen 1 (Fosl1) BC016648 ATCCAACTCCAGCAACTTCTTC GCACCTTCTGTCAGGAGATAGG VT
Plasminogen activator inhibitor type 1 (PAI1) N75719 CTGGGAGAGAAGTTTGAAGCAC TGGACTCTGAGATGAAAGGATG VT
Coagulation factor III (F3) W27765 AGAACTCCCCAGAGTCACACAC AGGGGATCACTGCTTGAACACT VT
Thioredoxin reductase 1 (TXNRD1) AA453335 GTCAATGTACTGGCTGAGGATTC TACACAGCCAAATGAGATGAGG VT
Activating transcription factor 4 (ATF4) XM_039372 AGTTTAGAGCTGGGCAGTGAAG CTCACCCTTTACTTTTGCTGCT VT
DNA-damage-inducible transcript 3 (DDIT3) AA015892 AGCTGAGACCTTTCCTTTTGTCT AACGGAAAACAGAGTGGTCATT VT
Fos BC004490 ACATCTTCCCTAGAGGGTTCCT TATCCAGCACCAGGTTAATTCC T
Early growth response 1 (EGR1) X52541 CAAGTCCTCCCTCTCTACTGGA AATCCATGGCACAGACACTGTA T
Ribosomal protein large, P0 (RPLPO) BC008092 ATCTGCTGCATCTGCTTG CGACCTGGAAGTCCAACTAC N
Table 2.
 
Differential Gene Expression
Table 2.
 
Differential Gene Expression
Gene Name Gene Symbol Accession No. Microarray -Fold Change Subcellular Localization QPCR -Fold Change Function
A. Genes Differentially Expressed 3 Hours after ROS Challenge (FDR = 25%)
Up-regulated genes
 DNA-damage-inducible transcript 3 DDIT3 AA015892 3.2 Nuclear 3.2 Transcription regulation, stress response
 Hypothetical protein BC011981 AA429886 2.0
 Thioredoxin reductase 1 TXNRD1 AA453335 1.9 Cytoplasmic 2.1 Signal transducation, oxyreductase
 Microtubule-associated protein, RP/EB family, member 1 MAPRE1 AA001749 1.9 Associated with the microtubule network Cell cycle
 Epimorphin EPIM AA056536 1.9 Signal transduction
 EST AA015718 2.6
 Cyclin-dependent kinase inhibitor 2A CDKN2A AA877595 1.8 Cell cycle
 Activating transcription factor 4 ATF4 AA600217 2.3 Nuclear 1.9 Transcription regulation
 Coagulation factor III F3 W27765 4.1 2.5 Receptor, signaling, coagulation
 Fibroblast growth factor (acidic) intracellular binding protein FIBP AA490046 1.6 Nuclear and cytoplasmic membranes Signal transduction
 E3 ubiquitin ligase SMURF2 SMURF2 AA479976 2.1 Proteolysis regulates the activity of diverse receptor systems
 Jun B proto-oncogene JUNB M29039 1.9 Transcription regulation
 FOS-like antigen 1 FOSL1 BC016648 3.1 Nuclear 4.2 Transcription regulation, cell proliferation
 Ribophorin I RPN1 AA127100 1.8 Type i membrane protein, endoplasmic reticulum Protein modifecation
 Plasminogen activator inhibitor 1 PAI1 N75719 2.5 3.0 Proteinase inhibitor, coagulation, inhibitor of vitreonectin intgrin binding, inhibit CNV
 Dual specificity phosphatase 1 DUSP1 N62259 1.7 Oxidative stress response
 EST AA016065 2.0
 CD2 antigen CD2 AA927710 3.9 Type i membrane protein Receptor, cell adhesion, signal transduction
 Nuclear transcription factor Y, alpha NFYA AA412691 1.6 Nuclear Transcription regulation
 Insulin-like growth factor binding protein 1 IGFBP1 AA777187 1.6 Signal transduction cell proliferation
 Hypothetical protein BC014942 AA918089 1.7
 EST AA709414 2.4
 GK001 protein AA004671 2.4
 SWI/SNF related matrix-associated, actin-dependent regulator of chromatin, subfamily a, member 5 SMARCA5 AA608512 1.8 Transcription regulation
 EST AI024521 1.7
 Werner helicase interacting protein WHIP AA879105 1.8 May influence the aging process
 EST R85888 1.6
 Myogenin MYOG AI291603 1.5 Nuclear Transcription regulation
 Proteasome (prosome, macropain) inhibitor subunit 1 (PI31) PSMF1 AA421258 1.7 Proteosome inhibitor
 CK2 interacting protein 1 AA490216 1.8
 Excision repair cross-complementing rodent repair deficiency, complementation group 1 ERCC1 T95289 1.9 Nuclear DNA repair
 Hypothetical protein FLJ20986 H48097 1.6
 Discs, large (Drosophila) homolog 1 DLG1 H24707 1.5 Membrane-associated protein with guanylate kinase activity
 Kruppel-like factor 13 KLF13 H97677 2.9 Nuclear Transcription regulation
 Flotillin 2 FLOT2 R73545 1.5 Membrane-associated protein of caveolae Cell adhesion
 CD81 antigen CD81 AA486653 1.9 Integral membrane protein Signal transduction
 EST W28791 1.6
 Myelin gene expression factor 2 AA598567 1.6 Transcription regulation
 Protein tyrosine phosphatase type IVA, member 2 PTP4A2 AA504327 1.8 Protein modification
 LPS-induced TNF-alpha factor PIG7 AA625666 1.4 Transcription regulation
 EST AA018820 1.5
Down regulated genes
 Leukotriene A4 hydrolase LTA4H AA465366 −2.5 Cytoplasmic 0 Peptidase, leukotriene metabolism
 KIAA0798 gene product H81605 −3.7 Nuclear
 KIAA0161 gene product KIAA0161 W95118 −17.1
 Copper chaperone for superoxide dismutase CCS N30404 −2.5 Cytoplasmic −1.3 Intracellular copper delivery
Gene Name Gene Symbol Accession No. Microarray -Fold Change Subcellular Localization Gene Function
B. Gene Differentially Expressed 12 Hours after ROS Challenge (FDR = 20%)
EST AA054113 1.6
 Hypothetical protein MGC2752 H19107 1.5
 caveolin 1, caveolae protein, 22 kD AA487560 1.8 Caveolae membrane Structural protein, tumor suppressor
 Homologous to yeast nitrogen permease NPR2L AI222722 1.7 Candidate tumor suppressor
 Mitochondrial ribosomal protein L43 MRPL43 AA040752 1.5
 EST R37362 1.5
 CD5 antigen CD5 AA406027 1.5 Membrane T-cell surface glycoprotein
 Testis expressed sequence 27 AA457102 1.8
 Syntrophin, beta 2 SNTB2 AA489861 1.6 Dystrophin-associated
glycoprotein complex, protein binding
 EST AA015985 1.5
Figure 1.
 
Molecular function breakdown of 29 genes with known function found to be upregulated 3 hours after ROS challenge. The number of genes in each functional class is in parentheses.
Figure 1.
 
Molecular function breakdown of 29 genes with known function found to be upregulated 3 hours after ROS challenge. The number of genes in each functional class is in parentheses.
Figure 2.
 
mRNA levels of five transcripts upregulated 3 hours after ROS challenge, according to our microarray experiments, and of two transcripts previously reported, as assessed by QPCR. Seven time points were evaluated. The y-axis shows the log2 ratio of the mRNA levels in the sample challenged with ROS to the control samples. The x-axis shows the time in minutes after ROS challenge. (A) DNA-damage–inducible transcript 3 (DDIT3); (B) fos-like antigen 1 (Fosl1); (C) plasminogen activator inhibitor type 1 (PAI-1); (D) early growth response 1 (EGR1); (E) Fos; (F) activating transcription factor 4 (ATF4); and (G) thioredoxin reductase 1 (TXNRD1).
Figure 2.
 
mRNA levels of five transcripts upregulated 3 hours after ROS challenge, according to our microarray experiments, and of two transcripts previously reported, as assessed by QPCR. Seven time points were evaluated. The y-axis shows the log2 ratio of the mRNA levels in the sample challenged with ROS to the control samples. The x-axis shows the time in minutes after ROS challenge. (A) DNA-damage–inducible transcript 3 (DDIT3); (B) fos-like antigen 1 (Fosl1); (C) plasminogen activator inhibitor type 1 (PAI-1); (D) early growth response 1 (EGR1); (E) Fos; (F) activating transcription factor 4 (ATF4); and (G) thioredoxin reductase 1 (TXNRD1).
Figure 3.
 
ROS phagocytic challenge upregulates PAI-1 protein in ARPE-19 cells. Soluble PAI-1 inhibits ROS binding. (A) ARPE-19 cells received assay medium (medium) or ROS in medium (OS), for 3 to 6 hours as indicated before lysis. Immunoblot analysis was used to detect PAI-1 protein in samples containing an equal number of cells (PAI-1). Parallel gels blotted for actin confirmed equal loading of gels (actin). Quantification of band intensities revealed significant increases in PAI-1 protein in response to ROS by ARPE-19 cells (▪) at 5 and 6 hours, compared with cells before challenge (□, / on x-axis) as determined by one-way analysis of variance followed by the Bonferroni post hoc test (P < 0.001). At earlier time points and at all time points after the addition of medium alone ( Image not available), PAI-1 protein levels did not differ significantly from those in untreated control cells (P > 0.05). Data are the average results of three independent experiments ± standard deviation. (B) ARPE-19 cells were incubated with ROS for 2.5 and 5 hours in the presence of 2% PBS solvent ( Image not available) or of 1 μM recombinant human PAI-1 (▪). ROS total uptake and internalization were measured by fluorescence scanning of samples with and without trypan blue quenching of external OS, respectively. Binding indices and internalization indices were calculated. PAI-1 significantly reduced the OS binding index at the 2.5-hour time point by 57% ± 7% (t-test, P = 0.002) but had no effect on the internalization index, suggesting a primary effect on OS binding. Data are the average OS indices ± standard deviation (n = 3).
Figure 3.
 
ROS phagocytic challenge upregulates PAI-1 protein in ARPE-19 cells. Soluble PAI-1 inhibits ROS binding. (A) ARPE-19 cells received assay medium (medium) or ROS in medium (OS), for 3 to 6 hours as indicated before lysis. Immunoblot analysis was used to detect PAI-1 protein in samples containing an equal number of cells (PAI-1). Parallel gels blotted for actin confirmed equal loading of gels (actin). Quantification of band intensities revealed significant increases in PAI-1 protein in response to ROS by ARPE-19 cells (▪) at 5 and 6 hours, compared with cells before challenge (□, / on x-axis) as determined by one-way analysis of variance followed by the Bonferroni post hoc test (P < 0.001). At earlier time points and at all time points after the addition of medium alone ( Image not available), PAI-1 protein levels did not differ significantly from those in untreated control cells (P > 0.05). Data are the average results of three independent experiments ± standard deviation. (B) ARPE-19 cells were incubated with ROS for 2.5 and 5 hours in the presence of 2% PBS solvent ( Image not available) or of 1 μM recombinant human PAI-1 (▪). ROS total uptake and internalization were measured by fluorescence scanning of samples with and without trypan blue quenching of external OS, respectively. Binding indices and internalization indices were calculated. PAI-1 significantly reduced the OS binding index at the 2.5-hour time point by 57% ± 7% (t-test, P = 0.002) but had no effect on the internalization index, suggesting a primary effect on OS binding. Data are the average OS indices ± standard deviation (n = 3).
Gal A, Li Y, Thompson DA, et al. Mutations in MERTK, the human orthologue of the RCS rat retinal dystrophy gene, cause retinitis pigmentosa. Nat Genet. 2000;26:270–271. [CrossRef] [PubMed]
Vollrath D, Feng W, Duncan JL, et al. Correction of the retinal dystrophy phenotype of the RCS rat by viral gene transfer of Mertk. Proc Natl Acad Sci USA. 2001;98:12584–12589. [CrossRef] [PubMed]
Mullen RJ, LaVail MM. Inherited retinal dystrophy: primary defect in pigment epithelium determined with experimental rat chimeras. Science. 1976;192:799–801. [CrossRef] [PubMed]
Dowling J, Sidman RL. Inherited retinal dystrophy in the rat. J Cell Biol. 1962;14:73–109. [CrossRef] [PubMed]
Rakoczy PE, Zhang D, Robertson T, et al. Progressive age-related changes similar to age-related macular degeneration in a transgenic mouse model. Am J Pathol. 2002;161:1515–1524. [CrossRef] [PubMed]
Finnemann SC, Leung LW, Rodriguez-Boulan E. The lipofuscin component A2E selectively inhibits phagolysosomal degradation of photoreceptor phospholipid by the retinal pigment epithelium. Proc Natl Acad Sci USA. 2002;99:3842–3847. [CrossRef] [PubMed]
Boyle D, Tien LF, Cooper NG, Shepherd V, McLaughlin BJ. A mannose receptor is involved in retinal phagocytosis. Invest Ophthalmol Vis Sci. 1991;32:1464–1470. [PubMed]
Ryeom SW, Sparrow JR, Silverstein RL. CD36 participates in the phagocytosis of rod outer segments by retinal pigment epithelium. J Cell Sci. 1996;109:387–395. [PubMed]
Miceli MV, Newsome DA, Tate DJ, Jr. Vitronectin is responsible for serum-stimulated uptake of rod outer segments by cultured retinal pigment epithelial cells. Invest Ophthalmol Vis Sci. 1997;38:1588–1597. [PubMed]
Finnemann SC, Bonilha VL, Marmorstein AD, Rodriguez-Boulan E. Phagocytosis of rod outer segments by retinal pigment epithelial cells requires alpha(v)beta5 integrin for binding but not for internalization. Proc Natl Acad Sci USA. 1997;94:12932–12937. [CrossRef] [PubMed]
D’Cruz PM, Yasumura D, Weir J, et al. Mutation of the receptor tyrosine kinase gene Mertk in the retinal dystrophic RCS rat. Hum Mol Genet. 2000;9:645–651. [CrossRef] [PubMed]
Finnemann SC, Silverstein RL. Differential roles of CD36 and alpha-v-beta 5 integrin in photoreceptor phagocytosis by the retinal pigment epithelium. J Exp Med. 2001;194:1289–1298. [CrossRef] [PubMed]
Feng W, Yasumura D, Matthes MT, LaVail MM, Vollrath D. Mertk triggers uptake of photoreceptor outer segments during phagocytosis by cultured retinal pigment epithelial cells. J Biol Chem. 2002;277:17016–17022. [CrossRef] [PubMed]
Bosch E, Horwitz J, Bok D. Phagocytosis of outer segments by retinal pigment epithelium: phagosome-lysosome interaction. J Histochem Cytochem. 1993;41:253–263. [CrossRef] [PubMed]
Ershov AV, Lukiw WJ, Bazan NG. Selective transcription factor induction in retinal pigment epithelial cells during photoreceptor phagocytosis. J Biol Chem. 1996;271:28458–28462. [CrossRef] [PubMed]
Ershov AV, Bazan NG. Induction of cyclooxygenase-2 gene expression in retinal pigment epithelium cells by photoreceptor rod outer segment phagocytosis and growth factors. J Neurosci Res. 1999;58:254–261. [CrossRef] [PubMed]
Ershov AV, Parkins N, Lukiw WJ, Bazan NG. Modulation of early-response gene expression by prostaglandins in cultured rat retinal pigment epithelium cells. Curr Eye Res. 2000;21:968–974. [CrossRef] [PubMed]
Chowers I, Gunatilaka T, Farkas R, et al. Identification of novel genes preferentially expressed in the retina using a custom human retina cDNA microarray. Invest Ophthalmol Vis Sci. 2003;44:3732–3741. [CrossRef] [PubMed]
Dunn KC, Aotaki-Keen AE, Putkey FR, Hjelmeland LM. ARPE-19, a human retinal pigment epithelial cell line with differentiated properties. Exp Eye Res. 1996;62:155–169. [CrossRef] [PubMed]
Molday RS, Hicks D, Molday L. Peripherin: a rim-specific membrane protein of rod outer segment discs. Invest Ophthalmol Vis Sci. 1987;28:50–61. [PubMed]
Hicks D, Molday RS. Differential immunogold-dextran labeling of bovine and frog rod and cone cells using monoclonal antibodies against bovine rhodopsin. Exp Eye Res. 1986;42:55–71. [CrossRef] [PubMed]
Hegde P, Qi R, Abernathy K, et al. A concise guide to cDNA microarray analysis. Biotechniques. 2000;29:548–550. [PubMed]
Tusher VG, Tibshirani R, Chu G. Significance analysis of microarrays applied to the ionizing radiation response. Proc Natl Acad Sci USA. 2001;98:5116–5121. [CrossRef] [PubMed]
Simpson DA, Feeney S, Boyle C, Stitt AW. Retinal VEGF mRNA measured by SYBR green I fluorescence: a versatile approach to quantitative PCR. Mol Vis. 2000;6:178–183. [PubMed]
Finnemann SC, Rodriguez-Boulan E. Macrophage and retinal pigment epithelium phagocytosis: apoptotic cells and photoreceptors compete for alphavbeta3 and alphavbeta5 integrins, and protein kinase C regulates alphavbeta5 binding and cytoskeletal linkage. J Exp Med. 1999;190:861–874. [CrossRef] [PubMed]
Crandall DL, Busler DE, McHendry-Rinde B, Groeling TM, Kral JG. Autocrine regulation of human preadipocyte migration by plasminogen activator inhibitor-1. J Clin Endocrinol Metab. 2000;85:2609–2614. [CrossRef] [PubMed]
Moisseiev J, Jerdan JA, Dyer K, Maglione A, Glaser BM. Retinal pigment epithelium cells can influence endothelial cell plasminogen activators. Invest Ophthalmol Vis Sci. 1990;31:1070–1078. [PubMed]
Grant MB, Guay C, Marsh R. Insulin-like growth factor I stimulates proliferation, migration, and plasminogen activator release by human retinal pigment epithelial cells. Curr Eye Res. 1990;9:323–335. [CrossRef] [PubMed]
Campochiaro PA, Mimuro J, Sugg R, Loskutoff DJ. Retinal pigment epithelial cells produce a latent fibrinolytic inhibitor that is antigenically and biochemically related to type 1 plasminogen activator inhibitor produced by vascular endothelial cells. Exp Eye Res. 1989;49:195–203. [CrossRef] [PubMed]
Siren V, Stephens RW, Salonen EM, Vaheri A, Summanen P, Immonen I. Retinal pigment epithelial cells secrete urokinase-type plasminogen activator and its inhibitor PAI-1. Ophthalmic Res. 1992;24:203–212. [CrossRef] [PubMed]
Lambert V, Munaut C, Noel A, et al. Influence of plasminogen activator inhibitor type 1 on choroidal neovascularization. FASEB J. 2001;15:1021–1027. [CrossRef] [PubMed]
Matsunaga H, Handa JT, Gelfman CM, Hjelmeland LM. The mRNA phenotype of a human RPE cell line at replicative senescence. Mol Vis. 1999;5:39. [PubMed]
Tripathi BJ, Park JK, Tripathi RC. Extracellular release of tissue plasminogen activator is increased with the phagocytic activity of the retinal pigment epithelium. Invest Ophthalmol Vis Sci. 1989;30:2470–2473. [PubMed]
Levy S, Todd SC, Maecker HT. CD81 (TAPA-1): a molecule involved in signal transduction and cell adhesion in the immune system. Annu Rev Immunol. 1998;16:89–109. [CrossRef] [PubMed]
Dijkstra S, Geisert EE, Jr, Dijkstra CD, Bar PR, Joosten EA. CD81 and microglial activation in vitro: proliferation, phagocytosis and nitric oxide production. J Neuroimmunol. 2001;114:151–159. [CrossRef] [PubMed]
Edwards RL, Rickles FR, Bobrove AM. Mononuclear cell tissue factor: cell of origin and requirements for activation. Blood. 1979;54:359–370. [PubMed]
Figure 1.
 
Molecular function breakdown of 29 genes with known function found to be upregulated 3 hours after ROS challenge. The number of genes in each functional class is in parentheses.
Figure 1.
 
Molecular function breakdown of 29 genes with known function found to be upregulated 3 hours after ROS challenge. The number of genes in each functional class is in parentheses.
Figure 2.
 
mRNA levels of five transcripts upregulated 3 hours after ROS challenge, according to our microarray experiments, and of two transcripts previously reported, as assessed by QPCR. Seven time points were evaluated. The y-axis shows the log2 ratio of the mRNA levels in the sample challenged with ROS to the control samples. The x-axis shows the time in minutes after ROS challenge. (A) DNA-damage–inducible transcript 3 (DDIT3); (B) fos-like antigen 1 (Fosl1); (C) plasminogen activator inhibitor type 1 (PAI-1); (D) early growth response 1 (EGR1); (E) Fos; (F) activating transcription factor 4 (ATF4); and (G) thioredoxin reductase 1 (TXNRD1).
Figure 2.
 
mRNA levels of five transcripts upregulated 3 hours after ROS challenge, according to our microarray experiments, and of two transcripts previously reported, as assessed by QPCR. Seven time points were evaluated. The y-axis shows the log2 ratio of the mRNA levels in the sample challenged with ROS to the control samples. The x-axis shows the time in minutes after ROS challenge. (A) DNA-damage–inducible transcript 3 (DDIT3); (B) fos-like antigen 1 (Fosl1); (C) plasminogen activator inhibitor type 1 (PAI-1); (D) early growth response 1 (EGR1); (E) Fos; (F) activating transcription factor 4 (ATF4); and (G) thioredoxin reductase 1 (TXNRD1).
Figure 3.
 
ROS phagocytic challenge upregulates PAI-1 protein in ARPE-19 cells. Soluble PAI-1 inhibits ROS binding. (A) ARPE-19 cells received assay medium (medium) or ROS in medium (OS), for 3 to 6 hours as indicated before lysis. Immunoblot analysis was used to detect PAI-1 protein in samples containing an equal number of cells (PAI-1). Parallel gels blotted for actin confirmed equal loading of gels (actin). Quantification of band intensities revealed significant increases in PAI-1 protein in response to ROS by ARPE-19 cells (▪) at 5 and 6 hours, compared with cells before challenge (□, / on x-axis) as determined by one-way analysis of variance followed by the Bonferroni post hoc test (P < 0.001). At earlier time points and at all time points after the addition of medium alone ( Image not available), PAI-1 protein levels did not differ significantly from those in untreated control cells (P > 0.05). Data are the average results of three independent experiments ± standard deviation. (B) ARPE-19 cells were incubated with ROS for 2.5 and 5 hours in the presence of 2% PBS solvent ( Image not available) or of 1 μM recombinant human PAI-1 (▪). ROS total uptake and internalization were measured by fluorescence scanning of samples with and without trypan blue quenching of external OS, respectively. Binding indices and internalization indices were calculated. PAI-1 significantly reduced the OS binding index at the 2.5-hour time point by 57% ± 7% (t-test, P = 0.002) but had no effect on the internalization index, suggesting a primary effect on OS binding. Data are the average OS indices ± standard deviation (n = 3).
Figure 3.
 
ROS phagocytic challenge upregulates PAI-1 protein in ARPE-19 cells. Soluble PAI-1 inhibits ROS binding. (A) ARPE-19 cells received assay medium (medium) or ROS in medium (OS), for 3 to 6 hours as indicated before lysis. Immunoblot analysis was used to detect PAI-1 protein in samples containing an equal number of cells (PAI-1). Parallel gels blotted for actin confirmed equal loading of gels (actin). Quantification of band intensities revealed significant increases in PAI-1 protein in response to ROS by ARPE-19 cells (▪) at 5 and 6 hours, compared with cells before challenge (□, / on x-axis) as determined by one-way analysis of variance followed by the Bonferroni post hoc test (P < 0.001). At earlier time points and at all time points after the addition of medium alone ( Image not available), PAI-1 protein levels did not differ significantly from those in untreated control cells (P > 0.05). Data are the average results of three independent experiments ± standard deviation. (B) ARPE-19 cells were incubated with ROS for 2.5 and 5 hours in the presence of 2% PBS solvent ( Image not available) or of 1 μM recombinant human PAI-1 (▪). ROS total uptake and internalization were measured by fluorescence scanning of samples with and without trypan blue quenching of external OS, respectively. Binding indices and internalization indices were calculated. PAI-1 significantly reduced the OS binding index at the 2.5-hour time point by 57% ± 7% (t-test, P = 0.002) but had no effect on the internalization index, suggesting a primary effect on OS binding. Data are the average OS indices ± standard deviation (n = 3).
Table 1.
 
Primers Used for QPCR Experiments
Table 1.
 
Primers Used for QPCR Experiments
Gene Name Accession No. Forward Primer Backward Primer Experiment
Leukotriene A4 hydrolase (LTA4) AA465366 CTTTTAAGTCTTTCCCCACCAG GTCTGGCATTCAAATCCAAGTG V
Copper chaperone for superoxide dismutase (CCS) N30404 GTACTGAGCTCTCCAAAGACTGG TATCCAAAGATCACAGGGAACTC V
Fos-like antigen 1 (Fosl1) BC016648 ATCCAACTCCAGCAACTTCTTC GCACCTTCTGTCAGGAGATAGG VT
Plasminogen activator inhibitor type 1 (PAI1) N75719 CTGGGAGAGAAGTTTGAAGCAC TGGACTCTGAGATGAAAGGATG VT
Coagulation factor III (F3) W27765 AGAACTCCCCAGAGTCACACAC AGGGGATCACTGCTTGAACACT VT
Thioredoxin reductase 1 (TXNRD1) AA453335 GTCAATGTACTGGCTGAGGATTC TACACAGCCAAATGAGATGAGG VT
Activating transcription factor 4 (ATF4) XM_039372 AGTTTAGAGCTGGGCAGTGAAG CTCACCCTTTACTTTTGCTGCT VT
DNA-damage-inducible transcript 3 (DDIT3) AA015892 AGCTGAGACCTTTCCTTTTGTCT AACGGAAAACAGAGTGGTCATT VT
Fos BC004490 ACATCTTCCCTAGAGGGTTCCT TATCCAGCACCAGGTTAATTCC T
Early growth response 1 (EGR1) X52541 CAAGTCCTCCCTCTCTACTGGA AATCCATGGCACAGACACTGTA T
Ribosomal protein large, P0 (RPLPO) BC008092 ATCTGCTGCATCTGCTTG CGACCTGGAAGTCCAACTAC N
Table 2.
 
Differential Gene Expression
Table 2.
 
Differential Gene Expression
Gene Name Gene Symbol Accession No. Microarray -Fold Change Subcellular Localization QPCR -Fold Change Function
A. Genes Differentially Expressed 3 Hours after ROS Challenge (FDR = 25%)
Up-regulated genes
 DNA-damage-inducible transcript 3 DDIT3 AA015892 3.2 Nuclear 3.2 Transcription regulation, stress response
 Hypothetical protein BC011981 AA429886 2.0
 Thioredoxin reductase 1 TXNRD1 AA453335 1.9 Cytoplasmic 2.1 Signal transducation, oxyreductase
 Microtubule-associated protein, RP/EB family, member 1 MAPRE1 AA001749 1.9 Associated with the microtubule network Cell cycle
 Epimorphin EPIM AA056536 1.9 Signal transduction
 EST AA015718 2.6
 Cyclin-dependent kinase inhibitor 2A CDKN2A AA877595 1.8 Cell cycle
 Activating transcription factor 4 ATF4 AA600217 2.3 Nuclear 1.9 Transcription regulation
 Coagulation factor III F3 W27765 4.1 2.5 Receptor, signaling, coagulation
 Fibroblast growth factor (acidic) intracellular binding protein FIBP AA490046 1.6 Nuclear and cytoplasmic membranes Signal transduction
 E3 ubiquitin ligase SMURF2 SMURF2 AA479976 2.1 Proteolysis regulates the activity of diverse receptor systems
 Jun B proto-oncogene JUNB M29039 1.9 Transcription regulation
 FOS-like antigen 1 FOSL1 BC016648 3.1 Nuclear 4.2 Transcription regulation, cell proliferation
 Ribophorin I RPN1 AA127100 1.8 Type i membrane protein, endoplasmic reticulum Protein modifecation
 Plasminogen activator inhibitor 1 PAI1 N75719 2.5 3.0 Proteinase inhibitor, coagulation, inhibitor of vitreonectin intgrin binding, inhibit CNV
 Dual specificity phosphatase 1 DUSP1 N62259 1.7 Oxidative stress response
 EST AA016065 2.0
 CD2 antigen CD2 AA927710 3.9 Type i membrane protein Receptor, cell adhesion, signal transduction
 Nuclear transcription factor Y, alpha NFYA AA412691 1.6 Nuclear Transcription regulation
 Insulin-like growth factor binding protein 1 IGFBP1 AA777187 1.6 Signal transduction cell proliferation
 Hypothetical protein BC014942 AA918089 1.7
 EST AA709414 2.4
 GK001 protein AA004671 2.4
 SWI/SNF related matrix-associated, actin-dependent regulator of chromatin, subfamily a, member 5 SMARCA5 AA608512 1.8 Transcription regulation
 EST AI024521 1.7
 Werner helicase interacting protein WHIP AA879105 1.8 May influence the aging process
 EST R85888 1.6
 Myogenin MYOG AI291603 1.5 Nuclear Transcription regulation
 Proteasome (prosome, macropain) inhibitor subunit 1 (PI31) PSMF1 AA421258 1.7 Proteosome inhibitor
 CK2 interacting protein 1 AA490216 1.8
 Excision repair cross-complementing rodent repair deficiency, complementation group 1 ERCC1 T95289 1.9 Nuclear DNA repair
 Hypothetical protein FLJ20986 H48097 1.6
 Discs, large (Drosophila) homolog 1 DLG1 H24707 1.5 Membrane-associated protein with guanylate kinase activity
 Kruppel-like factor 13 KLF13 H97677 2.9 Nuclear Transcription regulation
 Flotillin 2 FLOT2 R73545 1.5 Membrane-associated protein of caveolae Cell adhesion
 CD81 antigen CD81 AA486653 1.9 Integral membrane protein Signal transduction
 EST W28791 1.6
 Myelin gene expression factor 2 AA598567 1.6 Transcription regulation
 Protein tyrosine phosphatase type IVA, member 2 PTP4A2 AA504327 1.8 Protein modification
 LPS-induced TNF-alpha factor PIG7 AA625666 1.4 Transcription regulation
 EST AA018820 1.5
Down regulated genes
 Leukotriene A4 hydrolase LTA4H AA465366 −2.5 Cytoplasmic 0 Peptidase, leukotriene metabolism
 KIAA0798 gene product H81605 −3.7 Nuclear
 KIAA0161 gene product KIAA0161 W95118 −17.1
 Copper chaperone for superoxide dismutase CCS N30404 −2.5 Cytoplasmic −1.3 Intracellular copper delivery
Gene Name Gene Symbol Accession No. Microarray -Fold Change Subcellular Localization Gene Function
B. Gene Differentially Expressed 12 Hours after ROS Challenge (FDR = 20%)
EST AA054113 1.6
 Hypothetical protein MGC2752 H19107 1.5
 caveolin 1, caveolae protein, 22 kD AA487560 1.8 Caveolae membrane Structural protein, tumor suppressor
 Homologous to yeast nitrogen permease NPR2L AI222722 1.7 Candidate tumor suppressor
 Mitochondrial ribosomal protein L43 MRPL43 AA040752 1.5
 EST R37362 1.5
 CD5 antigen CD5 AA406027 1.5 Membrane T-cell surface glycoprotein
 Testis expressed sequence 27 AA457102 1.8
 Syntrophin, beta 2 SNTB2 AA489861 1.6 Dystrophin-associated
glycoprotein complex, protein binding
 EST AA015985 1.5
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×