February 2007
Volume 48, Issue 2
Free
Retinal Cell Biology  |   February 2007
Characterization of Two Spontaneously Generated Human Müller Cell Lines from Donors with Type 1 and Type 2 Diabetes
Author Affiliations
  • Caroline B. Lupien
    From Unité de recherche en ophtalmologie, Centre de recherche du CHUQ, Ste-Foy, Québec, Canada; and
    Département d’ORLO, Faculté de médecine, Université Laval, Québec, Canada.
  • Christian Salesse
    From Unité de recherche en ophtalmologie, Centre de recherche du CHUQ, Ste-Foy, Québec, Canada; and
    Département d’ORLO, Faculté de médecine, Université Laval, Québec, Canada.
Investigative Ophthalmology & Visual Science February 2007, Vol.48, 874-880. doi:10.1167/iovs.05-0788
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Caroline B. Lupien, Christian Salesse; Characterization of Two Spontaneously Generated Human Müller Cell Lines from Donors with Type 1 and Type 2 Diabetes. Invest. Ophthalmol. Vis. Sci. 2007;48(2):874-880. doi: 10.1167/iovs.05-0788.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

purpose. Müller cells are the principal glial cells of the retina. They span the entire thickness of the neural retina, and they are in close contact with neurons. Müller cells grow very slowly, and they undergo senescence with increasing passages. Moreover, successful primary cultures of Müller cells can be obtained only with donors no older than 35 years. These limitations of primary cultures motivated the characterization of cell lines. The purpose of this study was thus to compare normal human Müller cells (NHMCs) with two spontaneously generated human Müller cell lines from donors with type 1 and 2 diabetes (HMCLs).

methods. Both cell lines were investigated for the expression of known markers of Müller cells as well as epithelial and endothelial cells by immunofluorescence and Western blot analyses. RT-PCR was also performed with growth factors that are typical of human Müller cells.

results. In contrast to the typical fibroblast-like morphology of Müller cells, HMCLs showed an epithelial shape. Immunofluorescence analyses and Western blot showed that both NHMCs and HMCLs express the known markers of Müller cells. In addition, HMCLs express cytokeratins K8 and K18 as well as typical growth factors for NHMCs. Finally, HMCLs have reached 30 passages until now without any change in their morphology or expression of markers, whereas NHMCs cannot typically be passed beyond small number of passages. HMCLs are the only human Müller cells lines that have a normal karyotype.

conclusions. HMCLs can be used as a model to improve the understanding of Müller cells in the context of chronic diabetes.

Müller cells are the principal glial cells of the retina. 1 2 Through their processes, Müller cells span the entire thickness of the neural retina and surround neuronal cell bodies, axons, and blood vessels. 2 3 This particular organization of Müller cells in the retina subserves their critical housekeeping role of removing neurotransmitters from the extracellular space after their release during neural activity 2 via the high-affinity glutamate transporter, GLAST-1. 4 In particular, being the only cells in the retina endowed with the enzyme glutamine synthetase (GS), 5 6 Müller cells transform glutamate into glutamine, which is then returned to the neural cells for glutamate resynthesis. 7  
Diabetic retinopathy is a complication of diabetes and is the leading cause of blindness in the working population of developed countries. In the past few years, the research has been focused on the entire retina, rather than only on retinal vessels. Multiple cell types in the retina are affected early by diabetes, and multiple processes are in operation. 8 There is an emerging body of evidence suggesting that neuronal changes are an early phenomenon in the diabetic retina and that several cell types are affected, including the neuronal and glial cells. 9 10 Glial reactivity, a reflection of altered glial function, 11 becomes evident in the retina during the first 3 months of diabetes. 12 This glial reactivity is manifested by an increased glial fibrillary acidic protein (GFAP) immunoreactivity and content, both in Müller cells and astrocytes. As glia support the functions of neurons and endothelial cells, 2 it is possible that glial-reactive changes affect the function and survival of both vascular and neuronal elements of the retina. Müller cells have characteristics that make them both potential targets of diabetes and potential contributors of retinopathy. 8  
Rat Müller cell lines created by transformation with oncogenes or viral proteins 13 14 15 as well as one spontaneously immortalized human Müller cell line 16 have recently become available. However, none of these cell lines bears a normal karyotype. In addition, no Müller cell line generated from donors with diabetes is yet available. The purpose of this study was to establish the phenotypic characterization of two spontaneous Müller cell lines originating from donors with type 1 and type 2 diabetes by using known markers that are typical of Müller cells. 
Methods
This study was conducted in accordance with the Declaration of Helsinki and our institution’s guidelines. 
Cell Culture
Two spontaneous human Müller cell lines (HMCLs) were obtained from donors with type 1 and 2 diabetes and were named HMCL-I and -II, respectively. The clinical data for the donor of HMCL-I are the following: age, 33 years; sex, male; diabetes, type 1; duration of diabetes, 28 years; diagnosis and treatment: proliferative diabetic retinopathy during the past 8 years and treated by laser in one eye; other diseases, nephropathy. The clinical data for the donor of HMCL-II are the following: age, 69 years; sex, female; diabetes, type 2; duration of diabetes, unknown; diagnosis and treatment: never evaluated by an ophthalmologist; other diseases, hyperglycemia, cardiopathy, and high blood pressure. Isolation and culture of HMCLs and normal human Müller cells (NHMCs) were performed as described previously. 17 Successful primary cultures of NHCM can be obtained only from donors younger than 35 years and from most but not all retinas. 
Phase-Contrast Microscopy, Karyotype, and BrdU Analyses
Micrographs of HMCLs and NHMCs were obtained by phase-contrast microscopy (Diaphot 300; Nikon, Mississauga, ON) using a digital camera (CoolPix 4500; Nikon). To determine whether the karyotype of HCMLs is normal, metaphase chromosomes of HMCLs were evaluated at passage 11 using a standard G-banding technique by the Laboratoire Diagnostic Pré-natal from the CHUQ (Centre Hospitalier Universitaire de Québec, Canada). Determination of the doubling time (DT) of NHMCs and HMCLs was performed in triplicate during 7 days. A suspension of 5 × 104 cell/mL was plated in each well of a six-well plate. The number of viable cells was determined by cell counting using trypan blue dye exclusion. The doubling time was estimated by using DT = (t 1t 0)log2/(logN 1 − logN 0), where t 0 is the time when cells were plated, t 1 is the time when cells were harvested (1–7 days), N 0 is the number of cells plated at time t 0 (5 × 104 cells), and N 1 is the number of viable cells. 18 The measurement of BrdU incorporation and quantification was performed by flow cytometry (FACS; Beckman Coulter, Mississauga, ON). 
Immunofluorescence Analyses
Immunofluorescence analyses were performed with HMCLs and NHMCs, as previously described. 17 We used antibodies against specific markers of Müller cells (a polyclonal rabbit anti-human CRALBP [cellular retinaldehyde-binding protein]; 1:50 dilution), a monoclonal mouse anti-human glutamine synthetase (1:50 dilution; Cedarlane, Hornby, ON, Canada), a monoclonal mouse anti-human GFAP (1:50 dilution; Serotec, Hornby, ON, Canada) and a polyclonal rabbit anti-rat glutamate transporter (GLAST; 1:50 dilution; Alpha Diagnostic, San Antonio, TX), as well as antibodies against known markers for epithelial (polyclonal guinea pig anti-human cytokeratins K8/K18, 1:300 dilution; ARP, Exeter, UK) and endothelial cells (monoclonal mouse anti-human von Willebrand factor VIII, 1:100 dilution; DakoCytomation, Mississauga, ON, Canada; and monoclonal mouse anti-human platelet-endothelial cell adhesion molecule [PECAM], 1:200 dilution; Chemicon, Temecula, CA). The secondary antibodies used included Alexa 488 coupled with goat anti-mouse (1:250 dilution; Invitrogen-Molecular Probes, Burlington, ON) for the primary antibodies against GFAP, glutamine synthetase, PECAM, and factor VIII; Alexa 488 coupled with goat anti-rabbit (1:250 dilution; Invitrogen-Molecular Probes) for the primary antibodies against CRALBP and GLAST; and Alexa 594 coupled with goat anti-guinea pig (1:400 dilution; Invitrogen-Molecular Probes) for the primary antibody against K8/K18. 
Western Blot Analyses
Western blot analyses were performed with HMCLs (at passage 4) as previously described. 17 Sixty micrograms of proteins was size-fractionated using 8% (glutamine synthetase) or 10% (all other proteins) polyacrylamide gel electrophoresis. The primary antibodies used included the polyclonal mouse anti-human GFAP (1:10,000 dilution; Dako, Mississauga, ON, Canada), the polyclonal rabbit anti-human CRALBP (1:1000 dilution), the polyclonal rabbit anti-human GLAST (1:10,000 dilution) and the polyclonal rabbit anti-human glutamine synthetase (1:300 dilution; Santa Cruz Biotechnology Inc., Santa Cruz, CA). The secondary antibodies used included a peroxidase-conjugated sheep anti-mouse for GFAP (1:10,000 dilution; Santa Cruz Biotechnology Inc.) and a peroxidase-conjugated donkey anti-rabbit for CRALBP, GLAST, and glutamine synthetase (1:10,000 dilution; GE Healthcare, Baie d’Urfé, QC, Canada). 
Semiquantitative RT-PCR Analyses
Total RNA from HMCLs and NHMCs was isolated, and first-strand cDNAs was synthesized and used for semiquantitative determination of brain-derived neurotrophic factor (BDNF), basic fibroblast growth factor (bFGF), ciliary neurotrophic factor (CNTF), CNTF receptor (CNTFR-α), epidermal growth factor (EGF), insulin-like growth factor (IGF-I), Ki67, nestin, PAX-6, platelet-derived growth factor (PDGFβ), transforming growth factor (TGF-α), TRK receptor (TRK-β) and vascular endothelial growth factor (VEGF-α) mRNA levels by PCR as previously described. 19 The DNA sequence of the 5′ and 3′ template primers used for each of these proteins are presented in Table 1 . The oligonucleotide primers used for the amplification of the 18s ribosomal RNA were provided with the kit (Quantum RNA 18S Internal Standards; Ambion Inc., Austin, TX), and the measurement was performed after the manufacturer’s instructions. The primer-competimer ratio used (1:9) was the same for all proteins. Cycle parameters were the same for both primers sets used except for the annealing temperature (see Table 1 ) (denaturation 94°C, 1 minute; annealing, 1 minute; extension 72°C, 1 minute) with a total number of 35 cycles. Band density has been evaluated by the Service d’analyze d’image du CHUL (Centre Hospitalier de l’Université Laval) with image-analysis software (Image; Scion Corp. Frederick, MD). 
Results
HMCL-I and -II were isolated and cultured exactly as performed for normal human Müller cells. As observed for a spontaneous RPE cell line, 20 HMCLs can be passaged a large number of times without senescence. Given that no immortalization treatment was performed, they can be considered spontaneous cell lines. As can be seen in Table 2 , HMCL-I and -II are rapidly growing human cell lines. Indeed, HMCL-I and -II grew respectively 2.4 and 4.7 times more rapidly than did the NHMCs. In addition, more HMCLs were in the G2/M phase compared with NHMCs, which is consistent with the data obtained for the doubling time (Table 2) . Phase-contrast micrographs (Fig. 1)show that the HMCL-I (Figs. 1A 1B)and HCML-II (Figs. 1C 1D)cells displayed a different morphology than did the NHMCs (Fig. 1E) . Indeed, in contrast to the typical fibroblast-like morphology of Müller cells, HMCLs had an epithelial shape. This shape became more visible with the number of passages. Moreover, the karyotype of HMCLs has been determined because cell immortalization is commonly associated with aneuploidy and other chromosomal abnormalities. These analyses allowed us to confirm the human male origin of HMCL-I (Fig. 2A) , displaying XY chromosomes, and the human female origin of HMCL-II (Fig. 2B) , displaying two X chromosomes. Both cell types contain 46 chromosomes, confirming that they are normal diploid cell lines. 
The phenotypic characterization of HMCLs was investigated by immunofluorescence analyses at passages 6 (Fig. 3)and 21 (data not shown) and that of NHMCs at passage 2. These analyses were performed with specific markers of human Müller cells 17 : CRALBP, glutamine synthetase, GLAST-1, and GFAP (Figs. 3A 3B 3C 3D) . As can be seen in Figure 3 , all those markers were expressed by HMCLs and NHMCs. Immunofluorescence analyses performed with two markers of endothelial cells (von Willebrand factor and PECAM) showed that HMCLs and NHMCs did not express those markers (data not shown). Moreover, Figures 3Eshow that HMCLs expressed the marker of epithelial cells (cytokeratins K8/18), whereas NHMCs did not. Therefore, NHMCs expressed all known markers for Müller cells, but did not express markers of endothelial and epithelial cells. HMCLs also expressed all known markers of Müller cells, but also expressed the K8/K18 marker for epithelial cells, which is consistent with their epithelioid shape (Fig. 1) . The expression of these markers remained unchanged for the HMCLs with the increase in number of passages (data not shown). 
The Western blot analyses performed with the HMCL lysates (Fig. 4)using the known markers of Müller cells confirmed the results obtained by immunofluorescence. Indeed, bands were obtained for CRALBP, glutamine synthetase, GFAP, and GLAST-1 at the expected molecular masses of 36, 45, 51, and 67 kDa, respectively. Differences can be observed for the migration pattern of CRALBP and GLAST between HMCL-I and -II which can be explained by the presence of degradation products in the cell lysate (see the low-molecular-weight products), although cocktails of protease inhibitors were used in our experiments. 
Müller glial cells were recently postulated to act as progenitor cells in the retina. 21 22 We thus looked for the expression of markers of progenitor cells (Ki67, nestin, and PAX-6), growth factors (bFGF, EGF, IGF-1, PDGFβ, TGF-α, and VEGF-α), and trophic factors and their receptors (BDNF, TRKβ, and CNTF, and CNTFR-α) in HMCLs and NHMCs by RT-PCR (Fig. 5) . It is noteworthy that an 18S ribosomal cDNA fragment (489 bp) was coamplified as a control for both cDNA synthesis and PCR efficiency, which thus enables semiquantitative analyses. Only positive results were obtained for BDNF, bFGF, CNTF, EGF, IGF-1, PAX-6, TGF-α, and VEGF-α, with both HMCLs and NHMCs, neither CNTFRα, Ki67, nestin, PDGFβ, or ΤRKβ are expressed by HMCLs or NHMCs. In addition, the data showed that bFGF is significantly differentially expressed by HMCLs than in NHMCs, whereas EGF, TGF-α, and VEGF-α were less expressed by HMCLs than by NHMCs (Fig. 5)
Discussion
The present study describes the characterization of two spontaneous human Müller cell lines derived from donors with diabetes. In the course of different molecular studies, 216 retinas have been plated to prepare primary cultures of Müller cells including 56 retinas from donors with type 1 and 2 diabetes and 160 retinas from normal donors. Of the six retinas from donors with type 1 diabetes, one spontaneous cell line (HMCL-I) was generated, whereas the spontaneous cell line from the donor with type 2 diabetes (HMCL-II) was obtained from 50 retinas. Moreover, primary Müller cell cultures prepared from donors with type 1 and 2 diabetes undergo more passages and grow much faster than do Müller cell cultures from normal donors in the same conditions (unpublished data). In addition, all cells from donors with diabetes had an epithelial shape (result not shown). Altogether, these observations suggest that Müller cells of donors with diabetes behave very differently than do Müller cells of normal donors. Chronic diabetes could thus be considered in part to play a role in the development of these cell lines. 
To our knowledge, HMCL-I and -II constitute the first human Müller cell lines from donors with diabetes and the first human Müller cell lines bearing a normal karyotype reported in the literature. Indeed, the human cell line reported until now is aneuploid, exhibiting polysomy. 16 Moreover, HMCL-I and -II are rapidly growing cell lines compared with NHMCs. Indeed, NHMCs are known to grow slowly 13 and to be limited to six to eight passages, whereas both HMCLs have been passaged 30 times until now and are still actively growing. One additional interesting feature is that frozen HMCLs can be successfully cultured after thawing whereas NHMC cannot. The contrasting difference between the epithelial shape of HMCLs and the typical fibroblast-like morphology of NHMC could suggest that HMCLs do not derive from Müller cells. However, the immunofluorescence and Western blot analyses reveal that HCMLs express all known markers of Müller cells that strongly suggests, together with their clustering property, that they are Müller cells. 
There is no compelling evidence until now that Müller cells are the primary sites affected during any retinal disease. However, there are many retinal conditions in which Müller cells appear to play a prominent role. Studies of diabetic retina and animal models of hyperglycemia have revealed changes in Müller cell morphology, protein expression, and physiology well in advance of detectable retinopathy. 1 12 23 24 25 26 There are numerous recent reports that improved our knowledge regarding the biochemical processes underlying diabetic retinopathy (for reviews, see Refs. 8 , 27 , 28 ). Particular attention has been focused on the role of growth factors in the pathogenesis of diabetic retinopathy. In fact, there is now evidence that the development of diabetic retinopathy is a multifactorial process implying growth factors. 29 Histologic studies have demonstrated the presence of growth factors (mainly VEGF, PDGF, 30 and bFGF 31 ) and their receptors and/or their mRNA in preretinal membranes of patients with proliferative diabetic retinopathy. The expression of growth and trophic factors by HMCL-I and -II was thus compared with that in normal Müller cells. Our results indicate the expression of VEGF and bFGF by HMCLs and NHMCs but no expression of PDGF. The RT-PCR results obtained with HMCLs show that a significantly larger expression is obtained with bFGF than in NHMCs. bFGF is a mitogen peptide that has a growth-promoting effect 32 33 and has been shown to stimulate proliferation of retinal Müller cells. 34 35 36 The higher rate of proliferation of HMCLs could thus be correlated with the presence of a stronger expression of bFGF in those cell lines. As observed for both HMCLs when compared with NHMCs, a recent study 37 showed an increase in the expression of bFGF in the glial cells of rat diabetic retina compared with nondiabetic rats. Furthermore, Patel et al., 38 observed that the immunoreactivity for EGF and TGF-α was generally stronger in diabetic retinas than in normal retinas. However, in our experiments, EGF and TGF-α transcripts are both expressed less by HMCLs than by NHMCs. These results are difficult to compare given that Patel et al. 38 made their observations in retina sections, where immunoreactivity was difficult to attribute to individual cells. Moreover, IGF-I is known to increase glucose transport in glial cells, 39 and insulin mRNA expression has been found in cultured Müller cells. 40 We also found that IGF-I is expressed by NHMCs at approximately the same level as in the HMCLs. Previous studies showed that CNTF was present in Müller cells from normal retina, 41 42 43 which is consistent with our observations. Indeed, we found RNA expression of CNTF in both HMCLs and NHMCs. Different immunohistochemical analyses have demonstrated that exogenous BDNF can diffuse throughout the retina 44 and bind to Müller cells 45 which express both BDNF receptors. 46 47 48 In addition, Seki et al., 49 have determined that Müller cells of mammals normally contain BDNF, which is consistent with our results. Indeed, we found RNA expression of BDNF by both HMCLs and NHMCs. 
Our recent data from SAGE (serial analyses of gene expression) demonstrated that only 5% of HMCL-I and 2% of HMCL-II genes are differentially expressed compared with those in NHMCs. The proteins upregulated in HMCLs compared with those increased in NHMCs are from the metabolism–energy category, which correlates well with the higher rate of proliferation of those cell lines. Similar variations have been observed in diabetes for several of these differentially expressed genes (Lupien et al., manuscript in preparation). These data as well as the data reported in Figures 2to 5could suggest that HMCLs do not behave much differently from normal human Müller cells. However, although HCMLs express all typical markers of Müller cells and bear a normal karyotype, their phenotype is different from that of NHMCs. Moreover, the same epithelial-like phenotype has been obtained for both HCMLs which have been isolated from donors with diabetes, and an epithelial-like phenotype has also been obtained for all other primary Müller cell cultures from donors with type 1 and 2 diabetes (other than the present HMCLs). In addition, the epithelial phenotype was present in all cells at the very beginning of the culture of HCMLs, as well as when passaged. These experimental observations argue that HMCLs are Müller cells whose phenotype has been modified, in part as a result of chronic diabetes (and not as a result of immortalization). In conclusion, HMCLs may thus represent very attractive, useful models for improving our understanding of diabetes. 
 
Table 1.
 
Primer Sequences Used for Semiquantitative RT-PCR Analyses
Table 1.
 
Primer Sequences Used for Semiquantitative RT-PCR Analyses
Name 5′ Primer Sequences Annealing Temperature (°C) cDNA Size (bp)
BDNF ATGACCATCCTTTTCCTTACTATGGT (forward) 60 741
TCTTCCCCTTTTAATGGTCAATGTAC (reverse)
bFGF AGCGGCTGTACTGCAAGAAC (forward) 60 293
CAGTGCCACATACCAACTGG (reverse)
CNTF TGGCTAGCAAGGAAGATTCGT (forward) 60 891
TGTAAGGCAGTTAAATGCCTG (reverse)
CNTFR-α CACCAAAGACCCCTCTCATC (forward) 60 245
GCAAAGGTGGAAGGACTGAA (reverse)
EGF TGACTCTGAATGTCCCCTGTC (forward) 60 150
AGTTCCCACCACTTCAGGTCT (reverse)
IGF-1 ATGTCCTCCTCGCATCTCTTC (forward) 60 337
CCTGTAGTTCTTGTTTCCTGC (reverse)
Ki67 CAAAAATCACTGAAGGAAAAG (forward) 60 455
GGAATCACCAAAGTTGTTGA (reverse)
Nestin GGCAGCGTTGGAACAGAGGTTGGA (forward) 68 718
CTCTAAACTGGAGTGGTCAGGGCT (reverse)
PAX-6 CCAGCCAGAGCCAGCATGCAGAACA (forward) 65 950
GGTTGGTAGACACTGGTGCTGAAACT (reverse)
PDGFβ AAGCACACGCATGACAAG (forward) 58 124
GGGGCAATACAGCAAATAC (reverse)
TGF-α TGGACAGCTCGCCCTGTT (forward) 60 805
ATGGCTGGCAGAAGACAACT (reverse)
TRKβ GTGATGGGACTTGTGCCTTT (forward) 60 155
ACCTGCCCTAGGCTGCTT (reverse)
VEGF-α CGAAACCATGAACTTTCTGC (forward) 65 302
CCTCAGTGGGCACACACTCC (reverse)
Table 2.
 
Doubling Time and BrdU Analyses
Table 2.
 
Doubling Time and BrdU Analyses
Name Doubling Time (h) BrdU + Cell Population
G0/G1 S-phase G2/M
NHMC 185 92.65 2.42 4.83
HMCL-I 76 74.67 6.65 17.61
HMCL-II 39 69.16 6.82 23.49
Figure 1.
 
Characterization of HMCL. Phase-contrast micrographs of human Müller cell lines (HMCL-I and -II) at passages 2 (A, C), 11 (B), and 17 (D) and NHMCs at passage 2 (E) with a 10× objective. Scale bar, 85 μm.
Figure 1.
 
Characterization of HMCL. Phase-contrast micrographs of human Müller cell lines (HMCL-I and -II) at passages 2 (A, C), 11 (B), and 17 (D) and NHMCs at passage 2 (E) with a 10× objective. Scale bar, 85 μm.
Figure 2.
 
Karyotype of the HMCL. Karyotype of (A) HMCL-I from a 33-year-old male donor with diabetes and (B) HMCL-II from a 69-year-old female donor with diabetes.
Figure 2.
 
Karyotype of the HMCL. Karyotype of (A) HMCL-I from a 33-year-old male donor with diabetes and (B) HMCL-II from a 69-year-old female donor with diabetes.
Figure 3.
 
Immunofluorescence analyses of HMCLs and NHMC. Expression of specific markers of Müller cells (A) CRALBP, (B) GS, (C) GLAST and (D) GFAP by HMCLs and NHMCs and a marker for epithelial cells (E) cytokeratins K8/K18 by HMCLs.
Figure 3.
 
Immunofluorescence analyses of HMCLs and NHMC. Expression of specific markers of Müller cells (A) CRALBP, (B) GS, (C) GLAST and (D) GFAP by HMCLs and NHMCs and a marker for epithelial cells (E) cytokeratins K8/K18 by HMCLs.
Figure 4.
 
Western blot analyses. Bands at 36, 45, and 51 kDa are observed for CRALBP, GS, and GFAP, respectively for both HMCL-I and -II. Several bands were observed for GLAST with a more dominant one at 67 kDa in HMCL-I, whereas only the 67-kDa band was observed for HMCL-II.
Figure 4.
 
Western blot analyses. Bands at 36, 45, and 51 kDa are observed for CRALBP, GS, and GFAP, respectively for both HMCL-I and -II. Several bands were observed for GLAST with a more dominant one at 67 kDa in HMCL-I, whereas only the 67-kDa band was observed for HMCL-II.
Figure 5.
 
Semiquantitative RT-PCR analyses. RT-PCRs were performed with RNA from NHMC (second well), HMCL-II (third well) and HMCL-I (fourth well). The expression of (A) BDNF, (B) bFGF, (C) CNTF, (D) EGF, (E) IGF-1, (F) PAX-6, (G) TGF-α, and (H) VEGF-α were measured at the RNA level. An 18S ribosomal cDNA fragment was coamplified as a control for both cDNAs synthesis and PCR efficiency. The positions of both cDNAs of relevant markers and 18S (489 bp) fragments are indicated. Bottom panels: band density was calculated by image-analysis software. The intensity of each PCR band was divided by the length of the corresponding PCR product and normalized with the intensity of the corresponding 18S RNA band. Ratio was calculated by using the NHMC value as the basal level (ratios were rounded off to hundredths).
Figure 5.
 
Semiquantitative RT-PCR analyses. RT-PCRs were performed with RNA from NHMC (second well), HMCL-II (third well) and HMCL-I (fourth well). The expression of (A) BDNF, (B) bFGF, (C) CNTF, (D) EGF, (E) IGF-1, (F) PAX-6, (G) TGF-α, and (H) VEGF-α were measured at the RNA level. An 18S ribosomal cDNA fragment was coamplified as a control for both cDNAs synthesis and PCR efficiency. The positions of both cDNAs of relevant markers and 18S (489 bp) fragments are indicated. Bottom panels: band density was calculated by image-analysis software. The intensity of each PCR band was divided by the length of the corresponding PCR product and normalized with the intensity of the corresponding 18S RNA band. Ratio was calculated by using the NHMC value as the basal level (ratios were rounded off to hundredths).
The authors thank John Saari (University of Washington School of Medicine, Seattle, WA) for the generous gift of anti-CRALBP; Jean Gekas and Stéphanie Côté (Laboratoire de cytogénétique du CHUL) for the karyotype determination; Claudia Fugère (Laboratoire d’organogénèse expérimentale, Hôpital du St-Sacrement) for the BrdU measurements; and the Banque d’Yeux Nationale, Inc. for providing us with human eyes. 
MizutaniM, GerhardingerC, LorenziM. Muller cell changes in human diabetic retinopathy. Diabetes. 1998;47:445–449. [CrossRef] [PubMed]
NewmanE, ReichenbachA. The Müller cell: a functional element of the retina. Trends Neurosci. 1996;19:307–312. [CrossRef] [PubMed]
HollanderH, MakarovF, DreherZ, et al. Structure of the macroglia of the retina: sharing and division of labour between astrocytes and Müller cells. J Comp Neurol. 1991;313:587–603. [CrossRef] [PubMed]
WardMM, JoblingAI, PuthusseryT, FosterLE, FletcherEL. Localization and expression of the glutamate transporter, excitatory amino acid transporter 4, within astrocytes of the rat retina. Cell Tissue Res. 2004;315:305–310. [CrossRef] [PubMed]
LinserP, MosconaAA. Induction of glutamine synthetase in embryonic neural retina: localization in Müller fibers and dependence on cell interactions. Proc Natl Acad Sci USA. 1979;76:6476–6480. [CrossRef] [PubMed]
LewisGP, EricksonPA, KaskaDD, FisherSK. An immunocytochemical comparison of Müller cells and astrocytes in the cat retina. Exp Eye Res. 1988;47:839–853. [CrossRef] [PubMed]
Poitry-YamateCL, PoitryS, TsacopoulosM. Lactate released by Müller glial cells is metabolized by photoreceptors from mammalian retina. J Neurosci. 1995;15:5179–5191. [PubMed]
LorenziM, GerhardingenC. Early cellular and molecular changes induced by diabetes in the retina. Diabetologica. 2001;44:791–804. [CrossRef]
SmithSB. Diabetic retinopathy and the NMDA receptor. Drug News Perspect. 2002;15:226–232. [CrossRef] [PubMed]
GardnerTW, AntonettiDA, BarberAJ, LaNoueKF, LevisonSW. Diabetic retinopathy: more than meets the eye. Surv Ophthalmol. 2002;47(suppl 2)S253–S262. [CrossRef] [PubMed]
AizuY, OyanagiK, HuJ, NakagawaH. Degeneration of retinal neuronal processes and pigment epithelium in the early stage of the streptozotocin-diabetic rats. Neuropathology. 2002;22:161–170. [CrossRef] [PubMed]
LiethE, BarberAJ, XuB, et al. Glial reactivity and impaired glutamate metabolism in short-term experimental diabetic retinopathy. Penn State Retina Research Group. Diabetes. 1998;47:815–820. [CrossRef] [PubMed]
SarthyVP, BrodjianSJ, DuttK, et al. Establishment and characterization of a retinal Müller cell line. Invest Ophthalmol Vis Sci. 1998;39:212–216. [PubMed]
RoqueRS, AgarwalN, WordingerRJ, et al. Human papillomavirus-16 E6/E7 transfected retinal cell line expresses the Müller cell phenotype. Exp Eye Res. 1997;64:519–527. [CrossRef] [PubMed]
TomiM, FunakiT, AbukawaH, et al. Expression and regulation of L-cystine transporter, system xc-, in the newly developed rat retinal Müller cell line (TR-MUL). Glia. 2003;43:208–217. [CrossRef] [PubMed]
LimbGA, SaltTE, MunroPM, MossSE, KhawPT. In vitro characterization of a spontaneously immortalized human Müller cell line (MIO-M1). Invest Ophthalmol Vis Sci. 2002;43:864–869. [PubMed]
LupienC, BrennerM, GuerinSL, SalesseC. Expression of glial fibrillary acidic protein in primary cultures of human Müller cells. Exp Eye Res. 2004;79:423–429. [CrossRef] [PubMed]
CristofaloVJ, CharpentierR, PhillipsPD. Serial propagation of human fibroblast.CelisJE eds. Cell Biology: A Laboratory Handbook. 1998;321–326.Academic Press San Diego.
ProulxS, GuerinSL, SalesseC. Effect of quiescence on integrin alpha5beta1 expression in human retinal pigment epithelium. Mol Vis. 2003;9:473–481. [PubMed]
DunnKC, Aotaki-KeenAE, PutkeyFR, HjelmelandLM. ARPE-19, a human retinal pigment epithelial cell line with differentiated properties. Exp Eye Res. 1996;62:155–169. [CrossRef] [PubMed]
FischerAJ, RehTA. Potential of Müller glia to become neurogenic retinal progenitor cells. Glia. 2003;43:70–76. [CrossRef] [PubMed]
LayerPG, RothermelA, WillboldE. From stem cells towards neural layers: a lesson from re-aggregated embryonic retinal cells. Neuroreport. 2001;12:A39–A46. [CrossRef] [PubMed]
CaldwellRB, BartoliM, BehzadianMA, et al. Vascular endothelial growth factor and diabetic retinopathy: pathophysiological mechanisms and treatment perspectives. Diabetes Metab Res Rev. 2003;19:442–455. [CrossRef] [PubMed]
HolopigianK, SeipleW, LorenzoM, CarrR. A comparison of photopic and scotopic electroretinographic changes in early diabetic retinopathy. Invest Ophthalmol Vis Sci. 1992;33:2773–2780. [PubMed]
AminRH, FrankRN, KennedyA, et al. Vascular endothelial growth factor is present in glial cells of the retina and optic nerve of human subjects with nonproliferative diabetic retinopathy. Invest Ophthalmol Vis Sci. 1997;38:36–47. [PubMed]
TzekovR, ArdenGB. The electroretinogram in diabetic retinopathy. Surv Ophthalmol. 1999;44:53–60. [CrossRef] [PubMed]
FrankRN. Diabetic retinopathy. N Engl J Med. 2004;350:48–58. [CrossRef] [PubMed]
AielloLP, CahillMT, CavalleranoJD. Growth factors and protein kinase C inhibitors as novel therapies for the medical management diabetic retinopathy. Eye. 2004;18:117–125. [CrossRef] [PubMed]
GargiuloP, GiustiC, PietrobonoD, et al. Diabetes mellitus and retinopathy. Digest Liver Dis. 2004;36(suppl 1)S101–S105. [CrossRef]
ChenYS, HackettSF, SchoenfeldCL, VinoresMA, VinoresSA, CampochiaroPA. Localisation of vascular endothelial growth factor and its receptors to cells of vascular and avascular epiretinal membranes. Br J Ophthalmol. 1997;81:919–926. [CrossRef] [PubMed]
FrankRN, AminRH, EliottD, PuklinJE, AbramsGW. Basic fibroblast growth factor and vascular endothelial growth factor are present in epiretinal and choroidal neovascular membranes. Am J Ophthalmol. 1996;122:393–403. [CrossRef] [PubMed]
WagnerJA. The fibroblast growth factors: an emerging family of neural growth factors. Curr Top Microbiol Immunol. 1991;165:95–118. [PubMed]
BairdA. Fibroblast growth factors: activities and significance of non-neurotrophin neurotrophic growth factors. Curr Opin Neurobiol. 1994;4:78–86. [CrossRef] [PubMed]
HicksD, CourtoisY. The growth and behaviour of rat retinal Müller cells in vitro. 1. An improved method for isolation and culture. Exp Eye Res. 1990;51:119–129. [CrossRef] [PubMed]
IkedaT, WaldbilligRJ, PuroDG. Truncation of IGF-I yields two mitogens for retinal Müller glial cells. Brain Res. 1995;686:87–92. [CrossRef] [PubMed]
LeeWH, JavedanS, BondyCA. Coordinate expression of insulin-like growth factor system components by neurons and neuroglia during retinal and cerebellar development. J Neurosci. 1992;12:4737–4744. [PubMed]
LaytonCJ, BeckerC, OsborneNN. The effect of insulin in glucose levels on retinal glial cell activation and pigment epithelium-derived fibroblast growth factor-2. Mol Vis. 2006;18:43–54.
PatelB, HiscottP, CharterisD, et al. Retinal and preretinal localisation of epidermal growth factor, transforming growth factor alpha, and their receptor in proliferative diabetic retinopathy. Br J Ophthalmol. 1994;78:714–718. [CrossRef] [PubMed]
WernerH, RaizadaMK, MuddLM, et al. Regulation of rat brain/HepG2 glucose transporter gene expression by insulin and insulin-like growth factor-I in primary cultures of neuronal and glial cells. Endocrinology. 1989;125:314–320. [CrossRef] [PubMed]
DasA, PanskyB, BuddGC. Demonstration of insulin-specific mRNA in cultured rat retinal glial cells. Invest Ophthalmol Vis Sci. 1987;28:1800–1810. [PubMed]
SarupV, PatilK, SharmaSC. Ciliary neurotrophic factor and its receptors are differentially expressed in the optic nerve transected adult rat retina. Brain Res. 2004;1013:152–158. [CrossRef] [PubMed]
JuWK, LeeMY, HofmannHD, KirschM, ChunMH. Expression of CNTF in Müller cells of the rat retina after pressure-induced ischemia. Neuroreport. 1999;10:419–422. [CrossRef] [PubMed]
WalshN, ValterK, StoneJ. Cellular and subcellular patterns of expression of bFGF and CNTF in the normal and light stressed adult rat retina. Exp Eye Res. 2001;72:495–501. [CrossRef] [PubMed]
IkedaK, TaniharaH, HondaY, et al. BDNF attenuates retinal cell death caused by chemically induced hypoxia in rats. Invest Ophthalmol Vis Sci. 1999;40:2130–2140. [PubMed]
HerzogKH, von BartheldCS. Contributions of the optic tectum and the retina as sources of brain-derived neurotrophic factor for retinal ganglion cells in the chick embryo. J Neurosci. 1998;18:2891–2906. [PubMed]
HaradaT, HaradaC, NakayamaN, et al. Modification of glial-neuronal cell interactions prevents photoreceptor apoptosis during light-induced retinal degeneration. Neuron. 2000;26:533–541. [CrossRef] [PubMed]
RohrerB, KorenbrotJI, LaVailMM, ReichardtLF, XuB. Role of neurotrophin receptor TrkB in the maturation of rod photoreceptors and establishment of synaptic transmission to the inner retina. J Neurosci. 1999;19:8919–8930. [PubMed]
DingJ, HuB, TangLS, YipHK. Study of the role of the low-affinity neurotrophin receptor p75 in naturally occurring cell death during development of the rat retina. Dev Neurosci. 2001;23:390–398. [CrossRef] [PubMed]
SekiM, NawaH, FukuchiT, AbeH, TakeiN. BDNF is upregulated by postnatal development and visual experience: quantitative and immunohistochemical analyses of BDNF in the rat retina. Invest Ophthalmol Vis Sci. 2003;44:3211–3218. [CrossRef] [PubMed]
Figure 1.
 
Characterization of HMCL. Phase-contrast micrographs of human Müller cell lines (HMCL-I and -II) at passages 2 (A, C), 11 (B), and 17 (D) and NHMCs at passage 2 (E) with a 10× objective. Scale bar, 85 μm.
Figure 1.
 
Characterization of HMCL. Phase-contrast micrographs of human Müller cell lines (HMCL-I and -II) at passages 2 (A, C), 11 (B), and 17 (D) and NHMCs at passage 2 (E) with a 10× objective. Scale bar, 85 μm.
Figure 2.
 
Karyotype of the HMCL. Karyotype of (A) HMCL-I from a 33-year-old male donor with diabetes and (B) HMCL-II from a 69-year-old female donor with diabetes.
Figure 2.
 
Karyotype of the HMCL. Karyotype of (A) HMCL-I from a 33-year-old male donor with diabetes and (B) HMCL-II from a 69-year-old female donor with diabetes.
Figure 3.
 
Immunofluorescence analyses of HMCLs and NHMC. Expression of specific markers of Müller cells (A) CRALBP, (B) GS, (C) GLAST and (D) GFAP by HMCLs and NHMCs and a marker for epithelial cells (E) cytokeratins K8/K18 by HMCLs.
Figure 3.
 
Immunofluorescence analyses of HMCLs and NHMC. Expression of specific markers of Müller cells (A) CRALBP, (B) GS, (C) GLAST and (D) GFAP by HMCLs and NHMCs and a marker for epithelial cells (E) cytokeratins K8/K18 by HMCLs.
Figure 4.
 
Western blot analyses. Bands at 36, 45, and 51 kDa are observed for CRALBP, GS, and GFAP, respectively for both HMCL-I and -II. Several bands were observed for GLAST with a more dominant one at 67 kDa in HMCL-I, whereas only the 67-kDa band was observed for HMCL-II.
Figure 4.
 
Western blot analyses. Bands at 36, 45, and 51 kDa are observed for CRALBP, GS, and GFAP, respectively for both HMCL-I and -II. Several bands were observed for GLAST with a more dominant one at 67 kDa in HMCL-I, whereas only the 67-kDa band was observed for HMCL-II.
Figure 5.
 
Semiquantitative RT-PCR analyses. RT-PCRs were performed with RNA from NHMC (second well), HMCL-II (third well) and HMCL-I (fourth well). The expression of (A) BDNF, (B) bFGF, (C) CNTF, (D) EGF, (E) IGF-1, (F) PAX-6, (G) TGF-α, and (H) VEGF-α were measured at the RNA level. An 18S ribosomal cDNA fragment was coamplified as a control for both cDNAs synthesis and PCR efficiency. The positions of both cDNAs of relevant markers and 18S (489 bp) fragments are indicated. Bottom panels: band density was calculated by image-analysis software. The intensity of each PCR band was divided by the length of the corresponding PCR product and normalized with the intensity of the corresponding 18S RNA band. Ratio was calculated by using the NHMC value as the basal level (ratios were rounded off to hundredths).
Figure 5.
 
Semiquantitative RT-PCR analyses. RT-PCRs were performed with RNA from NHMC (second well), HMCL-II (third well) and HMCL-I (fourth well). The expression of (A) BDNF, (B) bFGF, (C) CNTF, (D) EGF, (E) IGF-1, (F) PAX-6, (G) TGF-α, and (H) VEGF-α were measured at the RNA level. An 18S ribosomal cDNA fragment was coamplified as a control for both cDNAs synthesis and PCR efficiency. The positions of both cDNAs of relevant markers and 18S (489 bp) fragments are indicated. Bottom panels: band density was calculated by image-analysis software. The intensity of each PCR band was divided by the length of the corresponding PCR product and normalized with the intensity of the corresponding 18S RNA band. Ratio was calculated by using the NHMC value as the basal level (ratios were rounded off to hundredths).
Table 1.
 
Primer Sequences Used for Semiquantitative RT-PCR Analyses
Table 1.
 
Primer Sequences Used for Semiquantitative RT-PCR Analyses
Name 5′ Primer Sequences Annealing Temperature (°C) cDNA Size (bp)
BDNF ATGACCATCCTTTTCCTTACTATGGT (forward) 60 741
TCTTCCCCTTTTAATGGTCAATGTAC (reverse)
bFGF AGCGGCTGTACTGCAAGAAC (forward) 60 293
CAGTGCCACATACCAACTGG (reverse)
CNTF TGGCTAGCAAGGAAGATTCGT (forward) 60 891
TGTAAGGCAGTTAAATGCCTG (reverse)
CNTFR-α CACCAAAGACCCCTCTCATC (forward) 60 245
GCAAAGGTGGAAGGACTGAA (reverse)
EGF TGACTCTGAATGTCCCCTGTC (forward) 60 150
AGTTCCCACCACTTCAGGTCT (reverse)
IGF-1 ATGTCCTCCTCGCATCTCTTC (forward) 60 337
CCTGTAGTTCTTGTTTCCTGC (reverse)
Ki67 CAAAAATCACTGAAGGAAAAG (forward) 60 455
GGAATCACCAAAGTTGTTGA (reverse)
Nestin GGCAGCGTTGGAACAGAGGTTGGA (forward) 68 718
CTCTAAACTGGAGTGGTCAGGGCT (reverse)
PAX-6 CCAGCCAGAGCCAGCATGCAGAACA (forward) 65 950
GGTTGGTAGACACTGGTGCTGAAACT (reverse)
PDGFβ AAGCACACGCATGACAAG (forward) 58 124
GGGGCAATACAGCAAATAC (reverse)
TGF-α TGGACAGCTCGCCCTGTT (forward) 60 805
ATGGCTGGCAGAAGACAACT (reverse)
TRKβ GTGATGGGACTTGTGCCTTT (forward) 60 155
ACCTGCCCTAGGCTGCTT (reverse)
VEGF-α CGAAACCATGAACTTTCTGC (forward) 65 302
CCTCAGTGGGCACACACTCC (reverse)
Table 2.
 
Doubling Time and BrdU Analyses
Table 2.
 
Doubling Time and BrdU Analyses
Name Doubling Time (h) BrdU + Cell Population
G0/G1 S-phase G2/M
NHMC 185 92.65 2.42 4.83
HMCL-I 76 74.67 6.65 17.61
HMCL-II 39 69.16 6.82 23.49
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×