July 2004
Volume 45, Issue 7
Free
Biochemistry and Molecular Biology  |   July 2004
Sequence Variants in the Transforming Growth β-Induced Factor (TGIF) Gene Are Not Associated with High Myopia
Author Affiliations
  • Genaro S. Scavello
    From the Divisions of Ophthalmology and
  • Prasuna C. Paluru
    From the Divisions of Ophthalmology and
  • William R. Ganter
    From the Divisions of Ophthalmology and
  • Terri L. Young
    From the Divisions of Ophthalmology and
    Genetics, Children’s Hospital of Philadelphia, University of Pennsylvania Medical School, Philadelphia, Pennsylvania.
Investigative Ophthalmology & Visual Science July 2004, Vol.45, 2091-2097. doi:10.1167/iovs.03-0933
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to Subscribers Only
      Sign In or Create an Account ×
    • Get Citation

      Genaro S. Scavello, Prasuna C. Paluru, William R. Ganter, Terri L. Young; Sequence Variants in the Transforming Growth β-Induced Factor (TGIF) Gene Are Not Associated with High Myopia. Invest. Ophthalmol. Vis. Sci. 2004;45(7):2091-2097. doi: 10.1167/iovs.03-0933.

      Download citation file:


      © 2016 Association for Research in Vision and Ophthalmology.

      ×
  • Supplements
Abstract

purpose. High myopia is a common complex-trait eye disorder, with implications for blindness due to increased risk of retinal detachment, macular degeneration, premature cataracts, and glaucoma. Mapping studies have identified at least four loci for nonsyndromic autosomal dominant high myopia at 18p11.31, 12q22-q23, 17q21-q23, and 7q36. The smallest haplotyped interval for these loci is that of the MYP2 locus on 18p11.31. Recently, the transforming growth β-induced factor (TGIF) gene was reported to be a candidate gene for MYP2-associated high myopia in single-nucleotide polymorphism studies. The purpose of this study was to determine whether DNA sequence variants in the human TGIF gene are causally related to MYP2-associated high myopia.

methods. The protein coding regions and intron-exon boundaries of the human TGIF gene were sequenced using genomic DNA samples from MYP2 individuals (affected, unaffected) and external control subjects. The TGIF model used was the April 20, 2003, human genome National Center for Biotechnology Information (NCBI) build 33, which has 10 exons and encodes eight transcript variants. Polymorphic sequence changes were compared to those in the previous report. Reverse-transcription polymerase chain reaction (RT-PCR) was performed to validate TGIF gene expression in ocular tissues.

results. A total of 21 polymorphisms of TGIF were found by direct sequencing: 3 were missense, 2 were silent, 10 were not translated, 4 were intronic, and 2 were homozygous deletions. The 3 missense allelic variants were localized to exon 10 at positions 236C→T(Pro→Leu), 244C→T(Pro→Ser), and 245C→T(Pro→Leu). Silent mutations were observed in exon 10 at positions 177A→G, 333C→T. Ten polymorphisms were novel. No sequence alterations were exclusively associated with the affected disease phenotype. RT-PCR results confirmed expression of TGIF in RNA samples derived from human sclera, cornea, optic nerve, and retina.

conclusions. TGIF is a known candidate gene for MYP2-associated high myopia, based on its mapped location within the MYP2 interval. Mutation analysis of the encoded TGIF gene for MYP2 autosomal dominant high myopia did not identify sequence alterations associated with the disease phenotype. Further studies of MYP2 candidate genes are needed to determine the gene that causes of this potentially blinding disorder.

Myopia affects approximately 25% of the adult population of the United States 1 2 3 4 5 and is a significant public health problem, especially in Asian populations such as Chinese or Indians, as it is associated with increased risk for visual loss. 1 6 7 8 9 10 Myopic chorioretinal degeneration due to high myopia is the fourth most frequent cause of blindness, leading to registration for visual services and disability and accounting for 8.8% of all causes. 11 It has been estimated that 5.6% of blindness among school children in the United States is attributable to high myopia. 11 Substantial resources are required for optical correction of myopia with spectacles, contact lenses, and, more recently, surgical procedures such as photorefractive keratectomy. The market for optical aids in the United States was estimated to exceed $8 billion in annual sales in 1990; most dollars were spent for the correction of myopia. 11 The development of methods for preventing the onset or limiting the progression of myopia would be of considerable importance. 
Our laboratory identified the MYP2 locus in seven families with nonsyndromic autosomal dominant (AD) high myopia of −6.00 D or greater. We demonstrated significant linkage to the short arm of chromosome 18, region 11.31, with a maximum cumulative LOD score of 9.59 at θ = 0.0. 12 The 7.6 cM recombinant interval was defined distally by marker D18S59 and proximally by marker D18S1138, with recombinants in pedigrees 1, 4, and 5 (Table 1) . The genetic boundaries of the MYP2 region are currently defined by linkage analysis of these seven existing MYP2 pedigrees, which represent the group of MYP2-affected families we have screened for mutations at the MYP2 locus. 
In an effort to contract the MYP2 interval, transmission disequilibrium test (TDT) statistics 13 were obtained with the Statistical Analysis for Genetic Epidemiology Transmission Disequilibrium Test (SAGE-TDTEX) 14 and Genehunter-TDT (GH2-TDT) 15 programs. Both programs examine each allele separately to look for increased frequency of disequilibrium or nonrecombination events on disease-bearing chromosomes over normal chromosomes, using a standard one-sided test (Fisher exact test). The SAGE program also calculates a summary χ2 for each marker, as it examines the degree of linkage disequilibrium at the marker. TDT analysis was focused on eleven 18p markers used for fine mapping in the original study. 16 The significance values determined by both programs are listed in Table 1 for each marker locus in marker order for the 18p11.31 region. Markers D18S52 and D18S1138 show the strongest statistical association with the disease phenotype. These data suggest that the MYP2 gene is likely within a 2.2-cM interval between D18S52 and D18S481
Critically important are the recent independent confirmations of the MYP2 locus with an Italian patient population with AD high myopia by Heath et al. 17 and six families of Hong Kong Chinese descent by Lam et al. 18 The mapping studies of both laboratories support directing further gene identification efforts to the centromeric region of the initial 7.6-cM recombinant interval. These results, combined with our studies, provide a basis for focused positional candidate gene analysis at the MYP2 locus, as the interval of interest has likely contracted significantly from the initial 7.6 cM. 
We constructed a physical bacterial artificial chromosome (BAC) contig map across the MYP2 critical region, shown in Figure 1 , by taking advantage of the multiple databases available in conjunction with the Human Genome Project (HGP). Integration was obtained by mapping markers of different types (monomorphic, polymorphic, genes and expressed sequence tags [ESTs]) from different sources (e.g., NCBI, Genethon, Whitehead Institute, UCSC- “Golden Path”, Celera; see listing at end of article). The core region extends from marker D18S481 to D18S52. It ranges in depth from 1 to 9 BACs, with an average depth of −4 BACs and requires 19 overlapping BACs, averaging 150 to 200 kb, to span the MYP2 region. The MYP2 critical region on the short arm of chromosome 18 is now fully sequenced and is a 1.2-Mb region on contig NT_010859.13. There are six known and nine hypothetical genes that map within the MYP2 interval. All the sequences in this region are now labeled “finished” sequences. 
One gene that maps within the 18p11.3 interval is the transforming growth β-induced factor (TGIF) gene. TGIF is a DNA-binding homeo-domain protein that belongs to the TALE homeobox family. 19 20 It is a transcription repressor with multiple actions, including a role in retinoid-responsive transcription. 21 TGIF mutations are associated with holoprosencephaly, a congenital craniofacial and brain anomaly disorder. 22 23 24 25  
The direct analysis of sequence within a critical region can be the most accurate, precise, and efficient approach to disease gene identification. This is particularly true for instances where the “perfect” candidate gene (based on function or expression) does not exist within a defined critical region. It is also true for a disorder such as myopia, in which the temporal and spatial expression of the disease gene is not known, and could be restricted to early development and to any eye component. All genes that map within the MYP2 critical region are candidate disease genes based on position. TGIF for example, therefore, is a candidate gene for the MYP2-associated high myopia based on map position alone. Sequence variants must be uncovered only in affected subjects compared to unaffected subjects for a fully penetrant dominant disorder such as MYP2-linked high myopia. 
A recent report by Lam et al. describes a TGIF sequence variation study of the 3-exon transcript variant 4 using conformation specific gel-electrophoresis. 26 They found 25 single-nucleotide polymorphism (SNPs) on exon 3 (exon 10 in our study). Six SNPs showed significant high myopia association with univariate analysis, and one showed significance with multivariate analysis. 
We sought to determine whether the TGIF gene is causally related to MYP2-associated high myopia by direct DNA sequencing, using DNA samples from the original MYP2 pedigrees. One consideration is that the TGIF genetic structure studied by Lam et al. 26 had 3 exons—the current sequence build is a 10-exon gene structure. Exons 1, 2, and 3 are now exons 5, 9, and 10, respectively, according to the reference sequence build 33 (http://www.ncbi.nlm.nih.gov/genome/guide/human/HsStats.html) of TGIF, which corresponds to transcript variant 4. 
Methods
Patients
Probands, and affected subject representatives of the seven MYP2-affected families with an AD form of high myopia were studied (Table 2) . Each of the affected individuals had high myopia of −6.00 D sphere or more with elongated axial lengths. Clinical details regarding the complete pedigrees have been published. 12 Controls were obtained from family marry-ins, nonmyopic family members, and unrelated subjects. Table 2 displays the family and member number of each individual, as well as controls with refractive error. Twenty subjects were studied, of which 10 had high myopia and 10 were nonmyopic. 
Total genomic DNA was extracted from 10 to 15 mL of venous blood from all participants after informed consent was obtained. DNA was purified from lymphocyte pellets according to standard procedures using a kit (Puregene4 kit; Gentra Systems, Minneapolis, MN) or the phenol-chloroform extraction method. The study protocol was approved by the Children’s Hospital of Philadelphia Institutional Review Board on Human Subjects Research and adhered to the tenets of the Declaration of Helsinki. 
DNA Amplification and Mutation Screening
The genomic structure of TGIF, as reported in MapViewer (build 33) of the reference human genome sequence is outlined in Figure 2 . The genomic structure of TGIF contains 10 exons spanning 46 kb and has eight transcript variants encoding four proteins of 402 residues (variant 1), 287 residues (variant 2), 273 residues (variants 3 and 4), and 253 residues (variants 5 to 8). All participant DNA samples were also screened for sequence variants on exon 7, although it has no continuous open reading frame with the conserved region of exons 9 and 10, and only one known corresponding expressed sequence tag (EST). 
Twelve oligonucleotide primer pairs were designed to amplify the exonic sequences with 50 to 200 bp extensions beyond the intron-exon boundary (Table 3) . Polymerase chain reactions were performed on 150 ng genomic DNA with standard methods. Amplified products were separated by agarose gel electrophoresis and visualized by staining with ethidium bromide. Amplicons were purified in purification columns (QIAquick; Qiagen, Valencia, CA) and sequenced using dye terminator chemistry (BigDye Terminator ver. 3.1 on a model 3700 Genetic Analyzer; Applied Biosystems, Foster City, CA). 
Sequences were trimmed for quality, BLASTed and aligned (Sequencher; Gene Codes, Ann Arbor, MI. or Gap4; Staden, Cambridge, UK). Sequence alterations were annotated and compared between normal and affected individual DNA samples. 
Reverse Transcription-Polymerase Chain Reaction
Total RNA from retina, cornea, optic nerve, and sclera was isolated from four pooled human donor eyes from the Pennsylvania Lions Eye Bank (Philadelphia) using extraction reagent (TRIzol; Invitrogen-Gibco, Grand Island, NY). The eyes were treated by submersion in RNA stabilization solution (RNALater; Ambion Inc., Austin, TX) within 2 to 12 hours after death. Reverse transcription-polymerase chain reaction (RT-PCR) was performed with random hexamers using standard methods to synthesize cDNA (SuperScript II; Invitrogen Corp., Carlsbad, CA). One microgram of total RNA from the sclera, optic nerve, retina, and cornea, as well as commercially prepared poly-A RNA (BD Biosciences-Clontech Inc., Palo Alto, CA, and Ambion Inc.) from various human organs were used as templates for a 20 μL first-strand cDNA synthesis reaction. Gene-specific PCR was performed using platinum Taq polymerase according to recommended conditions, using 2 μL of each cDNA sample and 50 pM of primer in a final reaction volume of 50 μL. The PCR cycling conditions included an initial denaturation for 120 seconds at 95°C, followed by 34 cycles of denaturation for 15 seconds at 95°C, annealing for 30 seconds at 54°C, extension for 45 seconds at 68°C, and a final extension for 4 minutes at 68°C. The sense (5′GGGAGAGAGTTGGGCGAGGGA-3′) base pair 59-79 on NM_003244 and antisense (5′-TGCCTGAGCCAGCGGATGA-3′) base pair 419-401 on NM_003244 PCR primer pairs amplify a 360-bp product spanning exons 5 (sense) and 9 (antisense), detecting transcripts 3 and 4. The RT-PCR products, along with the amplicon products of the housekeeping gene β-actin were visualized on 2% agarose gels (Fig. 3) after electrophoresis and staining with ethidium bromide. 
Results
A total of 21 polymorphisms were found in the 10 exons screened (Table 4) . Of these, 3 were missense variances, 2 were silent, 10 were not translated, 4 were intronic, and 2 were homozygous deletions. The three missense allelic variants were observed at exon 10 at positions 236C→T (Pro→Leu), 244C→T(Pro→Ser), and 245C→T(Pro→Leu). Silent mutations were observed on exon 10 at positions 177A→G and 333C→T. The two deletions causing frameshift mutations were observed in exon 6 at positions 3442216 and 3442223 on NT_010859.13. Both deletions are predicted to cause early termination, yielding proteins of 132 and 141 residues, respectively. Ten polymorphisms were novel and have been submitted to the dbSNP database (http://www.ncbi.nlm.nih.gov/SNP/) provided in the public domain by NCBI. Eleven polymorphisms corresponded with previously reported SNPs in public databases. None of the sequence variants cosegregated with the affected phenotype. No heterozygous or homozygous polymorphisms were specific to affected individuals in any MYP2 pedigree. 
Notably, 18 of the 25 polymorphisms published by Lam et al. 26 did not match with the published wild-type sequence (accession no. NM_003244). Of these 25 previously published SNPs, only one at position 804A→G was observed in our investigation. We observed a C→T polymorphism at bp 245 on exon 10, which presumptively corresponds to the 804 A→G base pair change. 
RT-PCR results confirmed TGIF expression in all ocular and nonocular tissues (Fig. 3)
Discussion
Nonsyndromic high myopia is a common, complex disorder that is likely to result from alterations of multiple genetic factors. Indeed, several loci have been mapped for the disorder. 
We sequenced the full TGIF gene in our patient samples of individuals from pedigrees with MYP2-associated high myopia. No DNA sequence variants were noted that implicated TGIF as the causative gene. TGIF exon 10 (exon 3 in the initial build of this gene) did not show the same level of polymorphic variants in our cohort, as we observed 8 variants rather than the 25 reported by Lam et al. 26 This may be due to the ethnic differences in our two sample sets, although family 1 of the MYP2 pedigrees studied was of Chinese descent. All other families were of Northern European descent. 
In conclusion, TGIF is a known candidate gene for MYP2-associated high myopia based on its mapped location within the MYP2 interval. Mutation analysis of the encoded TGIF gene for MYP2 AD high myopia did not identify sequence alterations associated with the disease phenotype. Further studies of MYP2 candidate genes are needed to determine the molecular genetic factors that cause this potentially blinding disorder. 
Electronic Database Addresses
Electronic databases (listed below) were used for developing a physical map of the MYP2 critical region. The Genethon, Whitehead, and NCBI websites were queried for microsatellite marker data. The NCBI, UCSC, and Celera websites were used to align BACs and close gap regions. The hypothetical genes were determined by the GENSCAN and OTTO websites. All listed links are free to the public except for OTTO and Celera.
  •  
    Celera: http://cds.celera.com/cds
  •  
    Genethon: http://www.genethon.fr/php/index_us.php
  •  
    GENSCAN: http://genes.mit.edu/GENSCAN.htm
  •  
    MapViewer: http://www.ncbi.nlm.nih.gov/mapview/map_search.cgi
  •  
    NCBI: http://www.ncbi.nlm.nih.gov/
  •  
    OTTO: http://cds.celera.com/biolib/info
  •  
    Public SNP repository: http://www.ncbi.nlm.nih.gov/SNP
  •  
    UCSC “Golden Path”: http://genome.ucsc.edu/
  •  
    Whitehead Institute: http://www-genome.wi.mit.edu/
 
Table 1.
 
MYP2 Locus Marker Recombinants and TDT Allelic Association Analysis
Table 1.
 
MYP2 Locus Marker Recombinants and TDT Allelic Association Analysis
Marker Distance (cM) Pedigree Marker (Telomere) 1 4 5 SAGE-TDTEX P GH2-TDT P
D18S1140 + 0.036 0.083
0.1<
D18S59 + 0.013 0.317
1.5<
D18S476 0.007 0.045
0.1<
D18S1146 0.227 0.083
4.5<
D18S481 0.001 0.108
1.4<
D18S63 0.062 0.034
0.1<
D18S1138 + 3.9 × 104 0.011
0.7<
D18S52 + 1.79 × 106 0.007
9.4<
D18S62 + + 0.141 0.479
18.6<
D18S1150 + + + 0.018 0.096
4.1<
D18S1116 + + + 0.214 0.683
Figure 1.
 
Physical map of the 18p11.31 critical region. The horizontal scale in megabases (M) is at the top. Polymorphic microsatellite markers are labeled above the scale in grey. Below the scale, finished (phase 3) BAC clones are labeled in black lines, working draft (phase 2 or 1) BAC clones are in grey lines, known genes are in dark grey boxes, and in silico predicted genes by GENSCAN (http://genes.mit.edu/GENSCAN.htm) are in light grey boxes.
Figure 1.
 
Physical map of the 18p11.31 critical region. The horizontal scale in megabases (M) is at the top. Polymorphic microsatellite markers are labeled above the scale in grey. Below the scale, finished (phase 3) BAC clones are labeled in black lines, working draft (phase 2 or 1) BAC clones are in grey lines, known genes are in dark grey boxes, and in silico predicted genes by GENSCAN (http://genes.mit.edu/GENSCAN.htm) are in light grey boxes.
Table 2.
 
Subject DNA Samples Used in the Study
Table 2.
 
Subject DNA Samples Used in the Study
Original MYP2 Pedigree-Individual Refractive Error
OD OS
1-15 −10.50 + 2.50 × 82 −11.50 + 2.75 × 97
1-16 −11.00 + 0.75 × 60 −12.25 + 1.00 × 70
1-19 −6.00 + 1.50 × 50 −6.50 + 0.75 × 80
1-21 Plano Plano
1-23 Plano Plano
2-6 −16.00 sph −16.00 sph
2-10 Plano Plano
3-6 −19.25 + 2.25 × 135 −21.00 + 3.00 × 60
4-7 −6.25 sph −6.00 sph
4-8 Plano Plano
5-6 −10.00 + 1.50 × 46 −8.25 + 1.75 × 105
5-9 +0.25 + 0.50 × 170 +0.25 + 0.25 × 170
6-4 −7.25 + 1.25 × 180 −7.25 + 1.25 × 20
6-6 Plano Plano
7-5 −10.75 + 2.00 × 10 −10.50 + 2.50 × 70
External control-1 (C1) Plano Plano
External control-2 (C2) Plano Plano
External control-3 (C3) Plano Plano
External control-4 (C4) Plano Plano
External Myopic control-5 (C5) −9.00 sph −9.00 sph
Figure 2.
 
The associated ∼47.6-kb region of NT_010859 on 18p11.31 of TGIF, showing 10 exons with alternative start sites and splicing that generate eight transcript variants. Boxes: exons; vertical line with arrowhead: initiation codons; vertical line with square: stop codons.
Figure 2.
 
The associated ∼47.6-kb region of NT_010859 on 18p11.31 of TGIF, showing 10 exons with alternative start sites and splicing that generate eight transcript variants. Boxes: exons; vertical line with arrowhead: initiation codons; vertical line with square: stop codons.
Table 3.
 
TGIF Gene Primers Designed for Mutation Screening
Table 3.
 
TGIF Gene Primers Designed for Mutation Screening
Exon Size (bp) Primer Sequence 5′–3′ Primer
1 754 CAGGAAACACAGACCAGCTTATCTT TGIF1F
AATGCAGTCATGCCACTCGATATA TGIF1R
2 249 CCCAAATTGTCTATCGGTGA TGIF2F
ATGACTAGGTTCAAGCCAATG TGIF2R
3 449 TTTTGAGGCTGTTCCCTTTGTTACG TGIF3F
TGGACTTGGCTAATGACTGCGATT TGIF3R
4 632 GAGGCGGCTGTCTCGTGCGGCTAGA TGIF4F
GATCCCAGGCGCCCGCTCCTT TGIF4R
5 662 CCGCCCCCGAGGGACGAGT TGIF5F
AGCCGCTGCCGTTTCAGACGC TGIF5R
6 1061 GTCCCCCGAGTGTTCCGCTGT TGIF6F
CCCACCCCAGACGACTCGC TGIF6R
7 711 CCTCTGAGAAGGTGGGATTCACG TGIF7F
CCTTTGAGCTGGGAGCAATGTCTCT TGIF7R
796 GAATTCCTGCTTTGGGATTGC TGIF7AF
CACAAGCTTCTTTCACGCTATCCAC TGIF7AR
8 329 AGAACGTGCAGGAACAAGGTCG TGIF8F
CACTGCAGTAAAACCACGTTTGCTG TGIF8R
9 361 CTCGCTCTCAGTTGTTGG TGIF9F
TCACGCTCTCTTTCTTTA TGIF9R
562 TCTTCGGGATTGGCTGTATGA TGIF9AF
TCCCCATTTTAACCTATCACCTACT TGIF9AR
10 427 TCAATTAGGTACCCCATAGAACAT TGIF10F
TCCCACACCGACCGACTG TGIF10R
385 TCTGCCATACCACTGTGACTG TGIF10AF
AATATATAAAATAATGCAATTCATCTCTTG TGIF10AR
284 GGGAATGAGAAGATGCTAT TGIF10BF
GGTGAAGGCAAGAGATGAAT TGIF10BR
Figure 3.
 
Polymerase chain reaction β-actin and TGIF amplicons of reverse-transcribed human RNA from ocular tissues and commercially available poly-A RNA tissue types. Lane 1: sclera; lane 2: cornea; lane 3: optic nerve; lane 4: retina; lane 5: lung; lane 6: skeletal muscle; lane 7: heart; lane 8: trachea; lane 9: kidney (lanes 5–9 from BD Biosciences-Clontech, Inc.); lane 10: brain (from Ambion, Inc.).
Figure 3.
 
Polymerase chain reaction β-actin and TGIF amplicons of reverse-transcribed human RNA from ocular tissues and commercially available poly-A RNA tissue types. Lane 1: sclera; lane 2: cornea; lane 3: optic nerve; lane 4: retina; lane 5: lung; lane 6: skeletal muscle; lane 7: heart; lane 8: trachea; lane 9: kidney (lanes 5–9 from BD Biosciences-Clontech, Inc.); lane 10: brain (from Ambion, Inc.).
Table 4.
 
Observed Sequence Polymorphisms in the TGIF Gene
Table 4.
 
Observed Sequence Polymorphisms in the TGIF Gene
NT_010859.13 Position Wild-Type Nucleotide Base Pair Change Observed SNP rs Original MYP2 Family-Individual Exon Position AA Change
3402167 C C→T, T→T Novel 1-23, -15, -16, and -19, 2-10, 5-6, C2 and 3 bp96 of exon 1 5′ UTR
3402386 C C→T rs8092903 C2 Intron 1
3402523 C C→T, T→T Novel 5-6, 7-5, C2 Intron 1
3408219 T C→T Novel 7-5 Intron 2
3437725 C C→T 238137 1-16, 1-21, C2 bp118 of exon 3 5′ UTR
3437871 T C→T rs151472 1-15, 1-19, 4-7, 5-6, 7-5, 1-21, 1-23, 2-10, C2 Intron 3
3440455 C C→A rs238132 4-8, 6-4, C2, -3, and -4 bp284 of exon 5 5′ UTR
3441762 C C→T, T→T rs238533 4-7, 6-4, 4-8, C4 bp172 of exon 6 5′ UTR
3441896 G G→A, A→A Novel 4-7, 6-4, 4-8 bp306 of exon 6 5′ UTR
3442978 C C→T, T→T 2238536 4-7, 6-4, 4-8 bp374 of exon 7 UTR
3442216 C C→C Deletion Novel C1 bp626 of exon 6 frameshift
3442223 T T→T Deletion Novel 3-6, C1 bp633 of exon 6 frameshift
3443789 T G→T Novel 1-16 and 21, 2-6 bp18 of exon 8 5′ UTR
3447539 A G→A, G→G rs2229337 4-7, 6-4, C2, -4, and C5 bp177 of exon 10 NONE
3447598 C C→T Novel 6-6, C1 bp236 of exon 10 PRO→LEU
3447606 C C→T rs4468717 3-6 bp244 of exon 10 PRO→SER
3447607 C C→T, T→T rs2229333 4-7, 6-4, 4-8 bp245 of exon 10 PRO→LEU
3447695 C C→T rs2229335 C1 and -4 bp333 of exon 10 NONE
3447776 T T→G rs2229336 C1 and -4 bp414 of exon 10 3′ UTR
3448161 G G→A Novel 5-9 bp799 of exon 10 3′ UTR
3448260 G G→A Novel 4-7, 5-6 and -9, 6-4, 7-5, C2 bp898 of exon 10 3′ UTR
The authors thank the families for their participation. 
Curtin BJ. The Myopias: Basic Science and Clinical Management. 1985;237–245. Harper and Row New York.
Wang Q, Klein BEK, Klein R, et al. Refractive status in the Beaver Dam Eye Study. Invest Ophthalmol Vis Sci. 1994;35:4344–4347. [PubMed]
Sperduto RD, Siegel D, Roberts J, Rowland M. Prevalence of myopia in the United States. Arch Ophthalmol. 1983;101:405–407. [CrossRef] [PubMed]
Angle J, Wissmann DA. The epidemiology of myopia. Am J Epidemiol. 1980;111:220–228. [PubMed]
Wu HM, Seet B, Yap EP, Saw SM, Lim TH, Chia KS. Does education explain ethnic differences in myopia prevalence?—a population-based study of young adult males in Singapore. Optom Vis Sci. 2001;378:234–239.
Leibowitz HM, Krueger DE, Maunder LR. The Framingham eye study monograph. Surv Ophthalmol. 1980;24(suppl)472–479. [CrossRef]
Katz J, Tielsch JM, Sommer A. Prevalence and risk factors for refractive errors in an adult inner city population. Invest Ophthalmol Vis Sci. 1997;38:334–340. [PubMed]
Burton TC. The influence of refractive error and lattice degeneration on the incidence of RD. Trans Am Ophthalmol Soc. 1990;87:143–155.
Curtin BJ. Myopia: a review of its etiology, pathogenesis, and treatment. Surv Ophthalmol. 1970;15:1–17.
Ghafour IM, Allan D, Foulds WS. Common causes of blindness and visual handicap in the west of Scotland. Br J Ophthalmol. 1983;67:209–213. [CrossRef] [PubMed]
National Advisory Council. Strabismus, Amblyopia and Visual Processing Panel (1999) Vision Research: A National Plan: 1999–2003. 1999; National Institutes of Health Washington, DC.
Young TL, Ronan SM, Drahozal LA, et al. Evidence that a locus for familial high myopia maps to chromosome 18p. Am J Hum Genet. 1998;63:109–119. [CrossRef] [PubMed]
Spielman RS, McGinis RE, Ewens WJ. Transmission test for linkage disequilibrium: the insulin gene region and insulin-dependent diabetes mellitus (IDDM). Am J Hum Genet. 1993;52:506–516. [PubMed]
S. A. G. E. Statistical Analysis for Genetic Epidemiology, Release 3.1. Available from the Department of Epidemiology and Biostatistics, Rammelkamp Center for Education and Research, MetroHealth Campus. 1997; Case Western Reserve University Cleveland, OH.
Pratt SC, Daly MJ, Kruglyak L. Exact multi-point quantitative-trait linkage analysis in pedigrees by variance components. Am J Hum Genet. 2000;66:1153–1157. [CrossRef] [PubMed]
Young TL, Atwood LD, Ronan SM, et al. Further refinement of the MYP2 locus for autosomal dominant high myopia by linkage disequilibrium analysis. Ophthalmic Genet. 2001;22:69–75. [CrossRef] [PubMed]
Heath SC, Robeldo R, Beggs W, et al. A novel approach to search for identity by descent in small samples of patients and controls from the same Mendelian breeding unit: a pilot study on myopia. Hum Hered. 2001;52:183–190. [CrossRef] [PubMed]
Lam D, Leung Y, Fan D, Baum L, Tam P, Pang C. To locate a gene for familial myopia by linkage analysis (abstract). Clin Exp Ophthalmol. 2002;30(suppl)480.Abstract nr 273
Wotton D, Lo RS, Swaby LAC, Massague J. Multiple modes of repression by the Smad transcriptional corepressor TGIF. J Biol Chem. 1999;274:37105–37110. [CrossRef] [PubMed]
Wotton D, Lo RS, Lee S, Massague J. A Smad transcriptional corepressor. Cell. 1999;97:29–39. [CrossRef] [PubMed]
Bertolino E, Reimund B, Wildt-Perinic D, Clerc RG. A novel homeobox protein which recognizes a TGT core and function interferes with a retinoid-responsive motif. J Biol Chem. 1995;52:31178–31188.
Overhauser J, Mitchell HF, Zackai EH, Tick DB, Rojas K, Muenke M. Physical mapping of the holoprosencephaly critical region in 19p11.3. Am J Hum Genet. 1995;5:1080–1085.
Muenke M, Beachy PA. Genetics of ventral forebrain development and holoprosencephaly. Curr Opin Genet Dev. 2000;10:262–269. [CrossRef] [PubMed]
Gripp KW, Wotton D, Edwards MC, et al. Mutations in TGIF cause holoprosencephaly and link NODAL signaling to human neural axis determination. Nat Genet. 2000;25:205–208. [CrossRef] [PubMed]
Chen C-P, Chern S-R, Du S-H, Wang W. Molecular diagnosis of a novel heterozygous 268C→T (R90C) mutation in TGIF gene in a fetus with holoprosencephaly and premaxillary agenesis. Prenat Diagn. 2002;22:5–7. [CrossRef] [PubMed]
Lam DSC, Lee WS, Leung YF, et al. TGFB-induced factor: A candidate gene for high myopia. Invest Ophthalmol Vis Sci. 2003;44:1012–1015. [CrossRef] [PubMed]
Figure 1.
 
Physical map of the 18p11.31 critical region. The horizontal scale in megabases (M) is at the top. Polymorphic microsatellite markers are labeled above the scale in grey. Below the scale, finished (phase 3) BAC clones are labeled in black lines, working draft (phase 2 or 1) BAC clones are in grey lines, known genes are in dark grey boxes, and in silico predicted genes by GENSCAN (http://genes.mit.edu/GENSCAN.htm) are in light grey boxes.
Figure 1.
 
Physical map of the 18p11.31 critical region. The horizontal scale in megabases (M) is at the top. Polymorphic microsatellite markers are labeled above the scale in grey. Below the scale, finished (phase 3) BAC clones are labeled in black lines, working draft (phase 2 or 1) BAC clones are in grey lines, known genes are in dark grey boxes, and in silico predicted genes by GENSCAN (http://genes.mit.edu/GENSCAN.htm) are in light grey boxes.
Figure 2.
 
The associated ∼47.6-kb region of NT_010859 on 18p11.31 of TGIF, showing 10 exons with alternative start sites and splicing that generate eight transcript variants. Boxes: exons; vertical line with arrowhead: initiation codons; vertical line with square: stop codons.
Figure 2.
 
The associated ∼47.6-kb region of NT_010859 on 18p11.31 of TGIF, showing 10 exons with alternative start sites and splicing that generate eight transcript variants. Boxes: exons; vertical line with arrowhead: initiation codons; vertical line with square: stop codons.
Figure 3.
 
Polymerase chain reaction β-actin and TGIF amplicons of reverse-transcribed human RNA from ocular tissues and commercially available poly-A RNA tissue types. Lane 1: sclera; lane 2: cornea; lane 3: optic nerve; lane 4: retina; lane 5: lung; lane 6: skeletal muscle; lane 7: heart; lane 8: trachea; lane 9: kidney (lanes 5–9 from BD Biosciences-Clontech, Inc.); lane 10: brain (from Ambion, Inc.).
Figure 3.
 
Polymerase chain reaction β-actin and TGIF amplicons of reverse-transcribed human RNA from ocular tissues and commercially available poly-A RNA tissue types. Lane 1: sclera; lane 2: cornea; lane 3: optic nerve; lane 4: retina; lane 5: lung; lane 6: skeletal muscle; lane 7: heart; lane 8: trachea; lane 9: kidney (lanes 5–9 from BD Biosciences-Clontech, Inc.); lane 10: brain (from Ambion, Inc.).
Table 1.
 
MYP2 Locus Marker Recombinants and TDT Allelic Association Analysis
Table 1.
 
MYP2 Locus Marker Recombinants and TDT Allelic Association Analysis
Marker Distance (cM) Pedigree Marker (Telomere) 1 4 5 SAGE-TDTEX P GH2-TDT P
D18S1140 + 0.036 0.083
0.1<
D18S59 + 0.013 0.317
1.5<
D18S476 0.007 0.045
0.1<
D18S1146 0.227 0.083
4.5<
D18S481 0.001 0.108
1.4<
D18S63 0.062 0.034
0.1<
D18S1138 + 3.9 × 104 0.011
0.7<
D18S52 + 1.79 × 106 0.007
9.4<
D18S62 + + 0.141 0.479
18.6<
D18S1150 + + + 0.018 0.096
4.1<
D18S1116 + + + 0.214 0.683
Table 2.
 
Subject DNA Samples Used in the Study
Table 2.
 
Subject DNA Samples Used in the Study
Original MYP2 Pedigree-Individual Refractive Error
OD OS
1-15 −10.50 + 2.50 × 82 −11.50 + 2.75 × 97
1-16 −11.00 + 0.75 × 60 −12.25 + 1.00 × 70
1-19 −6.00 + 1.50 × 50 −6.50 + 0.75 × 80
1-21 Plano Plano
1-23 Plano Plano
2-6 −16.00 sph −16.00 sph
2-10 Plano Plano
3-6 −19.25 + 2.25 × 135 −21.00 + 3.00 × 60
4-7 −6.25 sph −6.00 sph
4-8 Plano Plano
5-6 −10.00 + 1.50 × 46 −8.25 + 1.75 × 105
5-9 +0.25 + 0.50 × 170 +0.25 + 0.25 × 170
6-4 −7.25 + 1.25 × 180 −7.25 + 1.25 × 20
6-6 Plano Plano
7-5 −10.75 + 2.00 × 10 −10.50 + 2.50 × 70
External control-1 (C1) Plano Plano
External control-2 (C2) Plano Plano
External control-3 (C3) Plano Plano
External control-4 (C4) Plano Plano
External Myopic control-5 (C5) −9.00 sph −9.00 sph
Table 3.
 
TGIF Gene Primers Designed for Mutation Screening
Table 3.
 
TGIF Gene Primers Designed for Mutation Screening
Exon Size (bp) Primer Sequence 5′–3′ Primer
1 754 CAGGAAACACAGACCAGCTTATCTT TGIF1F
AATGCAGTCATGCCACTCGATATA TGIF1R
2 249 CCCAAATTGTCTATCGGTGA TGIF2F
ATGACTAGGTTCAAGCCAATG TGIF2R
3 449 TTTTGAGGCTGTTCCCTTTGTTACG TGIF3F
TGGACTTGGCTAATGACTGCGATT TGIF3R
4 632 GAGGCGGCTGTCTCGTGCGGCTAGA TGIF4F
GATCCCAGGCGCCCGCTCCTT TGIF4R
5 662 CCGCCCCCGAGGGACGAGT TGIF5F
AGCCGCTGCCGTTTCAGACGC TGIF5R
6 1061 GTCCCCCGAGTGTTCCGCTGT TGIF6F
CCCACCCCAGACGACTCGC TGIF6R
7 711 CCTCTGAGAAGGTGGGATTCACG TGIF7F
CCTTTGAGCTGGGAGCAATGTCTCT TGIF7R
796 GAATTCCTGCTTTGGGATTGC TGIF7AF
CACAAGCTTCTTTCACGCTATCCAC TGIF7AR
8 329 AGAACGTGCAGGAACAAGGTCG TGIF8F
CACTGCAGTAAAACCACGTTTGCTG TGIF8R
9 361 CTCGCTCTCAGTTGTTGG TGIF9F
TCACGCTCTCTTTCTTTA TGIF9R
562 TCTTCGGGATTGGCTGTATGA TGIF9AF
TCCCCATTTTAACCTATCACCTACT TGIF9AR
10 427 TCAATTAGGTACCCCATAGAACAT TGIF10F
TCCCACACCGACCGACTG TGIF10R
385 TCTGCCATACCACTGTGACTG TGIF10AF
AATATATAAAATAATGCAATTCATCTCTTG TGIF10AR
284 GGGAATGAGAAGATGCTAT TGIF10BF
GGTGAAGGCAAGAGATGAAT TGIF10BR
Table 4.
 
Observed Sequence Polymorphisms in the TGIF Gene
Table 4.
 
Observed Sequence Polymorphisms in the TGIF Gene
NT_010859.13 Position Wild-Type Nucleotide Base Pair Change Observed SNP rs Original MYP2 Family-Individual Exon Position AA Change
3402167 C C→T, T→T Novel 1-23, -15, -16, and -19, 2-10, 5-6, C2 and 3 bp96 of exon 1 5′ UTR
3402386 C C→T rs8092903 C2 Intron 1
3402523 C C→T, T→T Novel 5-6, 7-5, C2 Intron 1
3408219 T C→T Novel 7-5 Intron 2
3437725 C C→T 238137 1-16, 1-21, C2 bp118 of exon 3 5′ UTR
3437871 T C→T rs151472 1-15, 1-19, 4-7, 5-6, 7-5, 1-21, 1-23, 2-10, C2 Intron 3
3440455 C C→A rs238132 4-8, 6-4, C2, -3, and -4 bp284 of exon 5 5′ UTR
3441762 C C→T, T→T rs238533 4-7, 6-4, 4-8, C4 bp172 of exon 6 5′ UTR
3441896 G G→A, A→A Novel 4-7, 6-4, 4-8 bp306 of exon 6 5′ UTR
3442978 C C→T, T→T 2238536 4-7, 6-4, 4-8 bp374 of exon 7 UTR
3442216 C C→C Deletion Novel C1 bp626 of exon 6 frameshift
3442223 T T→T Deletion Novel 3-6, C1 bp633 of exon 6 frameshift
3443789 T G→T Novel 1-16 and 21, 2-6 bp18 of exon 8 5′ UTR
3447539 A G→A, G→G rs2229337 4-7, 6-4, C2, -4, and C5 bp177 of exon 10 NONE
3447598 C C→T Novel 6-6, C1 bp236 of exon 10 PRO→LEU
3447606 C C→T rs4468717 3-6 bp244 of exon 10 PRO→SER
3447607 C C→T, T→T rs2229333 4-7, 6-4, 4-8 bp245 of exon 10 PRO→LEU
3447695 C C→T rs2229335 C1 and -4 bp333 of exon 10 NONE
3447776 T T→G rs2229336 C1 and -4 bp414 of exon 10 3′ UTR
3448161 G G→A Novel 5-9 bp799 of exon 10 3′ UTR
3448260 G G→A Novel 4-7, 5-6 and -9, 6-4, 7-5, C2 bp898 of exon 10 3′ UTR
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×