March 2005
Volume 46, Issue 3
Free
Cornea  |   March 2005
Increased Levels of Catalase and Cathepsin V/L2 but Decreased TIMP-1 in Keratoconus Corneas: Evidence that Oxidative Stress Plays a Role in This Disorder
Author Affiliations
  • M. Cristina Kenney
    From the Department of Ophthalmology, University of California Irvine, Medical Center, Irvine, California; the
    Cedars-Sinai Medical Center, Los Angeles, California.
  • Marilyn Chwa
    From the Department of Ophthalmology, University of California Irvine, Medical Center, Irvine, California; the
  • Shari R. Atilano
    From the Department of Ophthalmology, University of California Irvine, Medical Center, Irvine, California; the
  • Annie Tran
    From the Department of Ophthalmology, University of California Irvine, Medical Center, Irvine, California; the
  • Marilee Carballo
    From the Department of Ophthalmology, University of California Irvine, Medical Center, Irvine, California; the
  • Mehrnoosh Saghizadeh
    Jules Stein Eye Institute, University of California at Los Angeles, Los Angeles, California;
  • Vasilis Vasiliou
    Molecular Toxicology and Environmental Health Sciences Program, University of Colorado Health Sciences Center, Denver, Colorado; the
  • Wakako Adachi
    Department of Ophthalmology, Kyoto Prefectural University of Medicine, Kyoto, Japan; and
  • Donald J. Brown
    From the Department of Ophthalmology, University of California Irvine, Medical Center, Irvine, California; the
Investigative Ophthalmology & Visual Science March 2005, Vol.46, 823-832. doi:10.1167/iovs.04-0549
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to Subscribers Only
      Sign In or Create an Account ×
    • Get Citation

      M. Cristina Kenney, Marilyn Chwa, Shari R. Atilano, Annie Tran, Marilee Carballo, Mehrnoosh Saghizadeh, Vasilis Vasiliou, Wakako Adachi, Donald J. Brown; Increased Levels of Catalase and Cathepsin V/L2 but Decreased TIMP-1 in Keratoconus Corneas: Evidence that Oxidative Stress Plays a Role in This Disorder. Invest. Ophthalmol. Vis. Sci. 2005;46(3):823-832. doi: 10.1167/iovs.04-0549.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

purpose. The mRNA levels of antioxidant enzymes, matrix metalloproteinases, cathepsin V/L2, and tissue inhibitor of matrix metalloproteinases (TIMPs) were determined in keratoconus and normal corneas. Protein levels or enzyme activities were analyzed when RNA levels were different.

methods. A total of 25 physiologic (normal) and 32 keratoconus corneas were studied. mRNAs were analyzed by semiquantitative reverse transcription–polymerase chain reaction and Southern blot analysis. Proteins were assessed by immunohistochemistry and/or Western blot analysis. Catalase activity was measured in corneal extracts. Antioxidant enzymes examined were catalase, superoxide dismutase (SOD)-1, SOD3, glutathione reductase, glutathione S-transferase and aldehyde dehydrogenase 3A1. Degradative enzymes examined were cathepsin V/L2 and matrix metalloproteinase (MMP)-1, -2, -7, -9, and -14. Tissue inhibitor of matrix metalloproteinase (TIMP)-1, -2, and -3 were also examined.

results. Keratoconus corneas exhibited a 2.2-fold increase of catalase mRNA level (P < 0.01) and 1.8-fold of enzyme activity (P < 0.03); a 1.5-fold increase of cathepsin V/L2 mRNA (P < 0.03) and abnormal protein distribution; and a 1.8-fold decrease of TIMP-1 mRNA (P < 0.05) and 2.8-fold decrease of protein (P < 0.0001) compared with normal (physiologic) corneas. RNA levels for other antioxidant and degradative enzymes were similar between normal and keratoconus corneas.

conclusions. Keratoconus corneas have elevated levels of cathepsins V/L2, -B, and -G, which can stimulate hydrogen peroxide production, which, in turn, can upregulate catalase, an antioxidant enzyme. In addition, decreased TIMP-1 and increased cathepsin V/L2 levels may play a role in the matrix degradation that is a hallmark of keratoconus corneas. The findings support the hypothesis that keratoconus corneas undergo oxidative stress and tissue degradation.

Keratoconus (KC) is a significant clinical problem worldwide and a leading indication for corneal transplantation. 1 2 3 KC corneas have significant thinning that leads to keratometric steepening and irregular astigmatism. The onset is usually in the teens to early twenties, after which it can progress to cause moderate to severe vision loss. 2 The reported incidence of KC is approximately 1 in 2000 in the general population, but is 300 times higher in patients with Down syndrome. 1 2 4  
Studies suggest that oxidative stress is involved in KC. 5 6 7 8 9 KC corneas have increased levels of inducible nitric oxide synthase (iNOS), nitrotyrosine (a marker for peroxynitrite, ONOO), malondialdehyde (MDA), 9 and glutathione S-transferase, 6 and decreased activities of extracellular superoxide dismutase (SOD3, EC-SOD) 8 and aldehyde dehydrogenase class 3 (ALDH3A1). 5 These types of abnormalities are associated with elevated levels of superoxide radicals (O2 ), hydrogen peroxide (H2O2) and hydroxyl radicals (OH), commonly referred to as reactive oxygen species (ROS; Fig. 1 ). The accumulation of ROS can greatly damage cells by reacting with proteins, DNA, and membrane phospholipids. Normally, the cornea’s natural antioxidant enzymes eliminate the ROS before they damage cells. These include SODs, catalase, glutathione reductase, and glutathione peroxidase (Fig. 1) . Although antioxidant activities and protein levels have been examined in normal and keratoconus corneas 5 6 8 the mRNA levels for these enzymes have not been studied in KC corneas. 
Cells can also be damaged from aldehydes formed during ROS-mediated lipid peroxidation. 10 11 12 13 Aldehydes are relatively stable compared with free radicals and can diffuse to attack distant target sites. These aldehydes are highly reactive and can covalently interact with proteins and DNA to form adducts that alter signal transduction, gene expression, and proliferation. Glutathione S-transferase and ALDH3A1, which are abundant in the human cornea, detoxify aldehydes by GSH-conjugation and oxidation to their corresponding acids, 5 6 14 15 16 respectively, thereby protecting the cornea from lipid peroxidation damage (Fig. 1)
Aldehydes disrupt the membranes of lysosomes and cells releasing lysosomal proteolytic enzymes, including cathepsins. 17 Studies have demonstrated that KC corneas have increased levels of cathepsin B and -G, and lysosomal enzymes (acid esterases, acid phosphatases, and acid lipases). 18 19 20 21 These cathepsins can increase hydrogen peroxide production and oxidative stress and mediate apoptosis. 22 23 24 25 26 More recently, the basement membrane–associated cathepsin V/L2 has been detected in normal human corneas (Adachi W, et al. IOVS 1999;40:ARVO Abstract 2063). 27 28 Although epithelial basement membrane disruption is a hallmark of keratoconus, the expression and distribution of cathepsin V/L2 have not been determined in KC corneas. 
Although KC corneas do not have extensive scarring 29 30 or inflammatory cell infiltrates, 20 considerable degradation of the extracellular matrix occurs. Increased gelatinase–matrix metalloproteinase (MMP) activities are found in KC corneas. 31 32 33 Recent investigations show relationships between ROS, antioxidant enzymes, and MMPs. For example, HT-1080 fibrosarcoma cells that overexpress SOD2 had increased RNA levels of MMP-2, -3, -7, -9, -10, and -11. 34 In cultured human dermal fibroblasts, ROS increased MMP-1 RNA, 35 induced MMP-2 RNA, and decreased tissue inhibitor of metalloproteinase (TIMP)-2 RNA levels 36 leading to increased gelatinase activity of the MMPs. 37 In cultured human corneal fibroblasts, the addition of exogenous peroxynitrite (ONOO), known to be elevated in KC corneas, 9 resulted in upregulation of MMP-2 RNA levels and loss of TIMP-1 immunostaining. 38 Although KC corneas have evidence of increased ROS production, cytotoxic by-products, and gelatinase activity, 9 31 32 33 the RNA levels of the MMPs or TIMPs have not been studied. 
In this investigation, the RNA levels, protein distribution, and activity for various antioxidant enzymes, degradative enzymes, and TIMP inhibitors were analyzed. KC corneas had twofold increases of RNA and enzyme activity for catalase, the major antioxidant enzyme that eliminates hydrogen peroxide, a key element of oxidative stress. 30 31 32 33 34 35 36 37 38 39 40 41 Moreover, in addition to the elevated levels of cathepsin B and -G, 18 19 21 we demonstrate an upregulation and abnormal protein distribution for cathepsin V/L2. These cathepsins can stimulate hydrogen peroxide, which in turn can upregulate catalase, 39 42 cause oxidative damage, and induce apoptosis. 22 23 43 Finally, lower levels of the inhibitor TIMP-1 and increased cathepsin V/L2 provide causative mechanisms by which stromal and basement membrane degradation might occur in keratoconus corneas. 
Materials and Methods
Isolation of RNA and Protein from Normal and Keratoconus Corneas
Normal human corneas (n = 8) were obtained from the National Disease Research Institute (NDRI) within 24 hours of death. Keratoconus corneas (n = 12) were collected from ophthalmologists within 24 hours after surgery. The study was approved by the institutional review boards of University of California Irvine and Cedars-Sinai Medical Center. Informed consents were obtained from participants and the study was performed according to the tenets of the Declaration of Helsinki for research involving human subjects. Corneas were snap frozen and stored at −70°C until use. Care was taken to handle tissues gently to ensure that epithelium and endothelium would remain intact. Based on histology of frozen tissues, <1 in 20 corneas lose epithelium or endothelium during processing. Therefore, although it is possible that a small fraction of tissues used in this study may not represent intact corneas, we believe most specimens accurately represent the human cornea. Moreover, we analyzed a large number of specimens and used corroborating techniques such as Western blot analysis, immunohistochemistry, and activity assays to verify our RNA results. Finally, similar RNA isolation and RT-PCR methods have been applied successfully in other corneal studies. 44 45 46 It should be noted that in studies of human diseases, there is often individual variation that may be due to the heterogeneity or severity of the disease. This is a drawback of any human corneal tissue investigation. Therefore, we always examine larger number of corneas, do not pool samples and study multiple parameters (i.e., levels of RNA, protein and/or activities). 
The corneas were pulverized individually to a fine powder under liquid nitrogen with the use of a mortar and pestle. One milliliter of extraction reagent (TRIzol; Invitrogen, Carlsbad, CA) was added to the powder, and the sample was warmed to room temperature and homogenized. Chloroform (0.2 mL) was added, and the samples were centrifuged at 11,000 rpm for 15 minutes at 4°C to separate the aqueous and organic phases. Isopropanol (0.5 mL) was added to the aqueous phase for 10 minutes at room temperature to precipitate the RNA. Samples were centrifuged at 11,000 rpm for 15 minutes at 4°C. Pellets were washed with 75% ethanol, dried in a vacuum, and resuspended in RNase-free water. The yield of RNA was estimated by optical density at 260/280 nm. 
The protein was recovered from the organic phase by the addition of 0.3 mL 100% ethanol for 3 minutes at room temperature and then centrifugation at 2000 rpm for 5 minutes at 4°C. Isopropanol (1.5 mL) was added to the supernatant for 10 minutes at room temperature followed by centrifugation at 11,000 rpm for 10 minutes at 4°C. The protein pellets were washed three times in 0.3 M guanidine hydrochloride in 95% ethanol. Pellets were dried in a vacuum and stored at −70°C until further use. 
Reverse Transcription–Polymerase Chain Reaction Analysis
For these experiments, RNA samples from individual corneas were isolated, and the samples were not pooled together (8 normal and 12 KC). Two micrograms of RNA were reverse transcribed in an 80-μL reaction volume containing 500 μM dNTPs, 2.5 μM random hexamer primers, 20 U RNase inhibitor, and 200 U reverse transcriptase (SuperScript II; Invitrogen). Reactions were performed for 10 minutes at 25°C, 45 minutes at 42°C, and 5 minutes at 95°C, followed by cooling to 4°C. cDNA samples were subjected to PCR using specific primers (Table 1) . Primers were designed by computer (Primer 3 Internet software program; Whitehead Institute, Cambridge, MA), and their specificities were confirmed by a BLAST Internet software-assisted search of nonredundant nucleotide sequence database (National Library of Medicine, Bethesda, MD). 
Polymerase chain reactions (PCR) were performed with 5 to 25 ng of reverse-transcribed RNA, Taq polymerase buffer (200 μM deoxyribonucleoside triphosphates, 1.25 U Taq polymerase (Promega Biotech, Madison, WI), and 250 nM forward and reverse primers in a total volume of 50 μL. The conditions for the PCR reactions are described in Table 1 . For semiquantitative PCR, samples were amplified in the linear range, which was established by using serial cDNA dilutions and varying the number of cycles. Amplified products were separated by electrophoresis in 2% agarose gels and visualized under ultraviolet light after staining with ethidium bromide. All samples were normalized to β2-microglobulin (β2MG) amplification. Routine PCR control analyses without reverse transcriptase (water control) or with normal human genomic DNA as a template were negative. Blots were scanned by densitometry with phosphorimaging (Typhoon; Molecular Dynamics, Sunnyvale, CA) and bands were standardized to β2MG levels. Statistical analysis results were analyzed with the nonparametric Mann-Whitney test (InStat software program; GraphPad Software, San Diego, CA). 
Attempts to perform RT-PCR for glutathione peroxidase were not successful, but immunohistochemistry with specific antibody was performed. 
Southern Blot Analysis
PCR products were transferred from 2% agarose gels to positively charged nylon membranes (Hybond N+; Amersham, Arlington Heights, IL) using an alkaline blot procedure. Membranes were hybridized (Table 1)with oligonucleotide probes 5′-end labeled with [γ-32P] adenosine triphosphate (222 TBq/mmol; NEN, Boston, MA), washed at high stringency, and exposed to x-ray film (X-OMAT AR; Eastman Kodak, Rochester, NY). Blots were scanned by densitometry with phosphorimaging (Typhoon; Molecular Dynamics), and bands were standardized to β2MG levels. 
Immunohistochemistry
Normal corneas (n = 10) were obtained from NDRI within 24 hours of death. KC corneas (n = 10) were obtained within 24 hours after a corneal transplantation. On arrival in the laboratory, tissues were rinsed thoroughly in cold phosphate-buffered saline (pH 7.2) and embedded in OCT compound (Tissue-Tek; Sakura Finetec, Torrance, CA) before freezing in liquid nitrogen. Five-micrometer tissue sections were cut with a cryostat (Leica, Deerfield, IL), mounted onto microscope slides, and stored at −80°C until further use. 
Immunohistochemistry was performed with the polyclonal antibodies to SOD1 (1:10 dilution; 20 μg/mL; Santa Cruz Biotechnology, Inc., Santa Cruz, CA), catalase (1:500 dilution; Chemicon International, Temecula, CA), glutathione peroxidase (GPX; U.S. Biological, Swampscott, MA), and cathepsin V/L2 (a gift from Drs. Adachi, Ljubimov and Kinoshita). A monoclonal antibody to ALDH3A1 (1:20 dilution) was also used for immunohistochemical staining. 47 Rhodamine-conjugated secondary antibodies were from Chemicon International. 
Tissue sections were thawed and incubated in phosphate-buffered saline (PBS) for 15 minutes. Primary antibody was applied to the tissue and incubated in a humidified chamber for 1 hour. Tissues were washed with PBS and incubated in 50 μL of the appropriate secondary antibody for 1 hour in a humidified, dark chamber. Sections were washed again with PBS and mounted with glycerol/PBS (1:1). The slides were examined and photographed using a fluorescence microscope (Leica) with an attached digital camera. Controls included the use of secondary antibodies only, with available blocking peptides (SOD1) added to the primary antibodies. 
Western Blot Analysis
From normal (n = 8) and KC (n = 12) corneal extractions, equal amounts of protein, as determined by the bicinchoninic acid (BCA) protein assay kit (Pierce, Rockford, IL), were electrophoresed on precast 4% to 20% Tris-glycine sodium dodecyl sulfate polyacrylamide (SDS-PAGE) gels (Invitrogen). The samples were electrophoresed under nonreduced and reduced (3% dithiothreitol) conditions. Proteins were transferred to polyvinylidene difluoride membrane (Bio-Rad, Hercules, CA) and probed with a monoclonal TIMP-1 antibody (Chemicon International). The blots were blocked overnight with 5% bovine serum albumin, Tris saline, and 0.5% Tween 20. Primary antibody (1 μg/mL) was applied and incubated at 4°C overnight. Blots were washed with Tween and Tris-buffered saline (TTBS) and incubated for 1 hour with alkaline phosphatase–conjugated goat anti-mouse IgG antibody for TIMP-1 (1:5000). Blots were developed with chemiluminescent substrate solution (Immuno-Star; Bio-Rad, Hercules, CA). The densities of the Coomassie blue–stained SDS-PAGE gel and the TIMP-1 Western blot were scanned to standardize the levels of TIMP-1 to total protein. Statistical analysis results were analyzed with the Mann-Whitney test (InStat software program; GraphPad Software). 
Catalase Activity Assay
Normal (n = 7) and keratoconus (n = 10) frozen corneas were pulverized to a fine powder in liquid nitrogen and extraction buffer (0.1 M potassium phosphate [pH 7.7] and 0.2% Triton X-100) was added. Samples were centrifuged at 12,000 rpm at 4°C for 15 minutes. Protein concentrations were measured by a BCA protein assay kit (Pierce). Catalase activity was measured according to the manufacturer’s protocol (an Amplex Red Catalase kit; Molecular Probes, Eugene, OR). Briefly, catalase standards and 2 μg of each sample (total protein) were incubated in 40 μM H2O2 solution, followed by incubation with 100 μM of nonfluorescent reagent (Amplex Red; Molecular Probes) containing 0.4 U/mL horseradish peroxidase (HRP) at 37°C for 30 minutes. At the end of incubation, fluorescence intensity was measured with a laser-based scanning system (FMBIOIII; Hitachi, Yokohama, Japan) with excitation at 535 nm and emission at 590 nm. Statistical analysis was performed with the unpaired Student’s t-test (one-tailed). 
Results
Semiquantitative RT-PCR was performed with specific primers for six antioxidant enzymes, six degradative enzymes, and three TIMPs (Table 1) . All samples were amplified in a linear range established with serial cDNA dilution and varied number of cycles. The gels were scanned, normalized to β2MG and three genes—catalase, cathepsin V/L2, and TIMP-1—appeared to have altered expression. In those cases, further analyses by Southern blot analysis, Western blot analysis, immunohistochemistry, and/or enzyme activity assays were pursued. These results are presented in Figures 2 3 and 4
Catalase
Figure 2shows the catalase mRNA levels, activity, and protein distribution in KC corneas. Semiquantitative RT-PCR showed that after being standardized to β2MG, catalase RNA levels appeared to be increased in KC corneas (n = 8) compared with normal corneas (n = 8; Fig. 2A ). The blots were scanned, and statistical analysis of the results showed that the KC corneas (0.167 ± 0.02) had a 2.2-fold increase of catalase mRNA compared with age-matched normal corneas (0.076 ± 0.01; P < 0.01). Southern blot analysis with a labeled internal oligonucleotide specific for catalase (Table 1)was performed to confirm specificity of the product (Fig. 2B) . Whereas these results indicate alterations in the level of mRNA for catalase, it was possible that the level of catalase activity would not be similarly changed. Therefore, to assess the level of enzyme activity, a fluorescent substrate assay was used and the mean ± SEM was calculated. Extracts of normal (n = 7) and KC (n = 10) corneas showed an approximate 1.8-fold increase of catalase activity (P < 0.03) in KC corneas (216.0 ± 37.1 mU catalase activity/μg protein) when compared with normal corneas (120.8 ± 14.6 mU catalase activity/μg protein; Fig. 2C ). Within the KC group, the catalase activity levels showed large variations with the range from 94 to 448 mU catalase activity/μg protein. This higher activity level in KC corneas correlated well with the apparent increase in the level of catalase mRNA. Immunohistochemistry with an antibody specific to catalase was performed to determine whether the distribution of the protein was changed in KC corneas. Figure 2Dshowed that the catalase localized mainly to epithelial cells with slight staining of the keratocytes and endothelium. The catalase staining patterns for normal and KC corneas were similar to each other. 
Cathepsin V/L2
Figure 3shows the increased mRNA levels and altered protein distribution for cathepsin V/L2 in KC corneas. Semiquantitative RT-PCR (Fig. 3A)was performed followed by Southern blot analysis (Fig. 3B)using specific primers and oligonucleotides for cathepsin V/L2 (Table 1) . After normalization to the intensity values of β2MG, the cathepsin V/L2 RNA levels in KC corneas (1.48 ± 0.26) were increased ∼1.5-fold compared with age-matched normal corneas (0.97 ± 0.33; P < 0.03). To determine the protein distribution, immunohistochemistry was performed with an antibody specific for cathepsin V/L2 (Fig. 3C) . In normal corneas, cathepsin V/L2 was found primarily in association with the epithelial basement membrane (Adachi W, et al. IOVS 1999;40:ARVO Abstract 2063). 27 In KC corneas, increased staining with cathepsin V/L2 antibody was observed and the pattern of staining was variable. Some KC corneas had cathepsin V/L2-positive epithelial cells, other corneas showed staining of stromal cells, and still others had increased staining of the epithelial basement membrane. These data suggest that there is an increase and redistribution of cathepsin V/L2 expression in KC corneas. 
Tissue Inhibitor of Matrix Metalloproteinase-1
Figure 4shows decreased TIMP-1 mRNA and protein levels in KC corneas. Semiquantitative RT-PCR (Fig. 4A)and Southern blot (Fig. 4B)analyses were performed with TIMP-1 primers and oligonucleotides (Table 1) . The TIMP-1 mRNA levels (Fig. 4A)were decreased 1.8-fold in KC corneas (0.85 ± 0.42) compared with normal corneas (1.49 ± 0.40; P < 0.05). Western blot analyses of normal (n = 8) and KC (n = 12) corneal extracts were performed to determine whether the altered RNA expression for TIMP-1 was reflected at the protein level (Figs. 4C 4D) . The SDS-PAGE gel stained with Coomassie blue showed that equivalent amounts of protein were loaded in each lane (Fig. 4C) . Representative Western blot analysis showed that the TIMP-1 band migrating as a 28-kDa protein was decreased in KC corneas compared with normal corneas (Fig. 4D) . Quantitation of the band intensities revealed that levels of TIMP-1 protein per total protein in KC corneas (0.249 ± 0.088) were decreased 2.8-fold compared to normal corneas (0.694 ± 0.212, P < 0.0001), again correlating well with the RT-PCR results. As a control, some Western blot analyses were blocked with the recombinant TIMP-1 protein, which revealed the absence of the 28-kDa band (data not shown). Immunohistochemistry was not performed in this study because TIMP-1 protein distribution is reportedly similar in KC corneas and normal corneas. 48  
SOD1, ALDH3A1, and SOD3
Previous studies reported alterations in various activities of different antioxidant enzymes in KC corneas 5 6 8 but RNA levels and/or protein distributions were not examined. Figures 5A and 5Bshowed RNA levels and protein distributions for SOD1 (CuZn-SOD) and ALDH3A1 were similar between KC corneas and normal corneas. Anti-SOD1 antibody stained the cytoplasm of epithelial cells, endothelial cells, and a few of the keratocytes (Fig. 5B) . A monoclonal antibody to ALDH3A1 showed immunoreactivity in epithelial cells and keratocytes but not endothelial cells. Although EC-SOD (SOD3) enzyme activities are reportedly lower in KC corneas, 8 the RNA levels were similar as determined by RT-PCR (Fig. 5A) . Immunohistochemistry was not performed for EC-SOD (SOD3) since no antibody was commercially available. 
KC corneas have elevated levels of catalase, an antioxidant enzyme that eliminates hydrogen peroxide. 39 42 This prompted us to examine a second antioxidant enzyme known to act on hydrogen peroxide, GPX. Attempts to perform RT-PCR for GPX were not successful but immunohistochemistry with a GPX-specific antibody (Fig. 5B)showed similar positive staining of the epithelial cells, keratocytes, and endothelial cells in both KC and normal corneas. 
By semiquantitative RT-PCR, the RNA levels for glutathione reductase (GTR), glutathione S-transferase (GST-pi), MMP-2, MMP-14, TIMP-2, and TIMP-3 were similar between normal and KC corneas (data not shown). The RT-PCR reactions for MMP-7 and MMP-1 resulted in detectable but very low levels of reaction products that could not be quantified. Unfortunately, the primers for MMP-9 yielded only nonspecific bands from the RT-PCR reaction. 
Discussion
The findings in this study support our hypothesis that oxidative stress and tissue degradation are ongoing processes in KC corneas. Hydrogen peroxide (H2O2) is a key element in oxidative damage associated with a variety of diseases. High levels of H2O2 are a signal for upregulation of catalase. Cathepsins can increase H2O2 production, cleave Bid, cause release of cytochrome c, and initiate apoptosis. 22 23 43 49 50 In addition, cathepsins can degrade extracellular matrix and destabilize cell membranes. 18 51 52 53 Our data, along with others, show that KC corneas have increased catalase, cathepsins, lipid peroxidation related-aldehydes, nitric oxide pathway abnormalities, degradative enzymes, and decreased enzyme inhibitor levels, all of which are important elements for oxidative damage and matrix degradation within tissues. 
Catalase
Catalase is an important enzyme in the elimination of H2O2 from tissues (Fig. 1) . Catalase activity has been reported in experimental corneal animal models, 54 55 56 but this is the first report of catalase activity in human corneas. In this study, expression of catalase mRNA levels along with its enzyme activity was increased significantly in KC corneas. In a lens epithelial cell line conditioned to survive H2O2 exposure, the major antioxidant enzyme upregulated was catalase. 39 42 Similarly, increased levels of catalase were found in H2O2-stressed Chinese hamster fibroblasts, A549 human lung adenocarcinoma cells and U87MG glioblastoma cells. 57 58 59 It is suggested that catalase and not GPX is the major antioxidant enzyme responsible for H2O2 degradation. 39 40 41 Because H2O2 induces catalase expression, it is likely that KC corneas have elevated levels of this ROS, which could account for some of the oxidative damage associated with KC corneas. 9 Furthermore, under experimental conditions, H2O2 can inhibit SOD, 60 which may play a role in the lower SOD3 activities found in KC corneas. 8 Moreover, the cytotoxic by-products of oxidative stress, that is malondialdehyde (MDA) and peroxynitrite, are present in KC corneas. 9 MDA and peroxynitrite are formed from hydrogen peroxide and superoxide, respectively, both highly reactive oxygen species. Taken together with our findings of increased catalase levels, we believe these data support our hypothesis that ROS production and oxidative stress are important elements in KC. 
Cathepsin V/L2
Cathepsin V is a recently described addition to the cathepsin family. 27 51 61 It is a cysteine proteinase that is found in thymus, testis, and cornea. 28 52 Cathepsin V is homologous to cathepsin L, a lysosomal enzyme, with substrates that include fibronectin, laminin, collagens, and proteoglycans. 53 Although most corneal proteases are found either intracellularly or associated with the stromal matrix, cathepsin V/L2 is associated with normal corneal epithelial basement membranes (Adachi W, et al. IOVS 1999;40:ARVO Abstract S392). 27 61 Furthermore, although cathepsin V/L2 has weaker collagenolytic activity than cathepsin L, 51 its presence may still correlate with the digested basement membranes and Bowman’s layer seen early in KC corneas. 62 63 Increased cathepsin V/L2 expression and its redistribution may be related to the increased fragmentation of epithelial basement membranes in the KC corneas. 1 2 64  
The cathepsin V/L2 immunostaining patterns varied markedly in the individual KC corneas. In addition to staining of the epithelial basement membrane, some KC corneas had increased cathepsin V/L2 staining in stromal cells and epithelial cells. KC corneas have increased RNA and/or protein levels of cathepsin V/L2, -B, and -G 18 19 21 and we believe that their presence supports our hypothesis that KC corneas are oxidatively stressed. Purified cathepsin B can increase H2O2 production in isolated mitochondria, causing a release of cytochrome c and initiating apoptosis. 22 43 Cathepsins L and B cleave Bid, a proapoptotic BCl-2-family member, leading to cytochrome c release and apoptosis. 23 49 50 Cathepsins may play a role in the increased apoptosis in KC corneas. 63 64 65 66 Because evidence shows that cathepsins are involved in H2O2 formation and apoptosis, 22 23 69 70 it is reasonable to speculate that in KC corneas, elevated levels of cathepsin B, -G, and -V/L2 lead to increased H2O2 production, which in turn upregulates catalase. These events could be part of a destructive cycle in which excess H2O2 enters the lipid peroxidation pathway and damages lysosomal membranes, leading to additional cathepsin release and subsequently to higher H2O2 and catalase levels. Therefore, the alterations of cathepsins, H2O2, and catalase may be related to each other and may play a significant role in KC. 
Tissue Inhibitor of Matrix Metalloproteinase-1
Both the RNA and protein levels of TIMP-1 were decreased significantly in KC corneas compared with normal corneas, in agreement with previous in vitro experiments showing that KC corneas have decreased TIMP protein levels. 71 Decreased levels of TIMP-1 may be a mechanism by which increased gelatinase activities 71 72 73 and increased apoptosis 67 are found in KC corneas. In normal corneal fibroblast cultures, treatment with a peroxynitrite donor (3-morpholinosydomine N-ethylcarbamide or SIN-1) caused fragmentation of TIMP-1 protein but did not alter gelatinase activity. 38 Rather, the presence of SIN-1 in normal corneal fibroblast cultures yielded a picture that was similar to features found in KC corneas. 
Whether MMPs plays a role in KC is controversial. 18 32 33 74 75 KC corneal MMP-2 is activated more easily than MMP-2 from normal corneas, 32 75 and KC corneal cells in vitro have higher levels of MMP-2/TIMP-1 than do normal corneas. 76 In the present study, RNA levels for MMP-2 were normal. If MMP-2 is involved in KC, it may be indirectly through the nitric oxide pathway, since nitric oxide can activate MMP-2 activity of corneal fibroblasts in vitro. 38 In one study, MMP-3 RNA levels are decreased in KC corneas compared with normal or diabetic corneas, 46 but, in another report, expression levels of MMP-3 and MMP-10 are normal. 72 KC corneas have increased expression of MMP-14 (MT1-MMP), a membrane-bound MMP that activates MMP-2, 72 but in our study, cathepsin V/L2 was the only degradative enzyme examined that had increased RNA levels. 
The enzyme activities for SOD1 and -3 have been described in the human normal and KC corneas. 8 SOD3 binds to heparan sulfate proteoglycans and is localized to the cell membrane and basement membrane in human corneas. 8 Despite the significant decrease in SOD3 activity reported in KC corneas, 8 we found the level of SOD3 mRNA to be unaltered (Fig. 5A) . KC corneas also have higher GST enzyme activity and lower ALDH3A1 enzyme activity than do normal corneas, 6 but our data showed that GST and ALDH3A1 RNA levels in KC corneas were similar to those in normal corneas. The apparent lack of correlation between RNA levels and enzyme activities of these genes may be a result of post-translational processes, enzyme turnover rates or genetic polymorphisms. For example, the SWR/J mice have essentially normal mRNA levels but only trace levels of ALDH3A1 activity most likely due to nucleotide and amino acid alterations. 77 Further analysis of the corneal antioxidant enzyme RNAs may demonstrate variations in isoforms or polymorphisms that could account for abnormal enzyme activities while maintaining normal RNA levels. 
In summary, our findings of increased catalase expression and activity provide evidence that H2O2-related oxidative stress is involved in KC corneas. Decreased levels of TIMP-1 may play a role in the increased gelatinase activities and apoptosis found in KC corneas. Increased cathepsin V/L2 expression and its redistribution may be related to the increased fragmentation of epithelial basement membranes. Furthermore, cathepsin V/L2 is the third member of this family, along with cathepsins B and -G, which are upregulated and could contribute to the H2O2 burden and oxidative stress. Future studies will further test the hypothesis that oxidative stress may be an important factor in KC pathogenesis and that there is a role for antioxidant therapy in these patients. 
 
Figure 1.
 
Schematic of the reactive oxygen species and antioxidant enzymes. Oÿ 2, superoxide radical.
Figure 1.
 
Schematic of the reactive oxygen species and antioxidant enzymes. Oÿ 2, superoxide radical.
Table 1.
 
RT-PCR Primers, Annealing Temperatures and Hybridization Oligonucleotides Used for Antioxidant Enzymes, Degradative Enzymes and Inhibitors
Table 1.
 
RT-PCR Primers, Annealing Temperatures and Hybridization Oligonucleotides Used for Antioxidant Enzymes, Degradative Enzymes and Inhibitors
Gene Forward Primer Reverse Primer Size (bp) Annealing Temp. (°C) Cycles (n) Internal Oligonucleotide
ALDH3A1 TTCATGAACAGTGGCCAG CTTGTCGTTGCTGGAGAA 407 56 33 TCATCAACCAGCGTGAGA
CATase CATTCGATCTCACCAAGGTTTGGCC AGCAGGTAGGGACAGTTCACAGG 251 55 38 TAATTACTTTGCTGAGGTTGAACAGATA
SOD1 AGTGCAGGGCATCATCAATTTCGAGCAG GATGCAATGGTCTCCTGAGAGTGAGATC 279 56 33 GGGAAGCATTAAGGACTGACTG
SOD3 GAGCTTCTCCTCTGCTCCAA GGGAAGATCGTCAGGTCAAA 300 56 35 TCTCTTGGAGGAGCTGGA
GTR GATCCTGTCAGCCCTGGGTTCTAAGA CGTCTACGATGATATGACCCTTGTCATC 337 54 41 ND
GST-pi CGGAGACCTCACCCTGTACCAGTC GCAGCAAGTCCAGCAGGTTGTAGTCA 307 54 35 ND
MMP-1 CGACTCTAGAAACACAAGAGCAAGA AAGGTTAGCTTACTGTCACACGCTT 786 60 40 ND
MMP-2 GGGACAAGAACCAGATCACATAC CTTCTCAAAGTTGTAGGTGGTGG 446 60 36 AATGGCAAGGAGTACAACAGCTGCACTGAT
MMP-7 GGTCACCTACAGGATCGTATCATAT CATCACTGCATTAGGATCAGAGGAA 373 60 40 ND
MMP-9 GTATTTGTTCAAGGATGGGAAGTAC GCAGGATGTCATAGGTCACGTAG 515 65 40 ND
MMP-14 CGCTACGCCATCCAGGGTCTCAAA CGGTCATCATCGGGCAGCACAAAA 496 62 31 CATAATGAAATCACTTTCTGCATCCAGAATTACAC
CV/L2 TACGGCTTTGAAGGAGCAAAT AGAATTAAGCAATGAGTCCTTTGA 378 64 33 GGACAGCATGTCTGGGGAAATTTTATCTTGAAACTG
TIMP-1 CTGTTGTTGCTGTGGCTGATAG CTTTTCAGAGCCTTGGAGGAC 506 62 33 ACCTTATACCAGCGTTATGAGATCAAGATGACC
TIMP-2 TCTGGAAACGACATTTATGG GTTGGAGGCCTGCTTATGGG 507 58 32 TGGGGTCTCGCTGGACGTTGGAGGAAAGAAGGAA
TIMP-3 CATCAAGCAGATGAAGATGTACC GGTAGTAGCAGGACTTGATCTTGC 268 60 33 CTCACCCTCTCCCAGCGCAAGGGGCTGAACTATC
B2-MG CTCGCGCTACTCTCTCTTTCTG GCTTACATGTCTCGATCCCACTT 334 60 30 GTCTTTCAGCAAGGACTGGTCTTTCTATCTCTTGTA
Figure 2.
 
KC corneas had increased catalase mRNA levels and activity but normal protein distribution compared with normal corneas. (A) RT-PCR analysis of gene expression for catalase in normal and KC corneas. Lanes 1 to 8: normal corneas; lanes 9 to 16: KC corneas. H2O lane, water only. Hybridization signal intensities were normalized to values obtained for β2MG. KC corneas had an ∼2.2-fold increase of catalase mRNA compared to age-matched normal corneas (P < 0.01). (B) Southern blot analysis of catalase in normal and KC corneas. Primers for catalase were designed and used to amplify the RNA from individual corneas. After amplification, the products were run on agarose gels and then analyzed by Southern blot analysis using specific oligonucleotide probes to confirm the specificity of the product. Lanes are as in (A) −RT, negative control without RT; STD, dilution to show linear range. (C) Catalase activities from normal (n = 7) and KC (n = 10) corneas were measured. Note that the KC corneas had ∼1.8-fold increase of catalase activity compared with normal corneas (P < 0.03). (D) Immunohistochemical analysis of KC corneas stained with rhodamine-conjugated antibodies to catalase. Antibody to catalase stained the epithelial cell cytoplasm with slight staining of the keratocytes and endothelium. Normal corneas had staining patterns similar to those of the KC corneas. No staining was observed when only secondary antibody was used on the tissue sections. E, epithelium; S, stroma; Endo, endothelium. Scale bar, 100 μm.
Figure 2.
 
KC corneas had increased catalase mRNA levels and activity but normal protein distribution compared with normal corneas. (A) RT-PCR analysis of gene expression for catalase in normal and KC corneas. Lanes 1 to 8: normal corneas; lanes 9 to 16: KC corneas. H2O lane, water only. Hybridization signal intensities were normalized to values obtained for β2MG. KC corneas had an ∼2.2-fold increase of catalase mRNA compared to age-matched normal corneas (P < 0.01). (B) Southern blot analysis of catalase in normal and KC corneas. Primers for catalase were designed and used to amplify the RNA from individual corneas. After amplification, the products were run on agarose gels and then analyzed by Southern blot analysis using specific oligonucleotide probes to confirm the specificity of the product. Lanes are as in (A) −RT, negative control without RT; STD, dilution to show linear range. (C) Catalase activities from normal (n = 7) and KC (n = 10) corneas were measured. Note that the KC corneas had ∼1.8-fold increase of catalase activity compared with normal corneas (P < 0.03). (D) Immunohistochemical analysis of KC corneas stained with rhodamine-conjugated antibodies to catalase. Antibody to catalase stained the epithelial cell cytoplasm with slight staining of the keratocytes and endothelium. Normal corneas had staining patterns similar to those of the KC corneas. No staining was observed when only secondary antibody was used on the tissue sections. E, epithelium; S, stroma; Endo, endothelium. Scale bar, 100 μm.
Figure 3.
 
KC corneas had increased cathepsin V/L2 mRNA levels and abnormal protein distribution compared with normal corneas. (A) RT-PCR analysis of gene expression for cathepsin V/L2 in normal and KC corneas. Lanes 1 to 8: normal corneas; lanes 9 to 20: KC corneas. H2O lane, water only. Hybridization signal intensities were normalized to values obtained for β2MG. The cathepsin V/L2 RNA levels in KC corneas were increased ∼1.5-fold compared with age-matched normal corneas (P < 0.03). (B) Southern blot analysis of cathepsin V/L2 in normal and KC corneas. Primers for cathepsin V/L2 were designed and used to amplify the RNA from individual corneas. After amplification, the products were run on agarose gels and then assayed by Southern blot analysis with specific oligonucleotide probes to confirm the specificity of the product. Lanes are as in (A) −RT, negative control without RT; STD, dilution to show linear range. (C) Protein distribution was determined by immunohistochemistry with a cathepsin V/L2 antibody. In normal corneas, cathepsin V/L2 was associated primarily with the epithelial basement membrane. In KC corneas, increased staining with cathepsin V/L2 antibody was observed and the pattern of staining was variable. Some KC corneas had increased staining of the epithelial basement membranes, whereas other corneas showed cathepsin V/L2-positive epithelial cells and stromal cells. No staining was observed when only secondary antibody was used on the tissue sections. E, epithelium; S, stroma; Endo, endothelium. Scale bar, 100 μm.
Figure 3.
 
KC corneas had increased cathepsin V/L2 mRNA levels and abnormal protein distribution compared with normal corneas. (A) RT-PCR analysis of gene expression for cathepsin V/L2 in normal and KC corneas. Lanes 1 to 8: normal corneas; lanes 9 to 20: KC corneas. H2O lane, water only. Hybridization signal intensities were normalized to values obtained for β2MG. The cathepsin V/L2 RNA levels in KC corneas were increased ∼1.5-fold compared with age-matched normal corneas (P < 0.03). (B) Southern blot analysis of cathepsin V/L2 in normal and KC corneas. Primers for cathepsin V/L2 were designed and used to amplify the RNA from individual corneas. After amplification, the products were run on agarose gels and then assayed by Southern blot analysis with specific oligonucleotide probes to confirm the specificity of the product. Lanes are as in (A) −RT, negative control without RT; STD, dilution to show linear range. (C) Protein distribution was determined by immunohistochemistry with a cathepsin V/L2 antibody. In normal corneas, cathepsin V/L2 was associated primarily with the epithelial basement membrane. In KC corneas, increased staining with cathepsin V/L2 antibody was observed and the pattern of staining was variable. Some KC corneas had increased staining of the epithelial basement membranes, whereas other corneas showed cathepsin V/L2-positive epithelial cells and stromal cells. No staining was observed when only secondary antibody was used on the tissue sections. E, epithelium; S, stroma; Endo, endothelium. Scale bar, 100 μm.
Figure 4.
 
KC corneas had decreased TIMP-1 mRNA and protein levels. (A) RT-PCR analysis of gene expression for TIMP-1 in normal and KC corneas. Lanes 1 to 8: normal corneas; lanes 9 to 20: KC corneas. H2O lane, water only. Hybridization signal intensities were normalized to values obtained for β2MG. KC corneas had a ∼1.8-fold decrease in KC corneas compared with age-matched normal corneas (P < 0.05). (B) Southern blot analysis of TIMP-1 in normal and KC corneas. Primers for TIMP-1 were designed and used to amplify the RNA from individual corneas. After amplification, the products were run on agarose gels and then analyzed by Southern blot analysis with specific oligonucleotide probes to confirm the specificity of the product. Lanes are as in (A) −RT, negative control without RT; STD, dilution to show linear range. (C) Representative corneal extracts separated by SDS-PAGE and stained with Coomassie blue to verify that similar amounts of proteins were loaded in each lane. Each lane represents extracts of individual corneas. (D) Western blot analysis of KC corneal extracts using a monoclonal antibody to TIMP-1. The single 28-kDa band is the correct molecular weight for TIMP-1 (arrowhead). Note the decreased staining for TIMP-1 in the KC corneal extracts compared with normal corneas. The TIMP-1 densities in KC samples (n = 10) and normal samples (n = 8) were scanned and standardized to total protein. KC corneas had 2.8-fold a decrease in TIMP-1 protein (0.249 ± 0.088) compared with normal corneas (0.694 ± 0.212). P < 0.0001.
Figure 4.
 
KC corneas had decreased TIMP-1 mRNA and protein levels. (A) RT-PCR analysis of gene expression for TIMP-1 in normal and KC corneas. Lanes 1 to 8: normal corneas; lanes 9 to 20: KC corneas. H2O lane, water only. Hybridization signal intensities were normalized to values obtained for β2MG. KC corneas had a ∼1.8-fold decrease in KC corneas compared with age-matched normal corneas (P < 0.05). (B) Southern blot analysis of TIMP-1 in normal and KC corneas. Primers for TIMP-1 were designed and used to amplify the RNA from individual corneas. After amplification, the products were run on agarose gels and then analyzed by Southern blot analysis with specific oligonucleotide probes to confirm the specificity of the product. Lanes are as in (A) −RT, negative control without RT; STD, dilution to show linear range. (C) Representative corneal extracts separated by SDS-PAGE and stained with Coomassie blue to verify that similar amounts of proteins were loaded in each lane. Each lane represents extracts of individual corneas. (D) Western blot analysis of KC corneal extracts using a monoclonal antibody to TIMP-1. The single 28-kDa band is the correct molecular weight for TIMP-1 (arrowhead). Note the decreased staining for TIMP-1 in the KC corneal extracts compared with normal corneas. The TIMP-1 densities in KC samples (n = 10) and normal samples (n = 8) were scanned and standardized to total protein. KC corneas had 2.8-fold a decrease in TIMP-1 protein (0.249 ± 0.088) compared with normal corneas (0.694 ± 0.212). P < 0.0001.
Figure 5.
 
The SOD1, ALDH3A1, SOD3, and GPX RNA levels and/or protein distributions were similar between normal and KC corneas. (A) RT-PCR analysis of gene expression for SOD1, ALDH3A1, and SOD3 in normal and KC corneas. Lanes 1 to 8: normal corneas; lanes 9 to 16: KC corneas. H2O lane, water only. The intensities of the signals were normalized to value obtained for β2MG. The RNA levels for SOD1, ALDH3A1, or SOD3 were similar in normal and KC corneas. (B) Immunohistochemical analysis of KC corneas stained with rhodamine conjugated antibodies to SOD1, ALDH3A1, and GPX. The SOD1antibody stained the epithelial cell cytoplasm and endothelium. Anti-ALDH3A1 antibody heavily stained the stromal keratocytes and epithelial cells but did not stain the endothelial cells. GPX antibody staining was diffuse in epithelial cells, keratocytes, and endothelial cells. The KC corneas and normal corneas had similar staining patterns for SOD1, ALDH3A1, and GPX (normal cornea sections not shown). No staining was observed when only secondary antibody (IgG only) was used on the tissue sections. E, epithelium; S, stroma; Endo, endothelium; **sites of Bowman’s layer disruption where the stroma is in direct contact with the epithelium. Scale bar, 100 μm.
Figure 5.
 
The SOD1, ALDH3A1, SOD3, and GPX RNA levels and/or protein distributions were similar between normal and KC corneas. (A) RT-PCR analysis of gene expression for SOD1, ALDH3A1, and SOD3 in normal and KC corneas. Lanes 1 to 8: normal corneas; lanes 9 to 16: KC corneas. H2O lane, water only. The intensities of the signals were normalized to value obtained for β2MG. The RNA levels for SOD1, ALDH3A1, or SOD3 were similar in normal and KC corneas. (B) Immunohistochemical analysis of KC corneas stained with rhodamine conjugated antibodies to SOD1, ALDH3A1, and GPX. The SOD1antibody stained the epithelial cell cytoplasm and endothelium. Anti-ALDH3A1 antibody heavily stained the stromal keratocytes and epithelial cells but did not stain the endothelial cells. GPX antibody staining was diffuse in epithelial cells, keratocytes, and endothelial cells. The KC corneas and normal corneas had similar staining patterns for SOD1, ALDH3A1, and GPX (normal cornea sections not shown). No staining was observed when only secondary antibody (IgG only) was used on the tissue sections. E, epithelium; S, stroma; Endo, endothelium; **sites of Bowman’s layer disruption where the stroma is in direct contact with the epithelium. Scale bar, 100 μm.
The authors thank Alexander Ljubimov (Ophthalmology Research Laboratories, Cedars-Sinai Medical Center, University of California Los Angeles, Los Angeles, CA), Wakako Adachi, and Shigeru Kinoshita (Kyoto Prefecture University of Medicine, Kyoto, Japan) for the antibody to cathepsin V/L2, Joseph McCord for a critical reading of the manuscript; especially, Ezra Maguen, Anthony Nesburn, Frank Price, Yaron Rabinowitz, Theodore Perl for providing diseased corneas and the National Disease Research Interchange for supplying normal human corneas. 
KrachmerJH, FederRS, BelinMW. Keratoconus and related noninflammatory corneal thinning disorders. Surv Ophthalmol. 1984;28:293–322. [CrossRef] [PubMed]
RabinowitzYS. Keratoconus. Surv Ophthalmol. 1998;42:297–319. [CrossRef] [PubMed]
ZadnikK, BarrJT, GordonMO, EdringtonTB. Biomicroscopic signs and disease severity in keratoconus. Collaborative Longitudinal Evaluation of Keratoconus (CLEK) Study Group. Cornea. 1996;15:139–146. [CrossRef] [PubMed]
ShapiroMB, FranceTD. The ocular features of Down’s syndrome. Am J Ophthalmol. 1985;99:659–663. [CrossRef] [PubMed]
GondhowiardjoTD, van HaeringenNJ, Volker-DiebenHJ, et al. Analysis of corneal aldehyde dehydrogenase patterns in pathologic corneas. Cornea. 1993;12:146–154. [CrossRef] [PubMed]
GondhowiardjoTD, van HaeringenNJ. Corneal aldehyde dehydrogenase, glutathione reductase, and glutathione S-transferase in pathologic corneas. Cornea. 1993;12:310–314. [CrossRef] [PubMed]
KenneyMC, BrownDJ, RajeevB. Everett Kinsey lecture. The elusive causes of keratoconus: a working hypothesis. Clao J. 2000;26:10–13. [PubMed]
BehndigA, KarlssonK, JohanssonBO, et al. Superoxide dismutase isoenzymes in the normal and diseased human cornea. Invest Ophthalmol Vis Sci. 2001;42:2293–2296. [PubMed]
BuddiR, LinB, AtilanoSR, et al. Evidence of oxidative stress in human corneal diseases. J Histochem Cytochem. 2002;50:341–351. [CrossRef] [PubMed]
EsterbauerH, SchaurRJ, ZollnerH. Chemistry and biochemistry of 4-hydroxynonenal, malonaldehyde and related aldehydes. Free Radic Biol Med. 1991;11:81–128. [CrossRef] [PubMed]
SquadritoGL, PryorWA. Oxidative chemistry of nitric oxide: the roles of superoxide, peroxynitrite, and carbon dioxide. Free Radic Biol Med. 1998;25:392–403. [CrossRef] [PubMed]
SzaboC, OhshimaH. DNA damage induced by peroxynitrite: subsequent biological effects. Nitric Oxide. 1997;1:373–385. [CrossRef] [PubMed]
MurphyMP, PackerMA, ScarlettJL, MartinSW. Peroxynitrite: a biologically significant oxidant. Gen Pharmacol. 1998;31:179–186. [CrossRef] [PubMed]
SophosNA, PappaA, ZieglerTL, VasiliouV. Aldehyde dehydrogenase gene superfamily: the 2000 update. Chem Biol Interact. 2001;130–132:323–337. [PubMed]
SophosNA, VasiliouV. Aldehyde dehydrogenase gene superfamily: the 2002 update. Chem Biol Interact. 2003;143–144:5–22. [PubMed]
VasiliouV, PappaA. Polymorphisms of human aldehyde dehydrogenases: consequences for drug metabolism and disease. Pharmacology. 2000;61:192–198. [CrossRef] [PubMed]
HashimotoM, SibataT, WasadaH, et al. Structural basis of protein-bound endogenous aldehydes: chemical and immunochemical characterizations of configurational isomers of a 4-hydroxy-2-nonenal-histidine adduct. J Biol Chem. 2003;278:5044–5051. [CrossRef] [PubMed]
ZhouL, SawaguchiS, TwiningSS, et al. Expression of degradative enzymes and protease inhibitors in corneas with keratoconus. Invest Ophthalmol Vis Sci. 1998;39:1117–1124. [PubMed]
WhitelockRB, FukuchiT, ZhouL, et al. Cathepsin G, acid phosphatase, and alpha 1-proteinase inhibitor messenger RNA levels in keratoconus corneas. Invest Ophthalmol Vis Sci. 1997;38:529–534. [PubMed]
KenneyMC, ChwaM, LinB, et al. Identification of cell types in human diseased corneas. Cornea. 2001;20:309–316. [CrossRef] [PubMed]
BrookesNH, LohIP, CloverGM, et al. Involvement of corneal nerves in the progression of keratoconus. Exp Eye Res. 2003;77:515–524. [CrossRef] [PubMed]
ZhaoM, AntunesF, EatonJW, BrunkUT. Lysosomal enzymes promote mitochondrial oxidant production, cytochrome c release and apoptosis. Eur J Biochem. 2003;270:3778–3786. [CrossRef] [PubMed]
CirmanT, OresicK, MazovecGD, et al. Selective disruption of lysosomes in HeLa cells triggers apoptosis mediated by cleavage of Bid by multiple papain-like lysosomal cathepsins. J Biol Chem. 2004;279:3578–3587. [PubMed]
IshisakaR, UtsumiT, KannoT, et al. Participation of a cathepsin L-type protease in the activation of caspase-3. Cell Struct Funct. 1999;24:465–470. [CrossRef] [PubMed]
IshisakaR, UtsumiK, UtsumiT. Involvement of lysosomal cysteine proteases in hydrogen peroxide-induced apoptosis in HL-60 cells. Biosci Biotechnol Biochem. 2002;66:1865–1872. [CrossRef] [PubMed]
GuicciardiME, DeussingJ, MiyoshiH, et al. Cathepsin B contributes to TNF-alpha-mediated hepatocyte apoptosis by promoting mitochondrial release of cytochrome c. J Clin Invest. 2000;106:1127–1137. [CrossRef] [PubMed]
AdachiW, KawamotoS, OhnoI, et al. Isolation and characterization of human cathepsin V: a major proteinase in corneal epithelium. Invest Ophthalmol Vis Sci. 1998;39:1789–1796. [PubMed]
KinoshitaS, AdachiW, SotozonoC, et al. Characteristics of the human ocular surface epithelium. Prog Retin Eye Res. 2001;20:639–673. [CrossRef] [PubMed]
KenneyMC, NesburnAB, BurgesonRE, et al. Abnormalities of the extracellular matrix in keratoconus corneas. Cornea. 1997;16:345–351. [PubMed]
TuoriA, VirtanenI, AineE, UusitaloH. The expression of tenascin and fibronectin in keratoconus, scarred and normal human cornea. Graefes Arch Clin Exp Ophthalmol. 1997;235:222–229. [CrossRef] [PubMed]
KaoWW, VergnesJP, EbertJ, et al. Increased collagenase and gelatinase activities in keratoconus. Biochem Biophys Res Commun. 1982;107:929–936. [CrossRef] [PubMed]
BrownD, ChwaMM, OpbroekA, KenneyMC. Keratoconus corneas: increased gelatinolytic activity appears after modification of inhibitors. Curr Eye Res. 1993;12:571–581. [CrossRef] [PubMed]
SmithVA, HohHB, LittletonM, EastyDL. Over-expression of a gelatinase A activity in keratoconus. Eye. 1995;9:429–433. [CrossRef] [PubMed]
NelsonKK, RanganathanAC, MansouriJ, et al. Elevated sod2 activity augments matrix metalloproteinase expression: evidence for the involvement of endogenous hydrogen peroxide in regulating metastasis. Clin Cancer Res. 2003;9:424–432. [PubMed]
BrenneisenP, BrivibaK, WlaschekM, et al. Hydrogen peroxide (H2O2) increases the steady-state mRNA levels of collagenase/MMP-1 in human dermal fibroblasts. Free Radic Biol Med. 1997;22:515–524. [CrossRef] [PubMed]
KawaguchiY, TanakaH, OkadaT, et al. The effects of ultraviolet A and reactive oxygen species on the mRNA expression of 72-kDa type IV collagenase and its tissue inhibitor in cultured human dermal fibroblasts. Arch Dermatol Res. 1996;288:39–44. [CrossRef] [PubMed]
SiwikDA, PaganoPJ, ColucciWS. Oxidative stress regulates collagen synthesis and matrix metalloproteinase activity in cardiac fibroblasts. Am J Physiol. 2001;280:C53–C60.
BrownDJ, LinB, ChwaM, et al. Elements of the nitric oxide pathway can degrade TIMP-1 and increase gelatinase activity. Mol Vis. 2004;10:281–288. [PubMed]
SpectorA, LiD, MaW, et al. Differential amplification of gene expression in lens cell lines conditioned to survive peroxide stress. Invest Ophthalmol Vis Sci. 2002;43:3251–3264. [PubMed]
YamadaM, HashinakaK, InazawaJ, AbeT. Expression of catalase and myeloperoxidase genes in hydrogen peroxide-resistant HL-60 cells. DNA Cell Biol. 1991;10:735–742. [CrossRef] [PubMed]
LinF, JacksonVE, GirottiAW. Amplification and hyperexpression of the catalase gene in selenoperoxidase-deficient leukemia cells. Arch Biochem Biophys. 1995;317:7–18. [CrossRef] [PubMed]
CarperD, JohnM, ChenZ, et al. Gene expression analysis of an HO-resistant lens epithelial cell line. Free Radic Biol Med. 2001;31:90–97. [CrossRef] [PubMed]
JohanssonAC, SteenH, OllingerK, RobergK. Cathepsin D mediates cytochrome c release and caspase activation in human fibroblast apoptosis induced by staurosporine. Cell Death Differ. 2003;10:1253–1259. [CrossRef] [PubMed]
SpirinKS, LjubimovAV, CastellonR, et al. Analysis of gene expression in human bullous keratopathy corneas containing limiting amounts of RNA. Invest Ophthalmol Vis Sci. 1999;40:3108–3115. [PubMed]
SaghizadehM, ChwaM, AokiA, et al. Altered expression of growth factors and cytokines in keratoconus, bullous keratopathy and diabetic human corneas. Exp Eye Res. 2001;73:179–189. [CrossRef] [PubMed]
SaghizadehM, BrownDJ, CastellonR, et al. Overexpression of matrix metalloproteinase-10 and matrix metalloproteinase-3 in human diabetic corneas: a possible mechanism of basement membrane and integrin alterations. Am J Pathol. 2001;158:723–734. [CrossRef] [PubMed]
PappaA, EsteyT, ManzerR, et al. Human aldehyde dehydrogenase 3A1 (ALDH3A1): biochemical characterization and immunohistochemical localization in the cornea. Biochem J. 2003;376:615–623. [CrossRef] [PubMed]
KenneyMC, ChwaM, AlbaA, et al. Localization of TIMP-1, TIMP-2, TIMP-3, gelatinase A and gelatinase B in pathological human corneas. Curr Eye Res. 1998;17:238–246. [CrossRef] [PubMed]
StokaV, TurkB, SchendelSL, et al. Lysosomal protease pathways to apoptosis: cleavage of bid, not pro-caspases, is the most likely route. J Biol Chem. 2001;276:3149–3157. [CrossRef] [PubMed]
KagedalK, JohanssonU, OllingerK. The lysosomal protease cathepsin D mediates apoptosis induced by oxidative stress. FASEB J. 2001;15:1592–1594. [PubMed]
BrommeD, LiZ, BarnesM, MehlerE. Human cathepsin V functional expression, tissue distribution, electrostatic surface potential, enzymatic characterization, and chromosomal localization. Biochemistry. 1999;38:2377–2385. [CrossRef] [PubMed]
RajahR, KatzL, NunnS, et al. Insulin-like growth factor binding protein (IGFBP) proteases: functional regulators of cell growth. Prog Growth Factor Res. 1995;6:273–284. [CrossRef] [PubMed]
IshidohK, KominamiE. Procathepsin L degrades extracellular matrix proteins in the presence of glycosaminoglycans in vitro. Biochem Biophys Res Commun. 1995;217:624–631. [CrossRef] [PubMed]
CejkovaJ, StipekS, CrkovskaJ, ArdanT. Changes of superoxide dismutase, catalase and glutathione peroxidase in the corneal epithelium after UVB rays. Histochemical and biochemical study. Histol Histopathol. 2000;15:1043–1050. [PubMed]
BilgihanA, BilgihanK, YisO, et al. Effects of topical vitamin E on corneal superoxide dismutase, glutathione peroxidase activities and polymorphonuclear leucocyte infiltration after photorefractive keratectomy. Acta Ophthalmol Scand. 2003;81:177–180. [CrossRef] [PubMed]
BilgihanA, BilgihanK, YisO, et al. The effect of excimer laser keratectomy on corneal glutathione-related enzymes in rabbits. Free Radic Res. 2003;37:399–403. [CrossRef] [PubMed]
SpitzDR, ElwellJH, SunY, et al. Oxygen toxicity in control and H2O2-resistant Chinese hamster fibroblast cell lines. Arch Biochem Biophys. 1990;279:249–260. [CrossRef] [PubMed]
HuntCR, SimJE, SullivanSJ, et al. Genomic instability and catalase gene amplification induced by chronic exposure to oxidative stress. Cancer Res. 1998;58:3986–3992. [PubMed]
BojesHK, SureshPK, MillsEM, et al. Bcl-2 and Bcl-xL in peroxide-resistant A549 and U87MG cells. Toxicol Sci. 1998;42:109–116. [PubMed]
BhuyanKC, BhuyanDK. Superoxide dismutase of the eye: relative functions of superoxide dismutase and catalase in protecting the ocular lens from oxidative damage. Biochim Biophys Acta. 1978;542:28–38. [CrossRef] [PubMed]
ItohR, KawamotoS, AdachiW, et al. Genomic organization and chromosomal localization of the human cathepsin L2 gene. DNA Res. 1999;6:137–140. [CrossRef] [PubMed]
MillinJA, GolubBM, FosterCS. Human basement membrane components of keratoconus and normal corneas. Invest Ophthalmol Vis Sci. 1986;27:604–607. [PubMed]
ScroggsMW, ProiaAD. Histopathological variation in keratoconus. Cornea. 1992;11:553–559. [CrossRef] [PubMed]
BronAJ. Keratoconus. Cornea. 1988;7:163–169. [PubMed]
WilsonSE, KimWJ. Keratocyte apoptosis: implications on corneal wound healing, tissue organization, and disease. Invest Ophthalmol Vis Sci. 1998;39:220–226. [PubMed]
KimWJ, RabinowitzYS, MeislerDM, WilsonSE. Keratocyte apoptosis associated with keratoconus. Exp Eye Res. 1999;69:475–481. [CrossRef] [PubMed]
KaldawyRM, WagnerJ, ChingS, SeigelGM. Evidence of apoptotic cell death in keratoconus. Cornea. 2002;21:206–209. [CrossRef] [PubMed]
TachibanaM, AdachiW, KinoshitaS, et al. Androgen-dependent hereditary mouse keratoconus: linkage to an MHC region. Invest Ophthalmol Vis Sci. 2002;43:51–57. [PubMed]
TermanA, NeuzilJ, KagedalK, et al. Decreased apoptotic response of inclusion-cell disease fibroblasts: a consequence of lysosomal enzyme missorting?. Exp Cell Res. 2002;274:9–15. [CrossRef] [PubMed]
BrunkUT, TermanA. The mitochondrial-lysosomal axis theory of aging: accumulation of damaged mitochondria as a result of imperfect autophagocytosis. Eur J Biochem. 2002;269:1996–2002. [CrossRef] [PubMed]
KenneyMC, ChwaM, OpbroekAJ, BrownDJ. Increased gelatinolytic activity in keratoconus keratocyte cultures: a correlation to an altered matrix metalloproteinase-2/tissue inhibitor of metalloproteinase ratio. Cornea. 1994;13:114–124. [CrossRef] [PubMed]
CollierSA. Is the corneal degradation in keratoconus caused by matrix-metalloproteinases?. Clin Experiment Ophthalmol. 2001;29:340–344. [CrossRef] [PubMed]
KenneyMC, ChwaM, EscobarM, BrownD. Altered gelatinolytic activity by keratoconus corneal cells. Biochem Biophys Res Commun. 1989;161:353–357. [CrossRef] [PubMed]
FiniME, YueBY, SugarJ. Collagenolytic/gelatinolytic metalloproteinases in normal and keratoconus corneas. Curr Eye Res. 1992;11:849–862. [CrossRef] [PubMed]
SmithVA, EastyDL. Matrix metalloproteinase 2: involvement in keratoconus. Eur J Ophthalmol. 2000;10:215–226. [PubMed]
OpbroekA, KenneyMC, BrownD. Characterization of a human corneal metalloproteinase inhibitor (TIMP- 1). Curr Eye Res. 1993;12:877–883. [CrossRef] [PubMed]
ShiaoT, TranP, SiegelD, et al. Four amino acid changes are associated with the Aldh3a1 locus polymorphism in mice which may be responsible for corneal sensitivity to ultraviolet light. Pharmacogenetics. 1999;9:145–153. [PubMed]
Figure 1.
 
Schematic of the reactive oxygen species and antioxidant enzymes. Oÿ 2, superoxide radical.
Figure 1.
 
Schematic of the reactive oxygen species and antioxidant enzymes. Oÿ 2, superoxide radical.
Figure 2.
 
KC corneas had increased catalase mRNA levels and activity but normal protein distribution compared with normal corneas. (A) RT-PCR analysis of gene expression for catalase in normal and KC corneas. Lanes 1 to 8: normal corneas; lanes 9 to 16: KC corneas. H2O lane, water only. Hybridization signal intensities were normalized to values obtained for β2MG. KC corneas had an ∼2.2-fold increase of catalase mRNA compared to age-matched normal corneas (P < 0.01). (B) Southern blot analysis of catalase in normal and KC corneas. Primers for catalase were designed and used to amplify the RNA from individual corneas. After amplification, the products were run on agarose gels and then analyzed by Southern blot analysis using specific oligonucleotide probes to confirm the specificity of the product. Lanes are as in (A) −RT, negative control without RT; STD, dilution to show linear range. (C) Catalase activities from normal (n = 7) and KC (n = 10) corneas were measured. Note that the KC corneas had ∼1.8-fold increase of catalase activity compared with normal corneas (P < 0.03). (D) Immunohistochemical analysis of KC corneas stained with rhodamine-conjugated antibodies to catalase. Antibody to catalase stained the epithelial cell cytoplasm with slight staining of the keratocytes and endothelium. Normal corneas had staining patterns similar to those of the KC corneas. No staining was observed when only secondary antibody was used on the tissue sections. E, epithelium; S, stroma; Endo, endothelium. Scale bar, 100 μm.
Figure 2.
 
KC corneas had increased catalase mRNA levels and activity but normal protein distribution compared with normal corneas. (A) RT-PCR analysis of gene expression for catalase in normal and KC corneas. Lanes 1 to 8: normal corneas; lanes 9 to 16: KC corneas. H2O lane, water only. Hybridization signal intensities were normalized to values obtained for β2MG. KC corneas had an ∼2.2-fold increase of catalase mRNA compared to age-matched normal corneas (P < 0.01). (B) Southern blot analysis of catalase in normal and KC corneas. Primers for catalase were designed and used to amplify the RNA from individual corneas. After amplification, the products were run on agarose gels and then analyzed by Southern blot analysis using specific oligonucleotide probes to confirm the specificity of the product. Lanes are as in (A) −RT, negative control without RT; STD, dilution to show linear range. (C) Catalase activities from normal (n = 7) and KC (n = 10) corneas were measured. Note that the KC corneas had ∼1.8-fold increase of catalase activity compared with normal corneas (P < 0.03). (D) Immunohistochemical analysis of KC corneas stained with rhodamine-conjugated antibodies to catalase. Antibody to catalase stained the epithelial cell cytoplasm with slight staining of the keratocytes and endothelium. Normal corneas had staining patterns similar to those of the KC corneas. No staining was observed when only secondary antibody was used on the tissue sections. E, epithelium; S, stroma; Endo, endothelium. Scale bar, 100 μm.
Figure 3.
 
KC corneas had increased cathepsin V/L2 mRNA levels and abnormal protein distribution compared with normal corneas. (A) RT-PCR analysis of gene expression for cathepsin V/L2 in normal and KC corneas. Lanes 1 to 8: normal corneas; lanes 9 to 20: KC corneas. H2O lane, water only. Hybridization signal intensities were normalized to values obtained for β2MG. The cathepsin V/L2 RNA levels in KC corneas were increased ∼1.5-fold compared with age-matched normal corneas (P < 0.03). (B) Southern blot analysis of cathepsin V/L2 in normal and KC corneas. Primers for cathepsin V/L2 were designed and used to amplify the RNA from individual corneas. After amplification, the products were run on agarose gels and then assayed by Southern blot analysis with specific oligonucleotide probes to confirm the specificity of the product. Lanes are as in (A) −RT, negative control without RT; STD, dilution to show linear range. (C) Protein distribution was determined by immunohistochemistry with a cathepsin V/L2 antibody. In normal corneas, cathepsin V/L2 was associated primarily with the epithelial basement membrane. In KC corneas, increased staining with cathepsin V/L2 antibody was observed and the pattern of staining was variable. Some KC corneas had increased staining of the epithelial basement membranes, whereas other corneas showed cathepsin V/L2-positive epithelial cells and stromal cells. No staining was observed when only secondary antibody was used on the tissue sections. E, epithelium; S, stroma; Endo, endothelium. Scale bar, 100 μm.
Figure 3.
 
KC corneas had increased cathepsin V/L2 mRNA levels and abnormal protein distribution compared with normal corneas. (A) RT-PCR analysis of gene expression for cathepsin V/L2 in normal and KC corneas. Lanes 1 to 8: normal corneas; lanes 9 to 20: KC corneas. H2O lane, water only. Hybridization signal intensities were normalized to values obtained for β2MG. The cathepsin V/L2 RNA levels in KC corneas were increased ∼1.5-fold compared with age-matched normal corneas (P < 0.03). (B) Southern blot analysis of cathepsin V/L2 in normal and KC corneas. Primers for cathepsin V/L2 were designed and used to amplify the RNA from individual corneas. After amplification, the products were run on agarose gels and then assayed by Southern blot analysis with specific oligonucleotide probes to confirm the specificity of the product. Lanes are as in (A) −RT, negative control without RT; STD, dilution to show linear range. (C) Protein distribution was determined by immunohistochemistry with a cathepsin V/L2 antibody. In normal corneas, cathepsin V/L2 was associated primarily with the epithelial basement membrane. In KC corneas, increased staining with cathepsin V/L2 antibody was observed and the pattern of staining was variable. Some KC corneas had increased staining of the epithelial basement membranes, whereas other corneas showed cathepsin V/L2-positive epithelial cells and stromal cells. No staining was observed when only secondary antibody was used on the tissue sections. E, epithelium; S, stroma; Endo, endothelium. Scale bar, 100 μm.
Figure 4.
 
KC corneas had decreased TIMP-1 mRNA and protein levels. (A) RT-PCR analysis of gene expression for TIMP-1 in normal and KC corneas. Lanes 1 to 8: normal corneas; lanes 9 to 20: KC corneas. H2O lane, water only. Hybridization signal intensities were normalized to values obtained for β2MG. KC corneas had a ∼1.8-fold decrease in KC corneas compared with age-matched normal corneas (P < 0.05). (B) Southern blot analysis of TIMP-1 in normal and KC corneas. Primers for TIMP-1 were designed and used to amplify the RNA from individual corneas. After amplification, the products were run on agarose gels and then analyzed by Southern blot analysis with specific oligonucleotide probes to confirm the specificity of the product. Lanes are as in (A) −RT, negative control without RT; STD, dilution to show linear range. (C) Representative corneal extracts separated by SDS-PAGE and stained with Coomassie blue to verify that similar amounts of proteins were loaded in each lane. Each lane represents extracts of individual corneas. (D) Western blot analysis of KC corneal extracts using a monoclonal antibody to TIMP-1. The single 28-kDa band is the correct molecular weight for TIMP-1 (arrowhead). Note the decreased staining for TIMP-1 in the KC corneal extracts compared with normal corneas. The TIMP-1 densities in KC samples (n = 10) and normal samples (n = 8) were scanned and standardized to total protein. KC corneas had 2.8-fold a decrease in TIMP-1 protein (0.249 ± 0.088) compared with normal corneas (0.694 ± 0.212). P < 0.0001.
Figure 4.
 
KC corneas had decreased TIMP-1 mRNA and protein levels. (A) RT-PCR analysis of gene expression for TIMP-1 in normal and KC corneas. Lanes 1 to 8: normal corneas; lanes 9 to 20: KC corneas. H2O lane, water only. Hybridization signal intensities were normalized to values obtained for β2MG. KC corneas had a ∼1.8-fold decrease in KC corneas compared with age-matched normal corneas (P < 0.05). (B) Southern blot analysis of TIMP-1 in normal and KC corneas. Primers for TIMP-1 were designed and used to amplify the RNA from individual corneas. After amplification, the products were run on agarose gels and then analyzed by Southern blot analysis with specific oligonucleotide probes to confirm the specificity of the product. Lanes are as in (A) −RT, negative control without RT; STD, dilution to show linear range. (C) Representative corneal extracts separated by SDS-PAGE and stained with Coomassie blue to verify that similar amounts of proteins were loaded in each lane. Each lane represents extracts of individual corneas. (D) Western blot analysis of KC corneal extracts using a monoclonal antibody to TIMP-1. The single 28-kDa band is the correct molecular weight for TIMP-1 (arrowhead). Note the decreased staining for TIMP-1 in the KC corneal extracts compared with normal corneas. The TIMP-1 densities in KC samples (n = 10) and normal samples (n = 8) were scanned and standardized to total protein. KC corneas had 2.8-fold a decrease in TIMP-1 protein (0.249 ± 0.088) compared with normal corneas (0.694 ± 0.212). P < 0.0001.
Figure 5.
 
The SOD1, ALDH3A1, SOD3, and GPX RNA levels and/or protein distributions were similar between normal and KC corneas. (A) RT-PCR analysis of gene expression for SOD1, ALDH3A1, and SOD3 in normal and KC corneas. Lanes 1 to 8: normal corneas; lanes 9 to 16: KC corneas. H2O lane, water only. The intensities of the signals were normalized to value obtained for β2MG. The RNA levels for SOD1, ALDH3A1, or SOD3 were similar in normal and KC corneas. (B) Immunohistochemical analysis of KC corneas stained with rhodamine conjugated antibodies to SOD1, ALDH3A1, and GPX. The SOD1antibody stained the epithelial cell cytoplasm and endothelium. Anti-ALDH3A1 antibody heavily stained the stromal keratocytes and epithelial cells but did not stain the endothelial cells. GPX antibody staining was diffuse in epithelial cells, keratocytes, and endothelial cells. The KC corneas and normal corneas had similar staining patterns for SOD1, ALDH3A1, and GPX (normal cornea sections not shown). No staining was observed when only secondary antibody (IgG only) was used on the tissue sections. E, epithelium; S, stroma; Endo, endothelium; **sites of Bowman’s layer disruption where the stroma is in direct contact with the epithelium. Scale bar, 100 μm.
Figure 5.
 
The SOD1, ALDH3A1, SOD3, and GPX RNA levels and/or protein distributions were similar between normal and KC corneas. (A) RT-PCR analysis of gene expression for SOD1, ALDH3A1, and SOD3 in normal and KC corneas. Lanes 1 to 8: normal corneas; lanes 9 to 16: KC corneas. H2O lane, water only. The intensities of the signals were normalized to value obtained for β2MG. The RNA levels for SOD1, ALDH3A1, or SOD3 were similar in normal and KC corneas. (B) Immunohistochemical analysis of KC corneas stained with rhodamine conjugated antibodies to SOD1, ALDH3A1, and GPX. The SOD1antibody stained the epithelial cell cytoplasm and endothelium. Anti-ALDH3A1 antibody heavily stained the stromal keratocytes and epithelial cells but did not stain the endothelial cells. GPX antibody staining was diffuse in epithelial cells, keratocytes, and endothelial cells. The KC corneas and normal corneas had similar staining patterns for SOD1, ALDH3A1, and GPX (normal cornea sections not shown). No staining was observed when only secondary antibody (IgG only) was used on the tissue sections. E, epithelium; S, stroma; Endo, endothelium; **sites of Bowman’s layer disruption where the stroma is in direct contact with the epithelium. Scale bar, 100 μm.
Table 1.
 
RT-PCR Primers, Annealing Temperatures and Hybridization Oligonucleotides Used for Antioxidant Enzymes, Degradative Enzymes and Inhibitors
Table 1.
 
RT-PCR Primers, Annealing Temperatures and Hybridization Oligonucleotides Used for Antioxidant Enzymes, Degradative Enzymes and Inhibitors
Gene Forward Primer Reverse Primer Size (bp) Annealing Temp. (°C) Cycles (n) Internal Oligonucleotide
ALDH3A1 TTCATGAACAGTGGCCAG CTTGTCGTTGCTGGAGAA 407 56 33 TCATCAACCAGCGTGAGA
CATase CATTCGATCTCACCAAGGTTTGGCC AGCAGGTAGGGACAGTTCACAGG 251 55 38 TAATTACTTTGCTGAGGTTGAACAGATA
SOD1 AGTGCAGGGCATCATCAATTTCGAGCAG GATGCAATGGTCTCCTGAGAGTGAGATC 279 56 33 GGGAAGCATTAAGGACTGACTG
SOD3 GAGCTTCTCCTCTGCTCCAA GGGAAGATCGTCAGGTCAAA 300 56 35 TCTCTTGGAGGAGCTGGA
GTR GATCCTGTCAGCCCTGGGTTCTAAGA CGTCTACGATGATATGACCCTTGTCATC 337 54 41 ND
GST-pi CGGAGACCTCACCCTGTACCAGTC GCAGCAAGTCCAGCAGGTTGTAGTCA 307 54 35 ND
MMP-1 CGACTCTAGAAACACAAGAGCAAGA AAGGTTAGCTTACTGTCACACGCTT 786 60 40 ND
MMP-2 GGGACAAGAACCAGATCACATAC CTTCTCAAAGTTGTAGGTGGTGG 446 60 36 AATGGCAAGGAGTACAACAGCTGCACTGAT
MMP-7 GGTCACCTACAGGATCGTATCATAT CATCACTGCATTAGGATCAGAGGAA 373 60 40 ND
MMP-9 GTATTTGTTCAAGGATGGGAAGTAC GCAGGATGTCATAGGTCACGTAG 515 65 40 ND
MMP-14 CGCTACGCCATCCAGGGTCTCAAA CGGTCATCATCGGGCAGCACAAAA 496 62 31 CATAATGAAATCACTTTCTGCATCCAGAATTACAC
CV/L2 TACGGCTTTGAAGGAGCAAAT AGAATTAAGCAATGAGTCCTTTGA 378 64 33 GGACAGCATGTCTGGGGAAATTTTATCTTGAAACTG
TIMP-1 CTGTTGTTGCTGTGGCTGATAG CTTTTCAGAGCCTTGGAGGAC 506 62 33 ACCTTATACCAGCGTTATGAGATCAAGATGACC
TIMP-2 TCTGGAAACGACATTTATGG GTTGGAGGCCTGCTTATGGG 507 58 32 TGGGGTCTCGCTGGACGTTGGAGGAAAGAAGGAA
TIMP-3 CATCAAGCAGATGAAGATGTACC GGTAGTAGCAGGACTTGATCTTGC 268 60 33 CTCACCCTCTCCCAGCGCAAGGGGCTGAACTATC
B2-MG CTCGCGCTACTCTCTCTTTCTG GCTTACATGTCTCGATCCCACTT 334 60 30 GTCTTTCAGCAAGGACTGGTCTTTCTATCTCTTGTA
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×