May 2006
Volume 47, Issue 5
Free
Biochemistry and Molecular Biology  |   May 2006
Differential Gene Expression in Mouse Sclera during Ocular Development
Author Affiliations
  • Jie Zhou
    From the Divisions of Ophthalmology and Genetics, Children’s Hospital of Philadelphia,
  • Eric F. Rappaport
    Children’s Hospital of Philadelphia Nucleic Acid and Protein Core, and the
  • John W. Tobias
    University of Pennsylvania Bioinformatics Core, University of Pennsylvania, Philadelphia, Pennsylvania.
  • Terri L. Young
    From the Divisions of Ophthalmology and Genetics, Children’s Hospital of Philadelphia,
Investigative Ophthalmology & Visual Science May 2006, Vol.47, 1794-1802. doi:10.1167/iovs.05-0759
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to Subscribers Only
      Sign In or Create an Account ×
    • Get Citation

      Jie Zhou, Eric F. Rappaport, John W. Tobias, Terri L. Young; Differential Gene Expression in Mouse Sclera during Ocular Development. Invest. Ophthalmol. Vis. Sci. 2006;47(5):1794-1802. doi: 10.1167/iovs.05-0759.

      Download citation file:


      © 2016 Association for Research in Vision and Ophthalmology.

      ×
  • Supplements
Abstract

purpose. Ocular development involves changes in extracellular matrix components of the scleral wall as it expands. This study was conducted to determine scleral gene expression profiles during mouse ocular development to identify genes involved in normal scleral growth.

methods. Sample sets of pooled sclerae of 3- and 8-week-old mice were microdissected, and total RNA was isolated. After reverse transcription, the cDNA was in vitro transcribed to produce biotin-labeled cRNA. The purified biotin-labeled cRNA samples were hybridized to microarray chips (GeneChip Mouse Genome 430 2.0; Affymetrix, Santa Clara, CA). Gene transcript expression profiles were determined, and eight differentially expressed genes between the two age groups underwent further confirmation by real-time PCR analysis.

results. Differential regulation of 4884 gene transcripts in mouse sclera with less than 5% false-discovery rate (FDR) was identified. The top 1000 with the lowest FDR among the 4884 probe sets were filtered for threefold changes between the two age groups, and 718 gene transcripts were identified. Among these 718 gene transcripts, 210 were upregulated and 508 downregulated in adult relative to juvenile mouse sclera. TGF-β1 and several collagen genes were significantly downregulated. Microarray differential expression by real-time PCR validation of eight extracellular matrix–associated gene transcripts was confirmed.

conclusions. This is the first study to demonstrate gene expression profiles in mouse sclera during ocular growth. These findings support the role of TGFβ1 as a signaling molecule in modulating extracellular matrix during ocular development. This endeavor may be helpful in furthering understanding of how scleral remodeling is regulated during eye growth.

The ocular refractive components undergo precisely coordinated physical alterations during ocular growth, to attain and maintain normal emmetropic visual acuity, so that the image focus falls on the retinal plane. 1 Any discordance between the axial length and other optical refractive components, such as corneal and lenticular curvatures would result in ametropia and blurred visual acuity, in which the focus of the image falls either in front of (myopia) or behind (hyperopia) the retina. It is thought that biological visual cues guide ocular growth, and determinants have been actively studied in experimental myopia in various animal species. 1 2 3 4 5 6 The models invariably alter the axial length of the eye with noted changes in scleral wall physiology. To date, the molecular events that synchronize the changes remain unclear. 
The sclera plays a key role in maintaining the axial length and the vitreous depth, a major factor contributing to the progression of myopia. 7 Studies of progressed human myopia have found significant reduction in collagen contents with corresponding reduced scleral thickness. 8 9 10 11 Compared with normal sclera, highly myopic eyes have smaller collagen fibril diameters with an altered lamellar interwoven fibril bundle arrangement, 10 suggesting potential changes in collagen components. 
Changes in scleral collagen fibrils were examined in animal models of induced myopia, where reduced scleral thickness has been observed. 12 13 14 15 16 In the tree shrew, regulation of collagen content occurs at both the mRNA and protein levels. There is noted significant reduction in the expression of type I collagen, whereas the expression of type III and V collagens remains relatively steady. 17 Increased degradation of collagen fibrils and the extracellular matrix (ECM) also occur during scleral remodeling. 18 19 20  
The molecular mechanisms of scleral remodeling remain to be elucidated. Several signaling molecules have been examined for their roles in influencing scleral enlargement. 15 21 22 23 24 25 26 The family of multifunctional transforming growth factors (TGFs) regulate cellular processes, including ECM structure. 27 Increased TGF-β levels result in increased collagen gene expression and protein synthesis in fibroblast cells. 21 Reduced TGF-β expression has been observed in the sclera of experimentally induced myopic animals, suggesting an important role in regulating scleral remodeling during the development of myopia. 21 Other genes and pathways, such as paired box gene 6 (PAX6), 28 29 members of the Notch signaling pathway, 30 31 sonic hedgehog (shh) signaling molecules, 32 and bone morphogenetic proteins (BMPs), 33 may also play a role in scleral remodeling. 
We hypothesize that gene signaling during scleral expansion and remodeling during myopic development may have similarities to scleral enlargement signals noted during normal ocular growth toward emmetropia. Both processes may use common pathways to achieve increases in scleral surface area and eye size. To work toward testing this hypothesis and to identify genes and pathways responsible for scleral expansion during ocular development, we performed gene expression profiling using mouse sclera at two stages of development. It has been shown that eyes of mice that undergo visual form deprivation have significant myopia due to an increase in the axial length, 34 35 thus resembling other well-characterized mammalian and nonmammalian models of induced myopia. 12 13 14 15 16 This information may be useful for further studies of mouse sclera, especially in induced-myopia experiments. 
Methods
Animals
This study protocol was approved by the Institutional Animal Care and Use Committee of the Children’s Hospital of Philadelphia and was in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. Eighteen each of C57BL/6J mice at 3- and 8- weeks of age were killed. Mouse eyes were microdissected to obtain sclera. Mouse sclera is a fibrous tissue containing small amounts of RNA. To obtain a sufficient amount for conducting oligonucleotide microarray analysis, sclerae from six mice in the same age group were pooled. Three independent pooled replicates from each age group were processed in parallel for all experimental procedures. 
RNA Extraction and cDNA Microarray
Scleral RNA was isolated (TRIzol) according to the manufacturer’s instructions (Invitrogen, Carlsbad, CA). RNA yields were assessed by absorbance at 260 nm, and the quality was confirmed (model 2100 bioanalyzer; Agilent Technologies, Inc., Palo Alto, CA). After reverse transcription of total RNA (Superscript II cDNA synthesis kit; Invitrogen), the cDNA was in vitro transcribed to produce biotin-labeled cRNA (Enzo Life Sciences, Inc, Farmingdale, NY). The purified biotin-labeled cRNA was fragmented into 50- to 200-bp products and hybridized to a gene microarray (GeneChip Mouse Genome 430 2.0 Array chips; Affymetrix, Inc., Santa Clara, CA) at 45°C for 16 hours. Posthybridization wash and streptavidin-phycoerythrin staining protocols were performed (Fluidics Station 450; Affymetrix, Inc.), and the microarray chips were scanned (GeneChip Scanner 3000; Affymetrix, Inc.). Six array chips (six pairs of mouse eyes per chip), representing three independent and pooled replicates for each age group were used in the study. 
Data Analysis
Data collection and probe level intensity analysis were performed (GeneChip Operating Software version 1.2; Affymetrix, Inc.). Probe intensities were normalized, and expression signals of all genes (probe sets) were calculated using GCRMA (GC robust multiarray analysis, as implemented in GeneSpring ver. 7.1; Silicon Genetics, Redwood City, CA). Principal components analysis (PCA) was used to assess variability of all samples. Data from one 3-week-old mouse array chip (chip no. 3) showed large variation and was excluded from further array statistical analysis. Although it was not included in the analysis, data from that chip showed a similar trend of gene expression relative to the two other 3-week-old mouse array chips. We are unable to repeat the experiment with an additional chip. 
GCRMA expression levels were recalculated from the five remaining chips (two from 3-week-old and three from 8-week-old mice), and differentially expressed genes were found using the local pooled error (LPE) statistical test (S+ ArrayAnalyzer ver. 2; Insightful Corp., Seattle, WA). The resampling technique was used to control the false-discovery rate (FDR). The LPE test is effective in identifying differentially expressed genes in experiments with limited numbers of replicates. 36 Analysis of 45,038 probe sets of the Mouse Genome 430 2.0 Array chip using LPE testing with default parameters identified 4884 probe sets with an FDR of less than 5%. Among the 4884 probe sets, the top 1000 (as ranked by statistical significance) with an FDR of less than 5% were further filtered for changes. Differentially expressed gene transcripts at more than threefold were used to generate relevant interaction networks using Ingenuity Pathways Analysis (IPA; www.ingenuity.com/ Ingenuity Systems, Redwood City, CA). This is a Web-based application that enables the discovery, visualization, and exploration of interaction networks significant to cDNA microarray data sets. A data set containing gene identifiers and corresponding multiples of change (x-fold) in expression were uploaded as a tab-delimited text file. Each gene identifier was mapped to its corresponding gene object in the Ingenuity Pathways Knowledge Base (IPKB; Ingenuity Systems). A change cutoff of 3-fold was set to identify genes with expression that was significantly differentially regulated. These genes, called “focus genes,” were then used as the starting point for generating biological networks. A group of extracellular matrix gene–gene interactions in mouse sclera during ocular growth was identified. 
Real-Time PCR
Eight genes that showed significant differential expression profiles with cDNA microarray analysis were confirmed for expression by real-time PCR analysis (SYBR Green PCR Master Mix; Applied Biosystems [ABI], Foster City, CA). Primers were designed on computer (Primer Express software; ABI) to amplify 60- to 150-bp cDNA fragments across intron–exon boundaries (Table 1) . The mouse β-actin gene was used as an internal control based on its constant level of expression across different age groups in the present cDNA microarray analysis. Standard curves were generated for each gene. The dye (SYBR Green I; ABI) binds to the minor groove of double-stranded (ds)DNA; thus, the fluorescent quantification could contain signals from self-complementary primer–dimer pairs. To determine the specificity of DNA quantification, a melting curve was generated for each gene. 
The same scleral RNA from both pooled samples used for microarray analysis (18 each at 3- and 8- weeks of age including the 3-week-old mouse subset sample with large variations), and samples isolated from one 3- and one 8-week-old mouse were used for real-time PCR analysis. After reverse transcription of total RNA (Superscript II cDNA synthesis kit; Invitrogen), the cDNA was in vitro transcribed to produce cRNA (Epicenter, Madison, WI). The cRNA was then used as a template for the second cycle of cDNA synthesis. Real-time PCR was performed using 0.5 μL of cDNA in a 10-μL reaction for 40 cycles under the following conditions: 60°C for 1 minute, 95°C for 15 seconds and 300 nM of each primer. All experiments were performed in triplicate (model 7900HT Sequence Detection System; ABI). 
Results
The cDNA Microarray Analysis of Expressed Genes
A mouse whole-genome expression array containing representations of more than 39,000 gene transcripts (45,038 probe sets) was used in the study. Three independent pooled replicates for each age group of 3- and 8 week-old mice were prepared and hybridized to six microarray chips (GeneChip Mouse Genome 430 2.0 Array; Affymetrix). The percentage of gene transcripts detected as present on array chips ranged from 46% to 52%. Analysis of the 45,038 probe sets identified 4884 transcripts with a significant FDR of less than 5% (P < 0.05). The top 1000 transcripts with the lowest FDR among the 4884 probe sets were filtered for threefold changes between different age groups, and 718 were retained (Fig. 1) . Among these 718 gene transcripts, 210 were upregulated and 508 were downregulated in adult relative to juvenile mouse sclera. The top 40 up- and downregulated (ranked by fold-change) gene transcripts are listed in Tables 2 and 3 , respectively. 
Hierarchical clustering of gene expression data from each of the 3- and 8-week-old mouse sclera chips showed a higher degree of similarity within each age group than between different groups (Fig. 2) . The biological replicates for each age group were clearly clustered together. 
The 718 gene transcripts represent 10 functional categories based on literature review and the use of the Entrez Gene database (http://www.ncbi.nlm.nih.gov/entrez; provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD). The functional categories listed include cell adhesion (2.5%), extracellular matrix (11.6%), cytoskeleton (5.4%), signal transduction (17.8%), organogenesis (9.4%), apoptosis (1.2%), transcription (9.2%), transporter (8.6%), metabolism (9.2%), and EST (expressed sequence tag; 26.8%). 
Validation of Gene Expression with Real-Time PCR
Eight genes displaying a high ratio of differential expression in microarray analysis or functionally related to extracellular matrix composition were chosen for further validation by real-time PCR analysis. Four upregulated and four downregulated in adult relative to juvenile mouse sclera were selected. Upregulated genes included kinesin family member 5A (KIF5A), extracellular proteinase inhibitor (EXPI), vitronectin (VTN), and neurogenic differentiation 1 (NEUROD1). The downregulated genes included procollagen Vα1 (COL5A1), procollagen type XIα2 (COL11A2), elastin (ELN), and transforming growth factor β1 (TGFB1). Their differential expression profiles were verified by quantitative real-time PCR (SYBR Green; ABI) using total RNA from both pooled samples, the same sample used for microarray analysis, and samples isolated from one 3- and one 8-week-old mouse sclera. A melting curve was generated for each gene, and a single specific PCR product melted at the expected temperature was confirmed for all eight genes. The housekeeping gene β-actin was used as an internal control to normalize gene expression quantity, as its expression remained constant between different age groups based on our cDNA microarray analysis. 
As shown in Figure 3 , the real-time PCR results confirmed the microarray data, and the up- and downregulated genes in microarray experiments showed corresponding increased or decreased expressions with real-time PCR analysis. However, the multiples of change (x-fold) determined by the two techniques varied. For example, for collagens 5A1 and 11A2, microarray analysis showed downregulation of 12- and 10-fold after normalization by the housekeeping gene β-actin, respectively. The real-time PCR analysis showed only six- and sevenfold changes, respectively. 
Downregulation of TGF-β1 and Collagen Genes in Adult Sclera
The 4884 expressed gene transcripts with less than 5% FDR includes several major collagen types, such as types I to VI, VIII, X to XII, XIV to XV, XVIII to XIX, and XXIV. Among them, collagen types I, III to VI, and XI showed significant downregulation ranging from 3- to 24-fold in adult sclera. In addition, the extracellular matrix–associated genes elastin, integrin A5, and integrin B1, were significantly downregulated at 10-, 3- and 3-fold, respectively. Integrin A5 and B1 are components of the fibronectin receptor, which mediates cell–matrix adhesion. 37 Analysis of expressed genes found TGF-β, -β1, -β2, and -β3 present in mouse sclera (<5% FDR). However, only TGF-β1 showed differential expression at more than threefold. We used the IPA program to highlight specific extracellular matrix genes thought to be involved in gene–gene interactions in mouse sclera during ocular growth, with the change notations shown in Figure 4
Discussion
To our knowledge, this is the first study to investigate differential gene expression in mouse sclera. The cDNA microarray analysis in the present study identified the expression of approximate 4884 transcripts in mouse sclera with less than 5% FDR. There were 718 differentially expressed genes at more than threefold— 210 upregulated and 508 downregulated—in the adult mouse sclera. Among differentially expressed genes, TGF-β1 and several collagen genes were significantly downregulated (Fig. 4) . The broad and significant downregulation of collagen genes suggests that cellular signaling molecules mediate changes in mouse sclera remodeling. This is particularly important, considering that significant reductions in collagen contents and a corresponding reduced scleral thickness have been reported in both human myopic eyes and animal models of myopia. 8 9 10 11 Results of this study support the hypothesis that scleral expansion and remodeling during myopic development and scleral enlargement during normal ocular growth could share a common signaling pathway to achieve an increase in scleral surface area and anterior–posterior globe size. 
The TGFs are secreted cytokines which control extracellular matrix synthesis. 21 Scleral expression has been confirmed in various species. 15 21 38 39 40 41 42 43 It has been reported that the family of TGFs play important roles in controlling collagen gene expression. 15 21 41 Our cDNA microarray study found TGF-β, -β1, -β2, and -β3 present in both juvenile and adult mouse sclera. Only TGF-β1 showed significant differential expression at more than threefold. The other isoforms showed marginal changes at their expression levels. The role of TGF-β1 in scleral remodeling has been studied in detail in myopic tree shrew. 21 TGF-β1 expression was shown to be downregulated by 32%, 1 day after myopic development, with persistent lower levels of expression thereafter. 
Information on the role of TGF-β1 in normal ocular growth has been limited. Subconjunctival injections of TGF-β1 had no effect on refractive error in control eyes, and effects on the myopic eyes were inconsistent due to large individual variation in a chick experimental myopia eye model study. 23 However, the presence of TGF-β1 reduced the rescue efforts by basic fibroblast growth factor (bFGF) of the myopic eye by 50%, as measured by axial length, suggesting that bFGF may act partially through the TGF-β1 pathway. Further characterization of TGF-β1 and bFGF pathways in mouse sclera may help to delineate mechanisms of ocular growth. 
Some early developmental genes may participate in late ocular growth. The homeobox gene Pax6 is essential for early ocular development, 44 and it remains expressed in the adult eyes. 45 In this study, we did not detect a significant change in Pax6 gene expression, nor did we find changes in the bone morphogenetic proteins (BMPs). Further data analysis and protein–protein interacting network exploration may help to uncover connections among differentially expressed genes. 
Studies of human myopic eyes show a significant decrease in scleral thickness and changes in collagen morphology. 8 9 10 11 Similar morphologic changes are also observed in animal models of myopia. 12 13 14 15 16 In myopic tree shrew sclerae, there was a 20% to 34% decrease in collagen type I expression and a 15% reduction in [3H] proline incorporation, suggesting reduced collagen synthesis. 17 20 The gene transcript expression profiles of collagen types III and V was unchanged. Our study also found significant downregulation in collagen type I gene expression. Unlike the myopic tree shrew, our study found decreased expression in several collagen genes, including types I, III to VI, and XI (Fig. 4) . The differences between the previous studies and the present study may be due to different animal models or different techniques. Additional information from other animal models may be useful. 
The scleral fibrils are assembled by heterogeneous collagen types, and the expressions of subtypes are dependent on various tissues and structures. 46 47 This study found 16 collagen subtypes present in mouse sclera. All collagen types have been recognized in sclera in previous animal studies. 17 47 48 49 Among these 16 subtypes, only types I, III to VI, and XI showed significant downregulation in adult sclera (Fig. 4) . Differential expression of collagen gene subtypes in juvenile relative to adult mice may suggest different scleral fibril composition and subsequent alteration in scleral rigidity and mechanical properties. 
Studies of scleral remodeling during normal and pathologic ocular growth have focused on known genes and factors historically. The cDNA microarray technology allows for gene expression study on a large scale. It is particularly important in ocular growth studies, as the molecular events occurring during development are complex, involving multiple factors and pathways. A detailed study of expressed scleral genes and a rational pathway during ocular development may help to identify signaling molecules that guide ocular growth. 
 
Table 1.
 
Real-Time PCR Gene Primer Pairs Used
Table 1.
 
Real-Time PCR Gene Primer Pairs Used
Gene Name RefSeq ID Forward Primers (5′–3′) Reverse Primers (5′–3′)
KIF5A NM_008447 AGAACAACCTGGAACAGCTTACAA CGAAGTCGTTTTTCCAATTTAGGA
EXPI NM_007969 CTGGTAGCTTTGATTTTCATGACAA GACAAGCGCCAGGTTTTTCT
VTN NM_011707 CCATTCAGAGCGTCTATTTCTTCTC TCCACTCGCCGGGTTCT
NEUROD1 NM_010894 CCCGAGGCTCCAGGGTTAT CCCGCTCTCGCTGTATGATT
COL5A1 NM_015734 TGAATTCAAGCGTGGGAAACT CCGCAGGAAGGTCATTTGTAC
COL11A2 NM_009926 TGGCACTCCTGGTCCAGAAG GCCGGGCTTTCCTGCTA
ELN NM_007925 GGCTTTGGACTTTCTCCCATT CCGGCCACAGGATTTCC
TGFB1 NM_011577 CACCGGAGAGCCCTGGATA TGCCGCACACAGCAGTTC
ACTB NM_013556 AGGTCATCACTATTGGCAACGA ATGGATGCCACAGGATTCCA
Figure 1.
 
Comparisons of microarray data from 3- and 8-week-old mouse sclera. The changes (x-fold) between different age groups are shown on the x-axis. The statistically significant values for a local pooled error (LPE) test of differences between different age group are shown on the y-axis. Horizontal threshold line: P = 0.01; vertical lines: two- and threefold changes, respectively (as labeled). The top, outer sextant points are genes with significant changes.
Figure 1.
 
Comparisons of microarray data from 3- and 8-week-old mouse sclera. The changes (x-fold) between different age groups are shown on the x-axis. The statistically significant values for a local pooled error (LPE) test of differences between different age group are shown on the y-axis. Horizontal threshold line: P = 0.01; vertical lines: two- and threefold changes, respectively (as labeled). The top, outer sextant points are genes with significant changes.
Table 2.
 
Representative Genes and ESTs Upregulated in 8-Week-Old-Mouse Sclera
Table 2.
 
Representative Genes and ESTs Upregulated in 8-Week-Old-Mouse Sclera
Affymetrix ID UniGene ID RefSeq ID Gene Names Chromosomal Location Expression Ratio* 8 wk/3 wk Molecular Function
1422825_at Mm.75498 NM_013732 Cocaine and amphetamine regulated transcript chr13 D1 15.2 (2.9) Neuropeptide hormone activity
1434670_at Mm.30355 NM_008447 Kinesin family member 5A chr10:70.0 cM 8.8 (3.4) Motor activity
1441330_at Mm.95700 NM_133239 Crumbs homolog 1 chr1:73.0 cM 8.5 (1.1) Molecular function unknown
1433785_at Mm.40461 NM_008614 Myelin-associated oligodendrocytic basic protein chr9:69.0 cM 8.0 (4.7) Structural constituent of myelin sheath
1417160_s_at Mm.1650 NM_007969 Extracellular proteinase inhibitor chr11:C 7.9 (5.7) Endopeptidase inhibitor
1440256_at Mm.222680 NM_145840 Regulator of G-protein signalling 9 binding protein chr7:A3 6.8 (2.6) Molecular function unknown
1435447_at Mm.31625 NM_008600 Major intrinsic protein of eye lens fiber chr10:74.0 cM 6.7 (5.9) Structural constituent of eye lens
1436470_at Mm.125521 NM_053271 Regulating synaptic membrane exocytosis 2 chr15:16.0 cM 6.6 (2.1) Neurotransmitter transport
1424422_s_at Mm.258142 NM_177041 RIKEN cDNA A930017E24 gene chr3 F1 6.5 (5.6) Molecular function unknown
1457083_at Mm.234182 NM_025463 RIKEN cDNA 1810009A15 gene chr19 A 6.3 (1.0) Molecular function unknown
1435392_at Mm.95281 NM_028220 WD repeat domain 17 Chr8:8 3.1 6.2 (1.2) Molecular function unknown
1421084_at Mm.41982 NM_011302 Retinoschisis 1 homolog chrX:70.0 cM 5.5 (1.2) Cell adhesion
1455098_a_at Mm.3667 NM_011707 Vitronectin chr11 45.09 cM 5.3 (0.7) Cell adhesion
1426412_at Mm.4636 NM_010894 Neurogenic differentiation 1 chr2 46.0 cM 5.3 (2.0) DNA binding, eye morphogenesis
1419414_at Mm.218764 NM_022422 Guanine nucleotide binding protein 13, gamma chr17 A3.3 5.2 (2.2) Heterotrimeric G-protein GTPase activity
1420536_at Mm.1215 NM_007773 Crystallin, beta B2 chr5 60.0 cM 5.2 (7.3) Structural constituent of eye lens
1451590_at Mm.192285 NM_145493 Complexin IV chr18 E1 5.2 (0.9) Molecular function unknown
1451989_a_at Mm.132237 NM_153058 Microtubule-associated protein, member 2 chr18 A2 5.2 (3.6) Protein binding
1420453_at Mm.6253 NM_009967 Crystallin, gamma S chr16 16.1 cM 5.2 (5.0) Structural constituent of eye lens
1437145_s_at Mm.46431 NM_026415 RIKEN cDNA 2310002J15 gene chr2 A3 5.1 (2.6) Molecular function unknown
1419740_at Mm.1372 NM_008806 cGMP phosphodiesterase 6B, beta polypeptide chr5 57.0 cM 5.1 (2.2) Catalytic activity
1422651_at Mm.3969 NM_009605 Adipocyte complement related protein chr16 5.1 (7.0) Fatty acid beta-oxidation
1451763_at Mm.23793 NM_007723 Cyclic nucleotide gated channel alpha 1 chr5 41.0 cM 5.0 (1.0) Ion transport
1419392_at Mm.279903 NM_011995 Piccolo chr5 4.9 (1.3) Calcium-dependent phospholipid binding
1421061_at Mm.16224 NM_008189 Guanylate cyclase activator 1a (retina) chr17 D 4.8 (1.1) Calcium ion binding
1436981_a_at Mm.260643 NM_011740 Tyrosine 3-/tryptophan 5-monooxygenase activation protein chr14 8.0 cM 4.8 (5.0) Monooxygenase activity
1420338_at Mm.4584 NM_009660 Arachidonate 15-lipoxygenase chr11 40.0 cM 4.8 (3.9) Carbohydrate metabolism
1458871_at Mm.130801 NM_172880 Hypothetical protein A030012E10 chr5 E1 4.7 (4.0) Molecular function unknown
1431393_at Mm.242892 NM_029444 RIKEN cDNA 4930447C04 gene chr12 C2 4.7 (2.6) Molecular function unknown
1460368_at Mm.101838 NM_145143 Membrane protein, palmitoylated 4 chr1 C2 4.6 (1.2) Molecular function unknown
1451826_at Mm.103669 NM_013877 Calcium binding protein 5 chr7 A2 4.6 (2.0) Calcium ion binding
1456936_at Mm.70121 NM_144532 Calcium binding protein 4 chr19 A 4.6 (1.2) Calcium ion binding
1455266_at Mm.256342 NM_008449 Kinesin family member 5C chr2 32.5 cM 4.5 (1.0) Kinesin complex
1434292_at Mm.294494 NM_175692 RIKEN cDNA A930034L06 gene chr2 H2 4.5 (1.7) Molecular function unknown
1425530_a_at Mm.203928 NM_025606 Mitochondrial ribosomal protein L16 chr19 B 4.4 (2.0) Mitochondrial large ribosomal subunit
1435330_at Mm.447 NM_175026 Expressed sequence AI447904 chr1 H3 4.3 (3.0) Molecular function unknown
1416828_at Mm.45953 NM_011428 Synaptosomal-associated protein 25 2 78.2 cM 4.3 (1.4) Neurotransmitter uptake
Table 2A.
 
Representative Genes and ESTs Upregulated in 8-Week-Old-Mouse Sclera
Table 2A.
 
Representative Genes and ESTs Upregulated in 8-Week-Old-Mouse Sclera
Affymetrix ID UniGene ID RefSeq ID Gene Names Chromosomal Location Expression Ratio* 8 wk/3 wk Molecular Function
1434987_at Mm.284446 NM_009656 Aldehyde dehydrogenase 2, mitochondrial 5 F-G1 4.2 (7.1) Aldehyde dehydrogenase (NAD) activity
1448125_at Mm.209711 NM_173759 RIKEN cDNA A730017C20 gene 18 D3 4.2 (0.9) Integral to membrane
1437528_x_at Mm.5163 NM_009065 Ras-like without CAAX 2 18 B1 4.2 (1.3) GTPase mediated signal transduction
Table 3.
 
Representative Genes and ESTs Downregulated in 8-Week-Old-Mouse Sclera
Table 3.
 
Representative Genes and ESTs Downregulated in 8-Week-Old-Mouse Sclera
Affymetrix ID UniGene ID RefSeq ID Gene Names Chromosomal Location Expression Ratio* 3 wk/8 wk Molecular Function
1418464_at Mm.29428 NM_013592 Matrilin 4 chr2 94.0 cM 33.5 (12.3) Calcium ion binding
1416741_at Mm.7281 NM_015734 Procollagen, type V, alpha 1 chr2 18.0 cM 25.6 (13.9) Extracellular matrix structural constituent
1423578_at Mm.20230 NM_009926 Procollagen, type XI, alpha 2 chr17 18.51 cM 25.1 (10.5) Cell adhesion
1423253_at Mm.9986 NM_008623 Myelin protein zero chr1 92.4 cM 20.8 (13.6) Intercellular junction maintenance
1450661_x_at Mm.5104 NM_008688 Nuclear factor I/C chr10 43.0 cM 19.8 (6.5) DNA replication
1422966_a_at Mm.28683 NM_011638 Transferrin receptor chr16 21.2 cM 17.2 (9.7) Proteolysis and peptidolysis
1421290_at Mm.46181 NM_013868 Heat shock protein family, member 7 chr4 E1 13.9 (7.3) Response to stress, cytoskeleton
1450828_at Mm.212349 NM_080451 Synaptopodin 2 chr3 G3 12.9 (8.4) Actin binding
1425504_at Mm.247544 NM_139300 Myosin, light polypeptide kinase chr16 A1 10.5 (5.7) Cytoskeleton and ATP binding
1452308_a_at Mm.207432 NM_178405 ATPase, Na+/K+ transporting, alpha 2 chr1 94.2 cM 10.4 (5.4) Sodium/potassium-exchanging ATPase activity
1459909_at Mm.4925 NM_008535 EST chr8 38.5 cM 10.1 (4.2) DNA binding
1420854_at Mm.275320 NM_007925 Elastin chr5 75.0 cM 10.1 (25.8) Extracellular matrix
1416238_at Mm.4345 NM_011587 Tyrosine kinase receptor 1 chr4 50.0 cM 10.1 (3.7) Protein-tyrosine kinase activity
1454791_a_at Mm.12145 NM_009030 Retinoblastoma binding protein 4 chr4 D2 10.1 (12.7) DNA replication
1427385_s_at Mm.253564 NM_011501 Striamin chr12 C3 9.5 (4.2) Actin binding
1451285_at Mm.277680 NM_139149 Fusion, t(12; 16) malignant liposarcoma chr7 F3 9.4 (7.5) DNA binding
1423493_a_at Mm.9394 NM_010906 Nuclear factor I/X chr8 38.6 cM 9.4 (4.8) DNA replication
1449206_at Mm.20942 NM_008596 Mitsugumin 29 chr3 F3-H2 9.4 (5.2) Synaptic vesicle
1449888_at Mm.234875 NM_010137 Endothelial PAS domain protein 1 chr17 E4 9.4 (4.2) DNA binding
1450576_a_at Mm.262677 NM_013651 Splicing factor 3a, subunit 2 chr10 43.0 cM 9.0 (2.1) Nuclear mRNA splicing
1420653_at Mm.9154 NM_011577 Transforming growth factor, beta 1 chr7 6.5 cM 9.0 (3.3) Transforming growth factor beta receptor binding
1458087_at Mm.32087 NM_177707 Hypothetical protein 9830125E18 chr10 D3 8.9 (4.0) Phorbol esters/diacylglycerol binding
1415959_at Mm.293373 NM_009204 Facilitated glucose transporter, member 4 chr11 40.0 cM 8.8 (4.5) Glucose transport
1416572_at Mm.280175 NM_008608 Matrix metalloproteinase 14 chr14 12.5 cM 8.7 (5.0) Extracellular matrix, proteolysis and peptidolysis
1448228_at Mm.172 NM_010728 Lysyl oxidase chr18 29.0 cM 8.4 (5.7) Lysyl oxidase
1417634_at Mm.2407 NM_011435 Superoxide dismutase 3 chr5 31.0 cM 8.3 (3.3) Superoxide metabolism
1448914_a_at Mm.795 NM_007778 Colony stimulating factor 1 (macrophage) chr3 51.0 cM 8.0 (2.6) Cytokine activity
1450747_at Mm.248266 NM_016679 Kelch-like ECH-associated protein 1 chr9 A3 7.9 (3.7) Transcription regulation
1427884_at Mm.249555 NM_009930 Procollagen, type III, alpha 1 chr1 25.0 cM 7.6 (3.3) Cell adhesion
1429148_at Mm.263940 NM_026756 RIKEN cDNA 1110019L22 gene chr10 C1 7.6 (5.0) Molecular function unknown
1452787_a_at Mm.27545 NM_019830 Methyltransferase-like 2 chr7 23.1 cM 7.6 (5.0) RNA processing
1426251_at Mm.10104 NM_010445 H6 homeo box 1 chr5 18.0 cM 7.4 (5.3) Metallocarboxypeptidase activity
1448553_at Mm.290003 NM_010856 Myosin, heavy polypeptide 6, alpha chr14 20.0 cM 7.4 (3.9) Strialed muscle contraction
1448378_at Mm.289707 NM_007984 Fascin homolog 1, actin bundling protein chr5 86.0 cM 7.4 (2.2) Actin binding
1431856_a_at Mm.34776 NM_028331 C 1q& tumor necrosis factor related protein 6 chr15 E1 7.4 (3.8) Molecular_function unknown
1448469_at Mm.4691 NM_010917 Nidogen 1 chr13 7.0 cM 7.4 (2.9) Calcium ion binding: protein binding
1450085_at Mm.208919 NM_011923 Mus musculus cDNA clone IMAGE:4485306 chr2 B 7.3 (3.0) Molecular function unknown
1460633_at Mm.19091 NM_134129 PRP19/PSO4 homolog chr19 6.0 cM 7.2 (4.0) Molecular function unknown
1421289_at Mm.46181 NM_013868 Mus musculus cDNA clone IMAGE:4989198 chr4 E1 7.1 (6.9) Response to stress
1420941_at Mm.20954 NM_009063 Regulator of G-protein signaling 5 chr1 86.5 cM 7.1 (4.6) Regulator of PDGF and EDG receptor signaling
Figure 2.
 
Hierarchical clustering of gene expression data from 3- and 8-week-old mouse sclera based on expression level. Genes with a similar level of expression were grouped together along the vertical axis and genes with similar pattern of expression were close to each other on the horizontal axis. The biological replicates for each age group were clearly clustered together. A greater degree of similarity was observed within each age group than between different age groups.
Figure 2.
 
Hierarchical clustering of gene expression data from 3- and 8-week-old mouse sclera based on expression level. Genes with a similar level of expression were grouped together along the vertical axis and genes with similar pattern of expression were close to each other on the horizontal axis. The biological replicates for each age group were clearly clustered together. A greater degree of similarity was observed within each age group than between different age groups.
Figure 3.
 
Real-time PCR quantification of differentially expressed scleral genes. Sclera from 3- and 8-week-old mice were microdissected. Eight differentially expressed genes by microarray analysis were selected for real-time PCR analysis. PCR reactions were performed in triplicate for each gene. Product quantity was normalized using β-actin as an internal housekeeping gene control. Data are the mean of quantities in 8-week-old mouse sclera calibrated to quantities obtained from 3-week-old mouse sclera. The results are the means ± SE of three replicates.
Figure 3.
 
Real-time PCR quantification of differentially expressed scleral genes. Sclera from 3- and 8-week-old mice were microdissected. Eight differentially expressed genes by microarray analysis were selected for real-time PCR analysis. PCR reactions were performed in triplicate for each gene. Product quantity was normalized using β-actin as an internal housekeeping gene control. Data are the mean of quantities in 8-week-old mouse sclera calibrated to quantities obtained from 3-week-old mouse sclera. The results are the means ± SE of three replicates.
Figure 4.
 
Downregulation TGF-β1 and collagen genes in adult mouse sclera. The numbers on the y-axis are x-fold changes in microarray analysis.
Figure 4.
 
Downregulation TGF-β1 and collagen genes in adult mouse sclera. The numbers on the y-axis are x-fold changes in microarray analysis.
The authors thank George Hii at the Real-Time PCR Core Facility of the Children’s Hospital of Philadelphia for assistance with the real-time PCR analysis. 
WildsoetCF. Active emmetropization: evidence for its existence and ramifications for clinical practice. Ophthalmic Physiol Opt. 1997;17:279–290. [CrossRef] [PubMed]
WallmanJ, TurkelJ, TrachtmanJ. Extreme myopia produced by modest change in early visual experience. Science. 1978;201:1249–1251. [CrossRef] [PubMed]
IrvingE, CallenderM, SivakJ. Inducing myopia, hyperopia, and astigmatism in chicks. Optom Vis Sci. 1991;68:364–368. [CrossRef] [PubMed]
WieselT, RaviolaE. Myopia and eye enlargement after neonatal lid fusion in monkeys. Nature. 1977;266:66–68. [CrossRef] [PubMed]
TiggesM, TiggesJ, FernandesA, et al. Postnatal axial eye elongation in normal and visually deprived rhesus monkeys. Invest Ophthalmol Vis Sci. 1990;31:1035–1046. [PubMed]
ShermanS, NortonT, CasagrandeV. Myopia in the lid-sutured tree shrew (Tupaia glis). Brain Res. 1977;124:154–157. [CrossRef] [PubMed]
LamCS, EdwardsM, MillodotM, et al. A 2-year longitudinal study of myopia progression and optical component changes among Hong Kong schoolchildren. Optom Vis Sci. 1999;76:370–380. [CrossRef] [PubMed]
AvetisovES, SavitskayaNF, VinetskayaMI, et al. A study of biochemical and biomechanical qualities of normal and myopic eye sclera in humans of different age groups. Metab Pediatr Syst Ophthalmol. 1983;7:183–188. [PubMed]
CurtinBJ. Posterior staphyloma development in pathologic myopia. Ann Ophthalmol. 1982;14:655–658. [PubMed]
CurtinBJ, IwamotoT, RenaldoDP. Normal and staphylomatous sclera of high myopia: an electron microscopic study. Arch Ophthalmol. 1979;97:912–915. [CrossRef] [PubMed]
TsengJJ, TuranoMR, Jr, LangtonK, et al. Measurement of retinal thickness by ocular coherence tomography in a case of scleral transparency in high myopia. Am J Ophthalmol. 2004;138:169–170. [CrossRef] [PubMed]
FunataM, TokoroT. Scleral change in experimentally myopic monkeys. Graefes Arch Clin Exp Ophthalmol. 1990;228:174–179. [CrossRef] [PubMed]
McBrienNA, LawlorP, GentleA. Scleral remodeling during the development of and recovery from axial myopia in the tree shrew. Invest Ophthalmol Vis Sci. 2000;41:3713–3719. [PubMed]
McBrienNA, CornellLM, GentleA. Structural and ultrastructural changes to the sclera in a mammalian model of high myopia. Invest Ophthalmol Vis Sci. 2001;42:2179–2187. [PubMed]
KusakariT, SatoT, TokoroT. Visual deprivation stimulates the exchange of the fibrous sclera into the cartilaginous sclera in chicks. Exp Eye Res. 2001;73:533–546. [CrossRef] [PubMed]
KusakariT, SatoT, TokoroT. Regional scleral changes in form-deprivation myopia in chicks. Exp Eye Res. 1997;64:465–476. [CrossRef] [PubMed]
GentleA, LiuY, MartinJE, et al. Collagen gene expression and the altered accumulation of scleral collagen during the development of high myopia. J Biol Chem. 2003;278:16587–16594. [CrossRef] [PubMed]
RadaJA, BrenzaHL. Increased latent gelatinase activity in the sclera of visually deprived chicks. Invest Ophthalmol Vis Sci. 1995;36:1555–1565. [PubMed]
GuggenheimJA, McBrienNA. Form-deprivation myopia induces activation of scleral matrix metalloproteinase-2 in tree shrew. Invest Ophthalmol Vis Sci. 1996;37:1380–1395. [PubMed]
SiegwartJT, Jr, NortonTT. The time course of changes in mRNA levels in tree shrew sclera during induced myopia and recovery. Invest Ophthalmol Vis Sci. 2002;43:2067–2075. [PubMed]
JoblingAI, NguyenM, GentleA, et al. Isoform-specific changes in scleral transforming growth factor-beta expression and the regulation of collagen synthesis during myopia progression. J Biol Chem. 2004;279:18121–18126. [CrossRef] [PubMed]
GentleA, McBrienNA. Retinoscleral control of scleral remodeling in refractive development: a role for endogenous FGF-2?. Cytokine. 2002;18:344–348. [CrossRef] [PubMed]
RohrerB, StellWK. Basic fibroblast growth factor (bFGF) and transforming growth factor beta (TGF-beta) act as stop and go signals to modulate postnatal ocular growth in the chick. Exp Eye Res. 1994;58:553–562. [CrossRef] [PubMed]
VesseyKA, CottriallCL, McBrienNA. Muscarinic receptor protein expression in the ocular tissue of the chick during normal and myopic eye development. Dev Brain Res. 2002;135:79–86. [CrossRef]
TruongH, CottriallCL, GentleA, et al. Pirenzepine affects scleral metabolic changes in myopia through a non-toxic mechanism. Exp Eye Res. 2002;74:103–111. [CrossRef] [PubMed]
RadaJA, HuangY, RadaKG. Identification of choroidal ovotransferrin as a potential ocular growth regulator. Curr Eye Res. 2001;22:121–132. [CrossRef] [PubMed]
GovindenR, BhoolaKD. Genealogy, expression, and cellular function of transforming growth factor-beta. Pharmacol Ther. 2003;98:257–265. [CrossRef] [PubMed]
BaulmannDC, OhlmannA, Flugel-KochC, et al. Pax6 heterozygous eyes show defects in chamber angle differentiation that are associated with a wide spectrum of other anterior eye segment abnormalities. Mech Dev. 2002;118:3–17. [CrossRef] [PubMed]
KozmikZ. Pax genes in eye development and evolution. Curr Opin Genet Dev. 2005;15:430–438. [CrossRef] [PubMed]
LiveseyFJ, CepkoCL. Vertebrate neural cell-fate determination: lessons from the retina. Nat Rev Neurosci. 2001;2:109–118. [CrossRef] [PubMed]
LeeHY, WroblewskiE, PhilipsGT, et al. Multiple requirements for Hes 1 during early eye formation. Dev Biol. 2005;284:464–478. [CrossRef] [PubMed]
ShkumatavaA, NeumannCJ. Shh directs cell-cycle exit by activating p57kip2 in the zebrafish retina. EMBO Rep. 2005;6:563–569. [CrossRef] [PubMed]
DickA, MeierA, HammerschmidtM. Smad1 and smad5 have distinct roles during dorsoventral patterning of the zebrafish embryo. Dev Dyn. 1999;216:285–298. [CrossRef] [PubMed]
TejedorJ, de la VillaP. Refractive changes induced by form deprivation in the mouse eye. Invest Ophthalmol Vis Sci. 2003;44:32–36. [CrossRef] [PubMed]
SchaeffelF, BurkhardtE, HowlandHC, et al. Measurement of refractive state and deprivation myopia in two strains of mice. Optom Vis Sci. 2004;81:99–110. [CrossRef] [PubMed]
JainN, ThatteJ, BracialeT, et al. Local-pooled-error test for identifying differentially expressed genes with a small number of replicated microarrays. Bioinformatics. 2003;19:1945–1951. [CrossRef] [PubMed]
ZimmermannD, GuthohrleinEW, MalesevicM, et al. Integrin alpha5beta1 ligands: biological evaluation and conformational analysis. Chembiochem. 2005;6:272–276. [CrossRef] [PubMed]
HondaS, FujiiS, SekiyaY, et al. Retinal control on the axial length mediated by transforming growth factor-beta in chick eye. Invest Ophthalmol Vis Sci. 1996;37:2519–2526. [PubMed]
LiDQ, LeeSB, TsengSC. Differential expression and regulation of TGF-beta1, TGF-beta2, TGF-beta3, TGF-betaRI, TGF-betaRII and TGF-betaRIII in cultured human corneal, limbal, and conjunctival fibroblasts. Curr Eye Res. 1999;19:154–161. [CrossRef] [PubMed]
MietzH, Chevez-BarriosP, LiebermanMW. A mouse model to study the wound healing response following filtration surgery. Graefes Arch Clin Exp Ophthalmol. 1998;236:467–475. [CrossRef] [PubMed]
Westergren-ThorssonG, AntonssonP, MalmstromA, et al. The synthesis of a family of structurally related proteoglycans in fibroblasts is differently regulated by TGF-beta. Matrix. 1991;11:177–183. [CrossRef] [PubMed]
ZhangX, LiangL, PengD, et al. The expression of growth factors in filtering area following sclerectomy and the interaction between growth factors and interferon [in Chinese]. Yen Ko Hsueh Pao [Eye Science]. 2001;17:106–110.
SekoY, ShimokawaH, TokoroT. In vivo and in vitro association of retinoic acid with form-deprivation myopia in the chick. Exp Eye Res. 1996;63:443–452. [CrossRef] [PubMed]
Davis-SilbermanN, KalichT, Oron-KarniV, et al. Genetic dissection of pax6 dosage requirements in the developing mouse eye. Hum Mol Genet. 2005;14:2265–2276. [CrossRef] [PubMed]
Del Rio-TsonisK, WashabaughCH, TsonisPA. Expression of pax-6 during urodele eye development and lens regeneration. Proc Natl Acad Sci USA. 1995;92:5092–5096. [CrossRef] [PubMed]
IhanamakiT, PelliniemiLJ, VuorioE. Collagens and collagen-related matrix components in the human and mouse eye. Prog Retin Eye Res. 2004;23:403–434. [CrossRef] [PubMed]
WatsonPG, YoungRD. Scleral structure, organisation and disease: a review. Exp Eye Res. 2004;78:609–623. [CrossRef] [PubMed]
YoungTL, ScavelloGS, PaluruPC, et al. Microarray analysis of gene expression in human donor sclera. Mol Vis. 2004;10:163–176. [PubMed]
YoungTL, GuoXD, KingRA, et al. Identification of genes expressed in a human scleral cDNA library. Mol Vis. 2003;9:508–514. [PubMed]
Figure 1.
 
Comparisons of microarray data from 3- and 8-week-old mouse sclera. The changes (x-fold) between different age groups are shown on the x-axis. The statistically significant values for a local pooled error (LPE) test of differences between different age group are shown on the y-axis. Horizontal threshold line: P = 0.01; vertical lines: two- and threefold changes, respectively (as labeled). The top, outer sextant points are genes with significant changes.
Figure 1.
 
Comparisons of microarray data from 3- and 8-week-old mouse sclera. The changes (x-fold) between different age groups are shown on the x-axis. The statistically significant values for a local pooled error (LPE) test of differences between different age group are shown on the y-axis. Horizontal threshold line: P = 0.01; vertical lines: two- and threefold changes, respectively (as labeled). The top, outer sextant points are genes with significant changes.
Figure 2.
 
Hierarchical clustering of gene expression data from 3- and 8-week-old mouse sclera based on expression level. Genes with a similar level of expression were grouped together along the vertical axis and genes with similar pattern of expression were close to each other on the horizontal axis. The biological replicates for each age group were clearly clustered together. A greater degree of similarity was observed within each age group than between different age groups.
Figure 2.
 
Hierarchical clustering of gene expression data from 3- and 8-week-old mouse sclera based on expression level. Genes with a similar level of expression were grouped together along the vertical axis and genes with similar pattern of expression were close to each other on the horizontal axis. The biological replicates for each age group were clearly clustered together. A greater degree of similarity was observed within each age group than between different age groups.
Figure 3.
 
Real-time PCR quantification of differentially expressed scleral genes. Sclera from 3- and 8-week-old mice were microdissected. Eight differentially expressed genes by microarray analysis were selected for real-time PCR analysis. PCR reactions were performed in triplicate for each gene. Product quantity was normalized using β-actin as an internal housekeeping gene control. Data are the mean of quantities in 8-week-old mouse sclera calibrated to quantities obtained from 3-week-old mouse sclera. The results are the means ± SE of three replicates.
Figure 3.
 
Real-time PCR quantification of differentially expressed scleral genes. Sclera from 3- and 8-week-old mice were microdissected. Eight differentially expressed genes by microarray analysis were selected for real-time PCR analysis. PCR reactions were performed in triplicate for each gene. Product quantity was normalized using β-actin as an internal housekeeping gene control. Data are the mean of quantities in 8-week-old mouse sclera calibrated to quantities obtained from 3-week-old mouse sclera. The results are the means ± SE of three replicates.
Figure 4.
 
Downregulation TGF-β1 and collagen genes in adult mouse sclera. The numbers on the y-axis are x-fold changes in microarray analysis.
Figure 4.
 
Downregulation TGF-β1 and collagen genes in adult mouse sclera. The numbers on the y-axis are x-fold changes in microarray analysis.
Table 1.
 
Real-Time PCR Gene Primer Pairs Used
Table 1.
 
Real-Time PCR Gene Primer Pairs Used
Gene Name RefSeq ID Forward Primers (5′–3′) Reverse Primers (5′–3′)
KIF5A NM_008447 AGAACAACCTGGAACAGCTTACAA CGAAGTCGTTTTTCCAATTTAGGA
EXPI NM_007969 CTGGTAGCTTTGATTTTCATGACAA GACAAGCGCCAGGTTTTTCT
VTN NM_011707 CCATTCAGAGCGTCTATTTCTTCTC TCCACTCGCCGGGTTCT
NEUROD1 NM_010894 CCCGAGGCTCCAGGGTTAT CCCGCTCTCGCTGTATGATT
COL5A1 NM_015734 TGAATTCAAGCGTGGGAAACT CCGCAGGAAGGTCATTTGTAC
COL11A2 NM_009926 TGGCACTCCTGGTCCAGAAG GCCGGGCTTTCCTGCTA
ELN NM_007925 GGCTTTGGACTTTCTCCCATT CCGGCCACAGGATTTCC
TGFB1 NM_011577 CACCGGAGAGCCCTGGATA TGCCGCACACAGCAGTTC
ACTB NM_013556 AGGTCATCACTATTGGCAACGA ATGGATGCCACAGGATTCCA
Table 2.
 
Representative Genes and ESTs Upregulated in 8-Week-Old-Mouse Sclera
Table 2.
 
Representative Genes and ESTs Upregulated in 8-Week-Old-Mouse Sclera
Affymetrix ID UniGene ID RefSeq ID Gene Names Chromosomal Location Expression Ratio* 8 wk/3 wk Molecular Function
1422825_at Mm.75498 NM_013732 Cocaine and amphetamine regulated transcript chr13 D1 15.2 (2.9) Neuropeptide hormone activity
1434670_at Mm.30355 NM_008447 Kinesin family member 5A chr10:70.0 cM 8.8 (3.4) Motor activity
1441330_at Mm.95700 NM_133239 Crumbs homolog 1 chr1:73.0 cM 8.5 (1.1) Molecular function unknown
1433785_at Mm.40461 NM_008614 Myelin-associated oligodendrocytic basic protein chr9:69.0 cM 8.0 (4.7) Structural constituent of myelin sheath
1417160_s_at Mm.1650 NM_007969 Extracellular proteinase inhibitor chr11:C 7.9 (5.7) Endopeptidase inhibitor
1440256_at Mm.222680 NM_145840 Regulator of G-protein signalling 9 binding protein chr7:A3 6.8 (2.6) Molecular function unknown
1435447_at Mm.31625 NM_008600 Major intrinsic protein of eye lens fiber chr10:74.0 cM 6.7 (5.9) Structural constituent of eye lens
1436470_at Mm.125521 NM_053271 Regulating synaptic membrane exocytosis 2 chr15:16.0 cM 6.6 (2.1) Neurotransmitter transport
1424422_s_at Mm.258142 NM_177041 RIKEN cDNA A930017E24 gene chr3 F1 6.5 (5.6) Molecular function unknown
1457083_at Mm.234182 NM_025463 RIKEN cDNA 1810009A15 gene chr19 A 6.3 (1.0) Molecular function unknown
1435392_at Mm.95281 NM_028220 WD repeat domain 17 Chr8:8 3.1 6.2 (1.2) Molecular function unknown
1421084_at Mm.41982 NM_011302 Retinoschisis 1 homolog chrX:70.0 cM 5.5 (1.2) Cell adhesion
1455098_a_at Mm.3667 NM_011707 Vitronectin chr11 45.09 cM 5.3 (0.7) Cell adhesion
1426412_at Mm.4636 NM_010894 Neurogenic differentiation 1 chr2 46.0 cM 5.3 (2.0) DNA binding, eye morphogenesis
1419414_at Mm.218764 NM_022422 Guanine nucleotide binding protein 13, gamma chr17 A3.3 5.2 (2.2) Heterotrimeric G-protein GTPase activity
1420536_at Mm.1215 NM_007773 Crystallin, beta B2 chr5 60.0 cM 5.2 (7.3) Structural constituent of eye lens
1451590_at Mm.192285 NM_145493 Complexin IV chr18 E1 5.2 (0.9) Molecular function unknown
1451989_a_at Mm.132237 NM_153058 Microtubule-associated protein, member 2 chr18 A2 5.2 (3.6) Protein binding
1420453_at Mm.6253 NM_009967 Crystallin, gamma S chr16 16.1 cM 5.2 (5.0) Structural constituent of eye lens
1437145_s_at Mm.46431 NM_026415 RIKEN cDNA 2310002J15 gene chr2 A3 5.1 (2.6) Molecular function unknown
1419740_at Mm.1372 NM_008806 cGMP phosphodiesterase 6B, beta polypeptide chr5 57.0 cM 5.1 (2.2) Catalytic activity
1422651_at Mm.3969 NM_009605 Adipocyte complement related protein chr16 5.1 (7.0) Fatty acid beta-oxidation
1451763_at Mm.23793 NM_007723 Cyclic nucleotide gated channel alpha 1 chr5 41.0 cM 5.0 (1.0) Ion transport
1419392_at Mm.279903 NM_011995 Piccolo chr5 4.9 (1.3) Calcium-dependent phospholipid binding
1421061_at Mm.16224 NM_008189 Guanylate cyclase activator 1a (retina) chr17 D 4.8 (1.1) Calcium ion binding
1436981_a_at Mm.260643 NM_011740 Tyrosine 3-/tryptophan 5-monooxygenase activation protein chr14 8.0 cM 4.8 (5.0) Monooxygenase activity
1420338_at Mm.4584 NM_009660 Arachidonate 15-lipoxygenase chr11 40.0 cM 4.8 (3.9) Carbohydrate metabolism
1458871_at Mm.130801 NM_172880 Hypothetical protein A030012E10 chr5 E1 4.7 (4.0) Molecular function unknown
1431393_at Mm.242892 NM_029444 RIKEN cDNA 4930447C04 gene chr12 C2 4.7 (2.6) Molecular function unknown
1460368_at Mm.101838 NM_145143 Membrane protein, palmitoylated 4 chr1 C2 4.6 (1.2) Molecular function unknown
1451826_at Mm.103669 NM_013877 Calcium binding protein 5 chr7 A2 4.6 (2.0) Calcium ion binding
1456936_at Mm.70121 NM_144532 Calcium binding protein 4 chr19 A 4.6 (1.2) Calcium ion binding
1455266_at Mm.256342 NM_008449 Kinesin family member 5C chr2 32.5 cM 4.5 (1.0) Kinesin complex
1434292_at Mm.294494 NM_175692 RIKEN cDNA A930034L06 gene chr2 H2 4.5 (1.7) Molecular function unknown
1425530_a_at Mm.203928 NM_025606 Mitochondrial ribosomal protein L16 chr19 B 4.4 (2.0) Mitochondrial large ribosomal subunit
1435330_at Mm.447 NM_175026 Expressed sequence AI447904 chr1 H3 4.3 (3.0) Molecular function unknown
1416828_at Mm.45953 NM_011428 Synaptosomal-associated protein 25 2 78.2 cM 4.3 (1.4) Neurotransmitter uptake
Table 2A.
 
Representative Genes and ESTs Upregulated in 8-Week-Old-Mouse Sclera
Table 2A.
 
Representative Genes and ESTs Upregulated in 8-Week-Old-Mouse Sclera
Affymetrix ID UniGene ID RefSeq ID Gene Names Chromosomal Location Expression Ratio* 8 wk/3 wk Molecular Function
1434987_at Mm.284446 NM_009656 Aldehyde dehydrogenase 2, mitochondrial 5 F-G1 4.2 (7.1) Aldehyde dehydrogenase (NAD) activity
1448125_at Mm.209711 NM_173759 RIKEN cDNA A730017C20 gene 18 D3 4.2 (0.9) Integral to membrane
1437528_x_at Mm.5163 NM_009065 Ras-like without CAAX 2 18 B1 4.2 (1.3) GTPase mediated signal transduction
Table 3.
 
Representative Genes and ESTs Downregulated in 8-Week-Old-Mouse Sclera
Table 3.
 
Representative Genes and ESTs Downregulated in 8-Week-Old-Mouse Sclera
Affymetrix ID UniGene ID RefSeq ID Gene Names Chromosomal Location Expression Ratio* 3 wk/8 wk Molecular Function
1418464_at Mm.29428 NM_013592 Matrilin 4 chr2 94.0 cM 33.5 (12.3) Calcium ion binding
1416741_at Mm.7281 NM_015734 Procollagen, type V, alpha 1 chr2 18.0 cM 25.6 (13.9) Extracellular matrix structural constituent
1423578_at Mm.20230 NM_009926 Procollagen, type XI, alpha 2 chr17 18.51 cM 25.1 (10.5) Cell adhesion
1423253_at Mm.9986 NM_008623 Myelin protein zero chr1 92.4 cM 20.8 (13.6) Intercellular junction maintenance
1450661_x_at Mm.5104 NM_008688 Nuclear factor I/C chr10 43.0 cM 19.8 (6.5) DNA replication
1422966_a_at Mm.28683 NM_011638 Transferrin receptor chr16 21.2 cM 17.2 (9.7) Proteolysis and peptidolysis
1421290_at Mm.46181 NM_013868 Heat shock protein family, member 7 chr4 E1 13.9 (7.3) Response to stress, cytoskeleton
1450828_at Mm.212349 NM_080451 Synaptopodin 2 chr3 G3 12.9 (8.4) Actin binding
1425504_at Mm.247544 NM_139300 Myosin, light polypeptide kinase chr16 A1 10.5 (5.7) Cytoskeleton and ATP binding
1452308_a_at Mm.207432 NM_178405 ATPase, Na+/K+ transporting, alpha 2 chr1 94.2 cM 10.4 (5.4) Sodium/potassium-exchanging ATPase activity
1459909_at Mm.4925 NM_008535 EST chr8 38.5 cM 10.1 (4.2) DNA binding
1420854_at Mm.275320 NM_007925 Elastin chr5 75.0 cM 10.1 (25.8) Extracellular matrix
1416238_at Mm.4345 NM_011587 Tyrosine kinase receptor 1 chr4 50.0 cM 10.1 (3.7) Protein-tyrosine kinase activity
1454791_a_at Mm.12145 NM_009030 Retinoblastoma binding protein 4 chr4 D2 10.1 (12.7) DNA replication
1427385_s_at Mm.253564 NM_011501 Striamin chr12 C3 9.5 (4.2) Actin binding
1451285_at Mm.277680 NM_139149 Fusion, t(12; 16) malignant liposarcoma chr7 F3 9.4 (7.5) DNA binding
1423493_a_at Mm.9394 NM_010906 Nuclear factor I/X chr8 38.6 cM 9.4 (4.8) DNA replication
1449206_at Mm.20942 NM_008596 Mitsugumin 29 chr3 F3-H2 9.4 (5.2) Synaptic vesicle
1449888_at Mm.234875 NM_010137 Endothelial PAS domain protein 1 chr17 E4 9.4 (4.2) DNA binding
1450576_a_at Mm.262677 NM_013651 Splicing factor 3a, subunit 2 chr10 43.0 cM 9.0 (2.1) Nuclear mRNA splicing
1420653_at Mm.9154 NM_011577 Transforming growth factor, beta 1 chr7 6.5 cM 9.0 (3.3) Transforming growth factor beta receptor binding
1458087_at Mm.32087 NM_177707 Hypothetical protein 9830125E18 chr10 D3 8.9 (4.0) Phorbol esters/diacylglycerol binding
1415959_at Mm.293373 NM_009204 Facilitated glucose transporter, member 4 chr11 40.0 cM 8.8 (4.5) Glucose transport
1416572_at Mm.280175 NM_008608 Matrix metalloproteinase 14 chr14 12.5 cM 8.7 (5.0) Extracellular matrix, proteolysis and peptidolysis
1448228_at Mm.172 NM_010728 Lysyl oxidase chr18 29.0 cM 8.4 (5.7) Lysyl oxidase
1417634_at Mm.2407 NM_011435 Superoxide dismutase 3 chr5 31.0 cM 8.3 (3.3) Superoxide metabolism
1448914_a_at Mm.795 NM_007778 Colony stimulating factor 1 (macrophage) chr3 51.0 cM 8.0 (2.6) Cytokine activity
1450747_at Mm.248266 NM_016679 Kelch-like ECH-associated protein 1 chr9 A3 7.9 (3.7) Transcription regulation
1427884_at Mm.249555 NM_009930 Procollagen, type III, alpha 1 chr1 25.0 cM 7.6 (3.3) Cell adhesion
1429148_at Mm.263940 NM_026756 RIKEN cDNA 1110019L22 gene chr10 C1 7.6 (5.0) Molecular function unknown
1452787_a_at Mm.27545 NM_019830 Methyltransferase-like 2 chr7 23.1 cM 7.6 (5.0) RNA processing
1426251_at Mm.10104 NM_010445 H6 homeo box 1 chr5 18.0 cM 7.4 (5.3) Metallocarboxypeptidase activity
1448553_at Mm.290003 NM_010856 Myosin, heavy polypeptide 6, alpha chr14 20.0 cM 7.4 (3.9) Strialed muscle contraction
1448378_at Mm.289707 NM_007984 Fascin homolog 1, actin bundling protein chr5 86.0 cM 7.4 (2.2) Actin binding
1431856_a_at Mm.34776 NM_028331 C 1q& tumor necrosis factor related protein 6 chr15 E1 7.4 (3.8) Molecular_function unknown
1448469_at Mm.4691 NM_010917 Nidogen 1 chr13 7.0 cM 7.4 (2.9) Calcium ion binding: protein binding
1450085_at Mm.208919 NM_011923 Mus musculus cDNA clone IMAGE:4485306 chr2 B 7.3 (3.0) Molecular function unknown
1460633_at Mm.19091 NM_134129 PRP19/PSO4 homolog chr19 6.0 cM 7.2 (4.0) Molecular function unknown
1421289_at Mm.46181 NM_013868 Mus musculus cDNA clone IMAGE:4989198 chr4 E1 7.1 (6.9) Response to stress
1420941_at Mm.20954 NM_009063 Regulator of G-protein signaling 5 chr1 86.5 cM 7.1 (4.6) Regulator of PDGF and EDG receptor signaling
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×