January 2006
Volume 47, Issue 1
Free
Cornea  |   January 2006
Estrogen’s and Progesterone’s Impact on Gene Expression in the Mouse Lacrimal Gland
Author Affiliations
  • Tomo Suzuki
    From the Schepens Eye Research Institute and
    Department of Ophthalmology, Harvard Medical School;
  • Frank Schirra
    From the Schepens Eye Research Institute and
    Department of Ophthalmology, Harvard Medical School;
  • Stephen M. Richards
    From the Schepens Eye Research Institute and
    Department of Ophthalmology, Harvard Medical School;
  • Nathaniel S. Treister
    From the Schepens Eye Research Institute and
    Department of Oral Medicine, Infection, and Immunity, Harvard School of Dental Medicine; and
  • Michael J. Lombardi
    Department of Physics, University of Massachusetts Boston, Boston, Massachusetts.
  • Patricia Rowley
    Department of Physics, University of Massachusetts Boston, Boston, Massachusetts.
  • Roderick V. Jensen
    Department of Physics, University of Massachusetts Boston, Boston, Massachusetts.
  • David A. Sullivan
    From the Schepens Eye Research Institute and
    Department of Ophthalmology, Harvard Medical School;
Investigative Ophthalmology & Visual Science January 2006, Vol.47, 158-168. doi:10.1167/iovs.05-1003
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Tomo Suzuki, Frank Schirra, Stephen M. Richards, Nathaniel S. Treister, Michael J. Lombardi, Patricia Rowley, Roderick V. Jensen, David A. Sullivan; Estrogen’s and Progesterone’s Impact on Gene Expression in the Mouse Lacrimal Gland. Invest. Ophthalmol. Vis. Sci. 2006;47(1):158-168. doi: 10.1167/iovs.05-1003.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

purpose. The hypothesis tested in the study was that the effect of estrogen and progesterone on the lacrimal gland is mediated through specific receptors and that hormonal effects involve the regulation of gene expression and protein synthesis.

methods. Lacrimal glands were collected from young adult, ovariectomized mice, that were treated with 17β-estradiol, progesterone, 17β-estradiol plus progesterone or vehicle for 2 weeks. Glands were pooled according to treatment, processed for the isolation of RNA, and evaluated for differentially expressed mRNAs by using gene microarrays. Bioarray data were analyzed with sophisticated bioinformatics and statistical programs. The expression of selected genes was verified by using gene chips and quantitative real-time PCR methods.

results. The results demonstrate that 17β-estradiol, progesterone, or both hormones together significantly influences the expression of hundreds of genes in the mouse lacrimal gland. Sex steroid treatment led to numerous alterations in gene activities related to transcriptional control, cell growth and/or maintenance, cell communication, signal transduction, enzyme catalysis, immune expression, and the binding and metabolism of nucleic acids and proteins. A number of the 17β-estradiol, progesterone or 17β-estradiol plus progesterone effects on gene expression were similar, but most were unique to each treatment. Of particular interest was the finding that these hormones seem to contribute little to the known sex-related differences in gene expression of the lacrimal gland.

conclusions. These results support the hypothesis that estrogen’s and progesterone’s action on the lacrimal gland involves the regulation of numerous genes. However, these hormone effects do not appear to represent a major factor underlying the sexual dimorphism of gene expression in lacrimal tissue.

Investigators have proposed that estrogens may play an important role in the anatomy, physiology, and sexual dimorphism of the lacrimal gland. 1 2 3 4 . In support of this proposition are reports that ovariectomy or antiestrogen treatment lead to acinar cell disruption and necrosis, cellular vacuolization, DNA degradation, inflammation, glandular tissue loss, and dry eye (Jacobs M, et al. IOVS 1986;27:ARVO Abstract page 25; Azzarolo AM, et al. IOVS 1994;35:ARVO Abstract 2500; Huang ZM, et al. IOVS 1995;36:ARVO Abstract 2979; Coles N, et al. IOVS 1988;29:ARVO Abstract page 48). 1 2 4 5 6 7 8 Conversely, estrogen administration reportedly corrects these changes in lacrimal gland structure and function, and promotes lacrimal secretion (Jacobs M, et al. IOVS 1986;27:ARVO Abstract page 25; Azzarolo AM, et al. IOVS 1993;34:ARVO Abstract 3773). 1 2 7 9 10 11 12 13  
However, other researchers have found that neither estrogen insufficiency nor estrogen treatment has any effect on the weight, morphology, total protein content, specific enzyme activity, lymphocyte accumulation, or secretion of the lacrimal gland (Cripps MM, et al. IOVS 1986;27:ARVO Abstract page 25). 9 14 15 16 17 18 19 20 21 Yet, other investigators have reported that estrogens have a negative influence on lacrimal tissue and cause glandular regression, suppression of protein production, androgen antagonism, and reduced tear secretion (Azzarolo AM, et al. IOVS 1993;34:ARVO Abstract 3773). 5 9 15 22 23 24  
Some of these conflicting findings regarding estrogens may be explained by differences in experimental design, hormone dosage, or animal model. It is also possible that these disparate results may be due to variations in the relative levels of progesterone, a hormone that may significantly modify estrogen effects. However, an overriding difficulty with clarification is that the nature and extent of estrogen or progestin action on the lacrimal gland is not known. In fact, no consensus exists concerning the cellular targets for, or the cellular processes that may be controlled by, estrogens or progestins in lacrimal tissue. Indeed, it has not yet even been established whether these hormones have functional receptors in the lacrimal gland. 
We hypothesize that estrogen and progesterone action on the lacrimal gland is mediated through specific receptors and that hormonal effects involve the regulation of gene expression and protein synthesis. To begin to test this hypothesis, we examined in the present study whether 17β-estradiol, progesterone, and both hormones in combination influence gene expression in the female mouse lacrimal gland. 
Materials and Methods
Animals and Hormone Treatment
Young adult and age-matched BALB/c mice, that were ovariectomized at 8 weeks of age, were obtained from Taconic Laboratories (Germantown, NY). Animals were housed in constant temperature rooms (70–72°F) with fixed light–dark intervals of 12 hours. Ten days after surgery, ovariectomized mice were treated with subcutaneous pellet implants containing placebo (cholesterol, methylcellulose, lactose), 17β-estradiol (0.5 mg), progesterone (10 mg), or combined 17β-estradiol plus progesterone. These pellets were purchased from Innovative Research of America (Sarasota, FL) and were designed for the continuous release of vehicle or physiological amounts of hormone throughout the 14-day experimental period. When indicated, mice were killed by CO2 inhalation and exorbital lacrimal glands were removed (n = 7 to 20 mice per condition per experiment), pooled according to group (n = 14 to 40 glands per sample) and processed for molecular biological procedures. All experiments with mice were approved by the Institutional Animal Care and Use Committee of The Schepens Eye Research Institute and adhered to the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. 
Molecular Biological Procedures
To analyze the effects of 17β-estradiol and progesterone on lacrimal gland gene expression, total RNA was extracted from tissues by using TRIzol reagent (Invitrogen Corp., Carlsbad, CA). When indicated, samples were also exposed to RNase-free DNase (Invitrogen), examined spectrophotometrically at 260 nm to determine concentration and evaluated on 6.7% formaldehyde/1.3% agarose (Invitrogen-Gibco, Grand Island, NY) gels to verify RNA integrity. The RNA samples were then processed by using several different methods. 
The principle method to examine differential gene expression involved the use of CodeLink Uniset Mouse I Bioarrays (∼10,000 genes; GE Healthcare, Piscataway, NJ). Toward this end, glandular RNA samples were further purified with RNAqueous spin columns (Ambion, Austin, TX), and the integrity of these preparations was assessed with a RNA 6000 Nano LabChip with an Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA). The RNA samples were then processed for CodeLink Bioarray hybridization, as previously described. 25 In brief, cDNA was synthesized from RNA (2 μg) with a CodeLink Expression Assay Reagent Kit (Amersham, Piscataway, NJ) and purified with a QIAquick purification kit (Qiagen, Valencia, CA). After sample drying, cRNA was made with a CodeLink Expression Assay Reagent Kit (Amersham), recovered with an RNeasy kit (Qiagen) and quantified with an UV spectrophotometer. Fragmented, biotin-labeled cRNA was then incubated and agitated (300 rpm shaker) on a CodeLink Bioarray at 37°C for 18 hours. The Bioarray was then washed, exposed to streptavidin-Alexa 647, and scanned by using ScanArray Express software and a ScanArray Express HT scanner (Packard BioScience, Meriden, CT) with the laser set at 635 nm, laser power at 100%, and photomultiplier tube voltage at 60%. Scanned image files were evaluated by utilizing CodeLink image and data analysis software (Amersham), which produced both raw and normalized hybridization signal intensities for each array spot. The spot intensities (∼10,000) on the microarray image were standardized to a median of 1. Normalized data, with signal intensities exceeding 0.75, were analyzed with GeneSifter.Net software (VizX Labs LLC, Seattle, WA, vizxlabs.com). This comprehensive program also generated gene ontology and z-score reports. The ontologies were organized according to the guidelines of the Gene Ontology Consortium (http://www.geneontology.org/GO.doc.html), 26 and included biological processes, molecular functions, and cellular components. Data were evaluated with and without log transformation. Statistical analysis of individual gene expression data was performed with Student’s t-test (two-tailed, unpaired). 
The data from the individual Bioarrays (n = 6) are available for download through the National Center for Biotechnology Information’s Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov/geo) via series accession number GSE1582. The data will also be accessible for analyses through GeneSifter (http://genesifter.net/datacenter/). 
Differentially expressed mRNAs were also analyzed by utilizing GEM 1 (>8,000 genes) and GEM 2 (>9,500 genes) gene chips (Incyte Genomics, Inc., St. Louis, MO). The GEM chips and CodeLink arrays have over 4,700 sequences in common. Following additional purification with RNAqueous spin columns, poly(A) mRNA was extracted from lacrimal gland RNA samples (400 μg) by using the MicroPoly(A)Pure mRNA Isolation Kit (Ambion, Inc., Austin, TX). The mRNA concentration was determined with a RiboGreen RNA Quantitation Kit (Molecular Probes, Eugene, OR), according to Incyte’s procedures. After designating mRNA samples (750 ng) for use with either cy3 or cy5 probes, preparations were suspended in TE buffer, placed in siliconized RNase-Free Microfuge Tubes (Ambion) and shipped on dry ice to Incyte for hybridization. Microarray data were sent electronically to the Harvard Center for Genomic Research (Cambridge, MA). Results were downloaded into the Resolver Gene Expression Data Analysis System, version 2.0 (Rosetta Inpharmatics, Kirkland, WA), then normalized and evaluated as previously reported. 25  
Real Time PCR Procedures
Quantitative real-time PCR (qPCR) was used to verify the differential expression of selected genes. Sense and antisense primers were designed by using Primer Express Software, version 1.5a (Applied Biosystems, Inc., Foster City, CA; Table 1 ). The qPCR reactions were carried out according to the manufacturer’s protocol, by using aliquots of lacrimal gland cDNA (0.01–0.3 μL cDNA), optimal primer concentrations, and Applied Biosystems’ SYBR Green PCR Master Mix, MicroAmp Optical 96-Well Reaction Plates, ABI PRISM Optical Adhesive Covers and the GeneAmp 7900 HT Sequence Detection System. Gene expression was determined by employing the Relative Standard Curve Method, as described in User Bulletin #2 ABI Prism 7700 Sequence Detection System (Applied Biosystems; updated version 10/01), and standardizing levels to that of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA. Dissociation curves were monitored to confirm the absence of secondary PCR products. 
Results
Estrogen and Progesterone Regulation of Gene Expression in the Lacrimal Gland
To examine the influence of “female” sex steroids on gene expression in the lacrimal gland, tissues were obtained from ovariectomized mice (n = 7 per treatment group) that had been treated for 2 weeks with 17β-estradiol, progesterone, or both hormones in combination. Glands were processed for analysis by using CodeLink Uniset Mouse I Bioarrays and GeneSifter software. 
Examination of non- and log-transformed data from three different experiments demonstrated that 17β-estradiol and progesterone exert a very significant impact on gene activity in the lacrimal gland. As shown in Table 2 , these hormones, whether administered alone or together, significantly altered the expression of hundreds of genes. Those genes that were upregulated (e.g., asialoglycoprotein receptor 1 and NF-κ-B-repressing factor) and downregulated (e.g., lymphocyte antigen 6 complex, locus F, and dopamine receptor 2) to the greatest extent (i.e., in terms of ratios) after hormone treatment are listed in Tables 3 4 and 5
Administration of these various hormones had a considerable influence on biological processes, molecular functions, and cellular components in the lacrimal gland. For example, 17β-estradiol, progesterone, and the combined sex steroid treatment all significantly affected the expression of numerous genes (i.e., ≥34 genes per category) related to nucleic acid and protein metabolism, cell growth and/or maintenance, cell communication, signal transduction, transcriptional regulation, and development. In addition, these treatments all significantly influenced the expression of many genes (i.e., ≥26 genes per category) associated with nucleic acid, protein, adenosine triphosphate (ATP) and metal ion binding, as well as assorted catalytic, hydrolase, receptor, and transferase activities (data not shown). These hormones also affected a diverse array of immune-related genes (Table 6)
Of particular interest was the impact of sex steroids on specific gene ontologies. As shown by z-score analyses, the most significant 17β-estradiol actions were directed toward the stimulation of signaling pathways, ion transport, enzyme activities, and membrane aspects, whereas genes suppressed by estrogen were related to cell organization and biogenesis, cytokine activity, receptor binding, mitochondria, and intracellular components (Table 7) . Progesterone administration led to a significant increase in the expression of genes linked to signal transduction and cell communication and a decrease in those associated with cell growth and/or maintenance, metabolism, and ion binding (Table 8) . In contrast to these findings, combined 17β-estradiol and progesterone exposure enhanced the expression of cell death genes and attenuated those related to receptor binding, signal transduction, protein transport, cytokine activity, and development (Table 9)
In these studies the different hormone treatments had analogous or opposite effects on the expression of a number of genes (Table 10) . There were two genes that were significantly (P < 0.05) upregulated by 17β-estradiol or progesterone, as well as 17β-estradiol plus progesterone. These genes encode serine/threonine kinase 22B and discoidin domain receptor family, member 2, both of which are involved in phosphate metabolism. Conversely, there were 14 genes that were significantly (P < 0.05) downregulated by all three forms of hormone treatment. These genes (and their ontologies) included cell division cycle 45 homologue (S phase of mitotic cycle), chordin (neurogenesis), lysosomal acid lipase 1 (lipid metabolism), nidogen 1 (cell-matrix adhesion), parathyroid hormone receptor 1 (signal transduction), forkhead box P3 (Foxp3; regulation of transcription), high-mobility group box 2-like 1 (nucleic acid binding), and calpain 9 (protein metabolism). 
To confirm in part the CodeLink Bioarray data, additional lacrimal gland mRNA samples (n = 20 mice per group per experiment) were processed for the GEM 1 and 2 gene chip analyses. This approach identified 38 genes on GEM chips that were either up- or downregulated by hormone treatment, and that met our analytical criteria (i.e., GEM signal intensity ≥500; expression ratio ≥1.8 or ≤ −1.8). However, only two of these genes were common to both the GEM and CodeLink platforms (i.e., pancreatic lipase–related protein 1 and asialoglycoprotein receptor 1). Therefore, to verify further the CodeLink results, selected genes were analyzed by qPCR. As shown in Table 11 , this method confirmed the effect of hormones on a number of different genes. 
Role of 17β-Estradiol and Progesterone in the Sex-Related Differences in Gene Expression of the Lacrimal Gland
We have recently found that significant, sex-related differences exist in the expression of more than 500 genes in the mouse lacrimal gland. 25 To evaluate whether female sex steroids may contribute to these differences, we determined whether genes expressed to a greater extent in female lacrimal tissues, compared with those of males, are also upregulated by treatment with 17β-estradiol, progesterone or both hormones together. Moreover, we assessed whether genes expressed to a lower degree in female lacrimal glands, relative to those of males, are downregulated by female sex steroid administration. The ages of the BALB/c mice (n = 5 to 7 mice/sex/experiment) used in the analysis of sex-related differences (n = 3 experiments) in the lacrimal gland were similar to those in the present studies. 25 Furthermore, all gene expression data were generated from CodeLink Bioarrays and analyzed with GeneSifter software. 
As demonstrated in Table 12 , 17β-estradiol, progesterone, and combined hormone exposure seemed to account for a minority of the sex-related differences in gene expression of the lacrimal gland. Evaluation of nontransformed data indicated that estrogen, with or without progesterone, appeared to contribute to between 6.6% and 26.8% of the gene activity differences between male and female lacrimal tissues (Table 12) . In contrast, progesterone alone had relatively little influence (i.e., <4%) on these sex differences. Examples of genes affected similarly by sex and sex steroid administration are shown in Table 13
Discussion
This investigation demonstrates that the administration of 17β-estradiol, progesterone, or both hormones significantly influenced the expression of hundreds of genes in the mouse lacrimal gland. Sex steroid treatment led to numerous alterations in gene activities related to transcriptional control, cell growth and/or maintenance, cell communication, signal transduction, enzyme catalysis, and the binding and metabolism of nucleic acids and proteins. A number of the 17β-estradiol, progesterone, or 17β-estradiol plus progesterone effects on gene expression were similar, but most were unique to each treatment. These results support our hypothesis that the effect of estrogen and progesterone on the lacrimal gland involves the regulation of gene expression. 
Some of the most significant effects of 17β-estradiol were directed toward the control of genes linked to signaling pathways, transport, enzymatic activities, and cellular organization. For example, 17β-estradiol enhanced the mRNA levels of (1) mitogen-activated protein kinase kinase kinase 4, which activates the CSBP2, P38, and JNK MAPK pathways 28 ; (2) serine (or cysteine) proteinase inhibitor, clade A, member 6, which is another name for corticosteroid-binding globulin or transcortin and is the major transport protein for glucocorticoids and progestins 28 ; (3) aldo-keto reductase family 1, member C18, which is also called 20-α- hydroxysteroid dehydrogenase, and catalyzes the conversion of progesterone into the inactive 20-α-dihydroprogesterone 29 ; and (4) pancreatic lipase–related protein 1, which belongs to an enzymatic superfamily of lipases, esterases, and thioesterases. 30 In contrast, 17β-estradiol decreased the content of numerous mRNAs, such as that of dynamin binding protein, which plays a role in membrane trafficking, 28 and of metaxin 1, which is involved in the transport of proteins into mitochondria. 28  
Progesterone administration induced a significant increase in the expression of genes involved in signal transduction and cell communication and a significant decrease in those associated with metabolism and cell growth and/or maintenance. As examples, progesterone enhanced the activity of genes encoding mitogen-activated protein kinase kinase kinase 4, as well as for (1) tachykinin receptor 2, which binds substance K (neurokinin A) and activates a phosphatidylinositol-calcium second messenger system 28 ; (2) solute carrier family 2 (facilitated glucose transporter), member 9, which helps to maintain glucose homeostasis 28 ; and (3) tumor necrosis factor receptor superfamily, member 19, a protein capable of inducing apoptosis by a caspase-independent mechanism (online). Conversely, progesterone downregulated the expression of genes encoding such proteins as (1) 3-hydroxy-3-methylglutaryl-coenzyme A reductase, which is the rate-limiting enzyme for cholesterol synthesis 28 ; (2) dopamine receptor 2, a G protein-coupled receptor that inhibits adenylyl cyclase 28 ; (3) solute carrier family 16 (monocarboxylic acid transporters), member 2, which catalyzes the rapid transport of many monocarboxylates across the plasma membrane 28 ; (4) cyclin K, which may regulate transcription through the phosphorylation of RNA polymerase II 28 ; and (5) RAS p21 protein activator 3, a GTPase-activating protein involved in the control of cell proliferation and differentiation. 28  
Combined 17β-estradiol and progesterone exposure elicited many changes in gene expression that were analogous to those of each hormone individually, as well as novel to the combination alone. These sex steroids together altered the activity of numerous cell death, signal transduction, receptor, endocrine, enzymatic, and growth factor genes. Those increased included genes for vascular endothelial growth factor A, discoidin domain receptor 2 (a tyrosine kinase receptor for fibrillar collagen that mediates fibroblast migration and proliferation), 28 and the adenosine A2b receptor. Those decreased included genes for insulin-like growth factor I, fibroblast growth factor-10 (may be active in wound healing), 28 parathyroid hormone receptor, calpain 9 (a calcium-regulated non-lysosomal thiol-protease), 28 and nidogen 1 (participates in the assembly of basement membranes). 31  
Of particular interest was the influence of 17β-estradiol, with or without progesterone, on the expression of many immune-related genes. Thus, for example, hormone treatment downregulated the expression of genes linked to histocompatibility 2, O region alpha locus (i.e., MHC class II, a chain), 28 CDw131 antigen (a high-affinity receptor for IL-3, IL-5 and granulocyte-macrophage colony-stimulating factor), 28 IL-3 (stimulates development of stem cells, granulocytes, macrophages, mast cells, and eosinophils), 28 IL-2 receptor β chain (receptor for IL-2), 28 IL-12 α and β chains (growth factors for activated T and NK cells), 28 small inducible cytokine A28 (chemotactic for resting CD4, CD8 T-cells and eosinophils), 28 cell surface glycoprotein CD200 (OX2) receptor (involved in regulation of macrophage function), 32 and toll-like receptor 9 (participates in the innate immune response to microbial agents). 28 Estrogen also enhanced the mRNA levels of suppressor of cytokine signaling 3, which inhibits the signaling of specific proinflammatory cytokines. 33 34 35 36 It is possible that some of these hormonal effects could contribute to an anti-inflammatory action of 17β-estradiol in the lacrimal gland. Indeed, such an immunologic role for estrogen in lacrimal tissue has been proposed by several investigators. 37  
However, other effects of 17β-estradiol, again with or without progesterone, do not appear to be consistent with such a proposition. For instance, hormone administration upregulated the expression of lacrimal gland genes related to transcription factor 7 (involved in T cell differentiation), 28 T-cell surface antigen CD2 (promotes T-cell adhesion to other cell types) 28 and small inducible cytokine B15 (chemotactic for neutrophils). 28 Sex steroid treatment also reduced the gene expression for (1) leukocyte immunoglobulin-like receptor (subfamily B member 4), a receptor for class I MHC antigens, which is involved in the downregulation of the immune response and the development of tolerance, 28 and (2) Foxp3, which acts as a rheostat of the immune response. 38 A reduction in Foxp3 function, in turn, may attenuate the activity of regulatory CD4+ CD25+ T cells and promote both lymphoproliferation 38 and autoimmune disease. 39 Of interest, estrogen has opposite effects on Foxp3 expression elsewhere in the body. 40 41  
Another observation is that 17β-estradiol exposure significantly increased the mRNA levels of asialoglycoprotein receptor 1. This receptor has been linked to the development of exocrine gland inflammation and keratoconjunctivitis sicca. 42 43 44 Collectively, these latter findings suggest that estrogen may promote inflammation and autoimmune disease in the lacrimal gland. If so, such an action may explain why 17β-estradiol administration to a female mouse model of Sjögren’s syndrome caused a significant increase in the area of lymphoid infiltrates in lacrimal tissue. 22 Moreover, a proinflammatory effect would be consistent with estrogen’s known ability to enhance the polyclonal B cell activation, autoantibody formation, and tissue abnormalities encountered in this autoimmune disorder. 22 45 46  
The mechanism by which 17β-estradiol and progesterone act on the lacrimal gland may involve classic receptors. Estrogen and progesterone receptor mRNA have been identified in lacrimal glands of rats, rabbits, and humans, 47 48 and putative estrogen-binding sites have been detected in a pooled cytosol preparation from rabbit lacrimal glands. 24 However, there is no evidence indicating that estrogen or progesterone receptor mRNAs are translated into saturable, high-affinity, specific, and functional proteins. 20 49 It should be noted that low-affinity receptors for estrogens appear to exist in rat lacrimal tissue, but these sites may actually represent a low-affinity association of estrogens to androgen receptors. 49 A further possibility is that estrogen and progesterone may act on the lacrimal gland indirectly through the control of other hormones (e.g., from the pituitary), or through nonclassic pathways (e.g., signaling through membrane receptors). 50  
Our study indicated that 17β-estradiol and progesterone, whether alone or together, seem to contribute little to the known sex-related differences in gene expression of the lacrimal gland. 25 Estrogen (15%) and progesterone (2%) influenced only a small percentage of those lacrimal tissue genes that have been reported to vary significantly between males and females. 25 In contrast, androgens are involved in more than 70% of these variations 51 and may therefore represent the major factor underlying the sexual dimorphism of the lacrimal gland. 
In summary, our findings demonstrate that 17β-estradiol and progesterone exert a considerable impact on gene expression of the lacrimal gland. Our ongoing research is designed to determine the functional significance of these sex steroid actions. 
 
Table 1.
 
Oligonucleotide Primers for Real-Time PCR Confirmation of Selected Genes
Table 1.
 
Oligonucleotide Primers for Real-Time PCR Confirmation of Selected Genes
Accession No. mRNA Orientation Nucleotide Sequence (5′ → 3′)
BC022106 Asialoglycoprotein receptor 1 Sense CACATCCCAAAATTCCCAACTC
Antisense CCTGGTCCTCAGTGCTCACA
NM_054042 CD248 antigen, endosialin Sense AGATTTGGCTTCATTTGGTGAACT
Antisense ACGGGAACACTGTCGAAAGCT
M32599 Glyceraldehyde-3-phosphate dehydrogenase Sense CATGGCCTTCCGTGTTCCTA
Antisense CTGGTCCTCAGTGTAGCCCAA
NM_010917 Nidogen 1 Sense TGAGCTTCTATGATCGTACGGACAT
Antisense GTCCAAGTCAGCCAGGAAAGG
AF061274 Pancreatic lipase–related protein 1 Sense CCCAGGTGGCTCAGATGATT
Antisense AAGACCTGGAGTCCGACTTCCT
NM_011978 Solute carrier family 27 (fatty acid transporter), member 2 Sense AGAAAAGTTGCAAGGTATGAGCTGAT
Antisense TAATGGTGTGAGCTGTGTGATTTG
Table 2.
 
Influence of 17β-Estradiol and/or Progesterone on Gene Expression in the Lacrimal Gland
Table 2.
 
Influence of 17β-Estradiol and/or Progesterone on Gene Expression in the Lacrimal Gland
Treatment Genes ↑ Genes ↓ Total
17β-Estradiol
 No transformation 176 211 387
 Log transformation 175 188 363
 Total 203 233 436
Progesterone
 No transformation 102 138 240
 Log transformation 93 137 230
 Total 114 158 272
17β-Estradiol+Progesterone
 No transformation 136 210 346
 Log transformation 144 198 342
 Total 160 232 392
Table 3.
 
17β-Estradiol Effect on Gene Expression Ratios in the Mouse Lacrimal Gland
Table 3.
 
17β-Estradiol Effect on Gene Expression Ratios in the Mouse Lacrimal Gland
Accession No. Gene Ratio P Ontology
Estradiol>Placebo
 NM_018781 Early growth response 3 5.50 0.0137 Transcription
 NM_011105 Polycystin 4.23 0.0014 Signal transduction
 NM_008456 Kallikrein 5 4.05 0.0206 Protein catabolism
 NM_018874 Pancreatic lipase–related protein 1 3.40 0.0036 Metabolism
 AB059565 Aldo-keto reductase family 1, member C18 3.27 0.0000 Catalytic activity
 NM_054080 Aldo-keto reductase family 1, member C20 3.08 0.0140 Steroid metabolism
 NM_009714 Asialoglycoprotein receptor 1 3.04 0.0108 Vesicle-mediated transport
 NM_010349 Glutamate receptor, ionotropic, kainate 2 (β2) 2.78 0.0055 Transmission of nerve impulse
 NM_007618 Serine (or cysteine) proteinase inhibitor, clade A, member 6 2.76 0.0315 Transport
Placebo>Estradiol
 NM_031255 Radial spokehead-like 1 15.59 0.0034 Cell homeostasis
 NM_008530 Lymphocyte antigen 6 complex, locus F 11.42 0.0248 Response to biotic stimulus
 NM_020515 Olfactory receptor 140 9.85 0.0272 Signal transduction
 NM_011978 Solute carrier family 27 (fatty acid transporter), member 2 9.13 0.0045 Carboxylic acid metabolism
 AK010367 Dynamin-binding protein 7.43 0.0150 Binding
 NM_013604 Metaxin 1 7.33 0.0129 Transport
 NM_007975 Coagulation factor II (thrombin) receptor-like 3 6.26 0.0008 Signal transduction
 NM_019782 Leprecan 1 6.19 0.0061 Cell growth and/or maintenance
 NM_009469 Unc-51 like kinase 1 (C. elegans) 4.56 0.0253 Small GTPase mediated signal transduction
Table 4.
 
Progesterone Influence on Gene Expression Ratios in the Mouse Lacrimal Gland
Table 4.
 
Progesterone Influence on Gene Expression Ratios in the Mouse Lacrimal Gland
Accession No. Gene Ratio P Ontology
Progesterone>Placebo
 BE305606 Solute carrier family 2 (facilitated glucose transporter), member 9 3.19 0.0392 Carbohydrate transport
 AK020455 NF-kappa-B–repressing factor* 2.73 0.0270 Transcription
 NM_007427 Agouti-related protein 2.40 0.0273 Signal transduction
 NM_009436 Serine/threonine kinase 22B 2.29 0.0403 Metabolism
 NM_013869 Tumor necrosis factor receptor superfamily, member 19 2.27 0.0251 Signal transducer activity
 NM_009184 PTK6 protein tyrosine kinase 6 2.19 0.0044 Protein metabolism
 NM_011706 Transient receptor potential cation channel, subfamily V, member 2 2.19 0.0407 Transcription
 AF197159 Cubilin (intrinsic factor-cobalamin receptor) 2.13 0.0408 tRNA aminoacylation
 NM_007825 Cytochrome P450, family 7, subfamily b, polypeptide 1 2.06 0.0413 Sterol metabolism
Placebo>Progesterone
 NM_009197 Solute carrier family 16, member 2 (monocarboxylic acid transporter) 3.19 0.0118 Transport
 NM_010077 Dopamine receptor 2 2.89 0.0110 Signal transduction
 NM_026853 Ankyrin repeat and SOCS box-containing protein 11 2.29 0.0385 Transcription
 AF060517 Cyclin K 2.24 0.0433 Transcription
 NM_009765 Breast cancer 2 2.16 0.0281 Response to stress
 NM_010111 Ephrin B2 2.13 0.0483 Morphogenesis
 M62766 3-hydroxy-3-methylglutaryl-coenzyme A reductase 2.08 0.0121 Sterol metabolism
 NM_021559 Zinc finger protein 191 2.07 0.0070 Transcription
 NM_009025 RAS p21 protein activator 3 2.01 0.0261 Signal transduction
 AB060274 Endothelial cell growth factor 1 1.99 0.0096 Morphogenesis
Table 5.
 
Impact of 17β-Estradiol and Progesterone on Gene Expression Ratios in the Mouse Lacrimal Gland
Table 5.
 
Impact of 17β-Estradiol and Progesterone on Gene Expression Ratios in the Mouse Lacrimal Gland
Accession No. Gene Ratio P Ontology
Estradiol+Progesterone>Placebo
 NM_009331 Transcription factor 7, T-cell–specific 8.23 0.0009 Transcription
 NM_025371 Aminoacylase 1 7.03 0.0009 Amino acid metabolism
 NM_033037 Cysteine dioxygenase 1, cytosolic 5.31 0.0001 Amino acid metabolism
 AK002693 Monoacylglycerol O-acyltransferase 1 4.31 0.0088 Catalytic activity
 NM_011046 Furin (paired basic amino acid–cleaving enzyme) 3.18 0.0135 Protein catabolism
 NM_054080 Aldo-keto reductase family 1, member C20 3.09 0.0073 Steroid metabolism
 NM_018874 Pancreatic lipase–related protein 1 3.00 0.0105 Metabolism
 NM_008109 Growth differentiation factor 5 2.76 0.0311 Development
 NM_007427 Agouti-related protein 2.61 0.0150 Signal transduction
 NM_009714 Asialoglycoprotein receptor 1 2.59 0.0286 Vesicle-mediated transport
 NM_011105 Polycystin 2.56 0.0257 Signal transduction
 AB059565 Aldo-keto reductase family 1, member C18 2.53 0.0289 Catalytic activity
Placebo>Estradiol+progesterone
 NM_031255 Radial spokehead-like 1 18.38 0.0027 Cell homeostasis
 NM_008530 Lymphocyte antigen 6 complex, locus F 14.81 0.0147 Response to biotic stimulus
 NM_020515 Olfactory receptor 140 8.60 0.0327 Signal transduction
 NM_013604 Metaxin 1 7.65 0.0093 Transport
 AK010367 Dynamin binding protein 7.54 0.0050 Binding
 NM_009469 Unc-51-like kinase 1 (C. elegans) 7.53 0.0010 Small GTPase mediated signal transduction
 NM_020277 Transient receptor potential cation channel, subfamily M, member 5 7.28 0.0313 Cation transport
 NM_007975 Coagulation factor II (thrombin) receptor-like 3 7.14 0.0005 Signal transduction
 NM_019782 Leprecan 1 6.08 0.0016 Cell growth and/or maintenance
 NM_025973 Progastricsin (pepsinogen C) 5.64 0.0123 Protein catabolism
 NM_018763 Carbohydrate sulfotransferase 2 5.64 0.0038 Amino sugar metabolism
Table 6.
 
Sex Steroid Regulation of Various Immune-Related Genes in the Lacrimal Gland
Table 6.
 
Sex Steroid Regulation of Various Immune-Related Genes in the Lacrimal Gland
Upregulation Downregulation
17β-Estradiol 17β-Estradiol
 CD 81 antigen  B-cell receptor-associated protein 29
 CD14 antigen  C1q and tumor necrosis factor related protein 1
 CD151 antigen  CD86 antigen
 CD163 antigen  Chemokine (C-C motif) ligand 12
 CD5 antigen  Chemokine (C-C motif) ligand 28
 Chemokine (C-X-C motif) ligand 15  Chemokine (C-C motif) receptor 6
 Complement component 4–binding protein  Colony-stimulating factor 2 receptor, beta 1, Low-affinity (granulocyte-macrophage)
 Fc receptor, IgG, low affinity IIb
 Histocompatibility 2, complement component factor B  Duffy blood group
 LPS-induced TN factor  Forkhead box P3
 Myxovirus (influenza virus) resistance 1  Histocompatibility 2, O region alpha locus
 Suppressor of cytokine signaling 2  Interferon regulatory factor 5
 Suppressor of cytokine signaling 3  Interleukin 12a
 Tumor necrosis factor (ligand) superfamily, member 13b  Interleukin 2 receptor, beta chain
 Interleukin 3
 Lymphocyte antigen 6 complex, locus F
 Nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2
 Toll-like receptor 9
 Tumor necrosis factor (ligand) superfamily, member 9
Progesterone Progesterone
 CD2 antigen  CD28 antigen
 Chemokine (C-C) receptor 2  CD3 antigen, zeta polypeptide
 Chemokine (C-X-C motif) receptor 6  Chemokine (C-C motif) receptor 6
 Cytokine receptor-like factor 1  Forkhead box P3
 Immunoglobulin (CD79A) binding protein 1b  Interleukin 12b
 Integrin alpha 4  Leukocyte immunoglobulin-like receptor, subfamily B, member 4
 Lymphocyte antigen 6 complex, locus I
 TNF receptor-associated factor 6
 Tumor necrosis factor receptor superfamily, member 8
17β-Estradiol+Progesterone 17β-Estradiol+Progesterone
 Adipsin  Chemokine (C-C motif) ligand 28
 CD2 antigen  Chemokine (C-C motif) receptor 1
 Chemokine (C-X-C motif) ligand 15  Colony-stimulating factor 2 receptor, beta 1, low-affinity (granulocyte-macrophage)
 Complement component 1, q subcomponent, gamma polypeptide
 Forkhead box P3
 Eosinophil-associated, ribonuclease A family, member 1  Histocompat ibility 2, M region locus 3
 Interferon-induced transmembrane protein 7  Histocompatibility 2, O region alpha locus
 LPS-induced TN factor  Interferon regulatory factor 5
 Transcription factor 7, T-cell specific  Interleukin 12a
 Interleukin 12b
 Interleukin 24
 Interleukin 3
 Lymphocyte antigen 6 complex, locus F
 Lymphocyte antigen 78
 Neutrophil cytosolic factor 4
 Nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2
 Toll-like receptor 9
Table 7.
 
Highest and Lowest Expression of Gene Ontologies in the Lacrimal Glands of Placebo- or 17β-Estradiol-Treated Mice
Table 7.
 
Highest and Lowest Expression of Gene Ontologies in the Lacrimal Glands of Placebo- or 17β-Estradiol-Treated Mice
Ontology Gene List Estradiol Genes ↑ Placebo Genes ↑ Array Genes Estradiol z-score Placebo z-score
Biological Process
 Enzyme-linked receptor protein signaling pathway 9 6 3 120 2.47 0.37
 Pattern specification 8 5 3 102 2.2 0.66
 Ion transport 18 13 5 384 2.13 −1.04
 Cell organization and biogenesis 10 3 7 471 −2.11 −0.87
 Embryonic development (sensu Animalia) 7 3 4 60 1.74 2.56
Molecular Function
 Chymotrypsin activity 7 5 2 70 3.21 0.46
 Protein-tyrosine kinase activity 14 11 3 235 3.16 −0.87
 Alpha-type channel activity 12 10 2 206 3.13 −1.13
 Trypsin activity 7 5 2 74 3.06 0.38
 Ion channel activity 11 9 2 182 3.03 −0.94
 Channel/pore class transporter activity 12 10 2 215 2.98 −1.19
 Serine-type endopeptidase activity 8 6 2 103 2.92 −0.1
 Cation channel activity 8 7 1 132 2.87 −1.07
 Serine-type peptidase activity 8 6 2 109 2.76 −0.18
 Transporter activity 37 24 13 787 2.47 −0.88
 Transmembrane receptor activity 26 15 11 444 2.33 0.61
 Protein kinase activity 18 12 6 343 2.2 −0.43
 Receptor activity 43 24 19 832 2.18 0.45
 Kinase activity 29 16 13 508 2.12 0.79
 Phosphotransferase activity, alcohol group as acceptor 21 13 8 392 2.09 −0.05
 ATP binding 33 21 12 727 2.03 −0.85
 Cytokine activity 10 3 7 149 0.09 2.27
 Receptor binding 18 6 12 327 −0.1 2.07
Cellular Component
 Integral to membrane 103 59 44 2185 3.85 −0.54
 Extracellular 99 44 55 1761 2.57 3.24
 Extracellular space 96 41 55 1691 2.24 3.58
 Membrane 119 61 58 2794 2 −0.37
 Mitochondrion 13 3 10 509 −2.13 −0.31
 Intracellular 142 57 85 3971 −2.6 −0.09
 Cytoplasm 70 26 44 2206 −2.64 −0.62
 Extracellular region 19 5 14 260 0.16 3.66
 Cell 221 104 117 5869 −0.33 −2.13
Table 8.
 
Highest and Lowest Expression of Gene Ontologies in the Lacrimal Glands of Placebo- or Progesterone-Treated Mice
Table 8.
 
Highest and Lowest Expression of Gene Ontologies in the Lacrimal Glands of Placebo- or Progesterone-Treated Mice
Ontology Gene List Progesterone Genes ↑ Placebo Genes ↑ Array Genes Progesterone z-Score Placebo z-Score
Biological Process
 Signal transduction 39 28 11 1175 5 −1.61
 Cell communication 48 31 17 1532 4.32 −1.26
 Cell growth and/or maintenance 41 14 27 2131 −2.09 −0.84
 Physiological process 135 50 85 5573 −2.41 1.13
 Metabolism 109 40 69 3863 −0.02 2.67
 Lipid metabolism 14 3 11 304 −0.09 3.24
 Response to stress 7 6 1 394 0.98 −2.04
Molecular Function
 Signal transducer activity 40 26 14 1273 3.55 −0.97
 Phosphoric ester hydrolase activity 8 6 2 170 3.08 −0.24
 Receptor activity 28 17 11 832 2.78 −0.17
 Metal ion binding 34 12 22 951 0.52 2.62
 Zinc ion binding 15 4 11 369 −0.03 2.69
 Transition metal ion binding 18 5 13 476 −0.11 2.59
 Transferase activity 7 1 6 106 −0.15 3.79
Cellular Component
 Extracellular 61 32 29 1761 3.39 0.92
 Extracellular space 60 31 29 1691 3.38 1.17
 Cytoplasm 40 15 25 2206 −2.25 −1.38
 Plasma membrane 16 10 6 902 0.05 −2.06
Table 9.
 
Highest and Lowest Expression of Gene Ontologies in the Lacrimal Glands of Placebo- or 17β-Estradiol- and Progesterone-Treated Mice
Table 9.
 
Highest and Lowest Expression of Gene Ontologies in the Lacrimal Glands of Placebo- or 17β-Estradiol- and Progesterone-Treated Mice
Ontology Gene List Estradiol and Progesterone Genes ↑ Placebo Genes ↑ Array Genes Estradiol and Progesterone z-Score Placebo z-Score
Biological Process
 Regulation of apoptosis 11 7 4 132 3.85 0.73
 Cell death 14 8 6 276 2.16 0.06
 Death 14 8 6 280 2.11 0.03
 Protein transport 8 0 8 304 −2.13 0.63
 Organogenesis 34 10 24 674 0.19 2.74
 Morphogenesis 35 10 25 742 −0.14 2.5
 Immune response 17 4 13 328 −0.29 2.38
 Cell–cell signaling 8 1 7 144 −0.73 2.31
 Embryonic development 7 2 5 96 0.57 2.12
 DNA replication and chromosome cycle 7 2 5 97 0.56 2.09
 Cell differentiation 12 3 9 218 −0.03 2.09
 Development 47 14 33 1133 −0.53 2.03
Molecular Function
 Hydrolase activity, acting on ester bonds 18 15 3 324 5.01 −1.46
 Hydrolase activity 43 25 18 1145 2.4 −1.24
 Phosphoric ester hydrolase activity 7 6 1 170 2.36 −1.36
 Cytokine activity 12 2 10 149 −0.08 4.06
 Receptor binding 23 7 16 327 1.14 3.72
 Signal transducer activity 52 16 36 1273 −0.53 2.17
 Hormone activity 7 3 4 74 1.93 2.05
Cellular Component
 Extracellular matrix (sensu Metazoa) 8 5 3 148 2.08 −0.08
 Extracellular region 17 4 13 260 0.2 3.28
 Extracellular space 79 29 50 1691 1.3 2.73
 Extracellular 80 30 50 1761 1.29 2.4
Table 10.
 
Analogous and Opposite Effects of 17β-Estradiol and Progesterone on Gene Expression in the Lacrimal Gland
Table 10.
 
Analogous and Opposite Effects of 17β-Estradiol and Progesterone on Gene Expression in the Lacrimal Gland
Treatment 1 Treatment 2 T1 ↑, T2 ↑ T1 ↓, T2 ↓ T1 ↑, T2 ↓ T1 ↓, T2 ↑
17β-Estradiol Progesterone 14 28 1 0
17β-Estradiol 17β-Estradiol + Progesterone 34 95 0 0
Progesterone 17β-Estradiol + Progesterone 14 40 1 0
Table 11.
 
Verification of Selected CodeLink Bioarray and GEM Chip Results
Table 11.
 
Verification of Selected CodeLink Bioarray and GEM Chip Results
Gene CodeLink Ratio GEM Ratio qPCR Ratio
17β-Estradiol>Placebo
 Pancreatic lipase related protein 1 3.4 4.7 11.3
 Asialoglycoprotein receptor 1 3.0 2.1 3.4
Placebo>17β-Estradiol
 Solute carrier family 27 (fatty acid transporter), member 2 9.1 2.6 8.8
 Nidogen 1 2.3 2.2 1.4
Progesterone>Placebo
 CD248 antigen, endosialin 2.0 4.9
Placebo>Progesterone
 Nidogen 1 1.6 1.6 1.5
17β-Estradiol+Progesterone>Placebo
 Pancreatic lipase related protein 1 3.0 5.2 12.6
 Asialoglycoprotein receptor 1 2.6 1.6 4.6
Placebo>17β-Estradiol+Progesterone
 solute carrier family 27 (fatty acid transporter), member 2 4.8 2.2 3.2
 Nidogen 1 2.1 1.4 1.5
Table 12.
 
Comparative Influence of Sex and Sex Steroid Treatment on Gene Expression in the Mouse Lacrimal Gland
Table 12.
 
Comparative Influence of Sex and Sex Steroid Treatment on Gene Expression in the Mouse Lacrimal Gland
Comparison 1 Comparison 2 Common Genes Total Common Genes as % of Total F>M Genes Total Common Genes as % of Total M>F Genes
No Transformation Log Transformation Total
F>M E2 > Plac 13 19 22 6.6
M>F Plac > E2 38 63 72 26.8
F>M Prog > Plac 2 2 3 0.9
M>F Plac > Prog 7 8 10 3.7
F>M E2+Prog > Plac 31 33 38 11.3
M>F Plac > E2+Prog 34 57 64 23.8
Table 13.
 
Similarities between the Effects of Sex and Sex Steroid Administration on the Expression of Specific Genes in the Mouse Lacrimal Gland
Table 13.
 
Similarities between the Effects of Sex and Sex Steroid Administration on the Expression of Specific Genes in the Mouse Lacrimal Gland
Female>Male Male>Female
17β-Estradiol>Placebo Placebo>E2
 Asialoglycoprotein receptor 1  Lymphocyte antigen 6 complex, locus F
 Pancreatic lipase–related protein 1  Radial spokehead-like 1
 Polycystin  Maestro
 High-mobility group nucleosomal binding domain 3  Olfactory receptor 140
 Furin (paired basic amino acid cleaving enzyme)  Midkine
 Growth differentiation factor 5  Solute carrier family 27 (fatty acid transported), member 2
 Aldo-keto reductase family 1, member C18  Stromal antigen 3
 Thioether S-methyltransferase  Progastricsin (pepsinogen C)
 LPS-induced TN factor  Unc-51 like kinase 1 (C. elegans)
 Ribosomal protein S6 kinase polypeptide 6  Placental growth factor
Progesterone>Placebo Placebo>Progesterone
 Solute carrier family 39 (metal ion transporter), member 8  Maestro
 RAD23a homolog (S. cerevisiae)  UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6
 Acid phosphatase 5, tartrate resistant  Cell division cycle 45 homolog (S. cerevisiae)-like
 Forkhead box P3
 BTB and CNC homology 1
 Chordin
 Heparanase
17β-Estradiol + Progesterone > Placebo Placebo > 17β-Estradiol + Progesterone
 Asialoglycoprotein receptor 1  Lymphocyte antigen 6 complex, locus F
 Pancreatic lipase–related protein 1  Radial spokehead-like 1
 Aminoacylase 1  Maestro
 Cysteine dioxygenase 1, cytosolic  Olfactory receptor 140
 Polycystin  Solute carrier family 27 (fatty acid transporter), member 2
 Transcription factor 7, T-cell specific  Interleukin 3
 High-mobility group nucleosomal binding domain 3  Transient receptor potential cation channel, subfamily M, member 5
 Hypoxanthine guanine phosphoribosyl transferase  Coagulation factor II (thrombin) receptor-like 3
 Cytosolic acyl-CoA thioesterase 1  Leprecan 1
 Butyryl coenzyme A synthetase 1  Stromal antigen 3
The authors thank Christian B. Wade (Seattle, WA) for assistance with the GeneSifter software and the Harvard Center for Genomic Research for help with processing GEM 1 and 2. 
GabeM. Conditionnement hormonal de la morphologie des glandes sus-parotidiennes chez le Rat albinos. Compt Rend Seanc Soc Biol. 1955;149:223–225.
BaquicheM. Le dimorphisme sexuel de la glande de Loewenthal chez le rat albinos. Acta Anat. 1959;36:247–280. [CrossRef] [PubMed]
Krawczuk-HermanowiczowaO. Effect of sex hormones on the lacrimal gland. III. Effects of testosterone and oestradiol and of both these hormones jointly on the morphological appearance of the lacrimal gland in castrated rats [in Polish]. Klin Oczna. 1983;85:337–339. [PubMed]
AzzaroloAM, EihausenH, SchechterJ. Estrogen prevention of lacrimal gland cell death and lymphocytic infiltration. Exp Eye Res. 2003;77:347–354. [CrossRef] [PubMed]
MircheffAK. Understanding the causes of lacrimal insufficiency: implications for treatment and prevention of dry eye syndrome. Research to Prevent Blindness Science Writers Seminar. 1993;51–54.Research to Prevent Blindness New York.
LubkinV, KramerP, NashR, BennettG. Evaluation of safety and efficacy of topical 17β-estradiol, 0.1% and 0.25%, in postmenopausal dry eye syndrome. Abstracts of the Second International Conference on the Lacrimal Gland, Tear Film and Dry Eye Syndromes: Basic Science and Clinical Relevance. 1996;160.Bermuda.
Krawczuk-HermanowiczowaO. Effects of sexual glands on the lacrimal gland. II. Changes in rat lacrimal glands after castration. Klin Oczna. 1983;85:15–17. [PubMed]
KrassoI. Die behandlung der erkrankungen des vorderen bulbusabschnittes mit buckys grenzstrahlen. Ztschr f Augenh. 1930;71:1–11.
LauriaA, PorcelliF. Leucine aminopeptidase (LAP) activity and sexual dimorphism in rat exorbital gland. Basic Appl Histochem. 1979;23:171–177. [PubMed]
WenderleinM, MattesS. The “dry eye” phenomenon and ovarian function. Study of 700 women pre- and postmenopausal. Zentralbl Gynakol. 1996;118:643–649. [PubMed]
GuaschinoS, GrimaldiE, SartoreA, et al. Visual function in menopause: the role of hormone replacement therapy. Menopause. 2003;10:53–57. [PubMed]
CavalleroC. The influence of various steroids on the Lowenthal lachrymal glands of the rat. Acta Endocrinol Suppl (Copenh). 1960;51:861.
AffinitoP, Di Spiezio SardoA, Di CarloC, et al. Effects of hormone replacement therapy on ocular function in postmenopause. Menopause. 2003;10:482–487. [CrossRef] [PubMed]
KuscuNK, ToprakAB, VatanseverS, et al. Tear function changes of postmenopausal women in response to hormone replacement therapy. Maturitas. 2003;44:63–68. [CrossRef] [PubMed]
PrijotE, BazinL, DestexheB. Essai de traitment hormonal de la keratocon-jonctivite seche. Bull Soc Belge Ophtalmol. 1972;162:795–800. [PubMed]
SullivanDA, BlochKJ, AllansmithMR. Hormonal influence on the secretory immune system of the eye: androgen regulation of secretory component levels in rat tears. J Immunol. 1984;132:1130–1135. [PubMed]
WinderickxJ, VercaerenI, VerhoevenG, HeynsW. Androgen-dependent expression of cystatin-related protein (CRP) in the exorbital lacrimal gland of the rat. J Steroid Biochem Molec Biol. 1994;48:165–170. [CrossRef] [PubMed]
VanakenH, ClaessensF, VercaerenI, HeynsW, PeetersB, RombautsW. Androgenic induction of cystatin-related protein and the C3 component of prostatic binding protein in primary cultures from the rat lacrimal gland. Mol Cell Endocrinol. 1996;121:197–205. [CrossRef] [PubMed]
SullivanDA, KelleherRS, VaermanJP, HannLE. Androgen regulation of secretory component synthesis by lacrimal gland acinar cells in vitro. J Immunol. 1990;145:4238–4244. [PubMed]
LaineM, TenovuoJ. Effect on peroxidase activity and specific binding of the hormone 17β-estradiol and rat salivary glands. Arch Oral Biol. 1983;8:847–852.
PelitA, BagisT, KayaselcukF, DursunD, AkovaY, AydinP. Tear function tests and conjunctival impression cytology before and after hormone replacement therapy in postmenopausal women. Eur J Ophthalmol. 2003;13:337–342. [PubMed]
SatoEH, SullivanDA. Comparative influence of steroid hormones and immunosuppressive agents on autoimmune expression in lacrimal glands of a female mouse model of Sjögren’s syndrome. Invest Ophthalmol Vis Sci. 1994;35:2632–2642. [PubMed]
VerbeckB. Augenbefunde und stoffwechselverhalten bei einnahme von ovulationshemmern. Klin Mbl Augenheilk. 1973;162:612–621. [PubMed]
RanganathanV, DePK. Androgens and estrogens markedly inhibit expression of a 20-kDa major protein in hamster exorbital lacrimal gland. Biochem Biophys Res Commun. 1995;208:412–417. [CrossRef] [PubMed]
RichardsSM, JensenRV, LiuM, et al. Influence of sex on gene expression in the mouse lacrimal gland. Exp Eye Res. .In press
AshburnerM, BallCA, BlakeJA, et al. Gene Ontology: tool for the unification of biology. The Gene Ontology Consortium. Nat Genet. 2000;25:25–29. [CrossRef] [PubMed]
DonigerSW, SalomonisN, DahlquistKD, VranizanK, LawlorSC, ConklinBR. MAPPFinder: using Gene Ontology and GenMAPP to create a global gene-expression profile from microarray data. Genome Biol. .4;2003 R7 (http://genomebiology.com/2003/4/1/R7)
National Center for BioTechnology. Information, http://www.ncbi.nlm.nih.gov/, and European Molecular Biology Laboratory Bioinformatic Harvester, http://harvester.embl.de/
DavorenJB, HsuehAJ. Insulin enhances FSH-stimulated steroidogenesis by cultured rat granulosa cells. Mol Cell Endocrinol. 1984;35:97–105. [CrossRef] [PubMed]
WongH, SchotzMC. The lipase gene family. J Lipid Res. 2002;43:993–999. [CrossRef] [PubMed]
PujuguetP, SimianM, LiawJ, TimplR, WerbZ, BissellMJ. Nidogen-1 regulates laminin-1-dependent mammary-specific gene expression. J Cell Sci. 2000;113:849–858. [PubMed]
WrightGJ, CherwinskiH, Foster-CuevasM, et al. Characterization of the CD200 receptor family in mice and humans and their interactions with CD200. J Immunol. 2003;171:3034–3046. [CrossRef] [PubMed]
AlexanderWS, HiltonDJ. The role of suppressors of cytokine signaling (SOCS) proteins in regulation of the immune response. Annu Rev Immunol. 2004;22:503–529. [CrossRef] [PubMed]
Zanin-ZhorovA, TalG, ShivtielS, et al. Heat shock protein 60 activates cytokine-associated negative regulator suppressor of cytokine signaling 3 in T cells: effects on signaling, chemotaxis, and inflammation. J Immunol. 2005;175:276–285. [CrossRef] [PubMed]
OrabonaC, BelladonnaML, VaccaC, et al. Cutting edge: silencing suppressor of cytokine signaling 3 expression in dendritic cells turns CD28-Ig from immune adjuvant to suppressant. J Immunol. 2005;174:6582–6586. [CrossRef] [PubMed]
YoshimuraA, NishinakamuraH, MatsumuraY, HanadaT. Negative regulation of cytokine signaling and immune responses by SOCS proteins. Arthritis Res Ther. 2005;7:100–110. [CrossRef] [PubMed]
IshimaruN, SaegusaK, YanagiK, HanejiN, SaitoI, HayashiY. Estrogen deficiency accelerates autoimmune exocrinopathy in murine Sjogren’s syndrome through fas-mediated apoptosis. Am J Pathol. 1999;155:173–181. [CrossRef] [PubMed]
OchsHD, ZieglerSF, TorgersonTR. FOXP3 acts as a rheostat of the immune response. Immunol Rev. 2005;203:156–164. [CrossRef] [PubMed]
HuanJ, CulbertsonN, SpencerL, et al. Decreased FOXP3 levels in multiple sclerosis patients. J Neurosci Res. 2005;81:45–52. [CrossRef] [PubMed]
OffnerH. Neuroimmunoprotective effects of estrogen and derivatives in experimental autoimmune encephalomyelitis: therapeutic implications for multiple sclerosis. J Neurosci Res. 2004;78:603–624. [CrossRef] [PubMed]
PolanczykMJ, CarsonBD, SubramanianS, et al. Cutting edge: estrogen drives expansion of the CD4+CD25+ regulatory T cell compartment. J Immunol. 2004;173:2227–2230. [CrossRef] [PubMed]
De VitaS, DamatoR, De MarchiG, SaccoS, FerraccioliG. True primary Sjogren’s syndrome in a subset of patients with hepatitis C infection: a model linking chronic infection to chronic sialadenitis. Isr Med Assoc J. 2002;4:1101–1105. [PubMed]
ToussirotE, Le HuedeG, MouginC, BalblancJC, BettingerD, WendlingD. Presence of hepatitis C virus RNA in the salivary glands of patients with Sjogren’s syndrome and hepatitis C virus infection. J Rheumatol. 2002;29:2382–2385. [PubMed]
SiagrisD, PharmakakisN, ChristofidouM, et al. Keratoconjunctivitis sicca and chronic HCV infection. Infection. 2002;30:229–233. [CrossRef] [PubMed]
CarlstenH, TarkowskiA, HolmdahlR, NilssonLA. Oestrogen is a potent disease accelerator in SLE-prone MRL lpr/lpr mice. Clin exp Immunol. 1990;80:467–473. [PubMed]
AhmedSA, AufdemorteTB, ChenJR, MontoyaAI, OliveD, TalalN. Estrogen induces the development of autoantibodies and promotes salivary gland lymphoid infiltrates in normal mice. J Autoimmunity. 1989;2:543–552. [CrossRef]
WickhamLA, GaoJ, TodaI, RochaEM, OnoM, SullivanDA. Identification of androgen, estrogen and progesterone receptor mRNAs in the eye. Acta Ophthalmol. 2000;78:146–153. [CrossRef]
WickhamLA, RochaAM, GaoJ, et al. Identification and hormonal control of sex steroid receptors in the eye. Adv Exp Med Biol. 1998;438:95–100. [PubMed]
SullivanDA, EdwardsJA, WickhamLA, et al. Identification and endocrine control of sex steroid binding sites in the lacrimal gland. Curr Eye Res. 1996;15:279–291. [CrossRef] [PubMed]
HewittSC, DerooBJ, KorachKS. Signal transduction: a new mediator for an old hormone?. Science. 2005;307:1625–1630. [CrossRef] [PubMed]
RichardsSM, LiuM, JensenRV, et al. Androgen regulation of gene expression in the mouse lacrimal gland. J Steroid Biochem Mol Biol. 2005;96:401–413. [CrossRef] [PubMed]
Table 1.
 
Oligonucleotide Primers for Real-Time PCR Confirmation of Selected Genes
Table 1.
 
Oligonucleotide Primers for Real-Time PCR Confirmation of Selected Genes
Accession No. mRNA Orientation Nucleotide Sequence (5′ → 3′)
BC022106 Asialoglycoprotein receptor 1 Sense CACATCCCAAAATTCCCAACTC
Antisense CCTGGTCCTCAGTGCTCACA
NM_054042 CD248 antigen, endosialin Sense AGATTTGGCTTCATTTGGTGAACT
Antisense ACGGGAACACTGTCGAAAGCT
M32599 Glyceraldehyde-3-phosphate dehydrogenase Sense CATGGCCTTCCGTGTTCCTA
Antisense CTGGTCCTCAGTGTAGCCCAA
NM_010917 Nidogen 1 Sense TGAGCTTCTATGATCGTACGGACAT
Antisense GTCCAAGTCAGCCAGGAAAGG
AF061274 Pancreatic lipase–related protein 1 Sense CCCAGGTGGCTCAGATGATT
Antisense AAGACCTGGAGTCCGACTTCCT
NM_011978 Solute carrier family 27 (fatty acid transporter), member 2 Sense AGAAAAGTTGCAAGGTATGAGCTGAT
Antisense TAATGGTGTGAGCTGTGTGATTTG
Table 2.
 
Influence of 17β-Estradiol and/or Progesterone on Gene Expression in the Lacrimal Gland
Table 2.
 
Influence of 17β-Estradiol and/or Progesterone on Gene Expression in the Lacrimal Gland
Treatment Genes ↑ Genes ↓ Total
17β-Estradiol
 No transformation 176 211 387
 Log transformation 175 188 363
 Total 203 233 436
Progesterone
 No transformation 102 138 240
 Log transformation 93 137 230
 Total 114 158 272
17β-Estradiol+Progesterone
 No transformation 136 210 346
 Log transformation 144 198 342
 Total 160 232 392
Table 3.
 
17β-Estradiol Effect on Gene Expression Ratios in the Mouse Lacrimal Gland
Table 3.
 
17β-Estradiol Effect on Gene Expression Ratios in the Mouse Lacrimal Gland
Accession No. Gene Ratio P Ontology
Estradiol>Placebo
 NM_018781 Early growth response 3 5.50 0.0137 Transcription
 NM_011105 Polycystin 4.23 0.0014 Signal transduction
 NM_008456 Kallikrein 5 4.05 0.0206 Protein catabolism
 NM_018874 Pancreatic lipase–related protein 1 3.40 0.0036 Metabolism
 AB059565 Aldo-keto reductase family 1, member C18 3.27 0.0000 Catalytic activity
 NM_054080 Aldo-keto reductase family 1, member C20 3.08 0.0140 Steroid metabolism
 NM_009714 Asialoglycoprotein receptor 1 3.04 0.0108 Vesicle-mediated transport
 NM_010349 Glutamate receptor, ionotropic, kainate 2 (β2) 2.78 0.0055 Transmission of nerve impulse
 NM_007618 Serine (or cysteine) proteinase inhibitor, clade A, member 6 2.76 0.0315 Transport
Placebo>Estradiol
 NM_031255 Radial spokehead-like 1 15.59 0.0034 Cell homeostasis
 NM_008530 Lymphocyte antigen 6 complex, locus F 11.42 0.0248 Response to biotic stimulus
 NM_020515 Olfactory receptor 140 9.85 0.0272 Signal transduction
 NM_011978 Solute carrier family 27 (fatty acid transporter), member 2 9.13 0.0045 Carboxylic acid metabolism
 AK010367 Dynamin-binding protein 7.43 0.0150 Binding
 NM_013604 Metaxin 1 7.33 0.0129 Transport
 NM_007975 Coagulation factor II (thrombin) receptor-like 3 6.26 0.0008 Signal transduction
 NM_019782 Leprecan 1 6.19 0.0061 Cell growth and/or maintenance
 NM_009469 Unc-51 like kinase 1 (C. elegans) 4.56 0.0253 Small GTPase mediated signal transduction
Table 4.
 
Progesterone Influence on Gene Expression Ratios in the Mouse Lacrimal Gland
Table 4.
 
Progesterone Influence on Gene Expression Ratios in the Mouse Lacrimal Gland
Accession No. Gene Ratio P Ontology
Progesterone>Placebo
 BE305606 Solute carrier family 2 (facilitated glucose transporter), member 9 3.19 0.0392 Carbohydrate transport
 AK020455 NF-kappa-B–repressing factor* 2.73 0.0270 Transcription
 NM_007427 Agouti-related protein 2.40 0.0273 Signal transduction
 NM_009436 Serine/threonine kinase 22B 2.29 0.0403 Metabolism
 NM_013869 Tumor necrosis factor receptor superfamily, member 19 2.27 0.0251 Signal transducer activity
 NM_009184 PTK6 protein tyrosine kinase 6 2.19 0.0044 Protein metabolism
 NM_011706 Transient receptor potential cation channel, subfamily V, member 2 2.19 0.0407 Transcription
 AF197159 Cubilin (intrinsic factor-cobalamin receptor) 2.13 0.0408 tRNA aminoacylation
 NM_007825 Cytochrome P450, family 7, subfamily b, polypeptide 1 2.06 0.0413 Sterol metabolism
Placebo>Progesterone
 NM_009197 Solute carrier family 16, member 2 (monocarboxylic acid transporter) 3.19 0.0118 Transport
 NM_010077 Dopamine receptor 2 2.89 0.0110 Signal transduction
 NM_026853 Ankyrin repeat and SOCS box-containing protein 11 2.29 0.0385 Transcription
 AF060517 Cyclin K 2.24 0.0433 Transcription
 NM_009765 Breast cancer 2 2.16 0.0281 Response to stress
 NM_010111 Ephrin B2 2.13 0.0483 Morphogenesis
 M62766 3-hydroxy-3-methylglutaryl-coenzyme A reductase 2.08 0.0121 Sterol metabolism
 NM_021559 Zinc finger protein 191 2.07 0.0070 Transcription
 NM_009025 RAS p21 protein activator 3 2.01 0.0261 Signal transduction
 AB060274 Endothelial cell growth factor 1 1.99 0.0096 Morphogenesis
Table 5.
 
Impact of 17β-Estradiol and Progesterone on Gene Expression Ratios in the Mouse Lacrimal Gland
Table 5.
 
Impact of 17β-Estradiol and Progesterone on Gene Expression Ratios in the Mouse Lacrimal Gland
Accession No. Gene Ratio P Ontology
Estradiol+Progesterone>Placebo
 NM_009331 Transcription factor 7, T-cell–specific 8.23 0.0009 Transcription
 NM_025371 Aminoacylase 1 7.03 0.0009 Amino acid metabolism
 NM_033037 Cysteine dioxygenase 1, cytosolic 5.31 0.0001 Amino acid metabolism
 AK002693 Monoacylglycerol O-acyltransferase 1 4.31 0.0088 Catalytic activity
 NM_011046 Furin (paired basic amino acid–cleaving enzyme) 3.18 0.0135 Protein catabolism
 NM_054080 Aldo-keto reductase family 1, member C20 3.09 0.0073 Steroid metabolism
 NM_018874 Pancreatic lipase–related protein 1 3.00 0.0105 Metabolism
 NM_008109 Growth differentiation factor 5 2.76 0.0311 Development
 NM_007427 Agouti-related protein 2.61 0.0150 Signal transduction
 NM_009714 Asialoglycoprotein receptor 1 2.59 0.0286 Vesicle-mediated transport
 NM_011105 Polycystin 2.56 0.0257 Signal transduction
 AB059565 Aldo-keto reductase family 1, member C18 2.53 0.0289 Catalytic activity
Placebo>Estradiol+progesterone
 NM_031255 Radial spokehead-like 1 18.38 0.0027 Cell homeostasis
 NM_008530 Lymphocyte antigen 6 complex, locus F 14.81 0.0147 Response to biotic stimulus
 NM_020515 Olfactory receptor 140 8.60 0.0327 Signal transduction
 NM_013604 Metaxin 1 7.65 0.0093 Transport
 AK010367 Dynamin binding protein 7.54 0.0050 Binding
 NM_009469 Unc-51-like kinase 1 (C. elegans) 7.53 0.0010 Small GTPase mediated signal transduction
 NM_020277 Transient receptor potential cation channel, subfamily M, member 5 7.28 0.0313 Cation transport
 NM_007975 Coagulation factor II (thrombin) receptor-like 3 7.14 0.0005 Signal transduction
 NM_019782 Leprecan 1 6.08 0.0016 Cell growth and/or maintenance
 NM_025973 Progastricsin (pepsinogen C) 5.64 0.0123 Protein catabolism
 NM_018763 Carbohydrate sulfotransferase 2 5.64 0.0038 Amino sugar metabolism
Table 6.
 
Sex Steroid Regulation of Various Immune-Related Genes in the Lacrimal Gland
Table 6.
 
Sex Steroid Regulation of Various Immune-Related Genes in the Lacrimal Gland
Upregulation Downregulation
17β-Estradiol 17β-Estradiol
 CD 81 antigen  B-cell receptor-associated protein 29
 CD14 antigen  C1q and tumor necrosis factor related protein 1
 CD151 antigen  CD86 antigen
 CD163 antigen  Chemokine (C-C motif) ligand 12
 CD5 antigen  Chemokine (C-C motif) ligand 28
 Chemokine (C-X-C motif) ligand 15  Chemokine (C-C motif) receptor 6
 Complement component 4–binding protein  Colony-stimulating factor 2 receptor, beta 1, Low-affinity (granulocyte-macrophage)
 Fc receptor, IgG, low affinity IIb
 Histocompatibility 2, complement component factor B  Duffy blood group
 LPS-induced TN factor  Forkhead box P3
 Myxovirus (influenza virus) resistance 1  Histocompatibility 2, O region alpha locus
 Suppressor of cytokine signaling 2  Interferon regulatory factor 5
 Suppressor of cytokine signaling 3  Interleukin 12a
 Tumor necrosis factor (ligand) superfamily, member 13b  Interleukin 2 receptor, beta chain
 Interleukin 3
 Lymphocyte antigen 6 complex, locus F
 Nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2
 Toll-like receptor 9
 Tumor necrosis factor (ligand) superfamily, member 9
Progesterone Progesterone
 CD2 antigen  CD28 antigen
 Chemokine (C-C) receptor 2  CD3 antigen, zeta polypeptide
 Chemokine (C-X-C motif) receptor 6  Chemokine (C-C motif) receptor 6
 Cytokine receptor-like factor 1  Forkhead box P3
 Immunoglobulin (CD79A) binding protein 1b  Interleukin 12b
 Integrin alpha 4  Leukocyte immunoglobulin-like receptor, subfamily B, member 4
 Lymphocyte antigen 6 complex, locus I
 TNF receptor-associated factor 6
 Tumor necrosis factor receptor superfamily, member 8
17β-Estradiol+Progesterone 17β-Estradiol+Progesterone
 Adipsin  Chemokine (C-C motif) ligand 28
 CD2 antigen  Chemokine (C-C motif) receptor 1
 Chemokine (C-X-C motif) ligand 15  Colony-stimulating factor 2 receptor, beta 1, low-affinity (granulocyte-macrophage)
 Complement component 1, q subcomponent, gamma polypeptide
 Forkhead box P3
 Eosinophil-associated, ribonuclease A family, member 1  Histocompat ibility 2, M region locus 3
 Interferon-induced transmembrane protein 7  Histocompatibility 2, O region alpha locus
 LPS-induced TN factor  Interferon regulatory factor 5
 Transcription factor 7, T-cell specific  Interleukin 12a
 Interleukin 12b
 Interleukin 24
 Interleukin 3
 Lymphocyte antigen 6 complex, locus F
 Lymphocyte antigen 78
 Neutrophil cytosolic factor 4
 Nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2
 Toll-like receptor 9
Table 7.
 
Highest and Lowest Expression of Gene Ontologies in the Lacrimal Glands of Placebo- or 17β-Estradiol-Treated Mice
Table 7.
 
Highest and Lowest Expression of Gene Ontologies in the Lacrimal Glands of Placebo- or 17β-Estradiol-Treated Mice
Ontology Gene List Estradiol Genes ↑ Placebo Genes ↑ Array Genes Estradiol z-score Placebo z-score
Biological Process
 Enzyme-linked receptor protein signaling pathway 9 6 3 120 2.47 0.37
 Pattern specification 8 5 3 102 2.2 0.66
 Ion transport 18 13 5 384 2.13 −1.04
 Cell organization and biogenesis 10 3 7 471 −2.11 −0.87
 Embryonic development (sensu Animalia) 7 3 4 60 1.74 2.56
Molecular Function
 Chymotrypsin activity 7 5 2 70 3.21 0.46
 Protein-tyrosine kinase activity 14 11 3 235 3.16 −0.87
 Alpha-type channel activity 12 10 2 206 3.13 −1.13
 Trypsin activity 7 5 2 74 3.06 0.38
 Ion channel activity 11 9 2 182 3.03 −0.94
 Channel/pore class transporter activity 12 10 2 215 2.98 −1.19
 Serine-type endopeptidase activity 8 6 2 103 2.92 −0.1
 Cation channel activity 8 7 1 132 2.87 −1.07
 Serine-type peptidase activity 8 6 2 109 2.76 −0.18
 Transporter activity 37 24 13 787 2.47 −0.88
 Transmembrane receptor activity 26 15 11 444 2.33 0.61
 Protein kinase activity 18 12 6 343 2.2 −0.43
 Receptor activity 43 24 19 832 2.18 0.45
 Kinase activity 29 16 13 508 2.12 0.79
 Phosphotransferase activity, alcohol group as acceptor 21 13 8 392 2.09 −0.05
 ATP binding 33 21 12 727 2.03 −0.85
 Cytokine activity 10 3 7 149 0.09 2.27
 Receptor binding 18 6 12 327 −0.1 2.07
Cellular Component
 Integral to membrane 103 59 44 2185 3.85 −0.54
 Extracellular 99 44 55 1761 2.57 3.24
 Extracellular space 96 41 55 1691 2.24 3.58
 Membrane 119 61 58 2794 2 −0.37
 Mitochondrion 13 3 10 509 −2.13 −0.31
 Intracellular 142 57 85 3971 −2.6 −0.09
 Cytoplasm 70 26 44 2206 −2.64 −0.62
 Extracellular region 19 5 14 260 0.16 3.66
 Cell 221 104 117 5869 −0.33 −2.13
Table 8.
 
Highest and Lowest Expression of Gene Ontologies in the Lacrimal Glands of Placebo- or Progesterone-Treated Mice
Table 8.
 
Highest and Lowest Expression of Gene Ontologies in the Lacrimal Glands of Placebo- or Progesterone-Treated Mice
Ontology Gene List Progesterone Genes ↑ Placebo Genes ↑ Array Genes Progesterone z-Score Placebo z-Score
Biological Process
 Signal transduction 39 28 11 1175 5 −1.61
 Cell communication 48 31 17 1532 4.32 −1.26
 Cell growth and/or maintenance 41 14 27 2131 −2.09 −0.84
 Physiological process 135 50 85 5573 −2.41 1.13
 Metabolism 109 40 69 3863 −0.02 2.67
 Lipid metabolism 14 3 11 304 −0.09 3.24
 Response to stress 7 6 1 394 0.98 −2.04
Molecular Function
 Signal transducer activity 40 26 14 1273 3.55 −0.97
 Phosphoric ester hydrolase activity 8 6 2 170 3.08 −0.24
 Receptor activity 28 17 11 832 2.78 −0.17
 Metal ion binding 34 12 22 951 0.52 2.62
 Zinc ion binding 15 4 11 369 −0.03 2.69
 Transition metal ion binding 18 5 13 476 −0.11 2.59
 Transferase activity 7 1 6 106 −0.15 3.79
Cellular Component
 Extracellular 61 32 29 1761 3.39 0.92
 Extracellular space 60 31 29 1691 3.38 1.17
 Cytoplasm 40 15 25 2206 −2.25 −1.38
 Plasma membrane 16 10 6 902 0.05 −2.06
Table 9.
 
Highest and Lowest Expression of Gene Ontologies in the Lacrimal Glands of Placebo- or 17β-Estradiol- and Progesterone-Treated Mice
Table 9.
 
Highest and Lowest Expression of Gene Ontologies in the Lacrimal Glands of Placebo- or 17β-Estradiol- and Progesterone-Treated Mice
Ontology Gene List Estradiol and Progesterone Genes ↑ Placebo Genes ↑ Array Genes Estradiol and Progesterone z-Score Placebo z-Score
Biological Process
 Regulation of apoptosis 11 7 4 132 3.85 0.73
 Cell death 14 8 6 276 2.16 0.06
 Death 14 8 6 280 2.11 0.03
 Protein transport 8 0 8 304 −2.13 0.63
 Organogenesis 34 10 24 674 0.19 2.74
 Morphogenesis 35 10 25 742 −0.14 2.5
 Immune response 17 4 13 328 −0.29 2.38
 Cell–cell signaling 8 1 7 144 −0.73 2.31
 Embryonic development 7 2 5 96 0.57 2.12
 DNA replication and chromosome cycle 7 2 5 97 0.56 2.09
 Cell differentiation 12 3 9 218 −0.03 2.09
 Development 47 14 33 1133 −0.53 2.03
Molecular Function
 Hydrolase activity, acting on ester bonds 18 15 3 324 5.01 −1.46
 Hydrolase activity 43 25 18 1145 2.4 −1.24
 Phosphoric ester hydrolase activity 7 6 1 170 2.36 −1.36
 Cytokine activity 12 2 10 149 −0.08 4.06
 Receptor binding 23 7 16 327 1.14 3.72
 Signal transducer activity 52 16 36 1273 −0.53 2.17
 Hormone activity 7 3 4 74 1.93 2.05
Cellular Component
 Extracellular matrix (sensu Metazoa) 8 5 3 148 2.08 −0.08
 Extracellular region 17 4 13 260 0.2 3.28
 Extracellular space 79 29 50 1691 1.3 2.73
 Extracellular 80 30 50 1761 1.29 2.4
Table 10.
 
Analogous and Opposite Effects of 17β-Estradiol and Progesterone on Gene Expression in the Lacrimal Gland
Table 10.
 
Analogous and Opposite Effects of 17β-Estradiol and Progesterone on Gene Expression in the Lacrimal Gland
Treatment 1 Treatment 2 T1 ↑, T2 ↑ T1 ↓, T2 ↓ T1 ↑, T2 ↓ T1 ↓, T2 ↑
17β-Estradiol Progesterone 14 28 1 0
17β-Estradiol 17β-Estradiol + Progesterone 34 95 0 0
Progesterone 17β-Estradiol + Progesterone 14 40 1 0
Table 11.
 
Verification of Selected CodeLink Bioarray and GEM Chip Results
Table 11.
 
Verification of Selected CodeLink Bioarray and GEM Chip Results
Gene CodeLink Ratio GEM Ratio qPCR Ratio
17β-Estradiol>Placebo
 Pancreatic lipase related protein 1 3.4 4.7 11.3
 Asialoglycoprotein receptor 1 3.0 2.1 3.4
Placebo>17β-Estradiol
 Solute carrier family 27 (fatty acid transporter), member 2 9.1 2.6 8.8
 Nidogen 1 2.3 2.2 1.4
Progesterone>Placebo
 CD248 antigen, endosialin 2.0 4.9
Placebo>Progesterone
 Nidogen 1 1.6 1.6 1.5
17β-Estradiol+Progesterone>Placebo
 Pancreatic lipase related protein 1 3.0 5.2 12.6
 Asialoglycoprotein receptor 1 2.6 1.6 4.6
Placebo>17β-Estradiol+Progesterone
 solute carrier family 27 (fatty acid transporter), member 2 4.8 2.2 3.2
 Nidogen 1 2.1 1.4 1.5
Table 12.
 
Comparative Influence of Sex and Sex Steroid Treatment on Gene Expression in the Mouse Lacrimal Gland
Table 12.
 
Comparative Influence of Sex and Sex Steroid Treatment on Gene Expression in the Mouse Lacrimal Gland
Comparison 1 Comparison 2 Common Genes Total Common Genes as % of Total F>M Genes Total Common Genes as % of Total M>F Genes
No Transformation Log Transformation Total
F>M E2 > Plac 13 19 22 6.6
M>F Plac > E2 38 63 72 26.8
F>M Prog > Plac 2 2 3 0.9
M>F Plac > Prog 7 8 10 3.7
F>M E2+Prog > Plac 31 33 38 11.3
M>F Plac > E2+Prog 34 57 64 23.8
Table 13.
 
Similarities between the Effects of Sex and Sex Steroid Administration on the Expression of Specific Genes in the Mouse Lacrimal Gland
Table 13.
 
Similarities between the Effects of Sex and Sex Steroid Administration on the Expression of Specific Genes in the Mouse Lacrimal Gland
Female>Male Male>Female
17β-Estradiol>Placebo Placebo>E2
 Asialoglycoprotein receptor 1  Lymphocyte antigen 6 complex, locus F
 Pancreatic lipase–related protein 1  Radial spokehead-like 1
 Polycystin  Maestro
 High-mobility group nucleosomal binding domain 3  Olfactory receptor 140
 Furin (paired basic amino acid cleaving enzyme)  Midkine
 Growth differentiation factor 5  Solute carrier family 27 (fatty acid transported), member 2
 Aldo-keto reductase family 1, member C18  Stromal antigen 3
 Thioether S-methyltransferase  Progastricsin (pepsinogen C)
 LPS-induced TN factor  Unc-51 like kinase 1 (C. elegans)
 Ribosomal protein S6 kinase polypeptide 6  Placental growth factor
Progesterone>Placebo Placebo>Progesterone
 Solute carrier family 39 (metal ion transporter), member 8  Maestro
 RAD23a homolog (S. cerevisiae)  UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6
 Acid phosphatase 5, tartrate resistant  Cell division cycle 45 homolog (S. cerevisiae)-like
 Forkhead box P3
 BTB and CNC homology 1
 Chordin
 Heparanase
17β-Estradiol + Progesterone > Placebo Placebo > 17β-Estradiol + Progesterone
 Asialoglycoprotein receptor 1  Lymphocyte antigen 6 complex, locus F
 Pancreatic lipase–related protein 1  Radial spokehead-like 1
 Aminoacylase 1  Maestro
 Cysteine dioxygenase 1, cytosolic  Olfactory receptor 140
 Polycystin  Solute carrier family 27 (fatty acid transporter), member 2
 Transcription factor 7, T-cell specific  Interleukin 3
 High-mobility group nucleosomal binding domain 3  Transient receptor potential cation channel, subfamily M, member 5
 Hypoxanthine guanine phosphoribosyl transferase  Coagulation factor II (thrombin) receptor-like 3
 Cytosolic acyl-CoA thioesterase 1  Leprecan 1
 Butyryl coenzyme A synthetase 1  Stromal antigen 3
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×