December 2005
Volume 46, Issue 12
Free
Physiology and Pharmacology  |   December 2005
Cytochrome P450 3A Expression and Activity in the Rabbit Lacrimal Gland: Glucocorticoid Modulation and the Impact on Androgen Metabolism
Author Affiliations
  • Mayssa Attar
    From the Department of Pharmaceutical Sciences, University of Southern California, Los Angeles, California; and the
    Department of Pharmacokinetics and Drug Metabolism, Allergan Inc., Irvine, California.
  • Kah-Hiing John Ling
    Department of Pharmacokinetics and Drug Metabolism, Allergan Inc., Irvine, California.
  • Diane D.-S. Tang-Liu
    From the Department of Pharmaceutical Sciences, University of Southern California, Los Angeles, California; and the
    Department of Pharmacokinetics and Drug Metabolism, Allergan Inc., Irvine, California.
  • Nouri Neamati
    From the Department of Pharmaceutical Sciences, University of Southern California, Los Angeles, California; and the
  • Vincent H. L. Lee
    From the Department of Pharmaceutical Sciences, University of Southern California, Los Angeles, California; and the
Investigative Ophthalmology & Visual Science December 2005, Vol.46, 4697-4706. doi:10.1167/iovs.05-0139
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Mayssa Attar, Kah-Hiing John Ling, Diane D.-S. Tang-Liu, Nouri Neamati, Vincent H. L. Lee; Cytochrome P450 3A Expression and Activity in the Rabbit Lacrimal Gland: Glucocorticoid Modulation and the Impact on Androgen Metabolism. Invest. Ophthalmol. Vis. Sci. 2005;46(12):4697-4706. doi: 10.1167/iovs.05-0139.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

purpose. Cytochrome P450 3A (CYP3A) is an enzyme of paramount importance to drug metabolism. The expression and activity of CYP3A, an enzyme responsible for active androgen clearance, was investigated in the rabbit lacrimal gland.

methods. Analysis of CYP3A expression and activity was performed on lacrimal gland tissues obtained from naïve untreated and treated New Zealand White rabbits. For 5 days, treated rabbits received daily administration of vehicle or 0.1% or 1.0% dexamethasone, in the lower cul-de-sac of each eye. Changes in mRNA expression were monitored by real-time RT-PCR. Protein expression was confirmed by Western blot. Functional activity was measured by monitoring the metabolism of CYP3A probe substrates—namely, 7-benzyloxyquinoline (BQ) and [3H]testosterone.

results. Cytochrome P450 heme protein was detected at a concentration of 44.6 picomoles/mg protein, along with its redox partner NADPH reductase and specifically CYP3A6 in the naïve rabbit lacrimal gland. Genes encoding CYP3A6, in addition to the pregnane-X-receptor (PXR) and P-glycoprotein (P-gp) were expressed in the untreated tissue. BQ dealkylation was measured in the naïve rabbit lacrimal gland at a rate of 14 ± 7 picomoles/mg protein per minute. Changes in CYP3A6, P-gp, and androgen receptor mRNA expression levels were detected after dexamethasone treatment. In addition, dexamethasone treatment resulted in significant increases in BQ dealkylation and CYP3A6-mediated [3H]testosterone metabolism. Concomitant increases in CYP3A6-mediated hydroxylated testosterone metabolites were observed in the treated rabbits. Furthermore, ketoconazole, all-trans retinoic acid, and cyclosporine inhibited CYP3A6 mediated [3H]testosterone 6β hydroxylation in a concentration-dependent manner, with IC50 ranging from 3.73 to 435 μM.

conclusions. The results demonstrate, for the first time, the expression and activity of CYP3A6 in the rabbit lacrimal gland. In addition, this pathway was shown to be subject to modulation by a commonly prescribed glucocorticoid and can be inhibited by known CYP3A inhibitors.

Cytochrome P450 enzymes play crucial roles in the metabolism of drugs, as well as the biosynthesis or degradation of endogenous substrates, such as steroids. 1 2 This superfamily of heme-containing proteins is arranged into families, subfamilies, and isoforms, on the basis of percentage amino acid sequence identity, denoted by an Arabic numeral, followed by a capital letter, followed by an Arabic numeral, respectively. 3 Members of the cytochrome P450 3A (CYP3A) subfamily are arguably the most important enzymes that participate in the oxidative metabolism of drugs. More than 50% of drugs of structurally diverse chemical classes are estimated to be metabolized by CYP3A isoforms. 4 The expression of CYP3A is mediated through the nuclear receptor (NR1I12), termed the pregnane-X-receptor (PXR). 5 6 7  
CYP3A and P-glycoprotein (P-gp) may act together as a protective mechanism in cells to remove drugs or endogenous chemicals. 8 9 Detoxification is achieved through CYP3A, which mediates deactivation of substrates, and P-gp, which acts as an integral membrane protein to export substances from inside cells and from membranes to the outside in an adenosine triphosphate (ATP)-dependent manner. 10 CYP3A and P-gp share broad substrate overlap and tissue distribution. 11  
CYP3A is predominantly expressed in the liver; however, many extrahepatic tissues that are steroid sensitive express this enzyme. Altered CYP3A metabolism impacts androgen-mediated prostate carcinogenesis and the presentation of prostate cancer. 12 Local expression of CYP3A is relevant to steroid hormone action in the brain 13 and in the endometrium of premenopausal women. 14 In rats, testosterone 6β hydroxylation, a reaction catalyzed by CYP3A, 15 was measurable in the thymus. 16  
Normal lacrimal gland function is modulated by androgens. 17 The tear secretory system is composed of the main lacrimal gland and the accessory glands, which together generate approximately 98% of tear film. 18 Primary lacrimal deficiency is thought to result when the bioavailability of androgens falls below a critical level. 19 In a study in which female rabbits underwent ovariectomy, total serum testosterone decreased and significant regression of the lacrimal gland was observed. 20 As well, examination of lacrimal glands obtained from a female mouse model of Sjögren’s syndrome revealed that testosterone therapy suppresses lymphocyte infiltration, improves the functional activity, and increases androgen receptor expression. 21 22 Thus, information regarding androgen metabolic routes in the lacrimal gland may give important insight into the pathogenesis and assist in the development of therapeutic intervention. 
Keratoconjunctivitis sicca, commonly referred to as dry eye, is estimated to affect 10% to 15% of the U.S. population aged 65 ± 10 years. 23 24 Dry eye is diagnosed most frequently in aging patients, in particular, postmenopausal women. 25 Furthermore, postmenopausal women who use hormone replacement therapy, in particular estrogen alone, have a higher prevalence of dry eye syndrome than do postmenopausal women who have never used hormone-replacement therapy. 26 Younger women, with premature ovarian failure which is associated with hypoandrogenemia and hypoestrogenemia, are more likely to exhibit dry eye symptoms than age-matched control subjects. 27 Men who have dry eye tend to be older and thus are more likely to have lower levels of circulating androgens. 19 Together these observations support the notion that dry eye is connected to sex steroid levels. 
Oxidative metabolism of androgens to inactive metabolites is a relatively unexplored area in ocular tissues. Although, it was observed that testosterone could undergo oxidative metabolism in the rabbit eye. 28 29 However, the nature of the metabolites and the enzymes responsible have not been identified. With the arrival of more sensitive technologies, including molecular biology techniques and the characterization of probe substrates for specific enzymes, we now have tools that allow us to better study ocular metabolism. 
In this study, we set out to map the drug-metabolism machinery in the rabbit lacrimal gland and to assess its possible role in lacrimal gland physiology. We used testosterone as a tool to probe CYP3A activity. 15 We used dexamethasone, a known CYP3A inducer, 5 and cyclosporine, retinoic acid, and ketoconazole, known substrates and competitive inhibitors of CYP3A, 30 31 32 as tools to modulate CYP3A activity. These compounds were chosen primarily due to their common use in the study of CYP3A metabolism in other tissues and secondarily for their respective relevance as either ophthalmic drugs and/or endogenous substrates. 
The primary objective of this study was to determine whether CYP3A was expressed and active in the rabbit lacrimal gland and if so, could this activity be modulated. In this study, we confirmed the expression of the isoform CYP3A6 by quantitative RT-PCR and Western blot in the rabbit lacrimal gland and also measured the gene expression of PXR and P-gp in this tissue. We describe the modulation of CYP3A6-mediated metabolism of testosterone in the lacrimal gland in response to dexamethasone ophthalmic treatment and in vitro inhibition by ketoconazole, all-trans retinoic acid and cyclosporine. 
Materials and Methods
Chemicals and Reagents
Potassium phosphate (monobasic), potassium phosphate (dibasic), sodium citrate (tribasic), glucose-6-phosphate, and nicotinamide dinucleotide diphosphate (NADP)-sodium salt, cyclosporine, all-trans retinoic acid, ketoconazole, 17β-estradiol, dexamethasone 21-phosphate disodium, and [3H]testosterone were purchased from Sigma-Aldrich Chemical Co. (St. Louis, MO); 7-benzyloxyquinoline (BQ) from BD Gentest (Woburn, MA); 2β-, 6β-, 7α-, 15β-, and 16β-hydroxytestosterone from Steraloids, Inc. (Newport, RI); and glucose-6-phosphate dehydrogenase from Roche Diagnostics (Indianapolis, IN). Polyclonal antibody raised in rabbit against rat CYP3A1/2 was obtained from Xenotech LLC (Kansas City, KS) and polyclonal antibody raised in rabbit against rat NADPH reductase protein from Stressgen (Victoria, BC, Canada). All other chemicals and reagents were of the highest grade obtainable—reagent grade or better—unless otherwise noted. 
Animals
The care and use of all animals was in accordance with the guidelines outlined in the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research, in addition to the policies of the Allergan Animal Care and Use Committee. Male New Zealand White rabbits, weighing 3.0 to 3.5 kg (Charles River Laboratories, Inc., Wilmington, MA), were used for all studies described. Rabbits were euthanatized by an injection of an overdose of pentobarbital sodium (85 mg/kg) into the marginal vein of the ear. Lacrimal gland, small intestine, and liver tissues were harvested from four naïve untreated male New Zealand White rabbits. Treated rabbits received 0.9% saline (vehicle control group, n = 4) or 0.1% (n = 6) or 1.0% (n = 6) dexamethasone 21-phosphate disodium salt, four times daily, for 5 days. Each rabbit received a single 50-μL drop of the appropriate treatment at the designated time in the lower cul-de-sac of each eye. On the fifth day of treatment, 2 hours after the last dose, the rabbits were killed, and the lacrimal glands were collected for RNA extraction and microsome preparation. 
Microsome Preparation
Lacrimal gland and liver tissues collected from naïve untreated rabbits were processed into microsomes by standard differential centrifugation methodology 33 and 1.15% potassium chloride as the homogenization buffer. Small intestine microsomes from naïve untreated rabbits were prepared in a similar manner, except that the homogenization buffer contained 0.1 mM phenylmethylsulfonyl fluoride in 1.15% potassium chloride. Lacrimal gland microsomes prepared from treated rabbits were prepared in a similar manner, except that the homogenization buffer contained 0.1 mM Tris buffer, 0.1 mM EDTA, 0.1 mM phenylmethylsulfonyl fluoride, 20% glycerol, 0.001% aprotinin, and 0.001% leupeptin in 1.15% potassium chloride. Protein concentration was determined spectrophotometrically using a protein assay kit (Bio-Rad; Hercules, CA). Cytochrome P450 content was measured spectrophotometrically using the carbon monoxide difference method. 34  
Gene Expression Analysis
Total RNA was extracted from rabbit lacrimal gland and liver tissue (TRIzol Reagent; Invitrogen-Gibco, Grand Island, NY) according to the manufacturer’s suggested protocol. cDNA was synthesized using a cDNA synthesis kit (iScript; Bio-Rad Laboratories, Hercules, CA). The rabbit mRNA sequences for CYP3A6, P-glycoprotein (P-gp), pregnane-X-receptor (PXR), androgen receptor (AR), and β-actin were downloaded from GenBank (http://www.ncbi.nlm.nih.gov/GenBank). A computer program (Beacon Designer 2.0; Premier Biosoft International, Palo Alto, CA) was used to design the primer sequences. The primer sequences and other relevant information are presented in Table 1 . Real-time quantitative RT-PCR was performed in a thermocycler (iCycler; Bio-Rad, Hercules, CA). The amplification reaction mixture contained cDNA, sense and antisense primers, and SYBR green mastermix (iQ SYBR Green Supermix; Bio-Rad, Hercules, CA) in a total volume of 15 μL. The thermocycler parameters were as follows: an initial ramp to 95°C followed by denaturation at 95°C for 3 minutes; 35 cycles of denaturation at 95°C for 10 seconds, annealing at 58°C for 20 seconds. At the end of each of the 35 cycles, fluorescence of SYBR green was measured at an excitation wavelength of 470 nm and an emission wavelength of 530 nm. To analyze results after real-time RT-PCR experiments, we performed relative quantitation of the target gene transcript in comparison to the reference gene transcript β-actin by using the mathematical model (2−ΔΔCt), as previously described. 35  
Western Blot Analysis
Microsomal proteins (10 μg) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Incubations with primary antibody were for 60 minutes at room temperature. The membranes were incubated for 60 minutes at room temperature with the secondary antibody raised in goat against rabbit, with an alkaline phosphatase label (Bio-Rad) with gentle agitation. After secondary antibody incubation, the proteins were visualized using a chemiluminescent protein detection system (Immun-Star; Bio-Rad). 
7-BQ Assay
The dealkylation of 7-BQ was used to monitor CYP3A6 activity. Lacrimal gland, small intestine, and liver microsomes (1 mg/mL) were incubated at 37°C, in 0.2 mL final volume, with 100 μM BQ, for 60 minutes. Incubations included the NADPH regeneration system which contained 0.4 mM NADP, 4 mM glucose-6-phosphate, 2 mM MgCl2, 0.6 U/mL glucose-6-phosphate dehydrogenase, and 1 mM NAD in 100 mM potassium phosphate buffer. Rabbit liver microsomes were tested as a positive control. Incubations were performed in the absence of an NADPH-regenerating system as a negative control. All incubations were performed in triplicate. The production of the fluorescent BQ metabolite, 7-hydroxyquinoline, was measured using an excitation wavelength of 410 nm and emission wavelength of 530 nm, as detected by a fluorometer (FLUOstar Galaxy; BMG Labtechnologies GmbH, Offenburg, Germany). 
[3H]Testosterone In Vitro Metabolism
The microsomal incubation mixture contained 10 μM/2 μCi per milliliter [3H]testosterone and 1 mg/mL lacrimal gland microsomal protein in a total incubation volume of 1 mL. Incubations included the NADPH-regenerating system in 100 mM potassium phosphate buffer. Incubations were performed at 37°C in a shaking water bath (Precision, Chicago, IL). Incubations were performed in the absence of an NADPH regenerating system as a negative control. All incubations were performed in duplicate. A 500-μL aliquot was removed from the microsomal reaction mixture at the 0- and 60-minute time points and transferred to a test tube containing 1500 μL ice-cold dichloromethane. The resultant sample (2.0 mL) was centrifuged at 1000 g for 10 minutes. The supernatant was removed and the bottom layer was evaporated to dryness under nitrogen, the dried residue was reconstituted in 150 μL of mobile phase (water-methanol-acetonitrile, 65:34:1, vol/vol/vol) and 100 μL was injected onto the HPLC system. 
Chemical Inhibition Studies
Inhibition experiments using ketoconazole, all-trans retinoic acid (ATRA), and cyclosporine (0–1000 μM) as inhibitors of CYP3A were conducted in a similar manner. Both the inhibitor and [3H]testosterone acid were added to lacrimal gland microsomes (1 mg/mL) before addition of cofactors in a total volume of 0.5 mL and incubated for 60 minutes at 37°C. All incubations were performed in duplicate. IC50 was determined by fitting each inhibition data set to the four-parameter IC50 equation by nonlinear regression analysis (GraFit, ver. 4.0; Erithacus Software Ltd., London, UK). 
Bioanalysis
Authentic standards of the hydroxylated metabolites of testosterone, testosterone, [3H]testosterone, and 17β-estradiol were analyzed to establish the retention times of these compounds. A Hewlett Packard Model 1100 solvent (Agilent Technologies, Palo Alto, CA) equipped with a Hewlett Packard Model 1100 UV-visible detector (Agilent Technologies) and a radiomatic detector (model B150; PerkinElmer Life Sciences, Boston, MA) were used. Separation of [3H]testosterone and its metabolites was achieved on a C18 column (3.0 × 250 mm, 5-μm particle size; Luna (Phenomenex, Torrance, CA) heated to 40°C. Mobile phase A consisted of water-methanol-acetonitrile (65:34:1, vol/vol/vol) and mobile phase B consisted of water-methanol-acetonitrile (18:80:2, vol/vol/vol). The following gradient program with a flow rate of 0.5 mL/min was used: 100% mobile phase A from 0 to 10 minutes, a linear gradient to 40% mobile phase B from 10 to 22 minutes, a linear gradient to 100% B from 22 to 30 minutes, 100% B from 30 to 35 minutes, a linear gradient to 100% A from 35 to 36 minutes, and 100% A from 36 to 39 minutes. [3H]Testosterone and its metabolites were detected with radiochemical detection and UV visible detection (λ = 254 nm). An HPLC data-acquisition system (Hewlett Packard System 1.0a; Agilent Technologies) was used for determination of peak area and ratio of the radioactive peaks of [3H]testosterone and all potential metabolites. 
Statistical Analysis
Comparisons among the treatment group means were performed by one-way analysis of variance (ANOVA). A Dunnett multiple-comparison test was used to discriminate among the means. P < 0.05 was considered statistically significant. 
Results
Characterization of CYP3A in the Naïve Untreated Rabbit Lacrimal Gland
The carbon monoxide difference spectra method 34 was used to measure cytochrome P450 heme protein content in lacrimal gland and liver microsomes prepared from naïve untreated rabbit tissues. Cytochrome P450 heme protein content in lacrimal gland microsomes was determined to be 44.6 picomoles/mg protein compared with 729 picomoles/mg protein in liver microsomes. 
The expression of NADPH-reductase protein in the lacrimal gland was identified by Western blot analysis. A protein band with an estimated molecular mass of 78 kDa was detected in lacrimal gland and liver microsomes (Fig. 1A) . The expected molecular weight of NADPH-reductase protein is 78 kDa. 36 A second band with an estimated molecular mass of 50 kDa was detected in lacrimal gland and liver microsomes. This cross reactivity is probably cytochrome P450 heme protein which has an expected molecular mass of approximately 50 kDa. 37  
To evaluate CYP3A6 gene expression in the rabbit lacrimal gland, RT-PCR was performed. In addition, PXR, P-gp, and AR were probed in the rabbit lacrimal gland (Fig. 2) . CYP3A6 was expressed in the lacrimal gland, although expression levels were more than 240-fold lower than the levels detected in the liver, as measured using real-time RT-PCR. Transcript copies of PXR and P-gp were also detected in the rabbit lacrimal gland, and the levels of expression were >160-fold and >300-fold lower, respectively, than the levels detected in the liver. We also confirm previous observations that the AR is expressed in the lacrimal gland. 38  
The expression of CYP3A6 in the lacrimal gland was confirmed by Western blot analysis. A protein band with an estimated molecular mass of 50 kDa, the expected molecular mass of CYP3A6, 37 was detected in lacrimal gland and liver microsomes (Fig. 1B)
7-BQ dealkylation to hydroxyquinoline was measured in microsomes prepared from rabbit lacrimal gland, small intestine, and liver tissues (Table 2) . BQ is a probe substrate for CYP3A. 39 The rate of 7-BQ dealkylation was measured to be 14 ± 7 picomoles/mg protein per minute in the lacrimal gland compared with 7 ± 3 and 142 ± 18 picomoles/mg protein per minute in the small intestine and liver, respectively. The relative levels of BQ dealkylation in lacrimal gland and small intestine microsomes compared with liver were 10% and 5%, respectively. 
Effect of Dexamethasone Topical Administration
Real-time RT-PCR was used to examine quantitative differences in the expression of CYP3A6, PXR, P-gp, and AR after topical treatment with either 0.1% or 1.0% dexamethasone compared with treatment with vehicle control (0.9% saline). A significant increase in CYP3A6 expression (>2.5-fold, P = 0.01) was observed when comparing the vehicle control to the 1.0% treatment group (Fig. 3) . Significant induction of P-gp gene expression was observed after 0.1% (>4-fold) and 1.0% (>9-fold) dexamethasone. The treatment appeared to suppress AR expression in the rabbit lacrimal gland. In fact, both 0.1% (P = 0.03) and 1.0% (P = 0.02) dexamethasone decreased expression by greater than 50%. Finally, there was no significant quantitative difference in PXR expression after dexamethasone treatment, although, dexamethasone may have induced a tendency to increased expression. 
Topical treatment of rabbits with 1.0% dexamethasone resulted in a significant increase in the rate of BQ dealkylation in lacrimal gland microsomes (256 ± 51 picomoles/mg protein per minute) compared with rabbits receiving vehicle treatment (120 ± 9 picomoles/mg protein per minute; Fig. 4A ). Rabbits receiving 0.1% dexamethasone treatment did not result in a significant increase in the rate of BQ dealkylation in lacrimal gland microsomes compared with rabbits that received vehicle treatment. 
Similarly, topical treatment of rabbits with 1.0% resulted in a significant increase in the rate of CYP3A6-mediated [3H]testosterone hydroxylation in the lacrimal gland microsomes (41 ± 8 picomoles-equivalents (eq)/mg protein per minute), compared with rabbits receiving vehicle (7 ± 2 picomoles-eq/mg protein per minute; Fig. 4B ). 
A concomitant increase in [3H]testosterone metabolite formation was observed (Fig. 5) . In particular, increased rates of formation of metabolites specifically mediated by CYP3A such as 15β-, 6β- and 2β-hydroxytestosterone 15 was observed with increasing concentrations of dexamethasone, from 0.1% to 1.0%. 
In 0.9% saline-treated rabbits, 6β-hydroxytestosterone (CYP3A6-mediated formation) and 17β-estradiol (CYP19 mediated formation) were detected after incubation with [3H]testosterone (Table 3 , Fig. 5C ). After 0.1% dexamethasone treatment, CYP3A6 activity was induced, as indicated by the increased formation of 15β-, 6β, and 2β-hydroxytestosterone (Fig. 5B) . An increase in 17β-estradiol formation was also observed. After 1.0% dexamethasone treatment, a further induction of CYP3A6 activity was observed, along with an induction of CYP2A activity (7α-hydroxytestosterone) and CYP2B (16β-hydroxytestosterone; Fig. 5A ). The rates of formation of specific metabolites are presented in Table 3
Effect of Chemical Inhibition on [3H]Testosterone Metabolism in Lacrimal Gland Microsomes
The potential for ketoconazole, all-trans retinoic acid (ATRA), and cyclosporine to inhibit CYP3A6 mediated [3H]testosterone 6β hydroxylation was tested in rabbit lacrimal gland microsomes. All three compounds produced concentration-dependent inhibition of [3H]testosterone 6β hydroxylation, although, the degree of potency varied. Ketoconazole inhibited CYP3A6-mediated testosterone 6β hydroxylation in a concentration-dependent manner with an IC50 of 3.73 ± 0.83 μM (Fig. 6) . ATRA and cyclosporine were determined to be weaker inhibitors of [3H]testosterone 6β hydroxylation in the rabbit lacrimal gland with IC50 of 9.32 ± 1.05 and 435 ± 98 μM, respectively (data not shown). 
Discussion
The cytochrome P450 3A (CYP3A) gene subfamily, in particular human CYP3A4, is arguably the most important cytochrome P450 enzyme that participates in oxidative drug metabolism. CYP3A6 is the predominant CYP3A isoform expressed in the rabbit liver 40 and accordingly shares substrate overlap with CYP3A4. 41 42 Applying this knowledge, we used substrates and antibodies known to react with CYP3A6 and designed our PCR primers against the CYP3A6 sequence. Thus, similar to rabbit liver, CYP3A6 is an expressed and active CYP3A isoform in the rabbit lacrimal gland. 
CYP3A Expression and Activity in the Untreated Rabbit Lacrimal Gland
The cytochrome P450 monooxygenase system is composed of the cytochrome P450 heme component and its redox partner NADPH reductase. In this study, both proteins were detected in the rabbit lacrimal gland. The value determined for cytochrome P450 heme content in rabbit liver microsomes was in good agreement with values in the literature. 34 NADPH reductase protein was detected using Western blot. Together, these data establish the expression of the necessary component proteins of the cytochrome P450 monooxygenase system in the naïve rabbit lacrimal gland. 
Using BQ dealkylation to probe CYP3A6 activity, we measured approximately 10% the level of enzyme activity in the lacrimal gland as in the liver. For comparison, BQ dealkylation was measured in rabbit small intestine microsomes and determined to be approximately 5% the level of activity measured in liver microsomes. Although the level of expression of cytochrome P450 enzymes in the small intestine is considerably less than in the liver, the importance of CYP3A-mediated metabolism in the gut in first-pass metabolism is well established. Thus, although the relative level of CYP3A6 activity in the lacrimal gland compared with the liver may be low, the low level does not preclude it from being significant to local substrate levels. The expression of CYP3A6 in the rabbit lacrimal gland was confirmed by Western blot (Fig. 1B)
CYP3A6 gene expression was detected in the rabbit lacrimal gland (Fig. 2) . Furthermore, genes encoding proteins known to work with CYP3A6 and therefore often coexpressed—namely, P-gp and PXR—were also detected. The expression of P-gp in the lacrimal gland identifies another mechanism by which this tissue can decrease the levels of active steroids through efflux transport. Furthermore, the expression of PXR, the nuclear hormone receptor (NR1I12), is notable because this receptor can interact with the CYP3A gene to induce transcription after ligand binding to PXR. 5 Thus, it appears that the lacrimal gland possesses the ability to modulation of CYP3A6 and P-gp 43 activity locally. 
Induction of CYP3A after Dexamethasone Treatment
Dexamethasone is a known ligand of PXR 5 and thus can induce the expression of CYP3A and P-gp. Dexamethasone is often used as a tool compound to induce CYP3A activity in tissues where endogenous expression may be low relative to that in the liver. 44 45 In ophthalmology, dexamethasone is used as a topical anti-inflammatory agent. Together, these characteristics of dexamethasone made it an interesting test compound for our studies. 
After our observation that CYP3A6 was indeed expressed in the lacrimal gland, we then hypothesized that topical treatment with dexamethasone may increase local CYP3A6 activity. To test whether CYP3A6 activity could be induced in the lacrimal gland, rabbits were administered topical treatment with 0.9% saline, 0.1% dexamethasone, or 1.0% dexamethasone, and CYP3A6 expression and activity were compared among the different treatment groups. 
Real-time RT-PCR analysis revealed a statistically significant increase in CYP3A6 gene expression (>2.5-fold), after 1.0% dexamethasone treatment. Significant induction of P-gp gene expression was observed after 0.1% dexamethasone treatment (>4-fold) and 1.0% dexamethasone (>9-fold). The individual levels of expression of CYP3A6 and P-gp in the rabbits correlated well across treatment groups (R 2 = 0.63, data not shown), supporting the notion that the expression of these two protein is linked through PXR. Dexamethasone treatment suppressed AR expression in the rabbit lacrimal gland, perhaps due to a direct glucocorticoid effect on AR expression. Alternatively, the induction of mechanisms to decrease intracellular levels of active androgens through CYP3A6-mediated metabolism and P-gp efflux may underlie the suppression of AR expression. Androgens can modulate the expression of their own receptors, and AR expression is downregulated in orchiectomized rats. 46 Testosterone administration to these rats resulted in a marked increase in AR expression. Potentially, induction of an androgen clearance pathway in the rabbit lacrimal gland in response to dexamethasone may contribute to the decreased expression of AR due to decreased levels of active androgens. 
Using the two probe substrates BQ and [3H]testosterone, we determined that the rates of metabolism increased significantly with 1.0% dexamethasone treatment. Furthermore, these activities correlated well, with a correlation factor of 0.69 (data not shown) suggesting that a common enzyme was responsible for the metabolism of these substrates. In fact, when the metabolite profiles obtained after incubation of [3H]testosterone with rabbit lacrimal gland microsomes were examined, indeed the formation of metabolites specifically mediated by CYP3A6 was induced, after topical dexamethasone treatment. In saline-treated rabbits, testosterone metabolites formed specifically via CYP3A6- or CYP19-mediated metabolism were detected. After 0.1% dexamethasone treatment, CYP3A6 activity was induced as indicated by the increased formation of 15β-, 6β, and 2β-hydroxytestosterone. An increase in 17β-estradiol formation was also observed, indicating induction of CYP19. After 1.0% dexamethasone treatment, a further induction of CYP3A6 activity was observed, along with an induction of CYP2A activity and CYP2B. 
CYP3A6, CYP2A, and CYP2B activity produced inactive testosterone metabolites, whereas CYP19 produces the active metabolite, 17β-estradiol. Furthermore, of the metabolic pathways producing inactive metabolites, only CYP3A6 activity was detected in the saline-treated rabbit lacrimal gland microsomes. Finally, the degree of induction for each specific enzyme was unique to that enzyme. In lacrimal gland microsomes from saline-treated rabbits, CYP19 activity predominated over CYP3A6 activity. After 1.0% dexamethasone treatment and a significant induction of CYP3A6-mediated metabolism to inactive hydroxylated testosterone metabolites, this pathway becomes predominant to CYP19 activity. This raises the possibility that in vivo, different chemical stimulants may result in altered testosterone metabolic pathways in the lacrimal gland. Furthermore, these altered pathways would change the levels of active versus inactive androgens and thus may alter lacrimal gland function. 
Overall, our data indicate that dexamethasone induces CYP3A6 expression and activity in the rabbit lacrimal gland after topical administration. However, there is some question as to whether this effect results after dexamethasone absorption into the lacrimal gland through ocular tissues or drug delivery through the systemic circulation. Topical administration of 0.1% dexamethasone disodium phosphate (pro drug), results in low levels of dexamethasone systemic exposure, in rabbits and humans. 47 48 Although some systemic absorption of dexamethasone was observed after topical administration to rabbits, systemic delivery did not achieve detectable drug levels in the untreated eye, as measured by [14C]radioactivity. 47 Together these data suggest that the effects observed in our study in the lacrimal gland after either 0.1% or 1.0% dexamethasone disodium phosphate topical treatment were probably due in large part to absorption of the drug through ocular tissues. 
Inhibition of CYP3A Metabolism by Specific Inhibitors
Finally, the observation that the specific inhibitor ketoconazole 4 and the CYP3A substrates ATRA 31 and cyclosporine 4 can inhibit CYP3A6-mediated testosterone metabolism in lacrimal gland microsomes further supports the expression of CYP3A6 in this tissue. Thus, depending on the endogenous substrates or drugs present, local CYP3A6 metabolism may be altered through inhibition. 
Proposed Negative Feedback Loop in the Lacrimal Gland
Based on these preliminary data, a model emerges for the proposed role CYP3A may play in the lacrimal gland control of local androgen levels. Androgens play an important role as steroid gene regulators in many tissues, including ocular tissues, to maintain a healthy state. Tight control of local androgen levels is necessary in these tissues. Thus, expression of drug metabolizing enzymes in ocular tissues may allow for a “fine tuning” mechanism. 
We propose the negative-feedback model illustrated in Figure 7 . Under normal conditions in the lacrimal gland, testosterone delivered to the cell can act directly on the androgen receptor. Alternatively, depending on the needs of the cell or on the chemical stimulants present, testosterone can be converted to active metabolites that can interact with receptors or feedback to PXR when their levels exceed a critical point. The interaction of ligands with PXR can induce either or both CYP3A and P-gp that can then act to decrease the level of testosterone available in the cell. Dry eye is a multietiological condition associated with androgen deficiency, 19 49 and, potentially in the diseased state, alterations in these pathways may contribute to abnormal androgen levels. 
We also propose that these pathways may offer insight into the adverse effects associated with some ophthalmic drugs as well as potential targets for therapeutic strategy. Ophthalmic drugs could interact with CYP3A, P-gp, or PXR. For example, dexamethasone, an anti-inflammatory agent, could induce the expression of CYP3A, thereby increasing CYP3A-mediated hydroxylation of testosterone to inactive metabolites. This may be an undesirable effect in a patient with dry eye patient who probably already has decreased androgen levels. 19 25 Alternatively, cyclosporine, an immunosuppressive agent that is approved for the treatment of dry eye, may inhibit CYP3A-mediated hydroxylation of testosterone and thus contribute to maintenance of higher levels of active androgens in a patient with dry eye. Preventing deactivation of testosterone and potentially other active androgens may be beneficial in a patient with dry eye who has decreased androgen levels. 
Future studies should examine the effects of local CYP3A metabolism on other ophthalmic drugs. As well, the effect of other modulators of CYP3A activity on androgen levels both in vitro and in vivo should be examined. For example, studying the effects of IL-2, a cytokine released as part of the dry-eye response, on the activity of CYP3A in the lacrimal gland may offer some insight into the physiological role of this enzyme. Finally, the expression and activity of CYP3A should be examined in other ocular tissues affected by dry eye disease, such as the conjunctiva, and in other animal species and humans. 
Overall, we have demonstrated that CYP3A6 is expressed at the gene and protein levels in the rabbit lacrimal gland. Furthermore, CYP3A6 expression in the lacrimal gland is subject to induction after topical treatment with the commonly prescribed glucocorticoid dexamethasone. Finally, known inhibitors of CYP3A6 can inhibit the metabolism of testosterone in lacrimal gland microsomes. Further study of this local androgen deactivation pathway may provide insight into the mechanisms underlying the disease of dry eye and strategies for therapeutic intervention. 
 
Table 1.
 
Oligonucleotide Primers Used in the Gene Expressions Studies
Table 1.
 
Oligonucleotide Primers Used in the Gene Expressions Studies
GenBank* Accession Number Gene Sense Primer Antisense Primer Product Length (bp)
J05034 CYP3A6 TCCTTCATTATGCATTTGTTGGCC ACCACCATGTCCAGATATTCCATC 137
AF182217 PXR AATGGTTACCACTTCAACGTCCTG CCACGGCCACATCGGACAT 211
AY360144 P-gp TGGAGACATGACGGACAGCTT GCACCAAAACGAAACCTGAATGT 196
U16366 AR TCCACCTCCTCCAAGGACAGT CCAACGCCTCCACACCCAA 112
AF000313 β-Actin TCCTTCCTGGGCATGGAGTC GGATGTCCACGTCGCACTTC 76
Figure 1.
 
Western blot analysis of NADPH-reductase (A) and CYP3A (B) expression in rabbit liver and lacrimal gland (LG) microsomes. Left: estimated molecular mass in kilodaltons, based on the migration of the molecular mass markers electrophoresed in parallel. The expected molecular mass of NADPH reductase protein is ∼78 kDa and that of cytochrome P450 is ∼50 kDa.
Figure 1.
 
Western blot analysis of NADPH-reductase (A) and CYP3A (B) expression in rabbit liver and lacrimal gland (LG) microsomes. Left: estimated molecular mass in kilodaltons, based on the migration of the molecular mass markers electrophoresed in parallel. The expected molecular mass of NADPH reductase protein is ∼78 kDa and that of cytochrome P450 is ∼50 kDa.
Figure 2.
 
Reverse transcription-polymerase chain reaction product analysis for mRNA expression by genes encoding CYP3A6, P-gp, AR, and PXR in the untreated rabbit liver (L) and lacrimal gland (LG). Left: molecular size of the DNA marker (MM) electrophoresed in parallel on an ethidium bromide stained 2% agarose gel. The specific RT-PCR products had the following expected molecular sizes (in base pairs): CYP3A6, 137; P-gp, 196; AR, 112; and PXR, 211.
Figure 2.
 
Reverse transcription-polymerase chain reaction product analysis for mRNA expression by genes encoding CYP3A6, P-gp, AR, and PXR in the untreated rabbit liver (L) and lacrimal gland (LG). Left: molecular size of the DNA marker (MM) electrophoresed in parallel on an ethidium bromide stained 2% agarose gel. The specific RT-PCR products had the following expected molecular sizes (in base pairs): CYP3A6, 137; P-gp, 196; AR, 112; and PXR, 211.
Table 2.
 
Rate of 7-BQ Dealkylation in Microsomes Prepared from Rabbit Lacrimal Gland, Small Intestine, and Liver Tissues
Table 2.
 
Rate of 7-BQ Dealkylation in Microsomes Prepared from Rabbit Lacrimal Gland, Small Intestine, and Liver Tissues
Tissue Rate of BQ Dealkylation ± SD (picomoles/mg protein per minute)*
Lacrimal gland 14 ± 7
Small intestine 7 ± 3
Liver 142 ± 18
Figure 3.
 
Gene expression analysis in rabbit lacrimal gland tissues after topical administration of 0.9% saline, 0.1% dexamethasone, or 1.0% dexamethasone, four times daily, for 5 days. Four to six rabbits per treatment group. Real-time RT-PCR experiments were performed in at least duplicate for each rabbit and each gene, including β-actin. Each bar represents the means determined from at least three rabbits; error bars, SEM. *Statistically significant (P < 0.05).
Figure 3.
 
Gene expression analysis in rabbit lacrimal gland tissues after topical administration of 0.9% saline, 0.1% dexamethasone, or 1.0% dexamethasone, four times daily, for 5 days. Four to six rabbits per treatment group. Real-time RT-PCR experiments were performed in at least duplicate for each rabbit and each gene, including β-actin. Each bar represents the means determined from at least three rabbits; error bars, SEM. *Statistically significant (P < 0.05).
Figure 4.
 
Effect of administration of topical dexamethasone on the rate of 7-BQ dealkylation (A) and the rate of [3H]testosterone hydroxylation (B) after 60 minutes of incubation at 37°C with lacrimal gland microsomes obtained from rabbits after topical administration of 0.9% saline, 0.1% dexamethasone, or 1.0% dexamethasone four times daily, for 5 days. Three rabbits per treatment group. Each incubation was performed in triplicate. *Statistically significant (P < 0.05).
Figure 4.
 
Effect of administration of topical dexamethasone on the rate of 7-BQ dealkylation (A) and the rate of [3H]testosterone hydroxylation (B) after 60 minutes of incubation at 37°C with lacrimal gland microsomes obtained from rabbits after topical administration of 0.9% saline, 0.1% dexamethasone, or 1.0% dexamethasone four times daily, for 5 days. Three rabbits per treatment group. Each incubation was performed in triplicate. *Statistically significant (P < 0.05).
Figure 5.
 
Representative HPLC radiochromatograms obtained after 60 minutes of incubation at 37°C of [3H]testosterone with lacrimal gland microsomes prepared from rabbits receiving (A) 1.0% dexamethasone, (B) 0.1% dexamethasone, or (C) 0.9% saline in the presence of an NADPH-regenerating system. x-axis: radioactivity in counts per million; y-axis: HPLC retention time in minutes.
Figure 5.
 
Representative HPLC radiochromatograms obtained after 60 minutes of incubation at 37°C of [3H]testosterone with lacrimal gland microsomes prepared from rabbits receiving (A) 1.0% dexamethasone, (B) 0.1% dexamethasone, or (C) 0.9% saline in the presence of an NADPH-regenerating system. x-axis: radioactivity in counts per million; y-axis: HPLC retention time in minutes.
Table 3.
 
Rates of [3H]Testosterone Metabolite Formation in Lacrimal Gland Microsomes Prepared from Rabbit Tissues following Topical Treatment
Table 3.
 
Rates of [3H]Testosterone Metabolite Formation in Lacrimal Gland Microsomes Prepared from Rabbit Tissues following Topical Treatment
Treatment CYP3A CYP2A CYP2B CYP19
15β 16β 17β-Estradiol
0.9% Saline 0.24 ± 0.26 1.79 ± 0.52 ND ND ND 9.79 ± 0.69
0.1% Dexamethasone 2.31 ± 0.54* 1.88 ± 0.71 0.12 ± 0.13 0.13 ± 0.21 0.26 ± 0.36 12.5 ± 1.6, †
1.0% Dexamethasone 7.34 + 2.73* 8.61 ± 3.62, † 4.34 ± 2.20, † 2.47 ± 0.99, † 4.74 ± 1.32* 17.4 ± 3.6*
Figure 6.
 
The effect of ketoconazole on [3H]testosterone 6β hydroxylation in rabbit lacrimal gland microsomes. Control activity is the measured rate of [3H]testosterone 6β hydroxylation when 10 μM/2 μCi per milliliter [3H]testosterone is incubated with 1 mg/mL rabbit lacrimal gland microsomes, at 37°C, for 60 minutes, in the absence of inhibitor. Each data point represents the mean value from duplicate incubations.
Figure 6.
 
The effect of ketoconazole on [3H]testosterone 6β hydroxylation in rabbit lacrimal gland microsomes. Control activity is the measured rate of [3H]testosterone 6β hydroxylation when 10 μM/2 μCi per milliliter [3H]testosterone is incubated with 1 mg/mL rabbit lacrimal gland microsomes, at 37°C, for 60 minutes, in the absence of inhibitor. Each data point represents the mean value from duplicate incubations.
Figure 7.
 
Illustration of a proposed negative feedback loop through potential testosterone metabolic and efflux pathways that exist to control the levels of active and inactive steroids in the lacrimal gland.
Figure 7.
 
Illustration of a proposed negative feedback loop through potential testosterone metabolic and efflux pathways that exist to control the levels of active and inactive steroids in the lacrimal gland.
The authors thank Darius Babusis and Vivian Liu for technical assistance in the rabbit in vivo studies and functional activity studies, respectively (Department of Pharmacokinetics and Drug Metabolism, Allergan Inc., Irvine, CA) and Carmen Plasencia for technical assistance in the design of gene expression studies and Ian Haworth for helpful discussions (both from the Department of Pharmaceutical Sciences, University of Southern California, Los Angeles, CA). 
ParkinsonA. An overview of current cytochrome P450 technology for assessing the safety and efficacy of new materials. Toxicol Pathol. 1996;24:48–57. [PubMed]
WilkinsonGR. Pharmacokinetics: the dynamics of drug absorption, distribution, and elimination.HardmanAJG LimbirdLE Goodman GilmanA eds. Goodman and Gilman’s: The Pharmacological Basis of Therapeutics. 2001;3–30.McGraw-Hill New York.
NebertDW, AdesnikM, CoonMJ, et al. The P450 gene superfamily: recommended nomenclature. DNA. 1987;6:1–11. [CrossRef] [PubMed]
WrightonSA, ThummelKE. CYP3A.LevyRH ThummelKE TragerWF HanstenPD EichelbaumM eds. Metabolic Drug Interactions. 2000;115–133.Lippincott Williams & Wilkins Philadelphia.
KliewerSA, MooreJT, WadeL, et al. An orphan nuclear receptor activated by pregnanes defines a novel steroid signaling pathway. Cell. 1998;92:73–82. [CrossRef] [PubMed]
LehmannJM, McKeeDD, WatsonMA, et al. The human orphan nuclear receptor PXR is activated by compounds that regulate CYP3A4 gene expression and cause drug interactions. J Clin Invest. 1998;102:1016–1023. [CrossRef] [PubMed]
BlumbergB, SabbaghW, Jr, JuguilonH, et al. SXR, a novel steroid and xenobiotic-sensing nuclear receptor. Genes Dev. 1998;12:3195–3205. [CrossRef] [PubMed]
CumminsCL, JacobsenW, BenetLZ. Unmasking the dynamic interplay between intestinal P-glycoprotein and CYP3A4. J Pharmacol Exp Ther. 2002;300:1036–1045. [CrossRef] [PubMed]
BenetLZ, CumminsCL, WuCY. Unmasking the dynamic interplay between efflux transporters and metabolic enzymes. Int J Pharm. 2004;277:3–9. [CrossRef] [PubMed]
Leveille-WebsterCR, AriasIM. The biology of the P-glycoproteins. J Membr Biol. 1995;143:89–102. [PubMed]
WacherVJ, WuCY, BenetLZ. Overlapping substrate specificities and tissue distribution of cytochrome P450 3A and P-glycoprotein: implications for drug delivery and activity in cancer chemotherapy. Mol Carcinog. 1995;13:129–134. [CrossRef] [PubMed]
RebbeckTR, JaffeJM, WalkerAH, et al. Modification of clinical presentation of prostate tumors by a novel genetic variant in CYP3A4. J Natl Cancer Inst. 1998;90:1225–1229. [CrossRef] [PubMed]
HagemeyerCE, RosenbrockH, DitterM, et al. Predominantly neuronal expression of cytochrome P450 isoforms CYP3A11 and CYP3A13 in mouse brain. Neuroscience. 2003;117:521–529. [CrossRef] [PubMed]
SarkarMA, VadlamuriV, GhoshS, et al. Expression and cyclic variability of CYP3A4 and CYP3A7 isoforms in human endometrium and cervix during the menstrual cycle. Drug Metab Dispos. 2003;31:1–6. [CrossRef] [PubMed]
WaxmanDJ, AttisanoC, GuengerichFP, et al. Human liver microsomal steroid metabolism: identification of the major microsomal steroid hormone 6 beta-hydroxylase cytochrome P-450 enzyme. Arch Biochem Biophys. 1988;263:424–436. [CrossRef] [PubMed]
BorlakJ, SchulteI, ThumT. Androgen metabolism in thymus of fetal and adult rats. Drug Metab Dispos. 2004;32:675–679. [CrossRef] [PubMed]
SullivanDA, WickhamLA, RochaEM, et al. Influence of gender, sex steroid hormones, and the hypothalamic-pituitary axis on the structure and function of the lacrimal gland. Adv Exp Med Biol. 1998;438:11–42. [PubMed]
MoroiSE, LichterPR. Ocular pharmacology.HardmanAJG LimbirdLE GoodmanGilmanA eds. Goodman and Gilman’s: The Pharmacological Basis of Therapeutics. 2001;1821–1848.McGraw-Hill New York.
MircheffAK, WarrenDW, WoodRL. Hormonal support of lacrimal function, primary lacrimal deficiency, autoimmunity, and peripheral tolerance in the lacrimal gland. Ocul Immunol Inflamm. 1996;4:145–172. [CrossRef] [PubMed]
AzzaroloAM, MircheffAK, KaswanRL, et al. Androgen support of lacrimal gland function. Endocrine. 1997;6:39–45. [CrossRef] [PubMed]
SatoEH, SullivanDA. Comparative influence of steroid hormones and immunosuppressive agents on autoimmune expression in lacrimal glands of a female mouse model of Sjögren’s syndrome. Invest Ophthalmol Vis Sci. 1994;35:2632–2642. [PubMed]
OnoM, RochaFJ, SullivanDA. Immunocytochemical location and hormonal control of androgen receptors in lacrimal tissues of the female MRL/Mp-lpr/lpr mouse model of Sjogren’s syndrome. Exp Eye Res. 1995;61:659–666. [CrossRef] [PubMed]
MossSE, KleinR, KleinBE. Prevalence of and risk factors for dry eye syndrome. Arch Ophthalmol. 2000;118:1264–1268. [CrossRef] [PubMed]
ClarkAF, YorioT. Ophthalmic drug discovery. Nat Rev Drug Discov. 2003;2:448–459. [CrossRef] [PubMed]
SternME, BeuermanRW, FoxRI, et al. The pathology of dry eye: the interaction between the ocular surface and lacrimal glands. Cornea. 1998;17:584–589. [CrossRef] [PubMed]
SchaumbergDA, BuringJE, SullivanDA, et al. Hormone replacement therapy and dry eye syndrome. JAMA. 2001;286:2114–2119. [CrossRef] [PubMed]
SmithJA, VitaleS, ReedGF, et al. Dry eye signs and symptoms in women with premature ovarian failure. Arch Ophthalmol. 2004;122:151–156. [CrossRef] [PubMed]
SouthrenAL, AltmanK, VittekJ, et al. Steroid metabolism in ocular tissues of the rabbit. Invest Ophthalmol. 1976;15:222–228. [PubMed]
StarkaL, ObenbergerJ. Testosterone metabolism in various tissues of the intact and inflamed rabbit eye. Ophthalmic Res. 1976;8:374–378. [CrossRef]
KronbachT, FischerV, MeyerUA. Cyclosporine metabolism in human liver: identification of a cytochrome P-450III gene family as the major cyclosporine-metabolizing enzyme explains interactions of cyclosporine with other drugs. Clin Pharmacol Ther. 1988;43:630–635. [CrossRef] [PubMed]
MarillJ, CresteilT, LanotteM, et al. Identification of human cytochrome P450s involved in the formation of all-trans-retinoic acid principal metabolites. Mol Pharmacol. 2000;58:1341–1348. [PubMed]
FowlerSM, RileyRJ, PritchardMP, et al. Amino acid 305 determines catalytic center accessibility in CYP3A4. Biochemistry. 2000;39:4406–4414. [CrossRef] [PubMed]
PearceRE, McIntyreCJ, MadanA, et al. Effects of freezing, thawing, and storing human liver microsomes on cytochrome P450 activity. Arch Biochem Biophys. 1996;331:145–169. [CrossRef] [PubMed]
OmuraT, SatoR. The carbon monoxide-binding pigment of liver microsomes. I. Evidence for its hemoprotein nature. J Biol Chem. 1964;239:2370–2378. [PubMed]
PfafflMW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001;29:E45. [CrossRef] [PubMed]
Ortiz de MontellanoPR. The cytochrome P450 oxidative system.WoolfTF eds. Handbook of Drug Metabolism. 1999;109–130.Marcel Dekker Inc New York.
ShimadaT, YamazakiH, MimuraM, et al. Interindividual variations in human liver cytochrome P-450 enzymes involved in the oxidation of drugs, carcinogens and toxic chemicals: studies with liver microsomes of 30 Japanese and 30 Caucasians. J Pharmacol Exp Ther. 1994;270:414–423. [PubMed]
RochaEM, WickhamLA, da SilveiraLA, et al. Identification of androgen receptor protein and 5alpha-reductase mRNA in human ocular tissues. Br J Ophthalmol. 2000;84:76–84. [CrossRef] [PubMed]
StresserDM, TurnerSD, BlanchardAP, et al. Cytochrome P450 fluorometric substrates: identification of isoform-selective probes for rat CYP2D2 and human CYP3A4. Drug Metab Dispos. 2002;30:845–852. [CrossRef] [PubMed]
DaletC, ClairP, DaujatM, et al. Complete sequence of cytochrome P450 3c cDNA and presence of two mRNA species with 3′ untranslated regions of different lengths. DNA. 1988;7:39–46. [CrossRef] [PubMed]
PotenzaCL, PendurthiUR, StromDK, et al. Regulation of the rabbit cytochrome P-450 3c gene: age-dependent expression and transcriptional activation by rifampicin. J Biol Chem. 1989;264:16222–16228. [PubMed]
DonatoMT, CastellJV. Strategies and molecular probes to investigate the role of cytochrome P450 in drug metabolism: focus on in vitro studies. Clin Pharmacokinet. 2003;42:153–178. [CrossRef] [PubMed]
GeickA, EichelbaumM, BurkO. Nuclear receptor response elements mediate induction of intestinal mdr1 by rifampin. J Biol Chem. 2001;276:14581–14587. [CrossRef] [PubMed]
HoffmeyerS, BurkO, von RichterO, et al. Functional polymorphisms of the human multidrug-resistance gene: multiple sequence variations and correlation of one allele with P-glycoprotein expression and activity in vivo. Proc Natl Acad Sci USA. 2000;97:3473–3478. [CrossRef] [PubMed]
HaagM, FautrelA, GuillouzoA, et al. Expression of cytochromes P450 3A in mouse lung: effects of dexamethasone and pregnenolone 16alpha-carbonitrile. Arch Toxicol. 2003;77:145–149. [PubMed]
RochaFJ, WickhamLA, PenaJD, et al. Influence of gender and the endocrine environment on the distribution of androgen receptors in the lacrimal gland. J Steroid Biochem Mol Biol. 1993;46:737–749. [CrossRef] [PubMed]
RosenblumC, DenglerRE, Jr, GeoffroyRF. Ocular absorption of dexamethasone phosphate disodium by the rabbit. Arch Ophthalmol. 1967;77:234–237. [CrossRef] [PubMed]
WeijtensO, SchoemakerRC, RomijnFP, et al. Intraocular penetration and systemic absorption after topical application of dexamethasone disodium phosphate. Ophthalmology. 2002;109:1887–1891. [CrossRef] [PubMed]
SullivanDA, BelangerA, CermakJM, et al. Are women with Sjogren’s syndrome androgen-deficient?. J Rheumatol. 2003;30:2413–2419. [PubMed]
Figure 1.
 
Western blot analysis of NADPH-reductase (A) and CYP3A (B) expression in rabbit liver and lacrimal gland (LG) microsomes. Left: estimated molecular mass in kilodaltons, based on the migration of the molecular mass markers electrophoresed in parallel. The expected molecular mass of NADPH reductase protein is ∼78 kDa and that of cytochrome P450 is ∼50 kDa.
Figure 1.
 
Western blot analysis of NADPH-reductase (A) and CYP3A (B) expression in rabbit liver and lacrimal gland (LG) microsomes. Left: estimated molecular mass in kilodaltons, based on the migration of the molecular mass markers electrophoresed in parallel. The expected molecular mass of NADPH reductase protein is ∼78 kDa and that of cytochrome P450 is ∼50 kDa.
Figure 2.
 
Reverse transcription-polymerase chain reaction product analysis for mRNA expression by genes encoding CYP3A6, P-gp, AR, and PXR in the untreated rabbit liver (L) and lacrimal gland (LG). Left: molecular size of the DNA marker (MM) electrophoresed in parallel on an ethidium bromide stained 2% agarose gel. The specific RT-PCR products had the following expected molecular sizes (in base pairs): CYP3A6, 137; P-gp, 196; AR, 112; and PXR, 211.
Figure 2.
 
Reverse transcription-polymerase chain reaction product analysis for mRNA expression by genes encoding CYP3A6, P-gp, AR, and PXR in the untreated rabbit liver (L) and lacrimal gland (LG). Left: molecular size of the DNA marker (MM) electrophoresed in parallel on an ethidium bromide stained 2% agarose gel. The specific RT-PCR products had the following expected molecular sizes (in base pairs): CYP3A6, 137; P-gp, 196; AR, 112; and PXR, 211.
Figure 3.
 
Gene expression analysis in rabbit lacrimal gland tissues after topical administration of 0.9% saline, 0.1% dexamethasone, or 1.0% dexamethasone, four times daily, for 5 days. Four to six rabbits per treatment group. Real-time RT-PCR experiments were performed in at least duplicate for each rabbit and each gene, including β-actin. Each bar represents the means determined from at least three rabbits; error bars, SEM. *Statistically significant (P < 0.05).
Figure 3.
 
Gene expression analysis in rabbit lacrimal gland tissues after topical administration of 0.9% saline, 0.1% dexamethasone, or 1.0% dexamethasone, four times daily, for 5 days. Four to six rabbits per treatment group. Real-time RT-PCR experiments were performed in at least duplicate for each rabbit and each gene, including β-actin. Each bar represents the means determined from at least three rabbits; error bars, SEM. *Statistically significant (P < 0.05).
Figure 4.
 
Effect of administration of topical dexamethasone on the rate of 7-BQ dealkylation (A) and the rate of [3H]testosterone hydroxylation (B) after 60 minutes of incubation at 37°C with lacrimal gland microsomes obtained from rabbits after topical administration of 0.9% saline, 0.1% dexamethasone, or 1.0% dexamethasone four times daily, for 5 days. Three rabbits per treatment group. Each incubation was performed in triplicate. *Statistically significant (P < 0.05).
Figure 4.
 
Effect of administration of topical dexamethasone on the rate of 7-BQ dealkylation (A) and the rate of [3H]testosterone hydroxylation (B) after 60 minutes of incubation at 37°C with lacrimal gland microsomes obtained from rabbits after topical administration of 0.9% saline, 0.1% dexamethasone, or 1.0% dexamethasone four times daily, for 5 days. Three rabbits per treatment group. Each incubation was performed in triplicate. *Statistically significant (P < 0.05).
Figure 5.
 
Representative HPLC radiochromatograms obtained after 60 minutes of incubation at 37°C of [3H]testosterone with lacrimal gland microsomes prepared from rabbits receiving (A) 1.0% dexamethasone, (B) 0.1% dexamethasone, or (C) 0.9% saline in the presence of an NADPH-regenerating system. x-axis: radioactivity in counts per million; y-axis: HPLC retention time in minutes.
Figure 5.
 
Representative HPLC radiochromatograms obtained after 60 minutes of incubation at 37°C of [3H]testosterone with lacrimal gland microsomes prepared from rabbits receiving (A) 1.0% dexamethasone, (B) 0.1% dexamethasone, or (C) 0.9% saline in the presence of an NADPH-regenerating system. x-axis: radioactivity in counts per million; y-axis: HPLC retention time in minutes.
Figure 6.
 
The effect of ketoconazole on [3H]testosterone 6β hydroxylation in rabbit lacrimal gland microsomes. Control activity is the measured rate of [3H]testosterone 6β hydroxylation when 10 μM/2 μCi per milliliter [3H]testosterone is incubated with 1 mg/mL rabbit lacrimal gland microsomes, at 37°C, for 60 minutes, in the absence of inhibitor. Each data point represents the mean value from duplicate incubations.
Figure 6.
 
The effect of ketoconazole on [3H]testosterone 6β hydroxylation in rabbit lacrimal gland microsomes. Control activity is the measured rate of [3H]testosterone 6β hydroxylation when 10 μM/2 μCi per milliliter [3H]testosterone is incubated with 1 mg/mL rabbit lacrimal gland microsomes, at 37°C, for 60 minutes, in the absence of inhibitor. Each data point represents the mean value from duplicate incubations.
Figure 7.
 
Illustration of a proposed negative feedback loop through potential testosterone metabolic and efflux pathways that exist to control the levels of active and inactive steroids in the lacrimal gland.
Figure 7.
 
Illustration of a proposed negative feedback loop through potential testosterone metabolic and efflux pathways that exist to control the levels of active and inactive steroids in the lacrimal gland.
Table 1.
 
Oligonucleotide Primers Used in the Gene Expressions Studies
Table 1.
 
Oligonucleotide Primers Used in the Gene Expressions Studies
GenBank* Accession Number Gene Sense Primer Antisense Primer Product Length (bp)
J05034 CYP3A6 TCCTTCATTATGCATTTGTTGGCC ACCACCATGTCCAGATATTCCATC 137
AF182217 PXR AATGGTTACCACTTCAACGTCCTG CCACGGCCACATCGGACAT 211
AY360144 P-gp TGGAGACATGACGGACAGCTT GCACCAAAACGAAACCTGAATGT 196
U16366 AR TCCACCTCCTCCAAGGACAGT CCAACGCCTCCACACCCAA 112
AF000313 β-Actin TCCTTCCTGGGCATGGAGTC GGATGTCCACGTCGCACTTC 76
Table 2.
 
Rate of 7-BQ Dealkylation in Microsomes Prepared from Rabbit Lacrimal Gland, Small Intestine, and Liver Tissues
Table 2.
 
Rate of 7-BQ Dealkylation in Microsomes Prepared from Rabbit Lacrimal Gland, Small Intestine, and Liver Tissues
Tissue Rate of BQ Dealkylation ± SD (picomoles/mg protein per minute)*
Lacrimal gland 14 ± 7
Small intestine 7 ± 3
Liver 142 ± 18
Table 3.
 
Rates of [3H]Testosterone Metabolite Formation in Lacrimal Gland Microsomes Prepared from Rabbit Tissues following Topical Treatment
Table 3.
 
Rates of [3H]Testosterone Metabolite Formation in Lacrimal Gland Microsomes Prepared from Rabbit Tissues following Topical Treatment
Treatment CYP3A CYP2A CYP2B CYP19
15β 16β 17β-Estradiol
0.9% Saline 0.24 ± 0.26 1.79 ± 0.52 ND ND ND 9.79 ± 0.69
0.1% Dexamethasone 2.31 ± 0.54* 1.88 ± 0.71 0.12 ± 0.13 0.13 ± 0.21 0.26 ± 0.36 12.5 ± 1.6, †
1.0% Dexamethasone 7.34 + 2.73* 8.61 ± 3.62, † 4.34 ± 2.20, † 2.47 ± 0.99, † 4.74 ± 1.32* 17.4 ± 3.6*
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×