October 2006
Volume 47, Issue 10
Free
Biochemistry and Molecular Biology  |   October 2006
Expression and Polarized Localization of the Hemochromatosis Gene Product HFE in Retinal Pigment Epithelium
Author Affiliations
  • Pamela M. Martin
    From the Departments of Biochemistry and Molecular Biology and
  • Jaya P. Gnana-Prakasam
    From the Departments of Biochemistry and Molecular Biology and
  • Penny Roon
    Cellular Biology and Anatomy, and the
  • Robert G. Smith
    Synapses and Cognitive Neuroscience Center, Medical College of Georgia, Augusta, Georgia.
  • Sylvia B. Smith
    Cellular Biology and Anatomy, and the
  • Vadivel Ganapathy
    From the Departments of Biochemistry and Molecular Biology and
Investigative Ophthalmology & Visual Science October 2006, Vol.47, 4238-4244. doi:10.1167/iovs.06-0026
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Pamela M. Martin, Jaya P. Gnana-Prakasam, Penny Roon, Robert G. Smith, Sylvia B. Smith, Vadivel Ganapathy; Expression and Polarized Localization of the Hemochromatosis Gene Product HFE in Retinal Pigment Epithelium. Invest. Ophthalmol. Vis. Sci. 2006;47(10):4238-4244. doi: 10.1167/iovs.06-0026.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

purpose. Hereditary hemochromatosis is an autosomal recessive disorder of iron overload leading to oxidative stress. Mutations in HFE are responsible for ∼90% of cases of this disease. HFE is the principal regulator of iron homeostasis, and the process involves interaction with transferrin receptor (TfR)-1, transferrin receptor (TfR)-2, and β2-microglobulin (β2M). Expression of HFE has not been investigated in the retina. In the present study, the expression of HFE and the HFE-interacting proteins TfR1, TfR2, and β2M were analyzed in mouse retina.

methods. RT-PCR was used to detect the expression of HFE mRNA in neural retina and the RPE-eyecup. Expression of HFE in intact retina was investigated by in situ hybridization, immunofluorescence, and immunogold electron microscopy. Expression of HFE-interacting proteins was also analyzed using similar techniques.

results. RT-PCR showed predominant expression of HFE mRNA in the RPE-eyecup. In situ hybridization in intact retina revealed that HFE mRNA is expressed almost exclusively in RPE Immunofluorescence and immunogold electron microscopy showed that HFE protein was specifically associated with the basolateral membrane of RPE. Expression of the HFE-interacting proteins TfR1, TfR2, and β2M was also evident in the retina.

conclusions. This is the first report on the expression of HFE in the retina. The specific localization of HFE and its interacting proteins, TfR1 and TfR2, at the basolateral membrane of RPE is relevant to the regulation of iron homeostasis in this cell. Patients with hemochromatosis may have impairment of iron homeostasis in RPE, potentially contributing to age-related RPE dysfunction and retinal degeneration.

Hemochromatosis is a genetic disease associated with iron overload. 1 2 3 4 5 Intestinal absorption of dietary iron is the primary site of regulation of the body’s iron status, and the absorption of iron is increased in hemochromatosis. 1 2 3 4 5 Iron is a pro-oxidant and excessive accumulation of iron in tissues leads to oxidative damage. Iron overload is an age-dependent process, and therefore hemochromatosis as a disease manifests only at >50 years of age. The tissues commonly affected in this disease are the liver, pancreas, kidney, pituitary, and heart. 1 2 3 4 5 The symptoms associated with the disease include liver cirrhosis, hepatocarcinoma, diabetes, cardiomyopathy, nephropathy, and endocrine dysfunction. 
Hemochromatosis is an autosomal recessive disorder, and most individuals with the disease have mutations in the HFE gene, coding for a protein that was originally identified as a human leukocyte antigen (HLA) class I–like protein and subsequently was found to function as a regulator of iron homeostasis (HFE, an HLA-like protein involved in iron [FE] homeostasis). This protein is involved in the sensing of the body’s iron status (in the form of transferrin saturation with iron) by the crypt cells of the duodenum, the part of the small intestine where the absorption of dietary iron occurs. The mechanisms involved in the regulation of iron homeostasis by HFE have become increasingly clear in recent years. 1 2 3 4 5 HFE interacts with transferrin receptor (TfR)-1 and -2, thus sensing the saturation of transferrin with iron in blood. In addition, HFE regulates the expression of hepcidin, a hormone secreted by the liver, which functions as an important regulator of iron absorption in the intestine and iron handling in macrophages. Iron export from the intestinal cells and macrophages is mediated by ferroportin, and hepcidin is a negative regulator of this export process. The disease caused by HFE mutations is known as HFE hemochromatosis and is associated with decreased expression of hepcidin in the liver, which leads to increased absorption of iron in the intestine, resulting in iron overload. There are additional genes that are involved in iron homeostasis, and mutations in many of these genes also cause hemochromatosis. These non-HFE genes associated with hemochromatosis code for hemojuvelin, hepcidin, TfR2, and ferroportin. The disease caused by mutations in these genes is known as non-HFE hemochromatosis. 6  
HFE complexes with β2-microglobulin (β2M) and the complex formation is obligatory for the presentation of HFE to the cell surface. Mutations in HFE are responsible for ∼90% of cases of hemochromatosis. Among the known disease-causing HFE mutations, C282Y is the most prevalent, representing >85% of cases. 7 The C282Y mutation disrupts the complex formation and thus interferes with the trafficking of HFE to the cell surface. The plasma membrane location of HFE is appropriate for its role in mediating the sensing of the body’s iron status by HFE-expressing cells in the form of transferrin saturation with iron. 
Recently, Hahn et al. 8 have shown that iron overload in the retinal pigment epithelium (RPE) of a knockout mouse model involving combined disruption of two iron regulatory proteins—namely, ceruloplasmin and hephaestin—is associated with an age-related macular degeneration (AMD)-like retinal phenotype. 8 However, there is little or no information available on retinal function in hemochromatosis. The hemochromatosis gene HFE is primarily expressed in the intestine and liver, the two major tissues involved in the maintenance of the body’s iron homeostasis. RPE, which constitutes the outer blood–retinal barrier, is likely to play a critical role in the regulation of iron status within the retina; yet, there have been no studies reported in the literature on the expression of HFE in the retina. Since the studies by Hahn et al. 8 have shown that iron overload in RPE has serious consequences for retinal function, we investigated the expression of HFE and the HFE-interacting proteins TfR1, TfR2, and β2M in the mouse retina. These studies demonstrate for the first time that HFE is expressed in the retina and that the expression may be restricted exclusively to the basolateral membrane of the RPE cell layer. TfR1, TfR2, and β2M are expressed widely in various cell types within the retina; but in RPE, these proteins colocalize with HFE, suggesting a role for these proteins in the regulation of iron homeostasis in this cell layer. 
Materials and Methods
Materials
Reagents were obtained from the following sources: RNA extraction reagent (TRIzol; Invitrogen-Gibco Corp., Grand Island, NY); RT-PCR kit (GeneAmp; Applied Biosystems, Inc., Foster City, CA); Taq polymerase kit (TaKaRa, Tokyo, Japan); reaction-blocking agent (PowerBlock; Biogenex, San Ramon, CA); and a resin-based embedding medium (LR White; Structure Probe, Inc./SPI Supplies, West Chester, PA). Antibodies used were obtained from the following sources: polyclonal anti-HFE, monoclonal anti-TfR1, polyclonal anti-TfR2, and polyclonal anti-β2M (Alpha Diagnostic International, San Antonio, TX); monoclonal anti-CRALBP (cellular retinaldehyde-binding protein; AbCam Inc., Cambridge, MA); chicken polyclonal anti-MCT1 (Chemicon, Temecula, CA); goat anti-rabbit IgG coupled to Alexa Fluor 568 and goat anti-mouse IgG coupled to Alexa Fluor 488 (Invitrogen-Molecular Probes, Carlsbad, CA); mounting medium with 4′,6′-diamino-2-phenylindole (DAPI; Vectashield Hardset; Vector Laboratories, Burlingame, CA). 
Animals
C57BL/6 mice (6 weeks old) were used for the preparation of total RNA from neural retina and RPE-eyecup Whole eyes, obtained from albino (BALB/c) mice (3 weeks old), were used for immunofluorescence and in situ hybridization analyses. Mice were purchased from Harlan-Sprague-Dawley and maintained in our facility. Care and use of the mice adhered to the principles set forth in the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. 
Reverse Transcription–Polymerase Chain Reaction
Neural retina and RPE-eyecup were prepared according to our previously published method 9 and used for preparation of total RNA. RT-PCR was performed under optimal conditions depending on the nature of the specific PCR primer pairs (Table 1) . 18S rRNA or HPRT1 (hypoxanthine phosphoribosyl transferase-1) was used as an internal control for the PCR reactions. The products were subcloned into the pGEM-T vector and sequenced to confirm their molecular identity. The subcloned plasmids were also used for generation of sense and antisense riboprobes for in situ hybridization. 
In Situ Hybridization
Mouse eyes were frozen in embedding compound (OCT; Tissue-Tek; Sakura Finetek, Torrance, CA), and sections were made at 10-μm thickness and fixed in 4% paraformaldehyde. Treatment of tissue sections and hybridization with digoxigenin-labeled sense and antisense riboprobes were performed as described previously. 10 11 12 The hybridization signals were detected with anti-digoxigenin antibody, conjugated to alkaline phosphatase. The color reaction was developed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate. In all cases, some cryosections were hybridized with the sense (negative control) riboprobe, to determine nonspecific binding. 
For the preparation of antisense and sense riboprobes, a ∼540-bp fragment of mouse HFE was amplified by RT-PCR and subcloned into the pGEM-T vector, and the orientation of the insert was identified by sequencing. We confirmed the specificity of the probe for HFE by searching the GenBank database (http://www.ncbi.nlm.nih.gov/Genbank; provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD) with the nucleotide sequence of the segment encompassed by the primers as the query. The probes were prepared by in vitro transcription with appropriate RNA polymerases after linearizing the plasmid with suitable restriction enzymes. 
Immunofluorescence Analysis
Cryosections of mouse eyes were fixed in 4% paraformaldehyde for 10 minutes, washed with 0.01 M PBS (pH 7.4), and blocked with 1× blocking agent (PowerBlock; Biogenex) for 10 minutes. Sections were then incubated overnight at 4°C with one or more of the following primary antibodies: polyclonal anti-HFE (1:1000), monoclonal anti-TfR1 (1:100), polyclonal anti-TfR2 (1:500), and polyclonal anti-β2M (1:250). Monoclonal anti-CRALBP, a known cytosolic protein in RPE and Müller cells, was used to assess polarization of HFE, TfR1, and TfR2 in the RPE cell layer. Polarization of HFE was assessed also by double-labeling with MCT1 (monocarboxylate transporter 1), a marker for the apical membrane of RPE. 13 14 Negative control sections were treated identically but in the absence of the primary antibodies. Sections were rinsed and incubated for 1 hour with goat anti-rabbit IgG coupled to Alexa Fluor 568 and/or goat anti-mouse IgG coupled to Alexa Fluor 488, both at a dilution of 1:1000. Coverslips were mounted in medium with DAPI (a nuclear stain; Vectashield Hardset; Vector Laboratories), and sections were examined with a wide-field epifluorescence microscope (Carl Zeiss Meditec, Oberkochen, Germany). In experiments involving the double-labeling of HFE and MCT1, sections were examined with an epifluorescence microscope as well as with a laser-scanning confocal imaging system (model MRC-600; Bio-Rad, Hercules, CA). 
Immunogold Electron Microscopy
Eyes were enucleated and fixed for 1 hour at room temperature in 2% paraformaldehyde/0.2% glutaraldehyde in 0.1 M cacodylate buffer in sucrose and postfixed for 1 hour with 1% tannic acid in 0.1 M sodium cacodylate buffer. Tissues were then washed in deionized water, dehydrated using a graded series of ethanol, and infiltrated with resin (LR White; Structure Probe, Inc.). Thin sections (60 nm) of intact retinal tissue were collected on nickel grids and processed for immunolabeling immediately after sectioning. The grids were blocked for 3 hours at room temperature in 1% normal goat serum and 0.1% bovine serum albumin in 50 mM Tris-buffered saline (pH 7.4) followed by overnight incubation with primary anti-HFE antibody (1:100) at 4°C. Au15-goat anti-rabbit IgG colloidal gold was prepared according to the method of Horisberger and Rosset. 15 Grids were washed in blocking buffer and incubated in Au15-goat anti-rabbit IgG (1:2 in blocking buffer) for 2 hours at room temperature. The grids were washed and stained with 1% uranyl acetate and viewed with a transmission electron microscope (JEM-1010; JEOL, Tokyo, Japan). 
Results
Expression of HFE in RPE
RT-PCR was performed with RNA isolated from neural retina (mostly devoid of RPE) and the RPE-eyecup of normal mice We found evidence of the expression of HFE mRNA primarily in the RPE-eyecup, with considerably lower expression in the neural retina (Fig. 1A) ; 18S rRNA was used as an internal control for the RT-PCR reaction. In situ hybridization for the analysis of HFE mRNA and immunofluorescence for the analysis of HFE protein revealed that the expression was restricted exclusively to the RPE cell layer of the retina (Figs 1B 1C) . The signals observed in these experiments were specific, because no positive signals were detected in in situ hybridization when a sense riboprobe was used in place of the antisense riboprobe or in immunofluorescence when the primary antibody was omitted. Based on the data from the in situ hybridization and immunofluorescence studies, it seems likely that the weak expression of HFE mRNA in the neural retina detected by RT-PCR (Fig. 1A)was due to RPE contamination. 
Polarized Expression of HFE in RPE
To determine the polarity in the expression of HFE, we performed double-labeling studies in normal mouse retinal sections with polyclonal anti-HFE (red), an integral membrane protein, and monoclonal anti-CRALBP (green), a cytosolic protein marker for RPE and Müller cells (Fig. 2A) . In the RPE cell layer, when the two fluorescent signals were merged, the HFE-specific fluorescence signal appeared below the green signal, which indicates that HFE protein is associated specifically with the basolateral membrane. The presence of HFE at the basolateral membrane in RPE was further confirmed by double-labeling with MCT1, a transporter expressed exclusively in the RPE apical membrane. Analysis of the retinal sections with a fluorescent microscope or with a laser-scanning confocal microscope showed clearly that HFE (green) was associated with the basolateral membrane and MCT1 (red) was associated with the apical membrane (Fig. 2B) . Immunogold electron microscopy provided further support for the exclusive association of HFE with the RPE basolateral membrane (Fig. 2C ; arrows, HFE-specific immunogold signals). 
Expression of HFE-Interacting Proteins in the RPE
RT-PCR was performed to detect the expression of mRNA transcripts for the HFE-interacting proteins TfR1, TfR2, and β2M in the neural retina and RPE-eyecup (Fig. 3) . TfR1 has been shown to be expressed widely within the retina. 16 17 18 This expression is expected, because all cells have a requirement for iron for their function and most likely use TfR1 to take up iron in the form of transferrin-Fe3+ TfR2 also mediates the entry of transferrin-Fe3+, but with relatively low affinity, and hence is believed to be less essential in the cellular uptake of iron. It does, however, interact with HFE and plays a role in the maintenance of iron homeostasis. 19 The expression of TfR2 in the retina has not been investigated previously. RT-PCR analysis demonstrated expression of TfR1 and TfR2 in both the neural retina and RPE-eyecup HFE translocation to the cell membrane was mediated by formation of a complex with β2M. Because HFE is expressed in the RPE, we confirmed β2M expression there also. Though all three genes (TfR1, TfR2, and β2M) were expressed in both the neural retina and RPE-eyecup, the expression of TfR1 and TfR2 was predominant in the neural retina, whereas the expression of β2M was predominant in the RPE-eyecup. 
Immunolocalization of TfR1, TfR2, and β2M in Normal Mouse Retina
Immunolocalization studies were conducted to determine the expression pattern of TfR1, TfR2, and β2M. All three HFE-interacting proteins were expressed extensively in the retina (Fig. 4A) . To determine whether TfR1 had a polarized distribution in RPE (i.e., apical or basolateral location), double-labeling studies were performed with antibodies specific to this protein as well as HFE and CRALBP. These studies demonstrated the polarized expression of TfR1 (Figs. 4B 4C)in association with the basolateral membrane in RPE. The merged image (yellow-orange) established the colocalization of HFE and TfR1 at the basolateral membrane of RPE (Fig. 4B) . These results were confirmed further in double-labeling studies for TfR1 and CRALBP (Fig. 4C) . Polyclonal anti-TfR2 primary antibody was used in colocalization studies with CRALBP (Fig. 4D) . Similar to HFE, TfR2 was also found to be localized near the basolateral membrane of RPE. Double-labeling for TfR2 and HFE could not be performed, as primary antibodies to TfR2 and HFE were both polyclonal. Evidence already exists for the expression of other proteins involved in iron metabolism in RPE, and these include transferrin, ferritin, TfR1, hephaestin, ceruloplasmin, and ferroportin. 8 16 17 18 20  
Discussion
Hemochromatosis, the most prevalent disease associated with iron overload in humans, is caused by disruption of HFE function. There are very few reports in the literature on the effects of hemochromatosis on iron status in the retina. It was also not known whether the hemochromatosis gene HFE was expressed in this tissue. We hypothesized that hemochromatosis may be associated with dysregulation of retinal iron homeostasis and therefore analyzed the expression of HFE and HFE-interacting proteins in the retina. Our studies show for the first time that HFE is expressed in the retina and that the expression is restricted exclusively to RPE, as was evident from the detection of mRNA and protein solely in this single retinal cell layer. Equally important and interesting was the polarized expression of HFE protein at the basolateral membrane of RPE. RPE is a component of the outer blood–retinal barrier and is responsible for the transcellular transport of various ions and nutrients from the choroidal blood to the neural retina. 21 Therefore, RPE must be involved in the transcellular transfer of iron, and HFE is very likely to play an essential role in the regulation of this process. The basal membrane of RPE, which is in contact with choroidal blood, is the site of the first step in the cellular uptake of iron from blood. Therefore, the specific location of HFE at this membrane strongly supports our hypothesis. 
All cells require iron as an essential nutrient and yet not every cell expresses HFE. Therefore, our findings on the expression of HFE in RPE raise the question: What is the need for the RPE cell to express this regulatory protein? The RPE must have mechanisms to obtain iron from the blood. Iron exists predominantly in the form of the transferrin-Fe3+ complex, and all cells express the transferrin receptor (TfR1), which facilitates the cellular entry of iron from this complex via receptor-mediated endocytosis. There is evidence in the literature for the expression of TfR1 in RPE. 16 17 18 What makes RPE unique is that this cell layer is also involved in the handling of iron arising from the continuous phagocytosis of outer rod segments. Thus, RPE must also have mechanisms to export iron to protect against the risk of excessive iron accumulation. To date, only one protein has been shown to participate in the export of iron from the cells into the blood This protein is an iron transporter, known as ferroportin. 22 Divalent iron (Fe2+) is the preferred substrate for ferroportin. Because apotransferrin in the blood binds Fe3+ and not Fe2+, there is a need for the oxidation of Fe2+ while it is transported out of the cells via ferroportin. This is accomplished by ceruloplasmin and hephaestin, both of which function as ferroxidases. 23 24 Thus, there is a functional connection between ferroportin and the two ferroxidases. Because Hahn et al. 8 observed the expression of ceruloplasmin and hephaestin in RPE, they subsequently investigated the expression of ferroportin in the retina. 20 Ferroportin was found to be expressed in RPE as well as in Müller cells. The expression pattern of ferroportin in RPE suggests that the transporter may function in the export of iron across the basolateral membrane. Thus, RPE possesses not only a mechanism for the uptake of iron via TfR1 and TfR2 but also a mechanism for the export of iron via ferroportin. Because this cell has to handle iron arising from ingested outer rod segments, it may need an exquisite mechanism for the regulation of iron homeostasis, to prevent excessive iron accumulation. This is most likely the reason for the expression of HFE in RPE. This reasoning is based on the finding that HFE is not necessary for the cellular uptake of iron but is needed only for the regulation of cellular iron homeostasis. Therefore, TfR1 and TfR2, which are involved in the cellular uptake of iron, are expressed widely within the retina, including the RPE, whereas HFE, which is a controller of iron homeostasis, is expressed exclusively in the RPE, suggesting that this cell layer plays an important role in the maintenance of iron homeostasis in the retina. 
The report by Hahn et al. 8 showed that a combined disruption of the function of both ceruloplasmin and hephaestin in mice leads to iron overload in the retina, especially in the RPE, and that the retinal accumulation of iron causes an AMD-like retinal phenotype. Because iron is a well known pro-oxidant, the findings by Hahn et al. in the mouse model of disruption of ceruloplasmin and hephaestin can be taken as supporting evidence for a role of iron-induced oxidative stress as an etiological factor in AMD. 
HFE is likely to play an important role in iron homeostasis, maintaining the intracellular levels of free iron within normal, nontoxic levels in the retina. Excess iron is toxic, especially to the photoreceptor cells. 18 25 There is also strong evidence for excessive accumulation of iron in the RPE and photoreceptor cells in patients with AMD. 26 27 Mutations in HFE protein leading to loss of its function, as occurs in hemochromatosis, may disrupt iron homeostasis in the RPE and cause iron overload. It could be argued that the blood–retinal barrier may dissociate the iron status in the retina from that in the systemic circulation, but this may not be true. There is evidence of excessive iron accumulation and of changes in pigmentation in the RPE in hemochromatosis. 28 29 Furthermore, several reports have described neuropathological changes in the presence of hemochromatosis. 30 31 32 The retina is a part of the central nervous system and, similar to the retina, the latter is also surrounded by the blood–brain barrier. Despite this barrier, iron accumulation in certain areas of the brain such as the basal ganglia has been demonstrated in patients with hemochromatosis. 33 34 35 In fact, mutations in HFE have been suggested to play a role in the etiology of central nervous system disorders such as Parkinson’s disease, 36 Alzheimer’s disease, 37 38 and amyotrophic lateral sclerosis. 39 Therefore, the iron status in the retina may not be dissociated from the systemic iron status, as is generally believed. In addition, the lack of widespread reports on the retinal effects in patients with hemochromatosis does not imply that such changes do not exist. Our findings that the hemochromatosis gene product HFE is expressed in RPE and that the protein is specifically associated with the basolateral membrane of this cell suggest a potential role for this protein in the maintenance of iron status in the RPE-retina. Therefore, the possibility that hemochromatosis may lead to iron overload in the retina, with consequent retinal degeneration, merits investigation. 
Table 1.
 
Sequences of RT-PCR Primers
Table 1.
 
Sequences of RT-PCR Primers
Gene Name NCBI Accession No. Primers Sequence Expected Size (bp)
Mouse HFE NM_010424 Forward: GGCTTCTGGAGATATGGTTAT 540
Reverse: GACTCCACTGATGATTCCGATA
Mouse TfR1 BC054522 Forward: GCCCAAGTATTCTCAGATATGAT 595
Reverse: TAGAAGTAGCACGGAAGTAGTCTC
Mouse TfR2 NM_015799 Forward: GAGGATCCGGAAGTCTACTGTC 575
Reverse: TCGATGCACGCAAAGATGTTACTG
Mouse β2M NM_009735 Forward: CCGAACATACTGAACTGCTAC 204
Reverse: CATACTGGCATGCTTAACTCT
Figure 1.
 
Expression of HFE in RPE. (A) RT-PCR analysis of mRNA transcripts specific for HFE in the neural retina and RPE-eyecup of a normal mouse. 18S rRNA was the internal control; the size of its specific RT-PCR product is 315 bp. The predicted size of the product for HFE is 540 bp. The DNA size ladder is in the first lane of the composite. (B) In situ hybridization analysis of HFE expression in mouse retina. Left: a representative section of mouse retina labeled with antisense probe for HFE. The antisense riboprobe detected strong expression of HFE mRNA in the RPE but nowhere else in the retina. Right: no positive signals were observed with the sense riboprobe (negative control). (C) Immunofluorescence detection of HFE protein in the retina. Left: HFE was expressed exclusively in the RPE cell layer. Omission of the primary antibody gave no positive signals (right). GCL, ganglion cell layer; INL, inner nuclear layer; ONL, outer nuclear layer; RPE, retinal pigment epithelium.
Figure 1.
 
Expression of HFE in RPE. (A) RT-PCR analysis of mRNA transcripts specific for HFE in the neural retina and RPE-eyecup of a normal mouse. 18S rRNA was the internal control; the size of its specific RT-PCR product is 315 bp. The predicted size of the product for HFE is 540 bp. The DNA size ladder is in the first lane of the composite. (B) In situ hybridization analysis of HFE expression in mouse retina. Left: a representative section of mouse retina labeled with antisense probe for HFE. The antisense riboprobe detected strong expression of HFE mRNA in the RPE but nowhere else in the retina. Right: no positive signals were observed with the sense riboprobe (negative control). (C) Immunofluorescence detection of HFE protein in the retina. Left: HFE was expressed exclusively in the RPE cell layer. Omission of the primary antibody gave no positive signals (right). GCL, ganglion cell layer; INL, inner nuclear layer; ONL, outer nuclear layer; RPE, retinal pigment epithelium.
Figure 2.
 
Association of HFE with the basolateral membrane in the RPE. The polarized expression of HFE was investigated by comparing its expression pattern with that of CRALBP (a cytosolic protein marker for RPE and Müller cells), and MCT1 (an apical membrane transporter in RPE). (A) HFE was detected with a secondary antibody conjugated to Alexa Fluor 568 (red) and CRALBP was detected with a secondary antibody conjugated to Alexa Fluor 488 (green). DAPI was used as a nuclear stain. Merging of the fluorescent signals in the RPE cell layer indicates that the expression of HFE is specifically associated with the basolateral membrane. Inset: a higher magnification of the RPE cell layer; a, apical membrane; b, basal membrane. (B) Double-labeling of HFE (green) and MCT1 (red) in retinal sections provided clear evidence of the separation of the MCT1-specific signal from the HFE-specific signal (left, wide-field epifluorescence microscope; right, laser-scanning confocal microscope). (C) Analysis of HFE expression by immunogold electron microscopy (arrows, positive signals). Magnification: (CA) ×10,000; (CB) ×20,000; (CC) ×50,000; (CD) ×20,000. (CD) Negative control with the omission of primary antibody.
Figure 2.
 
Association of HFE with the basolateral membrane in the RPE. The polarized expression of HFE was investigated by comparing its expression pattern with that of CRALBP (a cytosolic protein marker for RPE and Müller cells), and MCT1 (an apical membrane transporter in RPE). (A) HFE was detected with a secondary antibody conjugated to Alexa Fluor 568 (red) and CRALBP was detected with a secondary antibody conjugated to Alexa Fluor 488 (green). DAPI was used as a nuclear stain. Merging of the fluorescent signals in the RPE cell layer indicates that the expression of HFE is specifically associated with the basolateral membrane. Inset: a higher magnification of the RPE cell layer; a, apical membrane; b, basal membrane. (B) Double-labeling of HFE (green) and MCT1 (red) in retinal sections provided clear evidence of the separation of the MCT1-specific signal from the HFE-specific signal (left, wide-field epifluorescence microscope; right, laser-scanning confocal microscope). (C) Analysis of HFE expression by immunogold electron microscopy (arrows, positive signals). Magnification: (CA) ×10,000; (CB) ×20,000; (CC) ×50,000; (CD) ×20,000. (CD) Negative control with the omission of primary antibody.
Figure 3.
 
RT-PCR analysis of mRNA transcripts specific for TfR1, TfR2, and β2M in the neural retina and RPE-eyecup of the normal mouse. HPRT1 was used as the internal control. All three genes were expressed in both the neural retina and the RPE-eyecup.
Figure 3.
 
RT-PCR analysis of mRNA transcripts specific for TfR1, TfR2, and β2M in the neural retina and RPE-eyecup of the normal mouse. HPRT1 was used as the internal control. All three genes were expressed in both the neural retina and the RPE-eyecup.
Figure 4.
 
Immunolocalization of TfR1, TfR2, and β2M in a normal mouse retina. (A) Localization of TfR1, TfR2, and β2M in a normal mouse retina. (B) The polarity in the expression of TfR1 (green) in RPE is demonstrated by double-labeling for HFE (red) simultaneously. Merged image (yellow-orange) clearly indicates that HFE and TfR1 colocalized at the basolateral membrane of RPE. (C) Double-labeling for TfR1 (red) and CRALBP (green). (D) Colocalization of TfR2 (red) and CRALBP (green). TfR2 is also expressed predominantly in association with the basolateral membrane of RPE. Insets: higher magnifications of the RPE cell layer. a, apical membrane; b, basal membrane.
Figure 4.
 
Immunolocalization of TfR1, TfR2, and β2M in a normal mouse retina. (A) Localization of TfR1, TfR2, and β2M in a normal mouse retina. (B) The polarity in the expression of TfR1 (green) in RPE is demonstrated by double-labeling for HFE (red) simultaneously. Merged image (yellow-orange) clearly indicates that HFE and TfR1 colocalized at the basolateral membrane of RPE. (C) Double-labeling for TfR1 (red) and CRALBP (green). (D) Colocalization of TfR2 (red) and CRALBP (green). TfR2 is also expressed predominantly in association with the basolateral membrane of RPE. Insets: higher magnifications of the RPE cell layer. a, apical membrane; b, basal membrane.
 
DonovanA, AndrewsNC. The molecular regulation of iron metabolism. Hematol J. 2004;5:373–380. [CrossRef] [PubMed]
FlemingRE, BrittonRS, WaheedA, SlyWS, BaconBR. Pathophysiology of hereditary hemochromatosis. Semin Liver Dis. 2005;25:411–419. [CrossRef] [PubMed]
BeutlerE. Hemochromatosis: genetics and pathophysiology. Annu Rev Med. 2006;57:331–347. [CrossRef] [PubMed]
GanzT, NemethE. Iron imports. IV. Hepcidin and regulation of body iron metabolism. Am J Physiol. 2006;290:G199–G203.
FlemingRE, BrittonRS. Iron imports. VI. HFE and regulation of intestinal iron absorption. Am J Physiol. 2006;290:G590–G594.
PietrangeloA. Non-HFE hemochromatosis. Semin Liver Dis. 2005;25:450–460. [CrossRef] [PubMed]
GalhenageSP, ViialaCH, OlynykJK. Screening for hemochromatosis: patients with liver disease, families, and populations. Curr Gastroenterol Rep. 2004;6:44–51. [CrossRef] [PubMed]
HahnP, QianY, DentchevT, et al. Disruption of ceruloplasmin and hephaestin in mice causes retinal iron overload and retinal degeneration with features of age-related macular degeneration. Proc Natl Acad Sci USA. 2004;101:13850–13855. [CrossRef] [PubMed]
BridgesCC, HuH, MiyauchiS, et al. Induction of cystine/glutamate transporter x c by human immunodeficiency virus type 1 transactivator protein Tat in the retinal pigment epithelium. Invest Ophthalmol Vis Sci. 2004;45:2906–2914. [CrossRef] [PubMed]
BridgesCD, KekudaR, HuangW, et al. Expression and differential polarization of the reduced-folate transporter-1 and folate receptor-α in mammalian retinal pigment epithelium. J Biol Chem. 2000;275:20676–20684. [CrossRef] [PubMed]
RajanDP, KekudaR, ChancyCD, HuangW, GanapathyV, SmithSB. Expression of the extraneuronal monoamine transporter in RPE and neural retina. Curr Eye Res. 2000;20:195–204. [CrossRef] [PubMed]
OlaSM, MooreP, MaddoxD, et al. Analysis of sigma receptor (sigmaR1) expression in the retinal ganglion cells cultured under hyperglycemic conditions and in diabetic mice. Brain Res Mol Brain Res. 2002;107:97–107. [CrossRef] [PubMed]
PhilpNJ, WangD, YoonH, HjelmelandLM. Polarized expression of monocarboxylate transporters in human retinal pigment epithelium and ARPE-19 cells. Invest Ophthalmol Vis Sci. 2003;44:1716–1721. [CrossRef] [PubMed]
DeoraAA, PhilpNJ, HuJ, BokD, Rodriguez-BoulanE. Mechanisms regulating tissue-specific polarity of monocarboxylate transporters and their chaperone CD147 in kidney and retinal epithelia. Proc Natl Acad Sci USA. 2005;102:16245–16250. [CrossRef] [PubMed]
HorisbergerM, RossetJ. Colloidal gold, a useful marker for transmission and scanning electron microscopy. J Histochem Cytochem. 1977;25:295–305. [CrossRef] [PubMed]
SugasawaK, DeguchiJ, OkamiT, et al. Immunocytochemical analyses of distributions of Na, K-ATPase and GLUT1, insulin and transferrin receptors in the developing retinal pigment epithelial cells. Cell Struct Funct. 1994;19:21–28. [CrossRef] [PubMed]
YefimovaMG, JeannyJC, GuillonneauX, et al. Iron, ferritin, transferrin, and transferrin receptor in the adult rat retina. Invest Ophthalmol Vis Sci. 2000;41:2343–2351. [PubMed]
YefimovaMG, JeannyJC, KellerN, et al. Impaired retinal iron homeostasis associated with defective phagocytosis in Royal College of Surgeons rats. Invest Ophthalmol Vis Sci. 2002;43:537–545. [PubMed]
GriffithsWJH, CoxTM. Co-localization of the mammalian hemochromatosis gene product (HFE) and a newly identified transferrin receptor (TfR2) in intestinal tissue and cells. J Histochem Cytochem. 2003;51:613–623. [CrossRef] [PubMed]
HahnP, DentchevT, QianY, RouaultT, HarrisZL, DunaiefJL. Immunolocalization and regulation of iron handling proteins ferritin and ferroportin in the retina. Mol Vis. 2004;10:598–607. [PubMed]
BokD. The retinal pigment epithelium: a versatile partner in vision. J Cell Sci. 1993;17:189–195.
McKieAT, BarlowDJ. The SLC40 basolateral iron transporter family (IREG1/ferroportin/MTP1). Pflugers Arch. 2004;447:801–806. [CrossRef] [PubMed]
NittisT, GitlinJD. The copper-iron connection: hereditary aceruloplasminemia. Semin Hematol. 2002;39:282–289. [CrossRef] [PubMed]
AndersonGJ, FrazerDM, McKieAT, VulpeCD. The ceruloplasmin homolog hephaestin and the control of intestinal iron absorption. Blood Cells Mol Dis. 2002;29:367–375. [CrossRef] [PubMed]
WangZJ, LamKW, LamTT, TsoMO. Iron-induced apoptosis in the photoreceptor cells of rats. Invest Ophthalmol Vis Sci. 1998;39:631–633. [PubMed]
HahnP, MilamAH, DunaiefJL. Maculas affected by age-related macular degeneration contain increased chelatable iron in the retinal pigment epithelium and Bruch’s membrane. Arch Ophthalmol. 2003;121:1099–1105. [CrossRef] [PubMed]
DentchevT, HahnP, DunaiefJL. Strong labeling for iron and the iron-handling proteins ferritin and ferroportin in the photoreceptor layer in age-related macular degeneration. Arch Ophthalmol. 2005;123:1745–1746. [CrossRef] [PubMed]
DaviesG, DymockI, HarryJ, WilliamsR. Deposition of melanin and iron in ocular structures in haemochromatosis. Br J Ophthalmol. 1972;56:338–342. [CrossRef] [PubMed]
RothAM, FoosRY. Ocular pathologic changes in primary hemochromatosis. Arch Ophthalmol. 1972;87:507–514. [CrossRef] [PubMed]
NeumannMA. Hemochromatosis of the central nervous system. J Neuropathol Exp Neurol. 1948;7:19–34. [PubMed]
McDougalDB, AdamsRD. The neuropathological changes in haemochromatosis. J Neuropathol Exp Neurol. 1950;9:117–118.
MiyasakiK, MuraoS, KoizumiN. Hemochromatosis associated with brain lesions: a disorder of trace-metal binding proteins and/or polymers. J Neuropathol Exp Neurol. 1977;36:964–976. [CrossRef] [PubMed]
NielsenJE, JensenLN, KrabbeK. Hereditary haemochromatosis: a case of iron accumulation in the basal ganglia associated with a parkinsonian syndrome. J Neurol Neurosurg Psychiatry. 1995;59:318–321. [CrossRef] [PubMed]
BergD, HoggenmullerU, HofmannE, et al. The basal ganglia in haemochromatosis. Neuroradiology. 2000;42:9–13. [CrossRef] [PubMed]
CostelloDJ, WalshSL, HarringtonHJ, WalshCH. Concurrent hereditary haemochromatosis and idiopathic Parkinson’s disease: a case report series. J Neurol Neurosurg Psychiatry. 2004;75:631–633. [CrossRef] [PubMed]
DekkerMC, GiesbergenPC, NjajouOT, et al. Mutations in the hemochromatosis gene (HFE), Parkinson’s disease and parkinsonism. Neurosci Lett. 2003;348:117–119. [CrossRef] [PubMed]
PulliamJF, JenningsCD, KryscioRJ, et al. Association of HFE mutations with neurodegeneration and oxidative stress in Alzheimer’s disease and correlation with APOE. Am J Med Genet. 2003;119:48–53.
ConnorJR, MilwardEA, MoalemS, et al. Is hemochromatosis a risk factor for Alzheimer’s disease?. J Alzheimers Dis. 2001;3:471–477. [PubMed]
WangXS, LeeS, SimmonsZ, et al. Increased incidence of the HFE mutation in amyotrophic lateral sclerosis and related cellular consequences. J Neurol Sci. 2004;227:27–33. [CrossRef] [PubMed]
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×