April 2005
Volume 46, Issue 4
Free
Retinal Cell Biology  |   April 2005
Altered Gene Expression of Angiogenic Factors Induced by Calcium-Mediated Dissociation of Retinal Pigment Epithelial Cells
Author Affiliations
  • Xue-Feng Wang
    From the Department of Ophthalmology and Visual Sciences and Brain Research Centre, University of British Columbia, Vancouver, British Columbia, Canada.
  • Jing Z. Cui
    From the Department of Ophthalmology and Visual Sciences and Brain Research Centre, University of British Columbia, Vancouver, British Columbia, Canada.
  • Shiv S. Prasad
    From the Department of Ophthalmology and Visual Sciences and Brain Research Centre, University of British Columbia, Vancouver, British Columbia, Canada.
  • Joanne A. Matsubara
    From the Department of Ophthalmology and Visual Sciences and Brain Research Centre, University of British Columbia, Vancouver, British Columbia, Canada.
Investigative Ophthalmology & Visual Science April 2005, Vol.46, 1508-1515. doi:10.1167/iovs.04-0951
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Xue-Feng Wang, Jing Z. Cui, Shiv S. Prasad, Joanne A. Matsubara; Altered Gene Expression of Angiogenic Factors Induced by Calcium-Mediated Dissociation of Retinal Pigment Epithelial Cells. Invest. Ophthalmol. Vis. Sci. 2005;46(4):1508-1515. doi: 10.1167/iovs.04-0951.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

purpose. To examine the effect of loss of cell–cell contacts on the gene expression of vascular endothelial growth factor (VEGF) and other factors in primary culture of human retinal pigment epithelial (RPE) cells with real-time reverse transcription-PCR.

methods. The dissociation of postconfluent RPE cells was induced by calcium chelation, low-calcium medium, anti-E-cadherin, and anti-N-cadherin antibodies. Total RNA was isolated from the cultured RPE cells and reverse transcribed to cDNA. VEGF was quantified by real-time PCR with a fluorescence detector. VEGF isoforms were differentially measured by specific exon-spanning primers. Besides VEGF, the gene expression levels of some other growth factors were also examined in calcium-mediated dissociation.

results. Disruption of cell–cell contacts of RPE cells was induced by calcium chelation and low-calcium medium, but not by anti-E-cadherin and anti-N-cadherin antibodies. Calcium-mediated dissociation of RPE cells significantly increased the gene expression levels of VEGF. The mRNA levels of VEGF increased by 6.3-fold on treatment with EGTA and by 4.7-fold in the low-calcium medium at 6 hours. Splice variants of VEGF showed the differential pattern of gene expression. Whereas the expression of VEGF121 and VEGF165 was upregulated on calcium-induced dissociation of RPE cells, that of VEGF145 and VEGF189 was unchanged. VEGF206 was not detected. On calcium-induced dissociation, bFGF, IL-6, matrix metalloproteinase (MMP)-1, and placental growth factor (PlGF) were upregulated, whereas acidic (a)FGF and pigment epithelium–derived factor (PEDF) were both downregulated.

conclusions. The results show that loss of intercellular contacts promotes increased gene expression of VEGF and other angiogenic factors in human RPE cells.

Choroidal neovascularization (CNV) in age-related macular degeneration (AMD) is the leading cause of severe visual impairment in the elderly population. 1 2 3 The abnormally formed new vessels originate from the choroid, penetrate Bruch’s membrane, and grow into the subretinal space. Vascular endothelial growth factor (VEGF, also referred to as VEGF-A) is one of the most potent angiogenic factors identified to date and has been implicated in CNV. 4 5 6 7 8 Other growth factors that promote angiogenesis include basic fibroblast growth factor (bFGF, also FGF-2), 9 10 acidic fibroblast growth factor (aFGF, also FGF-1), 11 angiogenin, 12 angiopoietin, 13 interleukin (IL)-6, 14 leptin, 15 16 matrix metalloproteinases (MMPs), 17 18 placental growth factor (PlGF), 19 and platelet-derived growth factor (PDGF). 20 Angiogenesis is also regulated by inhibitors or angiostatic factors, such as pigment epithelium–derived factor (PEDF) 21 22 and tissue inhibitor of metalloproteinase (TIMP)-1 and its family members. 23 24 The exact role of these factors in CNV is still under debate. 
RPE cells secrete angiogenic factors and modulators, such as VEGF and PEDF. 6 7 25 26 This cell type has also been shown to have diverse functions in the maintenance of retinal integrity and probably plays a crucial role in the formation of CNV. 6 7 25 26 27 28 29 30 31 32 33 However, the triggers that cause RPE cells to secrete angiogenic factors are still unknown. Oxidative stress is one factor that has been shown in experiments to cause the upregulation of angiogenic factors by RPE cells in vitro. 34 35 The lipid peroxide 4-hydroxynonenal has been found to increase VEGF expression in RPE cells in vitro. 36 Application of hydrogen peroxide to RPE cells in vitro does not change VEGF levels, but reduces the expression of PEDF in RPE cells, leading to an imbalance between angiogenic and angiostatic factors. 22 Aging is also an important factor implicated in the pathogenesis of AMD. We have recently analyzed the differential gene expression levels of VEGF and other angiogenic factors and have found that there is no enhanced expression of known angiogenic factors in late passage (replicatively senescent) RPE cells, 37 suggesting that aging, per se, is unlikely to be a causal factor in promoting CNV. 
In the present study, we investigated the effects of cell–cell interaction on the expression of angiogenesis-associated factors in RPE cells. Cell death of RPE occurs in aging eyes and pathologic conditions, such as oxidative stress, resulting in a partial loss of contacts with neighboring cells. 38 39 40 Although it has been reported that disruption of cadherin-related adherens junctions increases VEGF expression in aortic endothelial cells, 41 the effects of cell–cell adhesion on the expression of angiogenesis-associated factors in RPE cells have not been investigated. Cadherins are a superfamily of calcium-dependent cell adhesion molecules. 42 The dynamic expression and distribution of cadherins, particularly of E- and N-cadherin, in RPE cells have been extensively studied by Burke et al. 43 44 In the present study, we used real-time, quantitative reverse transcription-PCR to quantify the gene expression levels of VEGF and other factors on calcium-mediated cell dissociation in primary RPE cells. The effects of anti-E- and N-cadherin antibodies on cell dissociation were also examined. 
Materials and Methods
Tissue Culture of Primary RPE Cells
The primary human RPE cells were obtained from donor tissues as described previously. 37 The cells of passages 3 through 5 were used. They were cultured in laminin-coated flasks and maintained in a humidified atmosphere with 5% CO2. The culture medium is Dulbecco’s modified Eagle’s medium (DMEM) containing 10% fetal bovine serum (FBS). RPE cells were plated at 1 × 105 cells per well in six-well plates for both control and experimental groups. The cells reached confluence after approximately 1 week and were used after further culturing of 5 to 10 days. 
Calcium-Dependent Dissociation of Confluent RPE Cells
Three methods were used to disrupt calcium-dependent intercellular adhesion of confluent RPE cells: calcium chelation by EGTA, low-calcium medium, and calcium-switch with anti-E- and N-cadherin antibodies. 41 43 45 46 One day before these treatments, the medium of all cultures, including the control cultures, was replaced by 1% FBS supplemented DMEM. For EGTA treatment, EGTA was added to the medium at a final concentration of 4 mM on the day of the experiment. For low-calcium (∼10 μM) treatment, the medium was changed to calcium-free DMEM with 1% FBS. For the calcium-switch experiment, antibodies to anti-E-cadherin (Clone SHE78-7; Calbiochem, La Jolla, CA) and anti-N-cadherin (Clone GC-4; Sigma-Aldrich, St. Louis, MO) were used. In this experiment, the culture medium was first changed to low-calcium medium (calcium-free DMEM with 1% FBS) for 1 hour. Anti-N- or anti-E-cadherin was then added to the medium. The anti-N-cadherin antibody was diluted 1:30. The concentration of anti-E-cadherin antibody was 3 μg/mL. Mouse IgG (3 μg/mL) was used as the control. After a 30-minute incubation, calcium chloride was added to the medium at a final concentration of 1.8 mM, equivalent to the calcium level of normal DMEM. Samples were collected at different time intervals. 
Immunohistochemical Staining of Actin and Cadherins
Cultured RPE cells were fixed in 4% formaldehyde solution and permeated by 0.1% Triton X-100 in PBS. Cells were preincubated in PBS containing 1% FBS for 30 minutes to reduce nonspecific staining. Fluorescent Texas red-X phalloidin (Molecular Probes, Eugene, OR) was then used to stain F-actin. For immunostaining of the cadherins, fixed monolayers were incubated with primary antibodies of anti-E-cadherin (1 μg/mL) or anti-N-cadherin (1:100) overnight at 4°C. FITC-conjugated anti-mouse IgG was used as secondary antibody to visualize the stained cells. 
RT-PCR and Quantitative Real-Time PCR
Total RNA was isolated from the cultured RPE cells using TRIzol (Invitrogen, Carlsbad, CA). The RNA sample was then treated with DNase I to remove genomic DNA contaminants. The RNA yields for both control and experimental groups did not display any significant difference. The cDNA was synthesized by reverse transcription (SuperScript II reverse transcriptase; Invitrogen) and random primers. 
The splice variants of VEGF were amplified by PCR and visualized in agarose gel. The VEGF gene is composed of eight exons. The reported splice variants of VEGF contain VEGF121, VEGF145, VEGF165, VEGF189, and VEGF206, according to the lengths of amino acids in the mature proteins. 4 5 47 48 49 The common sequence of all variants is exons 1 to 5 and exon 8 (Fig. 1) . Therefore, the following primers, positioned on exons 1 and exon 8, respectively, were used to amplify all isoforms: 5′- TGCTGTCTTGGGTGCATTGGA-3′ (forward) and 5′- GAGAGATCTGGTTCCCGAAA-3′ (reverse). The cDNA samples were amplified by TaqDNA polymerase (Invitrogen) in 50 mM KCl, 20 mM Tris-HCl, 1.5 mM MgCl2, 0.2 mM dNTP and 0.4 μM of each primer. PCR was performed at 94°C for 2 minutes, followed by 35 cycles of 94°C for 15 seconds, 58°C for 30 seconds, and 72°C for 1 minute. 
The primers for quantifying VEGF isoforms in real-time PCR are shown in Figure 1and Table 1 . The mRNA sequences of VEGF121, VEGF145, VEGF165, and VEGF189 are from Keck et al. 5 (GenBank accession no. M27281; http://www.ncbi.nlm.nih.gov/Genbank; provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD), whereas that of VEGF206 is from Houck et al. 47 (GenBank accession no. S85192). The only difference of these two reported sequences is the length of exon 6, with the latter designated as exon 6(206). The primers for measuring all isoforms reside on exon 3. Other primers amplify each splice variant specifically. Real-time PCR was performed with a commercially available system (Prism 7000 Sequence Detection System; Applied Biosystems, Inc. (ABI), Foster City, CA). Fluorescence was detected (SYBR Green; ABI), and the reactions were performed according to the manufacturer’s protocol. The reactions were performed at 95°C for 10 minutes, followed by 40 cycles of 95°C for 15 seconds and 60°C for 1 minute. The correct amplification of a specific product was confirmed by the dissociation temperature of the product and agarose gel electrophoresis. Relative quantitation of gene expression was performed using a standard curve method. Briefly, the analysis was based on the threshold cycle (C t) values of the target genes with glyceraldehydes-3-phosphate dehydrogenase (GAPDH), as the endogenous control. The standard curve for each amplified product was constructed from the four serially diluted samples in duplicate, starting with a 1:20 dilution of cDNA and 1:2 diluted to 1:40, 1:80, and 1:160. Each standard curve was used to calculate the relative amount of unknown samples for that product. The amount of the target product was divided by the amount of GAPDH in the same sample to calculate the normalized value. The relative gene expression was represented by ratios of the normalized values of the experimental samples to that of the control. The effects of calcium-mediated cell dissociation on the gene expression of some other angiogenic or angiostatic factors were also examined. The primers for these factors are listed in Table 2
Results
We first examined the effects of three experimental methods on cell–cell adhesion of RPE cells. Shortly after administration of 4 mM EGTA to the RPE cell cultures, disruption of cell–cell contacts was evident, as observed under phase-contrast microscopy and immunostaining with F-actin antibody (Fig. 2) . Dissociation of intercellular junctions also occurred when free Ca2+ concentration was lowered to approximately 10 μM in low-calcium medium. The cadherins, such as E- and N-cadherin, are major homophilic cell–cell adhesion molecules. Immunocytochemical staining of the RPE cultures with antibodies to E- and N-cadherin showed their existence at intercellular sites (data not shown). These antibodies have been used to induce the disruption of intercellular adherens junctions. 43 50 However, treatment with blocking antibodies against E-cadherin (3 μg/mL) or N-cadherin (1:30) in calcium-switch experiments did not induce dissociation of RPE cells (Fig. 2) . Other concentrations of the anti-E-cadherin (0.1–3 μg/mL) and anti-N-cadherin (1:1000–1:30) antibodies, as well as the combination of anti-E-cadherin (3 μg/mL) and anti-N-cadherin (1:30) antibodies were examined in calcium-switch experiments, and no cell dissociation was observed (data not shown). 
VEGF is the major angiogenic factor synthesized by RPE cells. To investigate the relationship of calcium-dependent cell–cell adhesion and VEGF gene expression, real-time PCR was used to measure VEGF gene expression under different conditions. Total VEGF mRNA was quantified with the primers on exon 3 to measure all splice variants of VEGF. GAPDH was used as the internal control. As shown in Figure 3 , the total VEGF mRNA levels at 6 hours after treatment of EGTA and low-calcium medium significantly increased, whereas VEGF levels did not change with treatments with anti-E- and anti-N-cadherin antibodies in calcium-switch experiments. These results suggest that gene expression of VEGF is highly regulated by intercellular adhesion of RPE cells whose dissociation is induced by calcium chelation and low calcium concentration, but not by cadherin blocking. The time course of VEGF expression was examined in RPE cultures treated with EGTA and low-calcium medium (Fig. 4) . Total VEGF gene expression increased at 3 hours after addition of 4 mM EGTA and low-calcium medium. The increased expression reached peak levels at approximately 6 hours and gradually decreased within 24 hours. 
There are several VEGF isoforms generated by alternative splicing from a single gene. The splice variants, including V121, V145, V165, V189, and V206, have been identified in human tissue. These VEGF species have been implicated in different functions in a variety of tissues. In the present experiment, we used specific boundary-spanning primers to quantify the VEGF isoforms in calcium-dependent cell dissociation. First, the existence of VEGF isoforms in RPE cell cultures was examined. Total RNA from cultured RPE cells was reverse transcribed to cDNA. Standard RT-PCR was used to amplify all VEGF splice variants with primers on exons 1 and 8. Four amplified species, corresponding to V121, V145, V165, and V189, were shown in the gel (Fig. 5A) . No amplified product corresponding to V206 was found. VEGF isoforms were also examined by real-time quantitative RT-PCR with their corresponding primers, as shown in Table 1 . Consistently, the amplified products of V121, V145, V165, and V189, but not V206, were identified in agarose gel (Fig. 5B) . The same results were obtained from the RPE cell samples treated with EGTA and low-calcium medium (data not shown). 
The changes of VEGF isoforms under the condition of calcium-dependent cell–cell dissociation were quantified by real-time quantitative RT-PCR. The primers for amplifying total VEGF and its splice variants were shown in Figure 1and Table 1 . The cultured RPE cells were treated with 4 mM EGTA and low-calcium medium for 6 hours. GAPDH was the internal control, as described in the Methods section. Although total VEGF expression increased with treatments with EGTA and low-calcium medium, the levels of VEGF isoforms showed a differential pattern of expression (Fig. 6) . In both of the treatments, the expression levels of V121 and V165 significantly increased, whereas V145 and V189 were unchanged compared with levels in the control cultures. The mRNA of V206 was not detected in all the samples. This result shows the differential expression of VEGF isoforms after intercellular dissociation of RPE cells and suggests that each fragment may have specific physiological functions in vivo. 
Besides VEGF, many other growth factors have been implicated in angiogenesis. The effects of calcium-mediated intercellular dissociation on the gene expression of these factors were investigated. Twelve angiogenesis-related factors were selected for real-time PCR examination (Table 2) . GAPDH was used as the internal control. Leptin cDNA was not detected. The results showed that the gene expression levels of bFGF increased and that of aFGF decreased significantly in RPE cells treated by both EGTA and low-calcium medium (Table 3) . RPE cells treated with EGTA, but not low-calcium medium, showed the upregulated expression of IL-6, MMP-1, and PlGF and downregulated expression of PEDF. It is unknown why the changes of these factors were not observed in the treatment of low-calcium medium. The gene expression levels of other factors, including angiogenin, angiopoietin, MMP-2, PDGF, and TIMP-1 were unchanged in calcium-mediated dissociation. 
Discussion
Angiogenesis is a highly regulated process that is under the control of angiogenic stimulators and inhibitors. Unregulated angiogenesis is seen under pathologic conditions, including CNV in the wet form of AMD. As discussed earlier, RPE cells have been found to secrete angiogenesis-associated factors and modulate the formation of choroidal capillaries. It is important, therefore, to know the potential external or internal stimuli that may alter the homeostasis of these growth factors. In the present study, we investigated the effects of disruption of cell–cell contacts on the gene expression of some selected angiogenesis-associated factors in cultured RPE cells. Our results show that gene expression levels of a number of factors are significantly affected by calcium-dependent intercellular dissociation. VEGF, the major angiogenic factor, has the highest increase of gene expression. Other factors, such as bFGF, IL-6, MMP-1, and PlGF, showed upregulated gene expression of various degrees. aFGF and PEGF, however, were downregulated on disruption of cell–cell contacts. 
Integral intercellular adhesion is fundamental for the epithelial cells to exert physiological functions and maintain normal structure. Adherens junctions, along with several other types of junctions, develop at the cell-to-cell contact sites between neighboring cells after confluence. Cadherins are a superfamily of Ca2+-dependent cell-adhesion molecules. 42 51 Calcium binding with the extracellular portion of the polypeptide chain is a prerequisite for cadherin-mediated cell–cell adhesion. Removal of extracellular Ca2+ ions by EGTA or calcium-free medium can cause obvious dissociation of RPE cells, as observed by changes in cellular morphology and junction-associated actin. However, function-blocking antibodies against E- and N-cadherin have failed to disrupt intercellular adhesions of RPE cells, though expression of E- and N-cadherin was confirmed by immunocytochemical staining. It is assumed that the formation of Ca2+-dependent adherens junctions of RPE cells involves many other members of the cadherin superfamily besides E- and N-cadherin. Blocking one or two cadherins may not be enough to disrupt the cell–cell adhesions. Blocking antibodies have been reported to induce disruption of intercellular adhesion in other cell types and, subsequently, changes of cellular function. It has been found that anti-vascular endothelial cadherin (VE-Cad) antibody, as well as EGTA, disrupts adherens junctions of aortic endothelial cells and stimulates VEGF production. 41 In airway epithelial cells, anti-E-cadherin antibody, or low Ca2+, disrupts intercellular adhesions and increases cell permeability and adenoviral infection. 50 These results indicate that functional changes are closely related to the status of intercellular adhesion. Disruption of cell–cell contacts by either extracellular Ca2+ manipulation or blocking antibodies of cadherins can trigger changes of a series of cellular functions. It is clear that the cadherin homodimers of the neighboring cells are linked to actin cytoskeleton by catenins and other cytoskeletal protein. 52 53 However, the signaling pathway from cadherins to the effective genes in nuclei remains largely unclear. It has yet to be clarified that the gene expression changes in Ca2+-mediated cell dissociation model do not result from the direct action of cellular Ca2+ concentration. There is no evidence thus far showing that low extracellular Ca2+ itself may change intracellular Ca2+ levels. However, an effective cell dissociation model without calcium involvement, such as physical removal of certain areas of confluent cells, needs to be developed to clarify the role of Ca2+ ions. 
RPE cells on Ca2+-mediated dissociation show the differential gene expression of VEGF isoforms in our study. Of the five reported splice variants of VEGF, V206 was not detected in RPE cells. V121 and V165 were significantly upregulated on Ca2+-mediated disruption of cell–cell contacts, whereas V145 and V189 were unchanged. This result reflects the different biological activities of each VEGF isoform. Consistent with this observation, other reports have shown the distinguished function of V121 and V165 in promoting angiogenesis. 47 54 55 56 For example, using transiently expressed VEGF clones, Houck et al. 47 found that V121 and V165, but not V189 and V206, possess endothelial cell mitogenic activity. A clinical study showed that VEGF121 and VEGF165 are more significantly related to synovial proliferation in diabetes mellitus than other VEGF isoforms. 56 The VEGF isoforms have different heparin-binding properties. V121, the shortest form, does not bind heparin, and diffuses more readily. 57 V145 and V165 both bind heparin. However, VEGF145 binds extracellular matrix (ECM) more efficiently, than does V165, which only weakly binds ECM. 49 57 V189 and V206 are tightly bound to the cell surface and ECM due to their powerful affinity to heparin-containing proteoglycans. 57 58 These lines of evidence suggest that the more diffusible isoforms of V121 and V165 play important roles in promoting angiogenesis. 
Besides VEGF, many other factors are involved in the angiogenesis process. Of the limited number of growth factors we examined, angiogenic stimulators and inhibitors displayed a differential expression pattern. bFGF is another major angiogenic factor that has been described. 59 60 61 In our study, bFGF was upregulated in Ca2+-mediated dissociation of RPE cells. Other genes that showed increased gene expression included PlGF, MMP-1, and IL-6. PlGF shares 53% amino acid sequence identity with VEGF and is capable of stimulating endothelial cell growth in vitro. 19 MMPs are a family of degradative enzymes involved in the breakdown of ECM in normal physiological functions and disease processes, including neovascularization. 17 62 IL-6 also plays a role in angiogenesis. 14 Our study shows the decreased gene expression of aFGF and PEDF on calcium chelation. The reason for the downregulation of aFGF is unknown, because aFGF is considered an angiogenic factor. 11 PEDF is a potent inhibitor of angiogenesis. 21 Ohno-Matsui et al. 22 reported that H2O2 induces a dose-dependent decrease of PEDF expression in differentiated RPE cells, whereas VEGF expression is unchanged. They suggested that the oxidative-stress–induced vessel formation results from the imbalance of VEGF and PEDF, rather than a single-factor action. These data demonstrate that synergistic efforts from angiogenic factors and inhibitors are necessary for the multistep process of angiogenesis that consists of degradation of basement membrane, migration, and proliferation of endothelial cells, canalization, and branching, for example. 
There are several lines of evidence that show the possible interaction among multiple angiogenic factors in different cell types. For example, combined administration of VEGF and bFGF to endothelial cells in three-dimensional collagen gels results in much greater and more rapid capillary tubule formation than the additive effects of either mitogen alone. 63 64 This synergism of VEGF and bFGF was also found in the capillary formation in an animal model of hind limb ischemia. 65 The combinations of other growth factors, such as bFGF and PlGF or VEGF and insulin-like growth factor (IGF)-I, have shown similar synergistic effects on cell migration and proliferation of retinal endothelial cells. 66 These results demonstrate the convergent action of multiple growth factors in processes leading to angiogenesis. Though the mechanism is largely unknown, some growth factors stimulate the production of receptors for other growth factors and act synergistically at this level. 67 68 Growth factors may also regulate the gene expression levels of other growth factors in an autocrine or paracrine manner. It has recently been reported that VEGF induces MMP-1 and IL-6 expression, and these findings suggest that VEGF is an autocrine stimulator in chondrocytes. 69 It was also found that bFGF could upregulate VEGF expression in different cell types, such as endothelial cells, 70 mesothelial cells, 71 and smooth muscle cells. 72 It is still unknown whether RPE cells share similar regulatory mechanisms, but it is highly possible. These studies point to the complex interactions among angiogenic factors, and highlight the need for further understanding of the synergistic effects, as well as the individual effects, of these growth factors. 
Upregulation of a variety of growth factors, or a balance shift toward angiogenesis, was also reported in the wound-healing response. Mainly studied in skin wound-healing models, the family members of growth factors, including VEGF, FGF, PDGF, IGF, and EGF, were shown to have increased expression at the wound site. 73 Similarly, induction of experimental CNV by laser burns increases the expression levels of VEGF and its receptor, as well as bFGF, in RPE cells. 74 75 There is evidence that wound healing may be a factor associated with the pathogenesis of AMD. 76 In the wound-healing models, cells at the edges of wounded monolayers not only lose cell–cell contacts, but also initiate an inflammatory response. Thus, in the wound-healing models, multiple factors may be associated with the balance shift toward angiogenesis. However, in the present study, we focused on the role of cell–cell contacts and its relationship to the balance shift toward angiogenesis. 
Evidence has been obtained from human donor eyes that RPE cells may undergo apoptosis due to aging and/or oxidative stress caused by such injuries as UV light damage or trauma. 77 The loss of cell–cell contacts within the RPE monolayer may be one of the triggers leading to a balance shift toward angiogenesis. If surrounding cells do not migrate into and replace the dead or dying cells, a chronic upregulation of angiogenic factors from the surviving cells may ensue. There is indirect evidence of this process, in that it has been found that focal CNV is associated with surviving RPE cells. 78 More efforts are needed to clarify the role of cell–cell contacts on the RPE cell in CNV and other angiogenic processes in the eye. 
 
Figure 1.
 
Primer design for the quantitative assay of VEGF isoforms by real-time PCR. There are five splice variants of VEGF reported thus far. Exons 1 to 5 and exon 8 (shaded areas) are the common fragments among all of them. Arrowheads: primers for amplifying all splice variants; arrows: primers for measuring each isoform. The reverse primers overlapping two exons determine their amplified specificity. The sequences of V121, V145, V165, and V189 are obtained from Keck et al., 5 and that of V206 from Houck et al. 47
Figure 1.
 
Primer design for the quantitative assay of VEGF isoforms by real-time PCR. There are five splice variants of VEGF reported thus far. Exons 1 to 5 and exon 8 (shaded areas) are the common fragments among all of them. Arrowheads: primers for amplifying all splice variants; arrows: primers for measuring each isoform. The reverse primers overlapping two exons determine their amplified specificity. The sequences of V121, V145, V165, and V189 are obtained from Keck et al., 5 and that of V206 from Houck et al. 47
Table 1.
 
Primers for Quantitation of VEGF and Its Splice Variants
Table 1.
 
Primers for Quantitation of VEGF and Its Splice Variants
Amplified VEGF Splice Variants Primer’s Sequence (5′–3′) (Forward and Reverse) and Length (bp) Primer Position on VEGF Exons Amplicon Size (bp)
All VEGF Variants (F) AGATCGAGTACATCTTCAAGCCATC (25) Exon 3 66
(R) CGTCATTGCAGCAGCCC (17) Exon 3
VEGF121 (F) GATCAAACCTCACCAAGGCCA (21) Exon 4 116
(R) GCCTCGGCTTGTCACATTTTTC (22) Exon 8 (1–17) + Exon 5 (18–22)
VEGF145 (F) ATCAGTTCGAGGAAAGGGAAAGG (23) Exon 6a 85
(R) CCTCGGCTTGTCACATACGCT (21) Exon 8 (1–16) + Exon 6a (17–21)
VEGF165 (F) CAGATTATGCGGATCAAACCTCA (23) Exon 3 (1–3) + Exon 4 (4–23) 125
(R) CAAGGCCCACAGGGATTTTC (20) Exon 7 (1–15) + Exon 5 (16–20)
VEGF189 (F) CAGCACAACAAATGTGAATGCAG (23) Exon 4 137
(R) GGCCCACAGGGAACGCT (17) Exon 7 (1–12) + Exon 6a (13–17)
VEGF206 (F) GGTATAAGTCCTGGAGCGTGTACG (24) Exon 6b 85
(R) CAAGGCCCACAGGGATGG (18) Exon 7 (1–15) + Exon 6b (16–18)
Table 2.
 
Primer List Used for Real-Time PCR
Table 2.
 
Primer List Used for Real-Time PCR
Gene GenBank Accession No. Forward Primer (5′–3′) Reverse Primer (5′–3′) Amplicon Length (bp)
aFGF X65779 CCTTCCGGATGGCACAGT ACATTCCTCATTTGGTGTCTGTGT 71
Angiogenin M11567 TTCCTGACCCAGCACTATGATG CGTCTCCTCATGATGCTTTCAC 74
Angiopoietin U83508 GGAACATGTGATGGAAAATTATACTCA GGGCCATCTCCGACTTCAT 83
bFGF J04513 CCGACGGCCGAGTTGAC TAACGGTTAGCACACACTCCTTTG 112
GAPDH X01677 CATCCATGACAACTTTGGTATCGT CAGTCTTCTGGGTGGCAGTGA 74
IL-6 X04602 GGTACATCCTCGACGGCATCT GTGCCTCTTTGCTGCTTTCAC 81
Leptin U18915 TCACCAGGATCAATGACATTTCAC CCCAGGAATGAAGTCCAAACC 80
MMP-1 X54925 TTGAAGCTGCTTACGAATTTGC GTCCCTGAACAGCCCAGTACTT 78
MMP-2 J03210 TCTTCCCCTTCACTTTCCTGG CACTTGCGGTCGTCATCGTA 112
PEDF M76979 CGACCAACGTGCTCCTGTCT GATGTCTGGGCTGCTGATCA 131
PIGF X54936 TGGAGACGGCCAATGTCA GAACGTCAGCTCCACGTAGGA 77
PDGF X02811 CGATCCGCTCCTTTGATGAT TCCAACTCGGCCCCATCT 73
TIMP-1 X03124 CGCTGACATCCGGTTCGT GTTGTGGGACCTGTGGAAGTATC 70
Figure 2.
 
Photomicrographs showing the effects of calcium chelation, low-calcium medium, and anti-cadherin antibodies on intercellular adhesions of RPE cells. The cells were visualized by phase-contrast microscope (A, C, E, G, I) and fluorescence-stained actin (B, D, F, H, J). The postconfluent cultures prepared from human donor eyes showed cell–cell contacts and circumferential actin (A, B). The cultures were treated with EGTA (4 mM) for 60 minutes (C, D), low-calcium medium for 60 minutes (E, F), or anti-E-cadherin (G, H; 3 μg/mL) or anti-N-cadherin (I, J; 1:30) antibodies in calcium-switch experiments for 60 minutes after calcium reloading. Scale bar: (A, C, E, G, I) 20 μm; (B, D, F, H, J) 10 μm.
Figure 2.
 
Photomicrographs showing the effects of calcium chelation, low-calcium medium, and anti-cadherin antibodies on intercellular adhesions of RPE cells. The cells were visualized by phase-contrast microscope (A, C, E, G, I) and fluorescence-stained actin (B, D, F, H, J). The postconfluent cultures prepared from human donor eyes showed cell–cell contacts and circumferential actin (A, B). The cultures were treated with EGTA (4 mM) for 60 minutes (C, D), low-calcium medium for 60 minutes (E, F), or anti-E-cadherin (G, H; 3 μg/mL) or anti-N-cadherin (I, J; 1:30) antibodies in calcium-switch experiments for 60 minutes after calcium reloading. Scale bar: (A, C, E, G, I) 20 μm; (B, D, F, H, J) 10 μm.
Figure 3.
 
Changes of VEGF expression induced by calcium chelation, low calcium and anti-cadherin antibodies. Postconfluent RPE cells were treated for 6 hours under the following conditions: EGTA (4 mM), low-calcium medium, anti-E-cadherin (3 μg/mL), and anti-N-cadherin (1:30) antibodies in calcium-switch experiments. The cDNA was synthesized by reverse transcription. The expression levels of total VEGF (including all splice variants) were quantified by real-time PCR with the primers on exon 3 as shown in Figure 1 . Values are expressed as x-fold changes compared with the control. Data represent the mean ± SEM of duplicate samples in four independent experiments. *Significantly different from the control (P < 0.01).
Figure 3.
 
Changes of VEGF expression induced by calcium chelation, low calcium and anti-cadherin antibodies. Postconfluent RPE cells were treated for 6 hours under the following conditions: EGTA (4 mM), low-calcium medium, anti-E-cadherin (3 μg/mL), and anti-N-cadherin (1:30) antibodies in calcium-switch experiments. The cDNA was synthesized by reverse transcription. The expression levels of total VEGF (including all splice variants) were quantified by real-time PCR with the primers on exon 3 as shown in Figure 1 . Values are expressed as x-fold changes compared with the control. Data represent the mean ± SEM of duplicate samples in four independent experiments. *Significantly different from the control (P < 0.01).
Figure 4.
 
Time course of VEGF expression on calcium-dependent cell dissociation. The postconfluent cultures were treated with EGTA and low-calcium medium. The samples were collected at different time intervals. Total VEGF levels were measured by real-time PCR with the primers on exon 3. Data are expressed as changes (x-fold) with respect to the control. Data represent the mean ± SEM of duplicates in four independent experiments. *Significantly different from the control (P < 0.01).
Figure 4.
 
Time course of VEGF expression on calcium-dependent cell dissociation. The postconfluent cultures were treated with EGTA and low-calcium medium. The samples were collected at different time intervals. Total VEGF levels were measured by real-time PCR with the primers on exon 3. Data are expressed as changes (x-fold) with respect to the control. Data represent the mean ± SEM of duplicates in four independent experiments. *Significantly different from the control (P < 0.01).
Figure 5.
 
Identification of amplified products of VEGF isoforms. The cDNA sample of confluent RPE cells was amplified by PCR and real-time PCR. (A) PCR products amplified with primers on exons 1 and 8. The expected lengths (base pairs) of the VEGF isoforms are 485 (V121), 557 (V145), 617 (V165), 689 (V189), and 740 (V206). (B) Real-time PCR products amplified with each pair of primers shown in Table 1 . V206 products were not detected in both cases. Similar results were also observed from RPE cells treated with EGTA and low-calcium medium (not shown).
Figure 5.
 
Identification of amplified products of VEGF isoforms. The cDNA sample of confluent RPE cells was amplified by PCR and real-time PCR. (A) PCR products amplified with primers on exons 1 and 8. The expected lengths (base pairs) of the VEGF isoforms are 485 (V121), 557 (V145), 617 (V165), 689 (V189), and 740 (V206). (B) Real-time PCR products amplified with each pair of primers shown in Table 1 . V206 products were not detected in both cases. Similar results were also observed from RPE cells treated with EGTA and low-calcium medium (not shown).
Figure 6.
 
Expression of individual splice variants of VEGF on calcium-dependent cell dissociation. Postconfluent RPE cells were treated with EGTA and low-calcium medium for 6 hours. The cDNA was synthesized by reverse transcription. Total VEGF and each splice variant were quantified by real-time PCR with the specific primers shown in Table 1 . V206 was not amplified in all the samples. Data are expressed as relative changes (x-fold) in comparison with the corresponding control cultures. Data represent the mean ± SEM of duplicates in four independent experiments. *Significantly different from the control (P < 0.01).
Figure 6.
 
Expression of individual splice variants of VEGF on calcium-dependent cell dissociation. Postconfluent RPE cells were treated with EGTA and low-calcium medium for 6 hours. The cDNA was synthesized by reverse transcription. Total VEGF and each splice variant were quantified by real-time PCR with the specific primers shown in Table 1 . V206 was not amplified in all the samples. Data are expressed as relative changes (x-fold) in comparison with the corresponding control cultures. Data represent the mean ± SEM of duplicates in four independent experiments. *Significantly different from the control (P < 0.01).
Table 3.
 
Relative Gene Expression of Angiogenesis-Related Factors in Calcium-Mediated RPE Cell Dissociation
Table 3.
 
Relative Gene Expression of Angiogenesis-Related Factors in Calcium-Mediated RPE Cell Dissociation
Gene EGTA/ Control Change Low Ca/Control Change
aFGF 0.24 ± 0.02 0.54 ± 0.09
Angiogenin 1.52 ± 0.23 1.17 ± 0.14
Angiopoietin 0.78 ± 0.24 1.04 ± 0.11
bFGF 1.60 ± 0.07 1.63 ± 0.14
IL-6 2.86 ± 0.19 0.88 ± 0.34
MMP-1 2.16 ± 0.28 1.56 ± 0.24
MMP-2 0.83 ± 0.08 1.08 ± 0.11
PEDF 0.69 ± 0.04 1.21 ± 0.05
PIGF 2.32 ± 0.12 1.12 ± 0.16
PDGF 1.18 ± 0.05 1.67 ± 0.19
TIMP-1 1.06 ± 0.07 1.11 ± 0.05
The authors thank Robert Molday for comments and suggestions during the course of this study. 
LeibowitzHM, KruegerDE, MaunderLR, et al. The Framingham Eye Study monograph: an ophthalmological and epidemiological study of cataract, glaucoma, diabetic retinopathy, macular degeneration, and visual acuity in a general population of 2631 adults, 1973–1975. Surv Ophthalmol. 1980;24:335–610. [CrossRef] [PubMed]
SommerA, TielschJM, KatzJ, et al. Racial differences in the cause-specific prevalence of blindness in east Baltimore. N Engl J Med. 1991;325:1412–1417. [CrossRef] [PubMed]
KleinR, WangQ, KleinBE, MossSE, MeuerSM. The relationship of age-related maculopathy, cataract, and glaucoma to visual acuity. Invest Ophthalmol Vis Sci. 1995;36:182–191. [PubMed]
LeungDW, CachianesG, KuangWJ, GoeddelDV, FerraraN. Vascular endothelial growth factor is a secreted angiogenic mitogen. Science. 1989;246:1306–1309. [CrossRef] [PubMed]
KeckPJ, HauserSD, KriviG, et al. Vascular permeability factor, an endothelial cell mitogen related to PDGF. Science. 1989;246:1309–1312. [CrossRef] [PubMed]
AdamisAP, ShimaDT, YeoKT, et al. Synthesis and secretion of vascular permeability factor/vascular endothelial growth factor by human retinal pigment epithelial cells. Biochem Biophys Res Commun. 1993;193:631–638. [CrossRef] [PubMed]
KvantaA, AlgverePV, BerglinL, SeregardS. Subfoveal fibrovascular membranes in age-related macular degeneration express vascular endothelial growth factor. Invest Ophthalmol Vis Sci. 1996;37:1929–1934. [PubMed]
WitmerAN, VrensenGF, Van NoordenCJ, SchlingemannRO. Vascular endothelial growth factors and angiogenesis in eye disease. Prog Retin Eye Res. 2003;22:1–29. [CrossRef] [PubMed]
EschF, BairdA, LingN, et al. Primary structure of bovine pituitary basic fibroblast growth factor (FGF) and comparison with the amino-terminal sequence of bovine brain acidic FGF. Proc Natl Acad Sci USA. 1985;82:6507–6511. [CrossRef] [PubMed]
StraumeO, AkslenLA. Importance of vascular phenotype by basic fibroblast growth factor, and influence of the angiogenic factors basic fibroblast growth factor/fibroblast growth factor receptor-1 and ephrin-A1/EphA2 on melanoma progression. Am J Pathol. 2002;160:1009–1019. [CrossRef] [PubMed]
ThomasKA, Rios-CandeloreM, Gimenez-GallegoG, et al. Pure brain-derived acidic fibroblast growth factor is a potent angiogenic vascular endothelial cell mitogen with sequence homology to interleukin 1. Proc Natl Acad Sci USA. 1985;82:6409–6413. [CrossRef] [PubMed]
FettJW, StrydomDJ, LobbRR, et al. Isolation and characterization of angiogenin, an angiogenic protein from human carcinoma cells. Biochemistry. 1985;24:5480–5486. [CrossRef] [PubMed]
SuriC, McClainJ, ThurstonG, et al. Increased vascularization in mice overexpressing angiopoietin-1. Science. 1998;282:468–471. [CrossRef] [PubMed]
MotroB, ItinA, SachsL, KeshetE. Pattern of interleukin 6 gene expression in vivo suggests a role for this cytokine in angiogenesis. Proc Natl Acad Sci USA. 1990;87:3092–3096. [CrossRef] [PubMed]
Sierra-HonigmannMR, NathAK, MurakamiC, et al. Biological action of leptin as an angiogenic factor. Science. 1998;281:1683–1686. [CrossRef] [PubMed]
BouloumieA, DrexlerHC, LafontanM, BusseR. Leptin, the product of Ob gene, promotes angiogenesis. Circ Res. 1998;83:1059–1066. [CrossRef] [PubMed]
FisherC, Gilbertson-BeadlingS, PowersEA, PetzoldG, PoormanR, MitchellMA. Interstitial collagenase is required for angiogenesis in vitro. Dev Biol. 1994;162:499–510. [CrossRef] [PubMed]
ItohT, TaniokaM, YoshidaH, YoshiokaT, NishimotoH, ItoharaS. Reduced angiogenesis and tumor progression in gelatinase A-deficient mice. Cancer Res. 1998;58:1048–1051. [PubMed]
MaglioneD, GuerrieroV, VigliettoG, Delli-BoviP, PersicoMG. Isolation of a human placenta cDNA coding for a protein related to the vascular permeability factor. Proc Natl Acad Sci USA. 1991;88:9267–9271. [CrossRef] [PubMed]
IshikawaF, MiyazonoK, HellmanU, et al. Identification of angiogenic activity and the cloning and expression of platelet-derived endothelial cell growth factor. Nature. 1989;338:557–562. [CrossRef] [PubMed]
DawsonDW, VolpertOV, GillisP, et al. Pigment epithelium-derived factor: a potent inhibitor of angiogenesis. Science. 1999;285:245–248. [CrossRef] [PubMed]
Ohno-MatsuiK, MoritaI, Tombran-TinkJ, et al. Novel mechanism for age-related macular degeneration: an equilibrium shift between the angiogenesis factors VEGF and PEDF. J Cell Physiol. 2001;189:323–333. [CrossRef] [PubMed]
JohnsonMD, KimHR, CheslerL, Tsao-WuG, BouckN, PolveriniPJ. Inhibition of angiogenesis by tissue inhibitor of metalloproteinase. J Cell Physiol. 1994;160:194–202. [CrossRef] [PubMed]
FassinaG, FerrariN, BrigatiC, et al. Tissue inhibitors of metalloproteases: regulation and biological activities. Clin Exp Metastasis. 2000;18:111–120. [CrossRef] [PubMed]
Tombran-TinkJ, ChaderGG, JohnsonLV. PEDF: a pigment epithelium-derived factor with potent neuronal differentiative activity. Exp Eye Res. 1991;53:411–414. [CrossRef] [PubMed]
SteeleFR, ChaderGJ, JohnsonLV, Tombran-TinkJ. Pigment epithelium-derived factor: neurotrophic activity and identification as a member of the serine protease inhibitor gene family. Proc Natl Acad Sci USA. 1993;90:1526–1530. [CrossRef] [PubMed]
SpraulCW, LangGE, GrossniklausHE. Morphometric analysis of the choroid, Bruch’s membrane, and retinal pigment epithelium in eyes with age-related macular degeneration. Invest Ophthalmol Vis Sci. 1996;37:2724–2735. [PubMed]
GreenWR, McDonnellPJ, YeoJH. Pathologic features of senile macular degeneration. Ophthalmology. 1985;92:615–627. [CrossRef] [PubMed]
SchraermeyerU, HeimannK. Current understanding on the role of retinal pigment epithelium and its pigmentation. Pigment Cell Res. 1999;12:219–236. [CrossRef] [PubMed]
BokD. The retinal pigment epithelium: a versatile partner in vision. J Cell Sci Suppl. 1993;17:189–195. [PubMed]
MarmorsteinAD, FinnemannSC, BonilhaVL, Rodriguez-BoulanE. Morphogenesis of the retinal pigment epithelium: toward understanding retinal degenerative diseases. Ann NY Acad Sci. 1998;857:1–12. [CrossRef] [PubMed]
KorteGE, GerszbergT, PuaF, HenkindP. Choriocapillaris atrophy after experimental destruction of the retinal pigment epithelium in the rat: a study in thin sections and vascular casts. Acta Anat (Basel). 1986;127:171–175. [CrossRef] [PubMed]
SakamotoT, SakamotoH, MurphyTL, et al. Vessel formation by choroidal endothelial cells in vitro is modulated by retinal pigment epithelial cells. Arch Ophthalmol. 1995;113:512–520. [CrossRef] [PubMed]
BeattyS, KohH, PhilM, HensonD, BoultonM. The role of oxidative stress in the pathogenesis of age-related macular degeneration. Surv Ophthalmol. 2000;45:115–134. [CrossRef] [PubMed]
CaiJ, NelsonKC, WuM, SternbergP, Jr, JonesDP. Oxidative damage and protection of the RPE. Prog Retin Eye Res. 2000;19:205–221. [CrossRef] [PubMed]
AyalasomayajulaSP, KompellaUB. Induction of vascular endothelial growth factor by 4-hydroxynonenal and its prevention by glutathione precursors in retinal pigment epithelial cells. Eur J Pharmacol. 2002;449:213–220. [CrossRef] [PubMed]
WangXF, CuiJZ, NieW, PrasadSS, MatsubaraJA. Differential gene expression of early and late passage retinal pigment epithelial cells. Exp Eye Res. 2004;79:209–221. [CrossRef] [PubMed]
DoreyCK, WuG, EbensteinD, GarsdA, WeiterJJ. Cell loss in the aging retina: relationship to lipofuscin accumulation and macular degeneration. Invest Ophthalmol Vis Sci. 1989;30:1691–1699. [PubMed]
KleinR, KleinBE, LintonKL. Prevalence of age-related maculopathy. The Beaver Dam Eye Study. Ophthalmology. 1992;99:933–943. [CrossRef] [PubMed]
JiangS, MoriartySE, GrossniklausH, NelsonKC, JonesDP, SternbergP, Jr. Increased oxidant-induced apoptosis in cultured nondividing human retinal pigment epithelial cells. Invest Ophthalmol Vis Sci. 2002;43:2546–2553. [PubMed]
CastillaMA, ArroyoMV, AceitunoE, et al. Disruption of cadherin-related junctions triggers autocrine expression of vascular endothelial growth factor in bovine aortic endothelial cells: effects on cell proliferation and death resistance. Circ Res. 1999;85:1132–1138. [CrossRef] [PubMed]
AngstBD, MarcozziC, MageeAI. The cadherin superfamily: diversity in form and function. J Cell Sci. 2001;114:629–641. [PubMed]
KaidaM, CaoF, SkumatzCM, IrvingPE, BurkeJM. Time at confluence for human RPE cells: effects on the adherens junction and in vitro wound closure. Invest Ophthalmol Vis Sci. 2000;41:3215–3224. [PubMed]
BurkeJM, CaoF, IrvingPE, SkumatzCM. Expression of E-cadherin by human retinal pigment epithelium: delayed expression in vitro. Invest Ophthalmol Vis Sci. 1999;40:2963–2970. [PubMed]
VolbergT, GeigerB, KartenbeckJ, FrankeWW. Changes in membrane-microfilament interaction in intercellular adherens junctions upon removal of extracellular Ca2+ ions. J Cell Biol. 1986;102:1832–1842. [CrossRef] [PubMed]
NorenNK, NiessenCM, GumbinerBM, BurridgeK. Cadherin engagement regulates Rho family GTPases. J Biol Chem. 2001;276:33305–33308. [CrossRef] [PubMed]
HouckKA, FerraraN, WinerJ, CachianesG, LiB, LeungDW. The vascular endothelial growth factor family: identification of a fourth molecular species and characterization of alternative splicing of RNA. Mol Endocrinol. 1991;5:1806–1814. [CrossRef] [PubMed]
TischerE, MitchellR, HartmanT, et al. The human gene for vascular endothelial growth factor: multiple protein forms are encoded through alternative exon splicing. J Biol Chem. 1991;266:11947–11954. [PubMed]
PoltorakZ, CohenT, SivanR, et al. VEGF145, a secreted vascular endothelial growth factor isoform that binds to extracellular matrix. J Biol Chem. 1997;272:7151–7158. [CrossRef] [PubMed]
ManY, HartVJ, RingCJ, SanjarS, WestMR. Loss of epithelial integrity resulting from E-cadherin dysfunction predisposes airway epithelial cells to adenoviral infection. Am J Respir Cell Mol Biol. 2000;23:610–617. [CrossRef] [PubMed]
NagafuchiA. Molecular architecture of adherens junctions. Curr Opin Cell Biol. 2001;13:600–603. [CrossRef] [PubMed]
VasioukhinV, FuchsE. Actin dynamics and cell–cell adhesion in epithelia. Curr Opin Cell Biol. 2001;13:76–84. [CrossRef] [PubMed]
GumbinerBM. Cell adhesion: the molecular basis of tissue architecture and morphogenesis. Cell. 1996;84:345–357. [CrossRef] [PubMed]
GengrinovitchS, GreenbergSM, CohenT, et al. Platelet factor-4 inhibits the mitogenic activity of VEGF121 and VEGF165 using several concurrent mechanisms. J Biol Chem. 1995;270:15059–15065. [CrossRef] [PubMed]
KondoS, MatsumotoT, YokoyamaY, OhmoriI, SuzukiH. The shortest isoform of human vascular endothelial growth factor/vascular permeability factor (VEGF/VPF121) produced by Saccharomyces cerevisiae promotes both angiogenesis and vascular permeability. Biochim Biophys Acta. 1995;1243:195–202. [CrossRef] [PubMed]
HandaA, GotohM, HamadaK, et al. Vascular endothelial growth factor 121 and 165 in the subacromial bursa are involved in shoulder joint contracture in type II diabetics with rotator cuff disease. J Orthop Res. 2003;21:1138–1144. [CrossRef] [PubMed]
HouckKA, LeungDW, RowlandAM, WinerJ, FerraraN. Dual regulation of vascular endothelial growth factor bioavailability by genetic and proteolytic mechanisms. J Biol Chem. 1992;267:26031–26037. [PubMed]
ParkJE, KellerGA, FerraraN. The vascular endothelial growth factor (VEGF) isoforms: differential deposition into the subepithelial extracellular matrix and bioactivity of extracellular matrix-bound VEGF. Mol Biol Cell. 1993;4:1317–1326. [CrossRef] [PubMed]
HayekA, CullerFL, BeattieGM, LopezAD, CuevasP, BairdA. An in vivo model for study of the angiogenic effects of basic fibroblast growth factor. Biochem Biophys Res Commun. 1987;147:876–880. [CrossRef] [PubMed]
FrankRN, AminRH, EliottD, PuklinJE, AbramsGW. Basic fibroblast growth factor and vascular endothelial growth factor are present in epiretinal and choroidal neovascular membranes. Am J Ophthalmol. 1996;122:393–403. [CrossRef] [PubMed]
AbrahamJA, MergiaA, WhangJL, et al. Nucleotide sequence of a bovine clone encoding the angiogenic protein, basic fibroblast growth factor. Science. 1986;233:545–548. [CrossRef] [PubMed]
NelsonAR, FingletonB, RothenbergML, MatrisianLM. Matrix metalloproteinases: biologic activity and clinical implications. J Clin Oncol. 2000;18:1135–1149. [PubMed]
GotoF, GotoK, WeindelK, FolkmanJ. Synergistic effects of vascular endothelial growth factor and basic fibroblast growth factor on the proliferation and cord formation of bovine capillary endothelial cells within collagen gels. Lab Invest. 1993;69:508–517. [PubMed]
PepperMS, FerraraN, OrciL, MontesanoR. Potent synergism between vascular endothelial growth factor and basic fibroblast growth factor in the induction of angiogenesis in vitro. Biochem Biophys Res Commun. 1992;189:824–831. [CrossRef] [PubMed]
AsaharaT, BautersC, ZhengLP, et al. Synergistic effect of vascular endothelial growth factor and basic fibroblast growth factor on angiogenesis in vivo. Circulation. 1995;92:II365–371. [CrossRef] [PubMed]
CastellonR, HamdiHK, SacerioI, AokiAM, KenneyMC, LjubimovAV. Effects of angiogenic growth factor combinations on retinal endothelial cells. Exp Eye Res. 2002;74:523–535. [CrossRef] [PubMed]
HataY, RookSL, AielloLP. Basic fibroblast growth factor induces expression of VEGF receptor KDR through a protein kinase C and p44/p42 mitogen-activated protein kinase-dependent pathway. Diabetes. 1999;48:1145–1155. [CrossRef] [PubMed]
YoshijiH, KuriyamaS, YoshiiJ, et al. Synergistic effect of basic fibroblast growth factor and vascular endothelial growth factor in murine hepatocellular carcinoma. Hepatology. 2002;35:834–842. [CrossRef] [PubMed]
PufeT, HardeV, PetersenW, GoldringMB, TillmannB, MentleinR. Vascular endothelial growth factor (VEGF) induces matrix metalloproteinase expression in immortalized chondrocytes. J Pathol. 2004;202:367–374. [CrossRef] [PubMed]
SeghezziG, PatelS, RenCJ, et al. Fibroblast growth factor-2 (FGF-2) induces vascular endothelial growth factor (VEGF) expression in the endothelial cells of forming capillaries: an autocrine mechanism contributing to angiogenesis. J Cell Biol. 1998;141:1659–1673. [CrossRef] [PubMed]
SakoA, KitayamaJ, YamaguchiH, et al. Vascular endothelial growth factor synthesis by human omental mesothelial cells is augmented by fibroblast growth factor-2: possible role of mesothelial cell on the development of peritoneal metastasis. J Surg Res. 2003;115:113–120. [CrossRef] [PubMed]
BelgoreF, LipGY, BlannAD. Basic fibroblast growth factor induces the secretion of vascular endothelial growth factor by human aortic smooth muscle cells but not by endothelial cells. Eur J Clin Invest. 2003;33:833–839. [CrossRef] [PubMed]
WernerS, GroseR. Regulation of wound healing by growth factors and cytokines. Physiol Rev. 2003;83:835–870. [PubMed]
WadaM, OgataN, OtsujiT, UyamaM. Expression of vascular endothelial growth factor and its receptor (KDR/flk-1) mRNA in experimental choroidal neovascularization. Curr Eye Res. 1999;18:203–213. [CrossRef] [PubMed]
YamamotoC, OgataN, YiX, et al. Immunolocalization of basic fibroblast growth factor during wound repair in rat retina after laser photocoagulation. Graefes Arch Clin Exp Ophthalmol. 1996;234:695–702. [CrossRef] [PubMed]
SchlingemannRO. Role of growth factors and the wound healing response in age-related macular degeneration. Graefes Arch Clin Exp Ophthalmol. 2004;242:91–101. [CrossRef] [PubMed]
Del PrioreLV, KuoYH, TezelTH. Age-related changes in human RPE cell density and apoptosis proportion in situ. Invest Ophthalmol Vis Sci. 2002;43:3312–3318. [PubMed]
McLeodDS, TaomotoM, OtsujiT, GreenWR, SunnessJS, LuttyGA. Quantifying changes in RPE and choroidal vasculature in eyes with age- related macular degeneration. Invest Ophthalmol Vis Sci. 2002;43:1986–1993. [PubMed]
Figure 1.
 
Primer design for the quantitative assay of VEGF isoforms by real-time PCR. There are five splice variants of VEGF reported thus far. Exons 1 to 5 and exon 8 (shaded areas) are the common fragments among all of them. Arrowheads: primers for amplifying all splice variants; arrows: primers for measuring each isoform. The reverse primers overlapping two exons determine their amplified specificity. The sequences of V121, V145, V165, and V189 are obtained from Keck et al., 5 and that of V206 from Houck et al. 47
Figure 1.
 
Primer design for the quantitative assay of VEGF isoforms by real-time PCR. There are five splice variants of VEGF reported thus far. Exons 1 to 5 and exon 8 (shaded areas) are the common fragments among all of them. Arrowheads: primers for amplifying all splice variants; arrows: primers for measuring each isoform. The reverse primers overlapping two exons determine their amplified specificity. The sequences of V121, V145, V165, and V189 are obtained from Keck et al., 5 and that of V206 from Houck et al. 47
Figure 2.
 
Photomicrographs showing the effects of calcium chelation, low-calcium medium, and anti-cadherin antibodies on intercellular adhesions of RPE cells. The cells were visualized by phase-contrast microscope (A, C, E, G, I) and fluorescence-stained actin (B, D, F, H, J). The postconfluent cultures prepared from human donor eyes showed cell–cell contacts and circumferential actin (A, B). The cultures were treated with EGTA (4 mM) for 60 minutes (C, D), low-calcium medium for 60 minutes (E, F), or anti-E-cadherin (G, H; 3 μg/mL) or anti-N-cadherin (I, J; 1:30) antibodies in calcium-switch experiments for 60 minutes after calcium reloading. Scale bar: (A, C, E, G, I) 20 μm; (B, D, F, H, J) 10 μm.
Figure 2.
 
Photomicrographs showing the effects of calcium chelation, low-calcium medium, and anti-cadherin antibodies on intercellular adhesions of RPE cells. The cells were visualized by phase-contrast microscope (A, C, E, G, I) and fluorescence-stained actin (B, D, F, H, J). The postconfluent cultures prepared from human donor eyes showed cell–cell contacts and circumferential actin (A, B). The cultures were treated with EGTA (4 mM) for 60 minutes (C, D), low-calcium medium for 60 minutes (E, F), or anti-E-cadherin (G, H; 3 μg/mL) or anti-N-cadherin (I, J; 1:30) antibodies in calcium-switch experiments for 60 minutes after calcium reloading. Scale bar: (A, C, E, G, I) 20 μm; (B, D, F, H, J) 10 μm.
Figure 3.
 
Changes of VEGF expression induced by calcium chelation, low calcium and anti-cadherin antibodies. Postconfluent RPE cells were treated for 6 hours under the following conditions: EGTA (4 mM), low-calcium medium, anti-E-cadherin (3 μg/mL), and anti-N-cadherin (1:30) antibodies in calcium-switch experiments. The cDNA was synthesized by reverse transcription. The expression levels of total VEGF (including all splice variants) were quantified by real-time PCR with the primers on exon 3 as shown in Figure 1 . Values are expressed as x-fold changes compared with the control. Data represent the mean ± SEM of duplicate samples in four independent experiments. *Significantly different from the control (P < 0.01).
Figure 3.
 
Changes of VEGF expression induced by calcium chelation, low calcium and anti-cadherin antibodies. Postconfluent RPE cells were treated for 6 hours under the following conditions: EGTA (4 mM), low-calcium medium, anti-E-cadherin (3 μg/mL), and anti-N-cadherin (1:30) antibodies in calcium-switch experiments. The cDNA was synthesized by reverse transcription. The expression levels of total VEGF (including all splice variants) were quantified by real-time PCR with the primers on exon 3 as shown in Figure 1 . Values are expressed as x-fold changes compared with the control. Data represent the mean ± SEM of duplicate samples in four independent experiments. *Significantly different from the control (P < 0.01).
Figure 4.
 
Time course of VEGF expression on calcium-dependent cell dissociation. The postconfluent cultures were treated with EGTA and low-calcium medium. The samples were collected at different time intervals. Total VEGF levels were measured by real-time PCR with the primers on exon 3. Data are expressed as changes (x-fold) with respect to the control. Data represent the mean ± SEM of duplicates in four independent experiments. *Significantly different from the control (P < 0.01).
Figure 4.
 
Time course of VEGF expression on calcium-dependent cell dissociation. The postconfluent cultures were treated with EGTA and low-calcium medium. The samples were collected at different time intervals. Total VEGF levels were measured by real-time PCR with the primers on exon 3. Data are expressed as changes (x-fold) with respect to the control. Data represent the mean ± SEM of duplicates in four independent experiments. *Significantly different from the control (P < 0.01).
Figure 5.
 
Identification of amplified products of VEGF isoforms. The cDNA sample of confluent RPE cells was amplified by PCR and real-time PCR. (A) PCR products amplified with primers on exons 1 and 8. The expected lengths (base pairs) of the VEGF isoforms are 485 (V121), 557 (V145), 617 (V165), 689 (V189), and 740 (V206). (B) Real-time PCR products amplified with each pair of primers shown in Table 1 . V206 products were not detected in both cases. Similar results were also observed from RPE cells treated with EGTA and low-calcium medium (not shown).
Figure 5.
 
Identification of amplified products of VEGF isoforms. The cDNA sample of confluent RPE cells was amplified by PCR and real-time PCR. (A) PCR products amplified with primers on exons 1 and 8. The expected lengths (base pairs) of the VEGF isoforms are 485 (V121), 557 (V145), 617 (V165), 689 (V189), and 740 (V206). (B) Real-time PCR products amplified with each pair of primers shown in Table 1 . V206 products were not detected in both cases. Similar results were also observed from RPE cells treated with EGTA and low-calcium medium (not shown).
Figure 6.
 
Expression of individual splice variants of VEGF on calcium-dependent cell dissociation. Postconfluent RPE cells were treated with EGTA and low-calcium medium for 6 hours. The cDNA was synthesized by reverse transcription. Total VEGF and each splice variant were quantified by real-time PCR with the specific primers shown in Table 1 . V206 was not amplified in all the samples. Data are expressed as relative changes (x-fold) in comparison with the corresponding control cultures. Data represent the mean ± SEM of duplicates in four independent experiments. *Significantly different from the control (P < 0.01).
Figure 6.
 
Expression of individual splice variants of VEGF on calcium-dependent cell dissociation. Postconfluent RPE cells were treated with EGTA and low-calcium medium for 6 hours. The cDNA was synthesized by reverse transcription. Total VEGF and each splice variant were quantified by real-time PCR with the specific primers shown in Table 1 . V206 was not amplified in all the samples. Data are expressed as relative changes (x-fold) in comparison with the corresponding control cultures. Data represent the mean ± SEM of duplicates in four independent experiments. *Significantly different from the control (P < 0.01).
Table 1.
 
Primers for Quantitation of VEGF and Its Splice Variants
Table 1.
 
Primers for Quantitation of VEGF and Its Splice Variants
Amplified VEGF Splice Variants Primer’s Sequence (5′–3′) (Forward and Reverse) and Length (bp) Primer Position on VEGF Exons Amplicon Size (bp)
All VEGF Variants (F) AGATCGAGTACATCTTCAAGCCATC (25) Exon 3 66
(R) CGTCATTGCAGCAGCCC (17) Exon 3
VEGF121 (F) GATCAAACCTCACCAAGGCCA (21) Exon 4 116
(R) GCCTCGGCTTGTCACATTTTTC (22) Exon 8 (1–17) + Exon 5 (18–22)
VEGF145 (F) ATCAGTTCGAGGAAAGGGAAAGG (23) Exon 6a 85
(R) CCTCGGCTTGTCACATACGCT (21) Exon 8 (1–16) + Exon 6a (17–21)
VEGF165 (F) CAGATTATGCGGATCAAACCTCA (23) Exon 3 (1–3) + Exon 4 (4–23) 125
(R) CAAGGCCCACAGGGATTTTC (20) Exon 7 (1–15) + Exon 5 (16–20)
VEGF189 (F) CAGCACAACAAATGTGAATGCAG (23) Exon 4 137
(R) GGCCCACAGGGAACGCT (17) Exon 7 (1–12) + Exon 6a (13–17)
VEGF206 (F) GGTATAAGTCCTGGAGCGTGTACG (24) Exon 6b 85
(R) CAAGGCCCACAGGGATGG (18) Exon 7 (1–15) + Exon 6b (16–18)
Table 2.
 
Primer List Used for Real-Time PCR
Table 2.
 
Primer List Used for Real-Time PCR
Gene GenBank Accession No. Forward Primer (5′–3′) Reverse Primer (5′–3′) Amplicon Length (bp)
aFGF X65779 CCTTCCGGATGGCACAGT ACATTCCTCATTTGGTGTCTGTGT 71
Angiogenin M11567 TTCCTGACCCAGCACTATGATG CGTCTCCTCATGATGCTTTCAC 74
Angiopoietin U83508 GGAACATGTGATGGAAAATTATACTCA GGGCCATCTCCGACTTCAT 83
bFGF J04513 CCGACGGCCGAGTTGAC TAACGGTTAGCACACACTCCTTTG 112
GAPDH X01677 CATCCATGACAACTTTGGTATCGT CAGTCTTCTGGGTGGCAGTGA 74
IL-6 X04602 GGTACATCCTCGACGGCATCT GTGCCTCTTTGCTGCTTTCAC 81
Leptin U18915 TCACCAGGATCAATGACATTTCAC CCCAGGAATGAAGTCCAAACC 80
MMP-1 X54925 TTGAAGCTGCTTACGAATTTGC GTCCCTGAACAGCCCAGTACTT 78
MMP-2 J03210 TCTTCCCCTTCACTTTCCTGG CACTTGCGGTCGTCATCGTA 112
PEDF M76979 CGACCAACGTGCTCCTGTCT GATGTCTGGGCTGCTGATCA 131
PIGF X54936 TGGAGACGGCCAATGTCA GAACGTCAGCTCCACGTAGGA 77
PDGF X02811 CGATCCGCTCCTTTGATGAT TCCAACTCGGCCCCATCT 73
TIMP-1 X03124 CGCTGACATCCGGTTCGT GTTGTGGGACCTGTGGAAGTATC 70
Table 3.
 
Relative Gene Expression of Angiogenesis-Related Factors in Calcium-Mediated RPE Cell Dissociation
Table 3.
 
Relative Gene Expression of Angiogenesis-Related Factors in Calcium-Mediated RPE Cell Dissociation
Gene EGTA/ Control Change Low Ca/Control Change
aFGF 0.24 ± 0.02 0.54 ± 0.09
Angiogenin 1.52 ± 0.23 1.17 ± 0.14
Angiopoietin 0.78 ± 0.24 1.04 ± 0.11
bFGF 1.60 ± 0.07 1.63 ± 0.14
IL-6 2.86 ± 0.19 0.88 ± 0.34
MMP-1 2.16 ± 0.28 1.56 ± 0.24
MMP-2 0.83 ± 0.08 1.08 ± 0.11
PEDF 0.69 ± 0.04 1.21 ± 0.05
PIGF 2.32 ± 0.12 1.12 ± 0.16
PDGF 1.18 ± 0.05 1.67 ± 0.19
TIMP-1 1.06 ± 0.07 1.11 ± 0.05
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×