November 2004
Volume 45, Issue 11
Free
Glaucoma  |   November 2004
Gene and Protein Expression Changes in Human Trabecular Meshwork Cells Treated with Transforming Growth Factor-β
Author Affiliations
  • Xiujun Zhao
    From the Section on Aging and Ocular Disease, National Eye Institute, National Institutes of Health, Bethesda, Maryland; and
  • Keri E. Ramsey
    Neurogenomics Division, Translational Genomics Research Institute, Phoenix, Arizona.
  • Dietrich A. Stephan
    Neurogenomics Division, Translational Genomics Research Institute, Phoenix, Arizona.
  • Paul Russell
    From the Section on Aging and Ocular Disease, National Eye Institute, National Institutes of Health, Bethesda, Maryland; and
Investigative Ophthalmology & Visual Science November 2004, Vol.45, 4023-4034. doi:10.1167/iovs.04-0535
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Xiujun Zhao, Keri E. Ramsey, Dietrich A. Stephan, Paul Russell; Gene and Protein Expression Changes in Human Trabecular Meshwork Cells Treated with Transforming Growth Factor-β. Invest. Ophthalmol. Vis. Sci. 2004;45(11):4023-4034. doi: 10.1167/iovs.04-0535.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

purpose. To determine the genomic and proteomic expression changes in human trabecular meshwork cells when they are treated with transforming growth factor (TGF)-β.

methods. Human trabecular meshwork cells from five donors were cultured for 3 days with 1 ng/mL of either TGF-β1 or -β2. Changes in gene expression determined with gene microarrays and alterations in protein expression detected by two-dimensional gel electrophoresis and matrix-assisted laser desorption/ionization-time-of-flight mass spectrometry (MALDI-TOF-MS) were studied in these cells after the incubation.

results. With both TGF-βs, there was a substantial upregulation of genes that were related to secreted proteins or extracellular matrix. This result was consistent with pathologic changes observed in disease and with experiments on perfused trabecular meshwork. Several of the gene changes suggest that other signaling pathways, such as ErbB and Wnt, were altered. Changes in enzyme expression in the prostaglandin pathway indicated that the prostaglandins may have a different cellular profile in the presence of glaucoma. Two genes, osteoblast-specific factor 2 and corneal-derived transcript 6, which are highly expressed in the cells under normal conditions, were substantially upregulated with the TGF-βs. Proteomic analysis indicated that there was increased proteolysis of vimentin with both treatments. Tropomyosin 1α was increased in both gene and protein expression, suggesting alterations of the cytoskeleton by the disease. The TGF-β1 treatment caused more robust changes than those induced by TGF-β2. Three genes—aldose reductase, thioredoxin reductase 1, and glucose-6-phosphate 1-dehydrogenase—were identified that were downregulated in expression. These genes had decreases in protein expression with TGF-β1 treatment but had little change in either gene or protein expression with TGF-β2.

conclusions. Human trabecular meshwork cells can be subjected to increased levels of TGF-β for several years as a result of glaucoma. The results indicate that changes in extracellular matrix as well as alterations in cytoskeletal proteins occur in these cells as a result of increased TGF-β. These results are consistent with changes observed in the trabecular meshwork in glaucoma and suggest that at least some of the histologic alterations observed in the meshwork in glaucoma may be the result of increased TGF-βs.

Subtypes of transforming growth factor (TGF)-β can have profound effects on several tissues. Overexpression of TGF-β1 causes a disruption of the development of the anterior segment in the eye, 1 whereas lack of expression of TGF-β2 alters corneal morphogenesis during embryonic development in the mouse. 2 Alterations in gene expression as a result of TGF-β have been observed in relatively short periods, but the long-term effects in tissues of chronic exposure to TGF-β have been less well studied. Both TGF-β1 and -β2 are normally present in the aqueous humor of the eye, 3 4 and the level of active TGF-β2 is increased in eyes that are glaucomatous. 5 6 Although many tissues in the anterior part of the eye are bathed in aqueous humor, this study looked at the effects of TGF-β on the trabecular meshwork. The human trabecular meshwork (HTM) is the tissue that is the major site of outflow resistance to aqueous humor 7 and is thought to regulate intraocular pressure. The actual cause of the ocular hypertension present in many cases of primary open-angle glaucoma (POAG) is still not understood, but it is thought to be an increase in resistance to aqueous humor outflow in the trabecular meshwork. 
There are currently two nonexclusive hypotheses about the reason for the increased resistance in the HTM in glaucoma. One of these concerns the cytoskeleton of the trabecular meshwork. In models of ocular hypertension, the actin meshwork forms a cross-link pattern. 8 Experimental evidence in perfused trabecular meshwork suggests that increased rigidity of the HTM cytoskeleton causes increased resistance to aqueous humor flow. 9 10 11 The other hypothesis suggests that changes in the extracellular matrix (ECM) of the HTM are related to increased intraocular pressure. Analyses of the HTM of patients with POAG show an increased amount of sheath-derived plaque and changes in the ECM. 12 13 14 15 Recent work on normal HTM perfused with TGF-β2 showed accumulation of ECM. 16 This change would be consistent with reduced aqueous humor outflow and increased intraocular pressure, thereby linking TGF-β2 levels to alterations in HTM function. The changes observed in these perfused eyes were similar to the pathologic changes in trabecular tissue in patients with POAG. 
The purpose of this investigation was to determine gene and protein expression changes when cells are incubated for an extended time with TGF-β. Earlier experience indicated that the HTM cells could be treated for 3 days with TGF-β without obvious cell loss or decreased viability. 17 Changes in expression levels should give an indication of possible alterations in the HTM caused by increased levels of TGF-β. 
Experimental Procedures
Cell Culture and TGF-β Treatment
Five pairs of normal human eyes from donors (ages 16, 66, 67, 73, and 76 years) with no history of eye diseases were obtained from the National Disease Research Interchange (Philadelphia, PA) at approximately 30 hours after death. The HTMs were dissected and the cells were cultured in a manner similar to that previously described. 18 The five human primary cell cultures were used in this experiment, and during the experimental incubation, they were cultured in serum-free Dulbecco’s modified Eagle’s medium (Invitrogen-Gibco, Carlsbad, CA). Three flasks of cells from each individual, from passage levels three to five depending on the individual sample, were treated (when the cells first reached confluence) with vehicle, 4 mM HCl containing 1% BSA (control), 1.0 ng/mL activated rhTGF-β1 (Roche, Mannheim, Germany), or 1.0 ng/mL activated rhTGF-β2 (R&D Systems, Minneapolis, MN) and incubated for 72 hours. During this period, the medium was changed every 24 hours, and the same TGF-βs were added to the fresh medium. The experiment was performed in duplicate: one set was for RNA extraction and the other set was for proteomic sample analysis. 
Gene Microarray Analysis
Total RNA was isolated from the cells for each of the experimental conditions (TRIzol Reagent; Invitrogen-Life Technologies, Gaithersburg, MD), using the manufacturer’s protocol. The same amount of total RNA from each of the five individuals (2 μg) was taken and pooled to generate three samples (Control, TGF-β1, and TGF-β2). The pooled samples were precipitated and quantified again for cDNA synthesis. At this point, each sample was divided in half and worked up separately. Doubled-stranded cDNA was synthesized from 5 μg purified total RNA with a kit (Superscript Double-Stranded cDNA Synthesis Kit; Invitrogen-Life Technologies) and a T7-(dT)24 primer (Affymetrix, Santa Clara, CA). After the double-stranded cDNA was purified by phenol-chloroform extraction, in vitro transcription reactions were performed (Bioassay High Yield RNA Transcript Labeling kit; Enzo Diagnostics, Farmingdale, NY), according to the manufacturer’s protocol. Biotin-labeled cRNA was purified (Qiagen, Valencia, CA) and quantified before being fragmented to 35 to 200 base fragments in an alkaline buffer. Six Human Genome U133A Arrays (Affymetrix) containing 22,215 genes were used. Washing, staining, and scanning were performed by using the Genechip Instrument System (Affymetrix) as recommended in the manufacturer’s technical manual. The arrays were scanned and data were analyzed on computer (Microarray Suite algorithm, ver. 5; Affymetrix). The absolute analysis results of each chip were scaled to the same target intensity value of 150 and could then be directly compared to one another. The absolute analysis calculates a variety of metrics using the probe array’s hybridization intensities measured by the scanner. The comparison analysis performs additional calculations on data from two separate probe array experiments to compare gene expression levels between two samples. The comparison analysis begins with the absolute analysis of one probe array experiment as the source of baseline data and a second probe array of the experimental condition as the source of data to be compared to the baseline. Because both experimental and control results were run twice, four comparisons for each experimental condition were determined (two control duplicates compared separately with two experimental duplicates). Those genes that had increased or decreased expression greater than twofold in all four comparisons were considered for additional verification. In addition, genes that had an Affymetrix change call of NC (no change) across all four comparisons were removed. 
Real-Time RT-PCR
cDNA was generated from the total RNA samples identical with the ones used for the chip analysis (Taqman Reverse Transcription Reagents kit; Applied Biosystems, Foster City, CA). PCR amplification was performed by two different methods. For one method, primers were designed by computer (Primer Express Software, ver. 2.0; Applied Biosystems), and real-time PCR was performed with a nucleic acid stain (SYBR Green; Applied Biosystems). (See Table 3 for primers for these genes.) The products were sequenced to ensure that the correct gene sequence was being amplified. For the second method, another kit was used (Assays-on-Demand Gene Expression Products; Applied Biosystems). PCR amplification was performed with master mix (TaqMan Universal PCR Master Mix with AmpErase UNG; Applied Biosystems, used according to the product protocol, with the Prism 7900HT; Applied Biosystems). All PCR reactions were performed in triplicate. Relative quantitation of gene expression was performed using the standard curve method (User Bulletin 2, Prism 7700 Sequence Detection System; Applied Biosystems). For comparison of the transcript levels between samples, standard curves were prepared for both the target gene and the endogenous reference (18S ribosomal RNA). For each experimental sample, the amounts of target and endogenous reference were determined from the appropriate standard curves. Then, the target amount was divided by the endogenous reference amount to obtain a normalized target value. Each of the experimental normalized sample values was divided by the normalized control sample value to generate the relative expression levels. 
Two-Dimensional Electrophoresis
The media from the cultured cells were completely removed, and the cells were immediately rinsed with Tris-buffered saline (10 mM Tris-HCl [pH 7.5] and 0.14 M NaCl) and the cells were scraped from the bottom of the culture flask with a cell scraper. The cell suspension was centrifuged, and the liquid was removed. The cell pellet was stored in −80°C for future use. Before isoelectric focusing (IEF), samples were acetone precipitated and solubilized in 40 mM Tris, 7 M urea, 2 M thiourea, and 2% CHAPS (3-([3-cholamidopropyl]dimethylammonio-2-hydroxy-1-propanesulfonate); reduced with 5 mM tri-butylphosphine; and alkylated with 10 mM acrylamide for 90 minutes at room temperature. After a second round of acetone precipitation, the pellet was solubilized in 7 M urea, 2 M thiourea, and 2% CHAPS and subjected to IEF on 11-cm pH 3 to 10 immobilized pH gradient (IPG) strips (Proteome Systems, Sydney, New South Wales, Australia). Equal amounts of protein from the five donor samples were pooled for each of the treatment conditions. After IEF, IPG strips were equilibrated in 6 M urea, 2% SDS, 50 mM Tris-acetate buffer (pH 7.0), and 0.01% bromophenol blue and subjected to SDS-polyacrylamide electrophoresis on 6% to 15% gel chips (Proteome Systems). All gels were stained (Sypro Ruby; Molecular Probes) and imaged by charge-coupled device (CCD) camera on a fluorescence imager (Alpha Innotech, San Leandro, CA). Two-dimensional gel (2D) images were analyzed on computer (Nonlinear Dynamics Progenesis Discovery software; Newcastle, UK). Two gels were run for the control samples and three gels were run for each of the TGF-β1–and the -β2–treated samples. 
Protein Digestion and Mass Spectrometry Analysis
Protein spots were automatically detected and excised with a commercial apparatus (Xcise; Shimadzu Biotech, Columbia, MD). Protein spots were chosen for analysis according to the following criteria: (1) spots that had molecular masses and isoelectric points (pIs) similar to the proteins whose mRNAs were significantly up- or downregulated as shown by the microarray, (2) spots with volumes that differed significantly on the 2D gels between the treatments and control, and (3) spots that had high concentrations on the 2D gels. Gel pieces were washed twice with 150 μL 25 mM ammonium bicarbonate (pH 8.2), 50% vol/vol acetylnitrile, dehydrated with the addition of 100% acetylnitrile, and then air dried. Trypsin (Promega, Madison, WI) in 25 mM ammonium bicarbonate (20 μg/μL) was added to each gel piece and incubated at 30°C for 16 hours. The peptides were extracted by sonication. The peptide solution was automatically desalted and concentrated (ZipTips; Millipore, Bedford, MA) on the exciser and spotted onto a matrix-assisted laser desorption/ionization (MALDI) target plate (Axima; Kratos, Manchester, UK). Peptide mass fingerprints of tryptic peptides were generated by MALDI-time-of-flight mass spectrometry (MALDI-TOF-MS; AximaCFR; Kratos). 
Bioinformatic Database Search
All spectra were automatically analyzed by an integrated suite of bioinformatics tools (BioinformatIQ) from Proteome Systems. Protein identifications were assigned by comparing peak lists to a database containing theoretical tryptic digests of National Center for Biotechnology Information (NCBI) and Swiss Prot sequence databases. The identification of the protein is evaluated based on percentage of coverage, MOWSE score (Molecular Weight Search; NCBI), number of peptide matches, peak intensity, and match of pI and molecular weight with the location of the protein on the 2D gel. 
Results
Gene Expression Profile
Gene expression profiles indicated that more genes had a twofold or greater change when the HTM cells were treated with TGF-β1 than when treated with TGF-β2 (Tables 1 2) . In the TGF-β1 group, there were 88 genes upregulated and 54 genes downregulated, whereas in the TGF-β2 group, there were 19 genes upregulated and 2 genes downregulated. Comparing the TGF-β1–treated group with the TGF-β2–treated group, there were 17 upregulated genes and the two downregulated genes that were present in both groups. The twofold change was an arbitrary level and each of the genes had to have expression changes at this level or greater in all four comparisons made. From the data we saw that certain genes such as phospholipase C, which had a greater than twofold change with TGF-β1 treatment, did not appear on the list of genes with TGF-β2. With TGF-β2, the data indicated that the phospholipase C was actually at a level of 2-fold or greater in three of the four comparisons, with the other value being 1.9-fold. Similarly, the plasminogen activator inhibitor 1 that was present on the TGF-β1 list was just under the twofold cutoff with TGF-β2. The upregulation of this gene has been shown recently in both mRNA and protein levels. 19 Although the twofold level is a convenient way to get data organized, other genes that may be up- or downregulated to a slightly lesser extent could be very significant to the functioning of these HTM cells. Several other genes that have been reported to be upregulated with TGF-β2 treatment did not make the twofold cutoff, but did show increased mRNA levels (Ohlmann A, et al. IOVS 2003;44:ARVO E-Abstract 1175; Shepard AR, et al. IOVS 2003;44:ARVO E-Abstract 3161). 20 Thrombospondin 1 was increased 2-fold; fibronectin, 1.7-fold; collagen type IV, 1.7-fold; and transglutaminase 2, 1.4-fold. However, connective tissue growth factor showed no change in our experiments. 
Up- and downregulated genes were subjected to analysis with DAVID software. 21 The results of analyses of all genes increasing twofold or more show that ∼30% of the genes in the TGF-β1–treated cells and 46% of the genes in the TGF-β2–treated cells were associated with secreted proteins and extracellular components. Genes related to physiological processes and structural components were also highly represented. Of all genes decreasing twofold or more with TGF-β1, 70% were related to physiological processes while 22% were associated with oxidoreductase activity. Using the EASE software package associated with the DAVID database, for both the TGF-β1–and -β2-treated cells, the top five categories of overrepresented genes were those related to ECM or extracellular function. The analysis also showed that of the 88 genes upregulated with TGF-β1, 10 were on the long arm of chromosome 5. The reason for the large number of genes on this particular part of chromosome 5 is unclear. 
Nine genes were selected and the expression changes were confirmed with quantitative real-time PCR (Table 3) . These gene were chosen either because of the high change in levels of expression or their previously reported relationship with the HTM. There was a good correlation between the values obtained by the real-time PCR and the ones from the microarrays, with the possible exception of the change in aldehyde dehydrogenase gene with TGF-β1 treatment. In that case, the value obtained by the real-time assay was substantially higher than the one from the microarray. The CDT6, OSF2, and GP39 genes have been reported to have high expression profiles in HTM libraries. 22 23 The leptin receptor knockout animal has been reported to have increased intraocular pressure 24 and the decreased expression of this gene with TGF-β treatment may have some effects on the intraocular pressure. 
The upregulation of the neuregulin 1 gene suggests that there may be additional changes in other signaling pathways, such as the ErbB. According to the list of genes that were up- and downregulated, expression of at least seven members of the Wnt pathway was also altered twofold. Three enzymes, prostacyclin synthase, 3α hydroxysteroid dehydrogenase, and prostaglandin D2 synthase, were downregulated with TGF-β1 treatment, suggesting some changes in the prostaglandin pathway. 
The upregulation of the gene ADAM12, one of the disintegrin and metalloproteinase genes, could have an impact on both the cytoskeleton and the ECM similar to that reported for preadipocytes involving β1 integrin. 25 The increased expression of glutathione peroxidase is consistent with the observed increase in this enzyme in the aqueous humor from patients with glaucoma thought to be related to increased oxidative stress with glaucoma. 27 A number of dehydrogenase genes, both alcohol and aldehyde, were downregulated, as were several genes in the aldo-keto reductase family. 
Proteomics Analysis Results
One of the striking features of the 2D gels of the HTM cells was the large amount of both actin and vimentin (Fig. 1 ; Table 4 ). Because of their amounts, additional protein spots that might be located in the general areas of these two proteins were obscured. One of these spots would be myocilin. The pI and molecular mass of this very important HTM protein was engulfed by the vimentin spots. 28 Comparing the gels from the control cells with the TGF-β1– and -β2–treated cells we see that the spots to the left of actin and slightly below vimentin were increased in the TGF-β–treated samples (Fig. 2) . Some of these spots were deduced by MALDI-TOF-MS to be vimentin related. Spots 21, 23, 80, and 81 (Fig. 1) are particularly interesting because of the change in volume detected by the software. The first spot, 21, represents a modified form of vimentin, since both the N- and C-terminal peptide fragments matched the peaks found with the MALDI-TOF-MS data. The other three spots probably represent vimentin that has been cleaved, since the molecular weights were lower than vimentin and the MALDI-TOF-MS data indicated that the C-terminal peptide matched a MALDI-TOF-MS peak and should therefore be intact whereas the N-terminal peptide signature was not present. Data about the percentage of increase from control levels as well as the position of the first amino acid from the N-terminal of the first peptide match with the MALDI-TOF-MS data are shown in Table 5
Attempts were made to get identification of spots that corresponded to the genes that had altered expression. The molecular masses and expected pIs of proteins, whose mRNA expressions were changed, were used to select spots to subject to MALDI-TOF-MS. Only a limited number of these spots turned out to be the proteins of interest. In addition, the a computer (Nonlinear Dynamics software) was used to identify spots in the gels whose densities were statistically different with TGF-β1 or -β2 treatment. More than 80 spots have currently been identified (Fig. 1) . The averaged control volume of each of the spots was set at a value of one. The averaged volume of a particular spot for each treatment is listed, and those volumes that had a significance of P < 0.05 as determined by Student’s t-test have an asterisk (Table 4) . In addition to the possible alterations in posttranslational changes with the vimentin, similar changes appeared to occur in several other proteins, such as myosin and annexin 1. Spots for which there was a significant change or a change of 1.5-fold or larger determined by the software and for which there was no posttranslational modification apparent, are listed with the gene expression change from the microarray (Table 6) . Most of the mRNA changes with these proteins were small and probably represented no change in expression. Some of the gene and protein expression changes, such as that of protein disulfide isomerase, appeared to mirror each other, whereas others such as that of calumenin for which the protein change did not match mRNA alterations may indicate differences in proteolysis. The spot volumes are corrected by the software to subtract artifactual protein stain that might have precipitated on or near the protein spot; however, alterations in staining may account for some of the differences detected by the software, especially with weakly staining spots. 
Four other genes, for which protein spots with the correct masses and pI were identified, were selected to run real-time PCR verifications (Taqman; Applied Biosystems) of the array data (Table 7) . These four genes were chosen, because the changes at the gene level and in protein expression suggested intriguing regulation with TGF-β treatment. Two of the genes, thioredoxin reductase 1 and aldose reductase, had decreased expression with TGF-β1. A decrease in protein expression was also found in the proteomic analysis. A curious finding was that there was little change in either gene or protein expression in these genes with the TGF-β2 treatment. Glucose-6-phosphate 1-dehydrogenase showed a similar pattern. Two genes, tropomyosin-1α and leprecan 1, had increased expression in both protein and gene analyses with the protein change generally greater than the mRNA change observed with both the array and the real-time PCR assay (Table 7)
Transgelin 2 (Table 4 , spot 52) was one protein identified for which there was a threefold increase in protein volume with both TGFβs, but the spot did not have the correct pI for the unmodified form of this protein. Identification of the spot of the unmodified form has currently not been determined, and so it is unclear whether there is an increase in this protein, but certainly there appears to be a change in the posttranslational processing of this protein. 
Discussion
This is the first report in which both gene and protein expression changes were measured after several days’ treatment of cells with either TGF-β1 or -β2. Because the level of TGF-β is elevated in aqueous humor in glaucoma, changes in gene and protein expression in the tissues in the anterior segment of the eye may be central to the pathologic behavior of the disease. It has been shown that certain genes in the HTM have increased expression with TGF-β2 treatment, such as plasminogen activator inhibitor-1, 28 but, until now, a comprehensive investigation of the effects of TGF-β2 or -β1 has not been undertaken. Analyses of the changes in gene expression indicate that genes related to ECM or extracellular proteins were the classes of genes most affected by TGF-β treatment. This result is consistent with the findings of major changes in the ECM of perfused HTM 16 and suggests that resistance to flow in the HTM may be related to elevated levels of TGF-β. One extracellular protein, versican, the protein backbone for chondroitin sulfate proteoglycan-2, had an increase in expression of more than fourfold in HTM with TGF-β. This protein has been observed to increase in glaucoma in the ECM, and is thought to cause increased resistance to aqueous humor outflow. 15 Increased expression of this protein in response to TGF-β1 has also been reported in prostatic fibroblast cultures. 29  
The increase in protein disulfide isomerase may be linked to the increases seen with collagen IV and V. Besides being essential for proline hydroxylation of collagen, this enzyme has several other functions. 19 This member of the thioredoxin superfamily is predominantly found in the endoplasmic reticulum, where it assists in protein folding and disulfide bond formation. It also can function as a chaperone to misfolded proteins. All these functions would be essential with increased secretion of ECM components or secreted proteins, so that an increased expression of this protein would seem consistent with cellular alterations caused by TGF-β treatment. 
The large upregulation of angiopoietin-like factor (CDT6) is of particular interest because of the high expression of this gene in normal HTM. 22 Very little is currently known about this protein, which is present in cornea and is thought to influence deposition of ECM. 30 It is noteworthy that the chromosome location of this gene, 1p36.3-p36.2, is the same locus as GLC3B, a primary congenital glaucoma-associated gene. The identification of the disease-causing gene at this locus is still undetermined. 
Several of the genes that were up- or downregulated had been previously reported to be influenced by TGF-β in other cells. Two of the genes that appear to be highly expressed in HTM, osteoblast-specific factor 2 and cartilage glycoprotein 39, are regulated in the same way with both TGF-β1 and -β2. The osteoblast-specific factor is upregulated nearly fourfold, whereas the expression of GP39 decreased approximately twofold with TGF-β treatment. The function of these secreted proteins in the HTM is unclear because, initially, these protein were thought to be more specific to either osteoblasts or chondrocytes. The change in expression of each of these genes has been documented in other cell lines treated with TGF-β, and the changes seen with those cells were consistent with the alterations in our experiments. 31 32  
The large increases in mRNA for glutathione peroxidase 3 and the downregulation of many of the dehydrogenases suggest that the REDOX cycling in the HTM cells is being altered with both TGF-β1 and -β2. TGF-β1 has been reported to trigger oxidative modifications of proteins in other cells, and this is generally related to the downregulation of either intracellular catalase or glutathione peroxidase. 33 These enzymes did have decreased gene expression in this study with catalase downregulated by 1.7- and 1.4-fold with TGF-β1 and -β2, respectively. Intracellular glutathione peroxidase mRNA levels were decreased 1.5- and 1.3-fold, respectively. Procollagen-proline, 2-oxoglutarate 4-dioxygenase was increased with TGF-β1 treatment, and another of this family of 2-oxoglutarate- and iron-dependent dioxygenases, leprecan, was found to be increased with the 2D analysis of proteins from the HTM cells with both TGF-β1 and -β2 treatment. The mRNA levels for leprecan were found to be increased but not at the twofold level used in the microarray analysis. This protein family is thought to catalyze oxidative detoxification in cells and to generate substrates for protein glycosylation. 34  
The large increase in expression of neuregulin 1 pointed to possible long-term alterations in signaling pathways with TGF-β treatment. Members of the Wnt pathway were also influenced by TGF-β, and several of the genes have increased expression with TGF-β1, such as dishevelled-associated activator of morphogenesis 1, frizzled homolog 7, and dickkopf homolog 2, although the secreted frizzled-related protein 1 has decreased expression of 2.5-fold. Also influenced by TGF-β1 is the prostaglandin pathway. Because prostaglandin F analogues are used to lower intraocular pressure, alteration in the pathway may have a direct effect on ocular hypertension. In an earlier study, several genes had alterations in expression levels in HTM cells with prostaglandin analogues that were exactly opposite of those observed in this study. 35 The principal effects of the prostaglandins are thought to be on ciliary muscle, another tissue that is bathed in aqueous humor, although alterations in the HTM cells have been observed. 35 It is also interesting that insulin-like growth factor binding protein 3 (IGFBP-3) increased threefold or more with TGF-β1 and -β2 treatments. The potential for increased alterations in cellular metabolism by insulin-like growth factors exists, but the protein ADAM12, a disintegrin and metalloproteinase domain 12, also was upregulated. Unlike other members of the disintegrin metalloproteinases that are membrane proteins, ADAM12 can exist as an alternately spliced, secreted protein that interacts with IGFBP-3 and can proteolyze it. 36 The membrane-bound ADAM12 interacts with α-actinin-1 and syndecan-4 and promotes β1 integrin-dependent cell spreading through protein kinase Cα and RhoA. 37 38 Thus, besides interacting with the IGF pathway, this protein may also alter the actin cytoskeleton and the ECM. 
The importance of the cytoskeletal structure of the HTM cells was demonstrated in the percentage of the cell lysate that was represented by actin and vimentin. With both TGF-β treatments, there was increased modification of vimentin. In addition to the modification represented in spot 21, discrete spots representing proteolyzed vimentin were present in all samples, but were greater in volume in the treated cells. The very discrete nature of the spots suggests a sequential cleavage of the vimentin, with possible roles for each cleaved fragment. Thus, whereas the analysis of the microarray data suggests the ECM is altered by TGF-β treatment, the changes in vimentin, as well as ADAM12 and tropomyosin, indicate that modification of the cytoskeleton is likely. A role for transgelin is more difficult to interpret. Although substantial increases in the volume of this protein were present, very little change in the mRNA levels were observed. This suggests either increased synthesis of this actin-associated protein or decreased proteolysis. Another possibility is that additional proteins migrated at the same point in the 2D gel and thereby contributed to the volume measured. We noted that several of the spots in the MALDI-TOF-MS analysis, selected because of gene expression changes using the criteria of molecular mass and pI, were not the proteins that we thought they might be. It is possible that the proteins of interest were actually at the same places in the gel but that the amounts present were lower than the proteins deduced by MS 
Several of the genes and protein spots were similarly changed with both TGF-β1 and -β2, although in general the alterations were more pronounced with TGF-β1. These changes could reflect alteration in proteolysis or posttranslational modification of the individual proteins, and some may reflect some uneven staining of a specific spot. Some of the genes indicated that certain changes were happening to cells treated with TGF-β1 that were not occurring in cells treated with TGF-β2. Thioredoxin reductase 1, aldose reductase, and G6PD were not significantly changed with the TGF-β2, but were clearly affected by TGF-β1. This difference was present in both the microarray data and the 2D analysis. These data point to certain differential effects of the TGFβs. 
In summary, TGF-β1 and -β2 cause gene and protein expression changes in the HTM cells. Although certain of these changes have been reported in other cell types, the major changes appear to be with the ECM and secreted proteins. This is consistent with changes seen in glaucoma and suggests that alterations in the ECM of the HTM might be partially responsible for the increased intraocular pressure in cases of POAG. The elevation in active TGF-β observed in the aqueous humor with glaucoma may cause other signaling pathways to be activated, especially with longer exposure times, and these may be more detrimental to the homeostasis of the HTM than the direct influence of the TGF-βs. Although the data suggest that the ECM may be the area principally altered by the TGF-βs, there were some changes that influence the cytoskeleton, so that the role of the cytoskeleton in the disease state as a result of increased TGF-β cannot be ruled out. 
Table 1.
 
Genes That Were Upregulated Twofold in the HTM Cells with TGF-β1 and -β2 Treatment
Table 1.
 
Genes That Were Upregulated Twofold in the HTM Cells with TGF-β1 and -β2 Treatment
SymbolGenBankTGF-β1 (x-Fold Change)TGF-β2 (x-Fold Change)Gene Name
XRCC4AB01744533.13.2X-ray repair complementing defective repair in Chinese hamster cells
CD24L3393020.4CD24 signal transducer
NRG1AF02614614.53.2Neuregulin 1
CDT6AJ30018811.15.8Angiopoietin-like factor, corneal-derived transcript 6
EBAFAF08150810.78.1Endometrial bleeding-associated factor
GPX3BC01321810.02.3Glutathione peroxidase 3 (plasma)
AI6931406.6DKFZp586F071
MATN3AA4614836.54.1Matrilin 3
ESM1AJ4010916.3Endothelial cell-specific molecule 1
LRRN3AB0609676.27.3Leucine-rich repeat neuronal 3
NOX4AB0410354.93.7NADPH oxidase 4
CSPG2D320394.82.7Chondroitin sulfate proteoglycan 2 (versican)
CYP26A1AF0054184.8Cytochrome P450, family 26, subfamily A, polypeptide 1
C1Borf1AF0094274.6Chromosome 18 open reading frame 1
ELNAA4792784.4Elastin
OSF-2AY1406463.82.7Osteoblast-specific factor 2 (fasciclin I-like)
CSRP2BC0009923.7Cysteine and glycine-rich protein 2
IGFBP3AK0556323.73.0Insulin-like growth factor binding protein 3
MGC4504BC0016833.63.6Hypothetical protein MGC4504
ADAM12AF0234763.52.8A disintegrin and metalloproteinase domain 12 (meltrin alpha)
INHBAAF2180183.42.6Inhibin, beta A (activin A, activin AB alpha polypeptide)
C5orf13AF1198593.4Chromosome 5 open reading frame 13
IL12AAF0500833.3Interleukin 12A
COL5A1AK0572313.32.2Collagen, type V, alpha 1
TNFAIP6AF0864843.3Tumor necrosis factor, alpha-induced protein 6
h-SmLIMU460063.2Smooth muscle LIM protein
SLC7A5AB0179803.1Solute carrier family 7, member 5
AMIGO2AB0790743.1Amphoterin-induced gene 2
CXCL12AK1246413.1Chemokine (C-X-C motif) ligand 12 (stromal cell-derived factor 1)
NKX3-1AF2477043.0NK3 transcription factor related, locus 1 (Drosophila)
MAFAF0553763.03.0V-maf musculoaponeurotic fibrosarcoma oncogene homolog (avian)
FSTL3AY3589172.9Follistatin-like 3 (secreted glycoprotein)
DKK2AB0332082.9Dickkopf homolog 2 (Xenopus laevis)
IVNS1ABPAB0206572.9Influenza virus NS1A binding protein
CDKN2BAF0048192.9Cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)
LANCL2AB0359662.9LanC lantibiotic synthetase component C-like 2 (bacterial)
LMCD1AF1692842.8LIM and cysteine-rich domains 1
ARL4BC0011112.8ADP-ribosylation factor-like 4
CTPSAK1305492.7CTP synthase
P4HA2AY3589702.7Procollagen-proline, 2-oxoglutarate 4-dioxygenase
TM4SF13AF1007592.7Transmembrane 4 superfamily member 13
IGSF4AB0175632.7Immunoglobulin superfamily, member 4
TFP12AF2175422.7Tissue factor pathway inhibitor 2
BCAT1AK0562552.7Branched-chain aminotransferase 1, cytosolic
HNOEL-isoAF2019452.7HNOEL-iso protein
MTHFD2AK1306642.6Methylene tetrahydrofolate dehydrogenase
COL4A1AF2583492.6Collagen, type IV, alpha 1
PLCB4AK0250272.6Phospholipase C, beta 4
TNFRSF10DAF0212322.5Tumor necrosis factor receptor superfamily, member 10d
FBN2AF1930462.5Fibrillin 2 (congenital contractural arachnodactyly)
GPRC5BAC0041312.5G protein-coupled receptor, family C, group 5, member B
LIMK2AB0166552.5LIM domain kinase 2
DACT1AF2510792.5Dapper homolog 1, antagonist of beta-catenin (xenopus)
LOC283537AL0501252.5Hypothetical protein LOC283824
FLRT2AB0078652.5Fibronectin leucine-rich transmembrane protein 2
RODHAF0165092.53-hydroxysteroid epimerase
DTRAC0046342.5Diphtheria toxin receptor
TGM2AK0580312.4Transglutaminase 2
THBS1NM_0032462.4Thrombospondin 1
LAMC2NM_0055622.4Laminin, gamma 2
NDST1BC0128882.4N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1
ODZ4AB0377232.4Odd Oz/ten-m homolog 4
TNFRSF21AF0688682.4Tumor necrosis factor receptor superfamily, member 21
CDH2AI6751512.4Cadherin 2, type 1, N-cadherin (neuronal)
COL4A2AF2583502.4Collagen, type IV, alpha 2
FBLN5AF0931182.4Fibulin 5
TPM1AF4741562.3Tropomyosin 1 (alpha)
SCRG1AJ2246772.32.2Scrapie responsive protein 1
DAAM2AB0023792.3Dishevelled-associated activator of morphogenesis 2
SERPINE1BC0059272.3Serine (or cysteine) proteinase inhibitor, clade E, member 1
BF5132442.3KIAA0831
FZD7AB0108812.3Frizzled homolog 7 (Drosophila)
DAAM1AB0145662.2Dishevelled-associated activator of morphogenesis 1
GPC4AF0301862.2Glypican 4
CLIC3AF1021662.2Chloride intracellular channel 3
SLC26A2BC0593902.2Solute carrier family 26 (sulfate transporter), member 2
PSME4D385212.2Proteasome (prosome, macropain) activator subunit 4
FIJ12442AF1317812.2Hypothetical protein FLJ12442
ARK5AB0111092.2KIAA0537 gene product
TMPONM_0032762.2Thymopoietin
LRRC17AY3588892.2Leucine-rich repeat containing 17
MESTAB0455822.2Mesoderm specific transcript homolog (mouse)
C6orf145AJ4205342.2Chromosome 6 open reading frame 145
ASNSAK0003792.1Asparagine synthetase
FN5AF1971372.1FN5 protein
CRTL1BC0578082.1Cartilage-linking protein 1
RAIAF0780362.1RelA-associated inhibitor
FAPAF0078222.0Fibroblast activation protein, alpha
OGNNM_0140572.6Ostoglycin
THBDNM_0003612.1Thrombomodulin
Table 2.
 
Genes That Were Downregulated Twofold in the HTM Cells with TGF-β1 and -β2 Treatment
Table 2.
 
Genes That Were Downregulated Twofold in the HTM Cells with TGF-β1 and -β2 Treatment
SymbolGenBankTGF-β1 (x-Fold Change)TGF-β2 (x-Fold Change)Gene Name
ADH1BAF040967−16.0−2.5Alcohol dehydrogenase IB (class I), beta polypeptide
GAS1L13698−5.2Growth arrest-specific 1
EDNRABC022511−4.8Endothelin receptor type A
CCL2AF519531−4.8Chemokine (C-C motif) ligand 2
SEPP1AK096125−4.2Selenoprotein P, plasma, 1
AKR1B10AF044961−4.1Aldo-keto reductase family 1, member B10 (aldose reductase)
PPAP2BAB000889−4.1Phosphatidic acid phosphatase type 2B
AKR1C1AB031083−3.9Aldo-keto reductase family 1, member C1
HGFAC004960−3.9Hepatocyte growth factor (hepapoietin A; scatter factor)
ALDH1A1AF003341−3.9Aldehyde dehydrogenase 1 family, member A1
ALDH3A1AK091272−3.8Aldehyde dehydrogenase 3 family, member A1
PTX3BC027887−3.8Pentaxin-related gene, rapidly induced by IL-1 beta
PTGISAF297048−3.8Prostaglandin 12 (prostacyclin) synthase
DUSP5NM_004419−3.8Dual-specificity phosphatase 5
MX1AC005612−3.7Myxovirus (influenza virus) resistance 1
IFIT1AK092813−3.6Interferon-induced protein with tetratricopeptide repeats 1
LDB2AF047337−3.6LIM domain-binding 2
AKR1C2AB021654−3.5Aldo-keto reductase family 1, member C2
NQO1BC000906−3.5NAD(P)H dehydrogenase, quinone 1
AKRIC3AB018580−3.4Aldo-keto reductase family 1, member C3
VCAM1AU121762−3.2Vascular cell adhesion molecule 1
DSCR1L1AK090990−3.1Down syndrome critical region gene 1-like 1
CA12AF051882−3.1Carbonic anhydrase XII
FIJ20151AK000158−3.0Hypothetical protein FLJ20151
PDGFRABC015186−2.9Platelet-derived growth factor receptor, alpha polypeptide
TPD52L1AF004427−2.9Tumor protein D52-like 1
IFIT4AF026939−2.9Interferon-induced protein with tetratricopeptide repeats 4
EMP1BC017854−2.7Epithelial membrane protein 1
MAN1C1AF261655−2.8Mannosidase, alpha, class 1C, member 1
PGDBC000368−2.7Phosphogluconate dehydrogenase
PTGDSAK075333−2.7Prostaglandin D2 synthase 21 kDa (brain)
DUSP6AB013601−2.6Dual-specificity phosphatase 6
ANXA10AF196478−2.6Annexin A10
COL14A1AK021997−2.6Collagen, type XIV, alpha 1 (undulin)
SFRP1AF001900−2.5Secreted frizzled-related protein 1
ADMBC015961−2.5Adrenomedullin
LMOD1AK126474−2.5Leiomodin 1 (smooth muscle)
BCL3M31731−2.5B-cell CLL/lymphoma 3
ADFPAF443203−2.5Adipose differentiation-related protein
PHLDA1AF220656−2.5Pleckstrin homology-like domain, family A, member 1
IFITM1BC000897−2.5Interferon-induced transmembrane protein 1 (9-27)
FLJ20035AK000042−2.4Hypothetical protein FLJ20035
PARRES1BC029640−2.4Retinoic acid receptor responder (tazarotene induced) 1
CITED2AF109161−2.3Cbp/p300-interacting transactivator
TM4SF1AK093829−2.3Transmembrane 4 superfamily member 1
DKFZP586N0721AF151027−2.3DKFZP586N0721 protein
SCDGF-BAF033832−2.3Spinal cord-derived growth factor-B
AP1G1AB015317−2.3Adaptor-related protein complex 1, gamma 1 subunit
CED-6AF191771−2.2PTB domain adaptor protein CED-6
GP39M80927−2.2−2.1Cartilage glycoprotein (chitinase 3-like 1)
MLAT4AJ430351−2.2Myxoid liposarcoma-associated protein 4
NRP1AF018956−2.1Neuropilin 1
SVILAF051850−2.0Supervillin
LEPRNM_002303−2.0Leptin receptor
Table 3.
 
Real-Time PCR Verification of Selected Genes
Table 3.
 
Real-Time PCR Verification of Selected Genes
Gene NameNCBI Accession No.Oligo SequenceProduct Length (bp)Average Threshold Cycle NumberReal-Time PCR (x-Fold Change)Microarray (x-Fold Change)
ControlTGF-β1TGF-β2TGF-β1TGF-β2TGF-β1TGF-β2
Matrilin 3 (MATN3)NM_002381F:CGAATCACACCCTTGTCAACAG7034.3931.7732.205.54.26.54.1
R:TGAAGGCTTCGTCCATTGCT
Neuregulin 1 (NRG1)NM_013957F:ACCATCACCCTCAGCAGTTCA7233.1729.8030.7811.55.614.73.2
R:GGCTAGCAGGGAGGCTGTTAC
Osteoblast-specific factor 2 (OSF2)NM_006475F:CCAGCAGTTTTGCCCATTG7631.2728.8929.245.34.23.82.7
R:CAGAATAGCGCTGCGTTGTG
Angiopoietin-like factor (CDT6)NM_021146F:CTCCGCAAAGGTGGCTACTG7533.1529.5830.0713.19.311.15.7
R:CTCACCCAGGCGGTAGTACAC
Aldehyde dehydrogenase 3 family member 1 (ALDH3A1)NM_000691F:GGAGCTGCTCAAGGAGAGGTT7831.1235.0332.19−15−2−3.8−1.7
R:GCAGCCGTCATGATGATCTTC
Glycoprotein (GP39)M80927F:GTCGCCGGACTTTCATCAA6929.4130.2930.67−1.8−2.3−2.2−2.0
R:CAAGGTCCAGCCCATCAAA
Leptin receptor (LEPR)U50748F:GCTACACAATGTGGATTAGGATCAA10033.4235.0134.03−3−1.5−2.0NC
R:GATGGAGGCAGTGGCTTCAC
Alcohol dehydrogenase (ADH2)M21692F:AACCCATCCAGGAAGTGCTAAA7831.8335.5233.19−13.4−2.6−16−2.5
R:TGTCAAGCCGACCGATGA
Glutathione peroxidase 3 (GPX3)NM_002084F:CATCCCCTTCAAGCAGTATGC7334.0029.3331.5219.24.110.02.3
R:GCCCGTCAGGCCTCAGTAG
Figure 1.
 
A 2D gel of HTM cell lysate. The spots on the gel that have been deduced by MALDI-TOF-MS are numbered. The proteins corresponding to these spots are listed in Table 4 . The molecular mass markers (in kilodaltons) are numbered on the right and were identical in all the gels.
Figure 1.
 
A 2D gel of HTM cell lysate. The spots on the gel that have been deduced by MALDI-TOF-MS are numbered. The proteins corresponding to these spots are listed in Table 4 . The molecular mass markers (in kilodaltons) are numbered on the right and were identical in all the gels.
Table 4.
 
Protein Spots Identified by MALDI-TOF
Table 4.
 
Protein Spots Identified by MALDI-TOF
Spot NumberProtein NameTGF-β1TGF-β2Accession No.Mass (kDa)pICoverage
1Myosin heavy chain2.32.4P35579.37226.35.5015.00
2Major vault protein−1.0−1.0Q14764.3599.75.3431.58
3Major vault protein−1.11.5Q96B6499.75.3432.36
4Grp942.0*1.6P1462592.44.7636.61
5ER transitional ATPase1.21.5P55072.3889.25.1442.43
6Leprican (GROS1-L protein)4.1*1.9Q9HC86.1683.35.0511.82
7Glucosidase II precursor−1.7−2.8*Q9P0X0.15106.85.7116.31
8GRP 78 and BiP (HSP A5)1.5*1.6*P11021.4072.25.0753.82
9GRP 78 and BiP−1.51.4P11021.4072.25.0735.17
10FK 506-binding protein (PPlase)−1.5−3.0Q96AY3.4164.25.3624.23
11HSP 711.31.2P11142.1170.85.3746.44
12HSP 71−1.2−1.0P11142.1170.85.3734.52
13GRP 75 and annexin 6−1.5−1.5P08133.1473.76.0540.20
14Protein disulfide isomerase1.81.3P07237.3557.04.7641.14
15Calregulin (calreticulin precursor)1.71.5P27797.2348.14.2932.61
16Protein disulfide isomerase A32.01.6P30101.3556.75.9938.22
17Protein disulfide isomerase A31.4−1.0P30101.3556.75.9941.78
18Vimentin2.2*1.3P08670.2753.55.0555.48
19Protein phosphatase 2C−1.51.5O75688.4052.64.9516.91
20Vimentin−1.3−1.4*P08670.2753.55.0570.75
21Vimentin1.7*1.4*P08670.2753.55.0571.40
22Vimentin1.5*1.1P08670.2753.55.0545.81
23Vimentin2.0*1.4P08670.2753.55.0526.02
24Calumenin5.1*3.2*O43852.3837.04.4748.57
2540S ribosomal protein SA1.8*1.6*P0886532.84.8023.73
26Reticulocalbin−1.6−1.1Q15293.3538.84.8638.97
27Elongation factor Tu−1.01.4P49411.3449.57.3628.98
28Tropomyosin beta chain3.11.6*P0795132.84.6636.62
29Tropomyosin 1 alpha chain7.5*2.9*P09493.1632.74.6933.80
30Tropomyosin alpha 42.62.8*P07226.0728.54.6741.13
3114-3-3 protein2.11.5P29312.2427.74.7339.18
32Actin1.1−1.3P02571.0141.75.3152.27
33Elongation factor 1 delta3.0*1.1P29692.4131.14.9030.25
34Rho GDP-dissociating inhibitor 1−1.6*1.3*P52565.3423.15.0143.63
35Myosin4.4*3.0*P1910519.74.7063.53
36Myosin6.14.0*P2484419.74.7839.77
37Myosin3.4*2.8*P1910519.74.6557.06
38Galectin 11.2*1.5*P09382.1014.55.3047.76
39Calgizzarin1.31.3P31949.3411.76.4852.38
40HSP 27−1.01.2P04792.4022.75.9941.46
41αB-crystallin1.01.0P02511.1320.06.8365.14
42Thioredoxin peroxidase 2−2.0−1.8*Q06830.2922.08.3152.26
43Annexin I−1.91.1P04083.0338.56.6351.88
44Annexin I−3.0−1.0P04083.0338.56.6361.16
45Annexin I2.0−1.2P04083.0338.56.6338.55
46Annexin I−2.0−1.1P04083.0338.56.6337.39
47GAPD and annexin 2−1.4*1.3*P07355.0738.47.7261.54
48GAPD and annexin 2−1.21.2P07355.0738.47.7250.23
49Annexin 2−2.0*−1.4P07355.0738.47.7240.24
50Thioredoxin peroxidase 3−1.11.3P30048.3527.67.8020.31
51Proteasome B3−1.71.5*P4972022.96.1747.32
52Transgelin 2 (SM22-alpha homolog)3.13.0P37802.3022.38.4450.75
53Cu-Zn SOD−1.51.2P0044115.95.79.00
54Coactosin-like protein1.01.4Q14019.4115.95.5139.44
55Ubiquitin C-ter hydrolase1.12.1P09936.1624.85.3328.70
56Nucleoside diphosphate kinase A−1.41.1P15531.1417.15.8329.61
57VDAC-12.62.4P21796.1830.68.6348.94
58VDAC-11.8*1.3P21796.1830.68.6336.52
59Thioredoxin peroxidase 2−1.01.3*Q06830.2922.08.3136.18
60Proteasome C33.11.3P25787.2225.77.1226.61
61Aldose reductase−1.6*−1.0P15121.2335.66.5549.84
62α-Enolase−2.0*−1.2P06733.0747.07.1552.42
63α-Enolase−1.4*1.2*P06733.0747.07.1518.24
64Thioredoxin reductase−1.7−1.0P30048.3560.16.2822.95
65α-Enolase−1.11.5P06733.0747.07.1538.11
66ATP synthase1.7*1.8*P2570559.79.1635.44
67Elongation factor 1 gamma1.11.3P26641.2350.06.2731.58
68Centractin1.01.3*P42024.3242.56.2027.66
69Pyruvate kinase, M1 ISOZYME2.42.9*P14618.4157.78.1146.42
70Pyruvate kinase, M2 ISOZYME−4.6−2.0P14786.1457.78.1149.81
71Pyruvate kinase−3.5*−2.0P14786.1457.78.1140.80
72Pyruvate kinase−4.0*−5.8*P14618.4157.78.1148.68
73KIF-3A (kinesin-like protein)−1.9*−2.0*Q9Y496.4280.36.0816.95
74Actin-interacting protein−2.6*−1.4*O75083.4066.16.1821.78
75Actin2.01.8*P02568.0142.05.2323.61
76Prohibitin1.11.4*P35232.2829.75.5736.76
77Thioredoxin (ATL-derived factor, ADF)1.11.0P10599.2411.54.8243.27
78T-complex protein 1, epsilon subunit1.82.4*P48643.3359.65.4423.29
79Glucose-6-phosphate 1-dehydrogenase−2.0−1.1P11413.3659.06.4438.52
80Vimentin1.41.3P08670.2753.55.0540.65
81Vimentin2.0*1.4P08670.2753.55.0543.87
Figure 2.
 
Three 2D gels of HTM cells. The gels for the control and the TGF-β1–and -β2–treated cells are representative of the other gels for each of the treatment conditions. The gradient of proteins from pI 3 to 10 is from right to left.
Figure 2.
 
Three 2D gels of HTM cells. The gels for the control and the TGF-β1–and -β2–treated cells are representative of the other gels for each of the treatment conditions. The gradient of proteins from pI 3 to 10 is from right to left.
Table 5.
 
Modified Forms of Vimentin That Were Increased by TGF-β Treatment
Table 5.
 
Modified Forms of Vimentin That Were Increased by TGF-β Treatment
Spot NumberPercent Increase in Spot Volume Compared with ControlPosition of First Matched Peptide (from N-terminus)
TGF-β1TGF-β2
211701401
8114013049
2320014071
80200140293
Table 6.
 
Comparison of the Changes in Protein or Gene Expression for the Proteins Identified by MALDI That Had the Proper Mass and pI
Table 6.
 
Comparison of the Changes in Protein or Gene Expression for the Proteins Identified by MALDI That Had the Proper Mass and pI
Protein NameProteomicsArray
TGF-β1TGF-β2TGF-β1TGF-β2
Major vault protein−1.0−1.0−1.5−1.3
Grp942.01.61.31.3
Glucosidase II precursor−1.7−2.81.1−1.1
FK506-binding protein (PPlase)−1.5−3.01.21.3
Protein disulfide isomerase1.81.31.41.2
Calregulin1.71.51.41.1
Protein phosphatase 2C−1.51.51.0−1.1
Calumenin5.13.21.51.3
40S ribosomal protein SA1.741.4−1.11.0
Reticulocalbin−1.6−1.1−1.11.0
Elongation factor Tu−1.01.4−1.1−1.1
Tropomyosin beta chain3.11.61.41.4
Tropomyosin alpha 42.62.81.41.1
Elongation factor 1 delta3.01.11.01.1
Cu-Zu SOD−1.51.2−1.2−1.1
Ubiquitin C-ter hydrolase1.12.1−1.1−1.1
Nucleoside diphosphate kinase A−1.41.11.21.0
Proteasome C33.11.3−1.2−1.1
Elongation factor 1gamma1.11.31.01.0
Centractin1.01.31.21.0
Prohibitin1.11.41.11.0
T-complex protein 1, epsilon subunit1.82.41.01.0
Glucose-6-phosphate 1-dehydrogenase (G6PD)−2.0−1.1−2.0−1.4
Table 7.
 
Four Genes in which the Change in Gene Expression Appeared to Match the Change in Protein Expression
Table 7.
 
Four Genes in which the Change in Gene Expression Appeared to Match the Change in Protein Expression
Gene NameTGF-β1TGF-β2
ArrayRT-PCRProteomicsArrayRT-PCRProteomics
Tropomyosin 1α2.327.51.41.92.9
Thioredoxin reductase 1−2.0−2.9−1.7−1.2−1.4−1.0
Leprecan 11.71.44.11.41.61.9
Aldose reductase−4.1−5.1−1.61.0−1.31.1
 
The authors thank the National Disease Research Interchange (Philadelphia, PA) for providing the donor tissue, Charles River Proteomic Services (Worcester, MA) for assisting with the proteomic analyses, and the NINDS NIMH Microarray Consortium (arrayconsortium.tgen.org) Center at the Translational Genomics Research Institute for assisting with the Affymetrix assays. 
Flugel-Koch C, Ohlmann A, Piatigorsky J, Tamm ER. Disruption of anterior segment development by TGF-beta1 overexpression in the eyes of transgenic mice. Dev Dyn. 2002;225:111–125. [CrossRef] [PubMed]
Saika S, Saika S, Liu CY, et al. TGFbeta2 in corneal morphogenesis during mouse embryonic development. Dev Biol. 2001;240:419–432. [CrossRef] [PubMed]
Jampel HD, Roche N, Stark WJ, Roberts AB. Transforming growth factor-beta in human aqueous humor. Curr Eye Res. 1990;9:963–969. [CrossRef] [PubMed]
Li J, Tripathi BJ, Chalam KV, Tripathi RC. Transforming growth factor-beta 1 and -beta 2 positively regulate TGF-beta 1 mRNA expression in trabecular cells. Invest Ophthalmol Vis Sci. 1996;37:2778–2782. [PubMed]
Tripathi RC, Li J, Chan WF, Tripathi BJ. Aqueous humor in glaucomatous eyes contains an increased level of TGF-beta 2. Exp Eye Res. 1994;59:723–727. [CrossRef] [PubMed]
Wimmer I, Welge-Luessen U, Picht G, Grehn F. Influence of argon laser trabeculoplasty on transforming growth factor-beta 2 concentration and bleb scarring following trabeculectomy. Graefes Arch Clin Exp Ophthalmol. 2003;241:631–636. [CrossRef] [PubMed]
Bill A. Some aspects of aqueous humour drainage. Eye. 1993;7:14–19. [CrossRef] [PubMed]
Clark AF, Wilson K, McCartney MD, Miggans ST, Kunkle M, Howe W. Glucocorticoid-induced formation of cross-linked actin networks in cultured human trabecular meshwork cells. Invest Ophthalmol Vis Sci. 1994;35:281–294. [PubMed]
Erickson-Lamy K, Schroeder A, Epstein DL. Ethacrynic acid induces reversible shape and cytoskeletal changes in cultured cells. Invest Ophthalmol Vis Sci. 1992;33:2631–2640. [PubMed]
Tian B, Geiger B, Epstein DL, Kaufman PL. Cytoskeletal involvement in the regulation of aqueous humor outflow. Invest Ophthalmol Vis Sci. 2000;41:619–623. [PubMed]
Rao PV, Deng PF, Kumar J, Epstein DL. Modulation of aqueous humor outflow facility by the Rho kinase-specific inhibitor Y-27632. Invest Ophthalmol Vis Sci. 2001;42:1029–1037. [PubMed]
Wiederholt M, Bielka S, Schweig F, Lütjen-Drecoll E, Lepple-Wienhues A. Regulation of outflow rate and resistance in the perfused anterior segment of the bovine eye. Exp Eye Res. 1995;61:223–234. [CrossRef] [PubMed]
Rohen JW, Lütjen-Drecoll E, Flugel C, Meyer M, Grierson I. Ultrastructure of the trabecular meshwork in untreated cases of primary open-angle glaucoma (POAG). Exp Eye Res. 1993;56:683–692. [CrossRef] [PubMed]
Furuyoshi N, Furuyoshi M, Futa R, Gottanka J, Lütjen-Drecoll E. Ultrastructural changes in the trabecular meshwork of juvenile glaucoma. Ophthalmologica. 1997;211:140–146. [CrossRef] [PubMed]
Knepper PA, Goossens W, Palmberg PF. Glycosaminoglycan stratification of the juxtacanalicular tissue in normal and primary open-angle glaucoma. Invest Ophthalmol Vis Sci. 1996;37:2414–2425. [PubMed]
Gottanka J, Chan D, Eichhorn M, Lütjen-Drecoll E, Ethier CR. Effects of TGF-beta2 in perfused human eyes. Invest Ophthalmol Vis Sci. 2004;45:153–158. [CrossRef] [PubMed]
Tamm ER, Russell P. The role of myocilin/TIGR in glaucoma: results of the Glaucoma Research Foundation catalyst meeting in Berkeley, California, March 2000. J Glaucoma. 2001;10:329–339. [CrossRef] [PubMed]
Tumminia SJ, Mitton KP, Arora J, Zelenka P, Epstein DL, Russell P. Mechanical stretch alters the actin cytoskeletal network and signal transduction in human trabecular meshwork cells. Invest Ophthalmol Vis Sci. 1998;39:1361–1371. [PubMed]
Davis R, Schooley K, Rasmussen B, Thomas J, Reddy P. Effect of PDI overexpression on recombinant protein secretion in CHO cells. Biotechnol Prog. 2000;16:736–743. [CrossRef] [PubMed]
Welge-Lussen U, May CA, Lütjen-Drecoll E. Induction of tissue transglutaminase in the trabecular meshwork by TGF-beta1 and TGF-beta2. Invest Ophthalmol Vis Sci. 2000;41:2229–2238. [PubMed]
Dennis G, Jr, Sherman BT, Hosack DA, et al. DAVID: Database for Annotation, Visualization, and Integrated Discovery. Genome Biol. 2003;4:3. [CrossRef]
Tomarev SI, Wistow G, Raymond V, Dubois S, Malyukova I. Gene expression profile of the human trabecular meshwork: NEIBank sequence tag analysis. Invest Ophthalmol Vis Sci. 2003;44:2588–2596. [CrossRef] [PubMed]
Gonzalez P, Epstein DL, Borras T. Characterization of gene expression in human trabecular meshwork using single-pass sequencing of 1060 clones. Invest Ophthalmol Vis Sci. 2000;41:3678–3693. [PubMed]
Savinova OV, Sugiyama F, Martin JE, et al. Intraocular pressure in genetically distinct mice: an update and strain survey. BMC Genet. 2001;2:12. [PubMed]
Kawaguchi N, Sundberg C, Kveiborg M, et al. ADAM12 induces actin cytoskeleton and extracellular matrix reorganization during early adipocyte differentiation by regulating beta1 integrin function. J Cell Sci. 2003;116:3893–3904. [CrossRef] [PubMed]
Ferreira SM, Lerner SF, Brunzini R, Evelson PA, Llesuy SF. Oxidative stress markers in aqueous humor of glaucoma patients. Am J Ophthalmol. 2004;137:62–69. [CrossRef] [PubMed]
Karali A, Russell P, Stefani FH, Tamm ER. Localization of myocilin/trabecular meshwork–inducible glucocorticoid response protein in the human eye. Invest Ophthalmol Vis Sci. 2000;41:729–740. [PubMed]
Fuchshofer R, Welge-Lussen U, Lütjen-Drecoll E. The effect of TGF-beta2 on human trabecular meshwork extracellular proteolytic system. Exp Eye Res. 2003;77:757–765. [CrossRef] [PubMed]
Sakko AJ, Ricciardelli C, Mayne K, et al. Modulation of prostate cancer cell attachment to matrix by versican. Cancer Res. 2003;63:4786–4791. [PubMed]
Peek R, Kammerer RA, Frank S, Otte-Holler I, Westphal JR. The angiopoietin-like factor cornea-derived transcript 6 is a putative morphogen for human cornea. J Biol Chem. 2002;277:686–693. [CrossRef] [PubMed]
Horiuchi K, Amizuka N, Takeshita S, et al. Identification and characterization of a novel protein, periostin, with restricted expression to periosteum and periodontal ligament and increased expression by transforming growth factor beta. J Bone Miner Res. 1999;14:1239–1249. [CrossRef] [PubMed]
Johansen JS, Olee T, Price PA, Hashimoto S, Ochs RL, Lotz M. Regulation of YKL-40 production by human articular chondrocytes. Arthritis Rheum. 2001;44:826–837. [CrossRef] [PubMed]
Islam KN, Kayanoki Y, Kaneto H, et al. TGF-beta1 triggers oxidative modifications and enhances apoptosis in HIT cells through accumulation of reactive oxygen species by suppression of catalase and glutathione peroxidase. Free Radic Biol Med. 1997;22:1007–1017. [CrossRef] [PubMed]
Aravind L, Koonin EV. The DNA-repair protein AlkB, EGL-9, and leprecan define new families of 2-oxoglutarate- and iron-dependent dioxygenases. Genome Biol. 2001;2RESEARCH0007
Zhao X, Pearson KE, Stephan DA, Russell P. Effects of prostaglandin analogues on human ciliary muscle and trabecular meshwork cells. Invest Ophthalmol Vis Sci. 2003;44:1945–1952. [CrossRef] [PubMed]
Shi Z, Xu W, Loechel F, Wewer UM, Murphy LJ. ADAM 12, a disintegrin metalloprotease, interacts with insulin-like growth factor-binding protein-3. J Biol Chem. 2000;275:18574–18580. [CrossRef] [PubMed]
Cao Y, Kang Q, Zolkiewska A. Metalloprotease-disintegrin ADAM 12 interacts with alpha-actinin-1. Biochem J. 2001;357:353–361. [CrossRef] [PubMed]
Thodeti CK, Albrechtsen R, Grauslund M, et al. ADAM12/syndecan-4 signaling promotes beta 1 integrin-dependent cell spreading through protein kinase Calpha and RhoA. J Biol Chem. 2003;278:9576–9584. [CrossRef] [PubMed]
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×