April 2007
Volume 48, Issue 4
Free
Retinal Cell Biology  |   April 2007
Vitreous Modulation of Gene Expression in Low-Passage Human Retinal Pigment Epithelial Cells
Author Affiliations
  • Ramapriya Ganti
    From the Departments of Pathology, Microbiology and Immunology, and
    Present affiliations: Department of Pathology, St. Jude Children’s Research Hospital, Memphis Tennessee; and
  • Richard C. Hunt
    From the Departments of Pathology, Microbiology and Immunology, and
    Ophthalmology, University of South Carolina School of Medicine, Columbia, South Carolina.
  • Sunil K. Parapuram
    From the Departments of Pathology, Microbiology and Immunology, and
    Department of Ophthalmology and Visual Sciences, Kellogg Eye Center, University of Michigan, Ann Arbor, Michigan.
  • D. Margaret Hunt
    From the Departments of Pathology, Microbiology and Immunology, and
    Ophthalmology, University of South Carolina School of Medicine, Columbia, South Carolina.
Investigative Ophthalmology & Visual Science April 2007, Vol.48, 1853-1863. doi:10.1167/iovs.06-0198
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Ramapriya Ganti, Richard C. Hunt, Sunil K. Parapuram, D. Margaret Hunt; Vitreous Modulation of Gene Expression in Low-Passage Human Retinal Pigment Epithelial Cells. Invest. Ophthalmol. Vis. Sci. 2007;48(4):1853-1863. doi: 10.1167/iovs.06-0198.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

purpose. In proliferative vitreoretinopathy (PVR), retinal pigment epithelial (RPE) cells enter the vitreous and proliferate. They become fibroblast-like and participate in the formation of contractile membranes, which can lead to retinal detachment. Vitreous treatment of RPE cells in vitro results in similar morphologic changes. This study was conducted to examine vitreous-induced modulation of gene expression in RPE cells.

methods. Low-passage human RPE cell lines derived from three donors were each treated for 6, 12, 24, or 48 hours with complete medium or complete medium containing 25% vitreous. Changes in mRNA levels were examined by using microarrays. Real-time quantitative PCR (qPCR) was used to measure mRNA expression of a subset of genes in cells from three additional donors. Immunohistochemistry and immunoblot analysis were used to examine protein expression.

results. Vitreous treatment caused a progressive reprogramming of gene expression. qPCR confirmed vitreous modulation of mRNA levels of 10 of 10 genes. Changes consistent with a transition from an epithelial to a mesenchymal phenotype were observed. Downregulated genes included genes associated with differentiated RPE cells. Upregulated genes included genes associated with stress and inflammation. Pathway analysis indicated that the transforming growth factor-β/bone morphogenetic protein (BMP) pathway and the focal adhesion pathway may play a role in this process. BMP-2 protein and mRNA were increased.

conclusions. Despite the biological variation in vitreous and RPE donors, vitreous reproducibly modulated a limited number of mRNAs. Many of these changes were consistent with the more fibroblast-like appearance of vitreous-treated cells and with the pathobiology of PVR. TGF-β and BMP-2 may be important modulators of vitreous-induced changes in gene expression.

Retinal pigment epithelial (RPE) cells form a barrier epithelium between the neural retina and the choriocapillaris at the back of the eye. They play an important role in the blood–retinal barrier and control access of nutrients from the choroidal blood supply to the outer retina. RPE cells have many other functions, including reduction of light scattering, participation in the visual cycle, the removal of waste products (including shed outer segment membranes), and the maintenance of the interphotoreceptor ionic environment. 1 RPE cells do not usually divide in adult life, but in certain diseases, such as proliferative vitreoretinopathy (PVR), they can dissociate from the Bruch’s membrane and proliferate in the vitreous or in the subretinal space. 2 3 4 In PVR, RPE cells are found in epiretinal membranes, which contain various cell types embedded in an extracellular matrix distinct from that of the vitreous. In what can be regarded as an aberrant wound-healing response, 2 3 these membranes become contractile and cause traction retinal detachment and loss of sight. RPE cells are thought to play a critical role in the formation and contraction of these membranes. 5 The RPE cells in PVR membranes have often undergone morphologic changes and appear more fibroblast-like than epithelial. 4 When exposed to vitreous in vivo 6 or in vitro, 7 they undergo similar morphologic changes. In vitro, this epithelial-mesenchymal transformation (EMT)–like process requires the presence of serum factors as well as vitreous. 8  
Risk factors for PVR include the presence of RPE cells in the vitreous, a tear in the neural retina (which could expose the RPE layer to vitreous components), a breakdown in the blood–retinal barrier and the presence of inflammatory components. 3 9 10 11 Knowledge of which mRNAs are modulated by vitreous treatment of RPE cells will help elucidate the early stages of PVR. Thus, differential display polymerase chain reaction (PCR)–based methods 12 13 and membrane arrays representing 588 genes 14 have been used, but these studies identified only a limited number of gene changes at a single time point. We report here the use of 21,000-gene microarrays to profile vitreous-induced changes in gene expression in low-passage human RPE cells from multiple donors at various times of treatment. Since vitreous-induced transformation of RPE cells requires serum, 8 all these experiments were performed in the presence of serum. Vitreous caused a progressive change in the transcriptional program of these cells. There was a downregulation of genes associated with tight junctions and a change in expression of focal adhesion genes, as would be expected if epithelial cells lost cell–cell contact, became migratory, and transformed into more fibroblast-like cells. Many of the modulated genes were associated with the transforming growth factor-β (TGFβ)/bone morphogenetic protein (BMP) pathway. 
Methods
RPE Cells
RPE cells were obtained postmortem from human donor eyes (Lifepoint, Charleston, SC, and Lions’ Eye Bank, Portland, OR). The protocol adhered to the tenets of the Declaration of Helsinki for research involving human tissue. Eyes were not used if there was a known history of retinal disease or diabetes. RPE cells were isolated as described previously 15 and cultured in F-10 medium (Invitrogen Corp., Carlsbad, CA) containing 10% fetal bovine serum (Invitrogen Corp.), 1% penicillin-streptomycin-glutamine (Invitrogen Corp.), 1 μM CaCl2, and 1% ITS (BD Biosciences, Franklin Lakes, CA). The epithelioid nature of the RPE cells was checked by immunohistochemistry using an anti-cytokeratin primary antibody and a fluorescent secondary antibody. 16 RPE cells were used between passages 3 and 6. 
Vitreous Treatment of RPE Cells
Vitreous gel from human donor eyes was shredded by using a syringe, diluted with three volumes of complete medium and was vacuum-filtered through a 0.22-μm polyethersulfone filter (Corning Inc., Corning, NY). 15 Control medium was also filtered. At the 0 time point, the medium was removed from subconfluent RPE cells and replaced with complete, serum-containing medium or complete, serum-containing medium containing 25% vitreous. Both control and vitreous-treated cells were then incubated at 37°C for the same time (6, 12, 24, or 48 hours) before RNA extraction. Cells were still subconfluent at the time RNA was extracted. 
RNA Extraction
The medium was quickly removed from the cells, which were briefly washed with PBS. RNA was extracted (RNeasy; Qiagen Inc., Valencia, CA). Column-bound RNA was treated with DNase (Qiagen, Inc.), according to the manufacturer’s directions, except that the concentration and time for DNase treatment were doubled. The amount and purity of the total RNA were determined from the absorbance at 260 and 280 nm and by nondenaturing gel electrophoresis. 15  
RNA Amplification and Hybridization to Microarrays
RNA extracted from each of three low-passage RPE donor–vitreous donor pairs at 6, 12, 24, or 48 hours of control treatment or vitreous treatment was copied into cDNA and subjected to linear amplification using an aRNA amplification kit (Amino Allyl MessageAmp; Ambion Inc., Austin, TX). The amino allyl-labeled RNA was fluorescently labeled with cyanine-3 or -5 using reactive dye packs (CyDye Post-Labeling; GE Healthcare, Piscataway, NJ) and purified on GFX columns (GE Healthcare). Fluorescently labeled RNA from the vitreous-treated and the corresponding control cells, each labeled with a different cyanine dye, were mixed and hybridized to prehybridized 70-mer oligonucleotide microarray slides (Operon Human Genome Oligo Set ver. 2, 21,318 genes; University of Cincinnati Genomics and Microarray Laboratory, Cincinnati, OH) according to the protocols of the W. M. Keck Foundation Biotechnology Resource Laboratory (New Haven, CT). All samples were analyzed twice, with the dyes reversed on the second analysis, giving a total of 24 dual-color microarray slides. Slides were scanned at the University of South Carolina Microarray Facility (ScanArray 5000; PerkinElmer Life and Analytical Sciences, Wellesley, MA) or the University of Cincinnati Genomics and Microarray Laboratory (GenePix 4000B; Molecular Devices, Sunnyvale, CA). 
In all cases, RNA from vitreous-treated cells from a particular donor was compared with RNA from untreated cells from the same donor, which were grown at the same time and incubated for the same period after medium change. Thus, genes that varied in expression from donor to donor but which were not modulated by vitreous should not be detected using this approach. 
Analysis of Gene Expression
Microarray analysis software (GeneSpring; Agilent Technologies, Palo Alto, CA) was used for the initial analysis of the digitized data and to correct for background. Gene expression was normalized using the Lowess option and the ratio of expression in vitreous:control cells determined for each gene (see Appendix A). The resultant data were analyzed using the Significance Analysis of Microarrays (SAM) statistics program to determine genes that were significantly regulated at each time point. 17 SAM uses a permutation method to determine the significance of the results and hence reports a false-discovery rate (FDR) rather than a probability. In addition, genes that gave signals at least 10 standard deviations above background (microarray scanner fluorescence values of >300 for ScanArray data [Perkin-Elmer] and >100 for GenePix data [Molecular Devices]) for both control and vitreous channels and that were regulated by at least twofold at any time point in all three donors were determined using the microarray analysis software (GeneSpring; Agilent Technologies). SOURCE 18 was used to annotate genes and to convert accession numbers to Entrez Gene IDs/Locus Link IDs or HGNC (Human Genome Nomenclature Committee) gene symbols. EASE 19 software was used to remove duplicated genes. Pathways were examined using the WebGestalt-Gene Set Analysis Toolkit 20 programs to search the KEGG database. 21 Statistical significance was determined using the hypergeometric test option. The Gene Ontology Database 22 was searched with DAVID 23 , EASE, Ontoexpress, 24 and GOTM. 20  
Reverse Transcription and Quantitative Real-Time PCR
Total RNA (1 μg) was reverse transcribed into cDNA (Iscript reagents; Bio-Rad Laboratories, Hercules, CA) and simultaneous priming from both oligo(dT) and random hexamers. The cDNA mix was diluted to 300 μL with glass-distilled water. QPCR was performed (iQ SYBR Green Supermix; Bio-Rad Laboratories, Hercules, CA) with 5 μL of the diluted DNA and 2.5 picomoles of each primer in a total volume of 25 μL. Reactions were run on a PCR system (iCycler IQ Real Time PCR; Bio-Rad Laboratories). Primer pairs (Table 1)were designed on computer (Oligo 6; Molecular Biology Insights, Cascade, CO). The specificity of all primer pairs was checked by direct sequencing of the PCR product. For validation experiments, five replicates were performed for both the target gene and the internal standard gene (ribosomal protein, large, P0; RPLP0) used for normalization. The relative expression of the target gene in RNA from vitreous-treated cells compared to the matched control cell RNA was determined using the Pfaffl analysis method 25 which corrects for any differences in the expression of the internal normalization gene (RPLP0; internal loading control) as well as for any differences in the efficiency of amplification for the primer pairs for each gene (Table 1) . Statistical significance was determined using REST-XL software. 26 Statistical analysis with this program in the non-normalized mode showed that vitreous treatment had no significant effect on the expression of the internal standard gene (RPLP0). 
Immunohistochemistry
RPE cells were grown for 48 hours in control medium or medium containing 25% vitreous. To inhibit secretion of extracellular proteins, Brefeldin A (Sigma-Aldrich, St. Louis, MO) was then added to the medium to a final concentration of 5 ng/mL, and the incubation was continued for a further 6 hours. The cells were fixed in 4% paraformaldehyde, permeabilized with 0.5% Triton X-100, and stained with rabbit anti-human tissue plasminogen activator antibody (Santa Cruz Biotechnology Inc., Santa Cruz, CA) or with rabbit anti-human BMP-2 antibody (Aviva Systems Biology, San Diego, CA) followed by Cy5-conjugated anti-rabbit IgG (Invitrogen). The cells were double stained with Texas Red phalloidin (Invitrogen) to detect actin microfilaments and were observed by confocal microscopy (Meta500; Carl Zeiss Meditec, Inc., Dublin, CA). 
Immunoblot Analysis
The cells were extracted with ice-cold extraction buffer (1% NP40; Sigma-Aldrich) in 50 mM Tris-HCl (pH 8.0) containing 340 mM NaCl, 1 mM phenylmethylsulfonyl fluoride (PMSF), 50 mM NaF and protease cocktail inhibitor (20 μL/mL; Pierce Biotechnology Inc., Rockford, IL). The extract was centrifuged and dissolved for SDS-polyacrylamide gel electrophoresis. After electrophoresis, the proteins were transferred to polyvinylidene difluoride (PVDF) membrane (Bio-Rad Laboratories) and protein-binding sites were blocked overnight with 5% nonfat dried milk in blocking buffer (20 mM Tris-HCl [pH 7.6], 0.8 M NaCl, and 0.1% Tween-20). Membranes were incubated overnight at 4°C with the appropriate primary antibody diluted in blocking buffer. The primary antibodies used were rabbit anti-human TFPI2 (kindly given by Walter Kisiel, Department of Pathology, University of New Mexico Health Sciences Center, Albuquerque, NM; diluted 1:1000), or rabbit anti-human BMP-2 antibody (diluted 1:100; Aviva Systems Biology). After the membrane was washed, it was incubated with horseradish peroxidase-conjugated goat anti-rabbit IgG (GE Healthcare). Chemiluminescence was used for detection (West Pico Supersignal; Pierce Biotechnology, Inc.). 
Results
Genes Modulated by Vitreous Treatment
Treatment of low-passage human RPE cells in serum-containing medium with 25% vitreous results in reproducible morphologic changes within 48 hours, although changes can often be detected earlier. 12 27 Hence, changes in gene expression were examined after 6, 12, 24, or 48 hours of incubation with normal or vitreous-containing medium. Some heterogeneity of response was expected because of biological variation between vitreous or RPE cells from different donors. Because the goal was to identify general responses to vitreous, microarray analysis was performed on three different RPE donor–vitreous donor pairs (RPE donors 1–3). In all cases, both control and vitreous-treated cells were kept subconfluent throughout treatment, partly because it is assumed that as RPE cells migrate into the vitreous, they are no longer in confluent monolayers and start to divide. 2 4 In addition, this method avoids possible complications resulting from vitreous-treated cells’ being less subject to contact inhibition than untreated cells. 12  
Genes that gave microarray signals that were at least 10 SD above background and that also showed at least twofold changes in expression in all three microarray donors (RPE donors 1–3) at any time point were identified. These 200 genes are referred to as the twofold/donors 1 to 3 gene set. Thus, these were genes with mRNA that was readily detectable on arrays with reproducible changes in expression at a level that should be detectable by qPCR. However, such an analysis may miss many mRNAs with lower levels of expression for at least one donor, or those that were regulated by less than twofold in at least one donor. Therefore, the data were also analyzed with SAM statistical analysis. SAM takes into account not only the ratio of a gene’s expression in treated compared with control cells, but also the variation in expression. It can thus detect changes in regulation of genes with expression levels or expression changes less than the cutoffs used for the twofold/donors 1 to 3 gene set. Not surprisingly, SAM analysis at each time point using a false-discovery rate (FDR) of <5% detected many more regulated genes. The number of regulated genes increased at longer periods of vitreous treatment, consistent with a prolonged, progressive alteration in the gene transcription program (Fig. 1 ; see Appendix B for the gene list). The 1335 regulated genes from the SAM FDR < 5% gene set included 187 of the 200 genes in the twofold/donors 1 to 3 gene set. Because these 187 genes were likely to be robustly regulated by vitreous in all donors at levels detectable by qPCR, we refer to this subset of the SAM FDR < 5% gene set as the “stringent gene set” (Appendix C). We focused on the stringent gene set for much of the initial validation. Most (79%) of the genes in this set were regulated at multiple time points, supporting the concept that these genes were robustly regulated by vitreous. A further indication of the reliability of the data was that 96% of those genes regulated at multiple time points were regulated at adjacent time points. 
Validation of Changes in mRNA Expression
To test the reliability of the microarray analysis, the effect of vitreous-treatment on 10 of the vitreous-regulated genes was determined in three additional donor/vitreous pairs (RPE donors 4–6) at 6, 12, 24, or 48 hours of treatment. Some genes were chosen because the changes observed on the microarrays were consistent with an EMT response. These included α-5 integrin (ITGA5), 28 Slug (SNAI2), 29 and collagen IV (COL4A1). 30 Connective tissue growth factor (CTGF) and thrombospondin-1 (THBS1) were included because others have speculated that increased expression of these genes, possibly by RPE cells, play a role in the early stages of PVR, 31 32 but the microarrays showed decreased expression. The remaining five genes (SAT, TFPI2, tissue plasminogen activator [PLAT], ADAMTS5, and TFRC) were chosen arbitrarily because they were up- or downregulated at multiple time points. However, recent reports indicate that TFPI2 is an RPE-specific growth factor 33 and that SAT is involved in cell migration. 34 These genes were all in the stringent gene set, except for SNAI2 which was in the SAM FDR < 5% gene set only. The qPCR results confirmed the microarray data for all 10 genes (Table 2 ; compare the average of the microarray results for RPE donors 1–3 with the qPCR data for donors 4–6). In general, the kinetics of gene regulation was similar to the microarray analysis, although the response of RPE donor 6 tended to be more transient than that of donors 4 and 5. 
We also examined expression of some of these genes at the protein level. We have reported that vitreous induces increased expression of α-5 integrin protein. 27 Expression of PLAT protein was examined by immunohistochemistry of RPE cells grown in the presence or absence of vitreous for 48 hours and then treated with 5 ng Brefeldin A/mL for 6 hours to prevent secretion of PLAT. Control cells showed little cytoplasmic fluorescence for PLAT (Figs. 2A 2B 2C) . However, vitreous treatment caused increased levels of PLAT protein in virtually all cells (Figs. 2D 2E 2F) . Expression of TFPI-2 protein was examined by immunoblot analysis of extracts from cells grown in the presence or absence of vitreous and treated with 5 ng Brefeldin A/mL for the final 6 hours of treatment. TFPI-2 protein levels were increased in the vitreous-treated cells at both 24 and 48 hours (Fig. 3)
Changes in mRNA levels for an additional eight genes from the SAM FDR < 5% list have been confirmed by qPCR (data not shown). Most attempts to confirm changes in mRNA expression of genes from this list have been successful. Failures were usually because of problems with design of good qPCR primers or because the signal in qPCR was too low. 
We have reported that the mRNA and protein for three genes associated with inflammation, cyclooxygenase-2 (PTGS2), prostaglandin E synthase (PTGES), and heme-oxygenase 1 (HO1) are increased by vitreous 15 35 ; all three geneswere present in the SAM FDR < 5% gene set. Fan et al. 14 observed vitreous-induced increases in expression of genes associated with inflammation in a human RPE continuous cell line (ARPE-19). Consistent with this, gene ontology analysis of the SAM FDR < 5% gene set showed that categories associated with inflammation and stress (response to stress, cytokine activity, innate immune response) were significantly overrepresented (EASE score <0.05) in the vitreous-induced genes. However, there was little overlap with the 24 vitreous-regulated genes identified by Fan et al. 14 in ARPE-19 cells. This could be because they used cDNA arrays with only 588 genes represented, or differences in the type of cells, the exact details of the vitreous treatment, or other aspects of the array methodology. 
We have reported that 48 hours of vitreous treatment results in decreased levels of fibroblast growth factor 2 (FGF2) mRNA and protein and that FGF2 downregulation plays an important role in the response to vitreous. 12 27 FGF2 was downregulated at 48 hours on the arrays for donors 1 and 3 (ratio of vitreous to control 0.49 and 0.51, respectively) but not in donor 2 (ratio 1.25). Interpretation of the array data is complicated, because the arrays only detect the largest of the four forms of FGF2 mRNA found in RPE cells 36 and thus may give misleading results. Even if donor 2 failed to downregulate FGF2, it is likely that signaling via the FGF pathway decreased, since FGF1, FGF5, and fibroblast growth factor receptor-2 (FGFR2) were all significantly downregulated (SAM analysis, FDR < 5%). In addition, vitreous contains soluble FGFRs, which would sequester FGF2 37 and opticin, which inhibits the FGF2 pathway (Le Goff MM, et al. IOVS 2005;46:ARVO E-Abstract 451). 
Pathway Analysis of Genes Modulated by Vitreous
The Genetic Information Processing, Environmental Information Processing and Cell Processes pathways from the KEGG database were analyzed with the WebGestalt program. Table 3shows the results for all pathways identified as significantly (P < 0.05) overrepresented in the SAM FDR < 5% or the stringent subset of vitreous-modulated genes compared with the total gene set on the microarrays. Of the six pathways identified as the most significantly (P < 0.01) overrepresented in the stringent gene set, five (extracellular matrix–receptor interaction, focal adhesion, TGF-β signaling, cell communication, and hematopoietic cell lineage pathways) were also among the most significantly (P < 0.01) overrepresented in the SAM FDR < 5% gene list. Because epithelioid RPE cells in culture tend to stay associated with each other after cell division, whereas vitreous-treated cells tend to migrate away from each other, 27 the overrepresentation of genes associated with the focal adhesion pathway (Table 4)was of interest. The downregulation of the mRNA for genes associated with tight junctions at later times (Table 5)was also consistent with less close contact between cells. The overrepresentation of genes associated with the TGFβ/BMP pathway (Table 6 , Fig. 4 ) was noteworthy because it has been proposed that TGFβ plays an important role in PVR. 38 Table 6includes six additional genes (RUNX2, POSTN1, DLX2, BAMBI, LAPTM5, and NBL1) from the SAM FDR < 5% gene set that are strongly associated with the TGFβ and/or BMP pathways but that were not in the KEGG pathway gene list. 
Effects of Vitreous on Expression of BMP-2 and Periostin mRNA
Because the potential involvement of the BMP-2 arm of the TGFβ/BMP-2 pathway (Fig. 4)was intriguing, mRNA levels for BMP-2 and periostin (a target of BMP-2 signaling, SAM [FDR < 5%] gene set) were measured by qPCR (Table 7) . Both were significantly upregulated by vitreous. Upregulation of periostin appeared to be later than that of BMP-2, as would be expected if it were a downstream target of BMP-2 signaling. 
Immunohistochemistry and Immunoblot Analysis of BMP-2
To determine whether vitreous modulates the levels of BMP-2 protein, RPE cells were grown in the presence or absence of vitreous for 48 hours and then treated with 5 ng Brefeldin A/mL for 6 hours to prevent secretion of BMP-2. Cells were stained using anti-human BMP-2 antibody to detect intracellular BMP-2 and were also stained for F-actin so that the proportion of cells expressing BMP-2 could be determined. Control cells showed little cytoplasmic fluorescence for BMP-2 (Figs. 5Aa-Ac ; the apparent nuclear fluorescence may be due to nonspecific binding). However, vitreous-treatment caused increased levels of BMP-2 protein in virtually all cells (Figs. 5Ad-f)
Immunoblot analysis indicated that treatment of the cells for 42 hours with vitreous followed by 6 hours with Brefeldin A resulted in the accumulation of a protein with an apparent molecular weight of ∼42 kDa that bound anti-human BMP-2 antibodies (Fig. 5B) . This size of protein was consistent with the molecular weight of pro-BMP-2 (the expected form of BMP-2, since Brefeldin A should inhibit processing of pro-BMP-2). 
Discussion
Oligonucleotide microarray technology enables mRNA levels for many genes to be examined simultaneously. Changes in mRNA levels are often (although not always) a good indication of changes in the expression of the corresponding protein. Thus, knowledge of global changes in mRNAs is valuable for our understanding of how cells respond to changes in their environment. In the present work, we examined the effects of vitreous treatment on low-passage human RPE cells, since this may help to elucidate early changes in gene expression in RPE cells in PVR. Biological variation is to be expected when cells from different donors are used. For example, variations in the repertoire of retinal gene expression between normal individuals have been reported. 39 Using differential display methodology, we observed that some vitreous-induced gene changes were dependent on a particular RPE donor or a particular vitreous donor, whereas other gene changes were common to multiple RPE and vitreous donors. 12 In the present study the use of multiple RPE donors and multiple vitreous donors served a filtering function enabling us to remove responses specific to a particular donor due to genetics, phenotypic changes, undetected disease processes, and medications. This may in part explain the high validation rate of independent RPE–vitreous donor combinations using qPCR. 
The number of vitreous-modulated genes increased from 6 to 48 hours of vitreous treatment, indicative of a gradual and major reprogramming of cell functions. Some changes were consistent with an alteration from epithelial-like to more motile and fibroblast-like cells. For example, genes in the tight junction pathway were downregulated by vitreous (Table 5) . Keratins 18 (KRT18) and 20 (KRT20), typical of simple epithelia 40 and collagen IV (COL4A), a typical component of epithelial cell basement membranes, 41 were also downregulated. Integrin α5 (ITGA5) is typically upregulated during epithelial–mesenchymal transformation. 28 We have shown integrin α5 protein is increased by vitreous treatment, 27 and in this study we report that the mRNA was upregulated. Slug is a transcriptional repressor associated with EMT in development and cancer 29 and epithelial cell migration during wound healing. 42 Slug and integrin α5 both have antiapoptotic effects, 43 44 and increased expression of such factors could promote survival of RPE cells after detachment from the basement membrane during the early stages of PVR. Downregulated genes with expression that is associated with the differentiated state of RPE cells included MITF (microphthalmia-associated transcription factor), which is associated with RPE development 45 ; ezrin (VIL2), which is important in the long apical RPE microvilli 1 ; and retinol dehydrogenase 5 (RDH5) which participates in the RPE visual cycle. 1  
The TGFβ/BMP pathway was significantly overrepresented in the vitreous-modulated genes. TGF-β and BMP belong to the TGFβ superfamily of growth factors, both have been implicated in EMT 46 47 and both can induce Slug. 29 TGF-β is known to play an important role in wound-healing and fibrosis and it has been postulated that it plays a role in PVR. In a mouse model of PVR, signaling via SMAD3 (a downstream target of TGFβ) is necessary for PVR, for transdifferentiation of RPE cells and for RPE cell expression of the myofibroblast marker, smooth muscle actin. 48 Normal vitreous contains TGFβ2, and levels of this cytokine have been reported to be elevated in PVR. 49 50 51 52 53 Hence, vitreous treatment may be expected to activate TGF-β signaling, and we have preliminary evidence that TGF-β signaling plays a role in vitreous-induced phenotypic changes in low-passage human RPE cells 35 (Parapuram S, Li L, Ganti R, Hunt RC, Hunt DM, unpublished data, 2004–2006). From the array data, it appeared that the TGFβ-dependent arm of the pathway might be downregulated at later times, since expression of mRNA for TGFβ2, the major form of TGFβ made by RPE cells, 54 and its receptor TGFβR1 was decreased at 12 to 48 and 24 to 48 hours, respectively. The decrease in thrombospondin-1 (THBS1) and increase in latent TGFβ-binding protein (LTBP1) expression could result in less activation and more sequestration of TGFβ. 55 CTGF has been reported to be induced by TGFβ, to prolong TGFβ signaling, and to be important in some of the profibrotic effects of TGFβ. 56 Thus, although downregulation of CTGF mRNA was unexpected in view of some of the models of the initial events in PVR, 31 this finding would fit with the concept of decreased TGFβ signaling at later times in vitreous-treated RPE cells. In PVR, RPE cells can acquire myofibroblast-like properties, and TGFβ and CTGF play important roles in myofibroblast differentiation, 56 which is associated with increased smooth muscle actin (ACTA2) expression. ACTA2 mRNA expression was decreased at later times, which would also be consistent with a downregulation of the TGFβ/CTGF pathway. Thus, although the vitreous-treated RPE cells have some features of fibroblasts, they may not be differentiating into myofibroblasts in this system, at least at the times examined. NRK fibroblasts treated with TGFβ and CTGF do not differentiate into myofibroblasts if they are still proliferating 57 and our experiments were performed with subconfluent cells in the presence of serum. Thus, even if TGFβ and CTGF were present and functional at early times, they may not be able to induce full myofibroblast differentiation in the subconfluent system. The fact that genes upregulated by vitreous did not include genes associated with fibrotic extracellular matrix production such as fibronectin or collagen I would be consistent with this. Thus, cultured, vitreous-treated RPE cells may be able to control fibrotic and myofibroblast responses induced by TGFβ by downregulation of the TGFβ pathway at later times, at least in subconfluent conditions. In vivo, additional factors, including variation between individuals in patterns of gene expression, 39 may interfere with this protective mechanism and contribute to the disease progression and fibrosis. 
The array data were consistent with upregulation of the BMP-2 pathway. BMP-2 mRNA and protein were increased (Table 7 , Fig. 5 ), and the BMP pathway inhibitors BAMBI, NBL1 and smurf2 were downregulated. In addition, periostin, runx2, DLX2, and ID1 have all been reported to be targets of BMP-2 signaling 58 59 60 and all were upregulated. Of interest, in view of the fact that ID1 can suppress myogenesis, 60 expression of genes related to muscle development was significantly downregulated in vitreous-treated cells. Although runx2, periostin, and ID1 are typically BMP targets, they can also be targets of the TGFβ pathway. 61 62 63 There is cross-talk between the TGFβ and BMP pathways, 64 and a balance between these pathways may be important in the effects of vitreous on RPE cells. 
Our results show that many of the effects of vitreous treatment on gene expression by RPE cells are consistent with what might be expected in early PVR. These include major changes in gene expression, upregulation of genes associated with stress and inflammation, downregulation of genes associated with epithelial cells and upregulation of genes associated with migration. The TGFβ pathway has already been implicated in PVR, but from the array data, it is possible that signaling via other members of the TGFβ family such as BMP-2 may also be important. 
 
Table 1.
 
Primers Used in qPCR
Table 1.
 
Primers Used in qPCR
Gene Symbol Sense Primer Antisense Primer E*
Normalization gene
 Ribosomal protein, large, P0 RPLP0 TTAAACCCCCTCGTGGCAATC CCACATTCCCCCGGATATGA 92%
Validation genes
 Integrin, alpha 5 ITGA5 CCCCACCCTCATTCTACTGA GCCCCATTTGAGTTCTGATTC 90%
 Snail homolog 2, Slug SNAI2 AGTGATTATTTCCCCGTATCT GGAGAGAGGCCATTGGGTAGC 94%
 Spermidine/spermine N1-acetyltransferase SAT CATACTGCGGCTGATCAA GCCAATCCACGGGTCATAGGT 98%
 Tissue factor pathway inhibitor 2 TFPI2 CAACGCCAACAATTTCTACAC CGCAGAAGCCCATACAAGTA 93%
 Tissue plasminogen activator PLAT CGATGGCCGCATGACTT CGGGTGTTCCTGGTCACGGTC 96%
 Collagen, type IV, alpha 1 COL4A1 TCACGGGGGAAAACATAAGAC TCGATGAATGGCGCACTT 91%
 Connective tissue growth factor CTGF CATCTTCGGTGGTACGGTGTA CAGGCAGTTGGCTCTAATCATAG 89%
 Thrombospondin 1 THBS1 GCCGGCGTGAAGTGTACTAGC TTGGCCGTGGCATGTTCGAC 97%
 Aggrecanase-2 ADAMTS5 GGTGGTGCTAGGCGACAAG CACATAAATCCTCCCGAGTAA 92%
 Transferrin receptor TFRC GCCCAGCAGAAGCATTATCTT TATAGAAATTGCCCAGTAACC 93%
Additional TGF/BMP pathway genes
 Bone morphogenetic protein 2 BMP2 CCCGACACTGAGACGCTGTTC GGGGAAGCAGCAACGCTAGAA 97%
 Periostin, osteoblast specific factor POSTN CGGATCTTGTGGCCCAATTAG TCCAGTATTTGCCCGTTGTAA 95%
Figure 1.
 
The number of genes whose expression is significantly upregulated (▪) or downregulated ( Image not available ) at the mRNA level by vitreous (SAM analysis, < 5% FDR) at each time point are shown.
Figure 1.
 
The number of genes whose expression is significantly upregulated (▪) or downregulated ( Image not available ) at the mRNA level by vitreous (SAM analysis, < 5% FDR) at each time point are shown.
Table 2.
 
Comparison of Vitreous-Induced Changes in mRNA Expression Determined by Microarray Analysis or by qPCR Analysis
Table 2.
 
Comparison of Vitreous-Induced Changes in mRNA Expression Determined by Microarray Analysis or by qPCR Analysis
GenBank Accession and Symbol* Gene Description Microarray Average (Donors 1–3), † QPCR Donors 4–6, ‡
6 h 12 h 24 h 48 h 6 h 12 h 24 h 48 h
Upregulated genes
 NM_002205 Integrin, alpha 5 1.8 2.3 2.1 1.6 2.4 2.6 3.2 1.9
ITGA5 2.4 2.1 1.7 1.1
1.7 1.1 2.3 1.4
 BC014890 Snail homolog 2 (slug) 1.3 1.7 2.4 1.7 2.1 4.7 5.6 3.3
SNAI2 2.0 2.1 2.3 4.1
0.6 0.9 0.9 2.4
 NM_002970 Spermidine/spermine N1-acetyltransferase 2.1 2.1 2.1 1.1 1.2 2.7 2.6 0.9
SAT 3.2 3.5 2.8 3.4
1.9 2.5 2.5 1.0
 NM_006528 Tissue factor pathway inhibitor 2 2.1 2.7 3.4 3.1 2.5 3.0 3.3 3.6
TFPI2 5.3 5.9 5.5 3.0
4.0 5.9 5.8 7.2
 NM_000930 Plasminogen activator, tissue 2.1 3.0 2.3 1.6 4.2 11.6 13.0 2.6
PLAT 4.1 7.8 4.7 2.9
3.5 5.5 2.7 5.6
Downregulated genes
 NM_001845 Collagen, type IV, alpha 1 0.8 0.9 0.5 0.5 0.8 0.7 0.5 0.4
COL4A1 0.9 0.9 0.6 0.3
1.0 0.7 0.7 0.6
 NM_001901 Connective tissue growth factor 1.1 0.7 0.6 0.4 1.3 0.6 0.3 0.3
CTGF 1.1 0.8 0.6 0.4
1.2 0.7 0.7 1.4
 BC015134 Thrombospondin 1 1.0 0.8 0.6 0.4 0.7 0.5 0.3 0.3
 NM_003246 0.9 0.5 0.5 0.4 0.7 0.4 0.3 0.3
THBS1 0.9 0.4 0.5 1.0
 NM_007038 ADAMTS5 (aggrecanase-2) 0.4 0.2 0.2 0.1 0.5 0.2 0.1 0.1
ADAMTS5 0.3 0.2 0.2 0.1
0.5 0.2 0.3 0.1
 NM_003234 Transferrin receptor 0.3 0.5 0.5 0.6 0.2 0.4 0.3 0.3
TFRC 0.2 0.4 0.5 0.6
0.2 0.4 0.5 1.0
Figure 2.
 
Effect of vitreous on protein expression of tissue plasminogen activator (PLAT). RPE cells (donor 7) were grown for 54 hours in either control medium (AC, GI) or medium with 25% vitreous (DF), with Brefeldin A (5 ng/mL) present from 48 to 54 hours. The cells were then stained with anti-human PLAT antibodies or phalloidin (to stain F-actin) (A, D) staining for PLAT; (G) staining as for PLAT but with the primary antibody omitted; (B, E, H) phalloidin staining; (C, F) merged images of anti-human PLAT and phalloidin-stained cells; (I) merged images in (G) and (H).
Figure 2.
 
Effect of vitreous on protein expression of tissue plasminogen activator (PLAT). RPE cells (donor 7) were grown for 54 hours in either control medium (AC, GI) or medium with 25% vitreous (DF), with Brefeldin A (5 ng/mL) present from 48 to 54 hours. The cells were then stained with anti-human PLAT antibodies or phalloidin (to stain F-actin) (A, D) staining for PLAT; (G) staining as for PLAT but with the primary antibody omitted; (B, E, H) phalloidin staining; (C, F) merged images of anti-human PLAT and phalloidin-stained cells; (I) merged images in (G) and (H).
Figure 3.
 
Effect of vitreous on protein expression of TFPI-2. RPE cells (donor 8) were grown for 24 or 48 hours in either control medium (C24, C48) or medium with 25% vitreous (V24, V48) with Brefeldin A (5 ng/mL) present for the last 6 hours. The extracts were subjected to immunoblotting with anti-human TFPI-2 antibodies.
Figure 3.
 
Effect of vitreous on protein expression of TFPI-2. RPE cells (donor 8) were grown for 24 or 48 hours in either control medium (C24, C48) or medium with 25% vitreous (V24, V48) with Brefeldin A (5 ng/mL) present for the last 6 hours. The extracts were subjected to immunoblotting with anti-human TFPI-2 antibodies.
Table 3.
 
Pathways Significantly Enriched in the Vitreous-Modulated Gene Sets
Table 3.
 
Pathways Significantly Enriched in the Vitreous-Modulated Gene Sets
Pathway* Gene Set Examined
Stringent SAM (FDR < 5%)
Genes P Genes P
ECM-receptor interaction 6 0.000 14 0.003
Hematopoietic cell lineage 6 0.000 13 0.007
Cytokine-cytokine receptor interaction 9 0.001 23 0.097, †
TGF-beta signaling pathway 5 0.002 12 0.009
Cell communication 5 0.002 16 0.002
Focal adhesion 7 0.007 34 0.000
Complement and coagulation cascades 3 0.038 10 0.024
MAPK signaling pathway 41 0.000
Circadian rhythm 5 0.002
Long-term potentiation 12 0.002
Wnt signaling pathway 18 0.014
Tight junction 15 0.016
Hedgehog signaling pathway 8 0.026
Adherens junction 10 0.038
Table 4.
 
Vitreous-Modulated Genes in the Focal Adhesion Pathway
Table 4.
 
Vitreous-Modulated Genes in the Focal Adhesion Pathway
GenBank Accession Gene Description Symbol Ratio Vitreous/Control*
6 h 12 h 24 h 48 h
Upregulated genes
 NM_001166 Baculoviral IAP repeat-containing 2 BIRC2 1.59 1.59 1.30 0.77
 AK056838 Calpain 2, (m/II) large subunit CAPN2 0.87 1.04 1.87 2.02
 NM_002203 Integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) ITGA2 1.53 1.60 2.33 1.42
 NM_002205 Sorting nexin 11 ITGA5 1.76 2.25 2.08 1.55
 NM_002290 Laminin, alpha 4 LAMA4 1.07 1.10 1.28 1.59
 NM_002291 Laminin, beta 1 LAMB1 1.27 1.61 1.87 1.48
 NM_000228 Laminin, beta 3 LAMB3 2.65 1.63 1.43 1.14
 NM_002293 Laminin, gamma 1 (formerly LAMB2) LAMC1 1.31 1.54 1.03 0.71
 AF022375 Vascular endothelial growth factor VEGF 1.98 1.61 0.60 0.48
Downregulated genes
 NM_001102 Actinin, alpha 1 ACTN1 0.83 0.84 0.72 0.65
 AF070674 Baculoviral IAP repeat-containing 3 BIRC3 2.30 1.47 0.51 0.27
 NM_001749 Calpain, small subunit 1 CAPNS1 1.11 1.47 0.62 1.15
 NM_001759 Cyclin D2 CCND2 1.13 1.07 0.84 0.48
 NM_001854 Collagen, type XI, alpha 1 COL11A1 0.80 0.58 0.58 0.74
 NM_001845 Collagen, type IV, alpha 1 COL4A1 0.83 0.88 0.48 0.46
 AK023345 Diaphanous homolog 1 (Drosophila) DIAPH1 0.85 0.87 0.48 1.83
 AK055601 FERM, RhoGEF and pleckstrin domain protein 2 FARP2 1.13 1.08 0.77 0.66
 AY014272 Actin-like protein FKSG30 0.97 0.87 0.61 0.85
 AK056699 FYN oncogene related to SRC, FGR, YES FYN 0.67 0.58 0.50 0.70
 AF109681 Integrin, alpha 11 ITGA11 1.24 0.88 0.80 0.35
 NM_000419 Integrin, alpha 2b (CD41) ITGA2B 0.74 0.61 0.40 0.28
 NM_002206 Integrin, alpha 7 ITGA7 1.04 0.84 0.59 0.82
 NM_053025 Myosin, light polypeptide kinase MYLK 0.88 0.82 0.66 0.78
 NM_002524 Neuroblastoma RAS viral (v-ras) oncogene homolog NRAS 0.93 0.87 0.89 0.68
 NM_016205 Platelet derived growth factor C PDGFC 0.80 0.79 0.78 0.59
 NM_002609 Platelet-derived growth factor receptor, beta polypeptide PDGFRB 0.75 0.56 0.60 0.95
 NM_014308 Phosphoinositide-3-kinase, regulatory subunit 5, p101 PIK3R5 0.67 0.70 0.54 0.45
 NM_002480 Protein phosphatase 1, regulatory (inhibitor) subunit 12A PPP1R12A 0.85 0.74 0.82 0.65
 AK055431 Protein kinase C, alpha PRKCA 0.82 0.75 0.71 0.67
 NM_002738 Protein kinase C, beta 1 PRKCB1 0.72 1.36 0.92 0.49
 NM_012250 Related RAS viral (r-ras) oncogene homolog 2 RRAS2 1.02 1.05 0.80 0.63
 NM_003246 Thrombospondin 1 THBS1 0.90 0.47 0.47 0.43
 AL049689 Tenascin N TNN 0.74 0.88 1.01 0.66
 AF022375 Vascular endothelial growth factor VEGF 1.98 1.61 0.60 0.48
 NM_003461 Zyxin ZYX 1.07 0.87 0.63 0.76
Table 5.
 
Vitreous-Modulated Genes in the Tight-Junction Pathway
Table 5.
 
Vitreous-Modulated Genes in the Tight-Junction Pathway
GenBank Accession Gene Description Symbol Ratio Vitreous/Control*
6 h 12 h 24 h 48 h
NM_001102 Actinin, alpha 1 ACTN1 0.83 0.84 0.72 0.65
NM_020770 Cingulin CGN 0.88 0.63 0.71 1.03
AF101051 Claudin 1 CLDN1 0.67 0.82 0.71 0.47
NM_001306 Claudin 3 CLDN3 0.66 0.67 0.47 1.02
NM_005231 Cortactin CTTN 0.90 0.91 0.64 0.57
AY014272 Actin-like protein FKSG30 0.97 0.87 0.61 0.85
NM_002069 Guanine nucleotide binding protein, alpha inhibiting activity polypeptide 1 GNAI1 0.68 0.61 0.67 0.56
NM_005799 InaD-like (Drosophila) INADL 0.94 0.80 0.55 0.81
NM_002524 Neuroblastoma RAS viral (v-ras) oncogene homolog NRAS 0.93 0.87 0.89 0.68
NM_016948 Par-6 partitioning defective 6 homolog alpha (C.elegans) PARD6A 1.02 0.81 0.65 0.75
NM_004156 Protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform PPP2CB 1.04 1.02 0.90 0.67
AK055431 Protein kinase C, alpha PRKCA 0.82 0.75 0.71 0.67
NM_002738 Protein kinase C, beta 1 PRKCB1 0.72 1.36 0.92 0.49
AK002107 RAB3B, member RAS oncogene family RAB3B 0.98 1.03 0.96 0.59
NM_012250 Related RAS viral (r-ras) oncogene homolog 2 RRAS2 1.02 1.05 0.80 0.63
Table 6.
 
Vitreous-Modulated Genes in the TGF-β/BMP Pathway
Table 6.
 
Vitreous-Modulated Genes in the TGF-β/BMP Pathway
GenBank Accession Gene Description Symbol Ratio Vitreous/Control*
6 h 12 h 24 h 48 h
Upregulated genes
 NM_001200 Bone morphogenetic protein 2 BMP2 2.13 2.43 1.38 1.02
 NM_004405 Distal-less homeobox 2 DLX2 3.07 1.89 0.62 0.51
 NM_002165 Inhibitor of DNA binding 1 ID1 1.11 1.40 1.86 1.69
 NM_000627 Latent transforming growth factor beta binding protein 1 LTBP1 1.11 1.23 1.65 1.23
 NM_006475 Periostin, osteoblast specific factor POSTN 0.97 1.22 1.78 1.75
 AL353944 Runt-related transcription factor 2 RUNX2 0.80 1.38 1.92 1.59
Downregulated genes
 NM_012342 BMP and activin membrane-bound inhibitor homolog BAMBI 0.49 0.60 0.54 0.82
 NM_001719 Bone morphogenetic protein 7 (osteogenic protein 1) BMP7 0.84 0.75 0.59 0.75
 NM_004405 Distal-less homeobox 2 DLX2 3.07 1.89 0.62 0.51
 BC014469 Cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4) CDKN2B 0.99 0.95 0.56 0.76
 BC014941 Inhibitor of DNA binding 4 ID4 0.37 0.41 0.68 0.51
 NM_006762 Lysosomal associated multispanning membrane protein 5 LAPTM5 0.86 0.79 0.48 0.55
 NM_002467 V-myc myelocytomatosis viral oncogene homolog MYC 1.30 1.07 1.09 0.68
 NM_005380 Neuroblastoma, suppression of tumorigenicity 1 (DAN) NBL1 1.22 1.15 1.01 0.67
 NM_004156 Protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform PPP2CB 1.04 1.02 0.90 0.67
 AK002019 SMAD specific E3 ubiquitin protein ligase 2 SMURF2 1.31 1.24 0.62 0.42
 NM_022739 SMAD specific E3 ubiquitin protein ligase 2 SMURF2 1.38 1.56 0.94 0.39
 AK021874 Transforming growth factor, beta 2 TGFB2 0.64 0.43 0.42 0.51
 NM_003238 Transforming growth factor, beta 2 TGFB2 0.81 0.69 0.66 0.67
 AK002171 Transforming growth factor, beta receptor TGFBR1 0.80 0.68 0.52 0.45
 NM_003246 Thrombospondin 1 THBS1 0.90 0.47 0.47 0.43
 BC015134 Thrombospondin 1 THBS1 0.96 0.82 0.56 0.41
Figure 4.
 
Vitreous-modulated genes in the TGFβ/BMP pathway. Orange: upregulated by vitreous; blue: downregulated by vitreous; orange/blue: upregulated at earlier times, downregulated at later times. Adapted from KEGG pathway hsa04350.
Figure 4.
 
Vitreous-modulated genes in the TGFβ/BMP pathway. Orange: upregulated by vitreous; blue: downregulated by vitreous; orange/blue: upregulated at earlier times, downregulated at later times. Adapted from KEGG pathway hsa04350.
Table 7.
 
Effect of Vitreous Treatment on Expression of BMP-2 and Periostin mRNAs
Table 7.
 
Effect of Vitreous Treatment on Expression of BMP-2 and Periostin mRNAs
GenBank Accession and Symbol* Gene Microarray Average (Donors 1–3)† QPCR Donors 4–6‡
6 h 12 h 24 h 48 h 6 h 12 h 24 h 48 h
NM_001200 Bone morphogenetic protein 2 2.1 2.4 1.4 1.0 3.1 2.6 2.8 0.7
BMP2 3.3 4.3 1.1 1.7
3.0 3.0 0.9 0.9
NM_006475 Periostin, osteoblast specific factor 1.0 1.2 1.8 1.7 1.0 1.0 1.2 1.9
POSTN 2.3 4.6 4.1 6.8
1.1 1.9 1.4 1.4
Figure 5.
 
Effect of vitreous on BMP protein expression. (A) RPE cells (donor 7) were grown for 54 hours in either control medium (A aA c, AgA i) or medium with 25% vitreous (AdA f), with Brefeldin A (5 ng/mL) present from 48 to 54 hours. The cells were then stained using anti-human BMP-2 antibodies or phalloidin (to stain F-actin). (A a, A d) Staining for BMP-2; (A g) staining as for BMP-2 but with the primary antibody omitted; (A b, A e, A h) phalloidin staining; (A c, A f) merged images of anti-BMP-2 and phalloidin-stained cells; (i) images in (g) and (h) merged. (B) RPE cells (donor 9) were grown for 24 or 48 hours in either control medium (c24, c48) or medium with 25% vitreous (v24, v48) with Brefeldin A (5 ng/mL) present from for the last 6 hours. A549 cell extract was the positive control (m). The extracts were subjected to immunoblot analysis with anti-human BMP-2 antibodies.
Figure 5.
 
Effect of vitreous on BMP protein expression. (A) RPE cells (donor 7) were grown for 54 hours in either control medium (A aA c, AgA i) or medium with 25% vitreous (AdA f), with Brefeldin A (5 ng/mL) present from 48 to 54 hours. The cells were then stained using anti-human BMP-2 antibodies or phalloidin (to stain F-actin). (A a, A d) Staining for BMP-2; (A g) staining as for BMP-2 but with the primary antibody omitted; (A b, A e, A h) phalloidin staining; (A c, A f) merged images of anti-BMP-2 and phalloidin-stained cells; (i) images in (g) and (h) merged. (B) RPE cells (donor 9) were grown for 24 or 48 hours in either control medium (c24, c48) or medium with 25% vitreous (v24, v48) with Brefeldin A (5 ng/mL) present from for the last 6 hours. A549 cell extract was the positive control (m). The extracts were subjected to immunoblot analysis with anti-human BMP-2 antibodies.
Supplementary Materials
Appendix A - 19.3 MB (.xls) 
The ratio of vitreous/control mRNA expression levels for all genes on the microarray determined using Genespring software. The first worksheet contains the data, the second worksheet has a key explaining the column headings on the first worksheet. 
Appendix B - 313 KB (.xls) 
The SAM (FDR<5%) gene list, including the GenBank Accession Number (column A), the Gene Description and HGNC symbol (columns B and C), whether vitreous caused up- or down-regulation of the gene (column D), the times at which the gene was found to be regulated (SAM analysis, 5% False Discovery Rate) (column E), the average of the ratio of expression in vitreous/control cells for all three donors at 6, 12, 24, or 48 hrs (columns F-I) as determined from the microarray data, and whether the gene is included in the stringent gene list (Column J). 
Appendix C - 63.5 KB (.xls) 
The stringent gene list, including the GenBank Accession Number (column A), the Gene Description and HGNC symbol (columns B and C), whether vitreous caused up- or down-regulation of the gene (column D), the times at which the gene was found to be regulated (SAM analysis, 5% False Discovery Rate) (columns E-H), and the average of the ratio of expression in vitreous/control cells for all three donors at 6, 12, 24, or 48 hrs (columns I-L) as determined from the microarray data. 
The authors thank Saravan Chaturvedi for help with database construction. 
StraussO. The retinal pigment epithelium in visual function. Physiol Rev. 2005;85:845–881. [CrossRef] [PubMed]
CampochiaroPA. Pathogenic mechanisms in proliferative vitreoretinopathy. Arch Ophthalmol. 1997;115:237–241. [CrossRef] [PubMed]
PastorJC. Proliferative vitreoretinopathy: an overview. Surv Ophthalmol. 1998;43:3–18. [CrossRef] [PubMed]
MachemerR. Proliferative vitreoretinopathy (PVR): a personal account of its pathogenesis and treatment. Invest Ophthalmol Vis Sci. 1988;29:1771–1783. [PubMed]
HiscottP, SheridanC, MageeRM, GriersonI. Matrix and the retinal pigment epithelium in proliferative retinal disease. Prog Retin Eye Res. 1999;18:167–190. [CrossRef] [PubMed]
MandelcornMS, MachemerR, FinebergE, HerschSB. Proliferation and metaplasia of intravitreal retinal pigment epithelium cell autotransplants. Am J Ophthalmol. 1975;80:227–237. [CrossRef] [PubMed]
Vidaurri-LealJ, HohmanR, GlaserBM. Effect of vitreous on morphologic characteristics of retinal pigment epithelial cells: a new approach to the study of proliferative vitreoretinopathy. Arch Ophthalmol. 1984;102:1220–1223. [CrossRef] [PubMed]
KirchhofB, SorgenteN. Pathogenesis of proliferative vitreoretinopathy: modulation of retinal pigment epithelial cell functions by vitreous and macrophages. Dev Ophthalmol. 1989;16:1–53. [PubMed]
PastorJC, de la RuaER, MartinF. Proliferative vitreoretinopathy: risk factors and pathobiology. Prog Retin Eye Res. 2002;21:127–144. [CrossRef] [PubMed]
CampochiaroPA. Retinal and choroidal neovascularization. J Cell Physiol. 2000;184:301–310. [CrossRef] [PubMed]
NagasakiH, ShinagawaK, MochizukiM. Risk factors for proliferative vitreoretinopathy. Prog Retin Eye Res. 1998;17:77–98. [CrossRef] [PubMed]
HuntDM, ChenW, HuntRC. Vitreous treatment of retinal pigment epithelial cells results in decreased expression of FGF-2. Invest Ophthalmol Vis Sci. 1998;39:2111–2120. [PubMed]
KociokN, HueberA, EsserP, et al. Vitreous treatment of cultured human RPE cells results in differential expression of 10 new genes. Invest Ophthalmol Vis Sci. 2002;43:2474–2480. [PubMed]
FanW, ZhengJJ, PeiperSC, McLaughlinBJ. Changes in gene expression of ARPE-19 cells in response to vitreous treatment. Ophthalmic Res. 2002;34:357–365. [CrossRef] [PubMed]
ParapuramSK, GantiR, HuntRC, HuntDM. Vitreous induces components of the prostaglandin E2 pathway in human retinal pigment epithelial cells. Invest Ophthalmol Vis Sci. 2003;44:1767–1774. [CrossRef] [PubMed]
DavisAA, BernsteinPS, BokD, TurnerJ, NachtigalM, HuntRC. A human retinal pigment epithelial cell line that retains epithelial characteristics after prolonged culture. Invest Ophthalmol Vis Sci. 1995;36:955–964. [PubMed]
TusherVG, TibshiraniR, ChuG. Significance analysis of microarrays applied to the ionizing radiation response. Proc Natl Acad Sci USA. 2001;98:5116–5121. [CrossRef] [PubMed]
DiehnM, SherlockG, BinkleyG, et al. SOURCE: a unified genomic resource of functional annotations, ontologies, and gene expression data. Nucleic Acids Res. 2003;31:219–223. [CrossRef] [PubMed]
HosackDA, DennisG, Jr, ShermanBT, LaneHC, LempickiRA. Identifying biological themes within lists of genes with EASE. Genome Biol. 2003;4:R70. [CrossRef] [PubMed]
ZhangB, KirovS, SnoddyJ. WebGestalt: an integrated system for exploring gene sets in various biological contexts. Nucleic Acids Res. 2005;33:W741–W748. [CrossRef] [PubMed]
KanehisaM, GotoS, KawashimaS, OkunoY, HattoriM. The KEGG resource for deciphering the genome. Nucleic Acids Res. 2004;32:D277–D280. [CrossRef] [PubMed]
AshburnerM, BallCA, BlakeJA, et al. Gene ontology: tool for the unification of biology. The Gene Ontology Consortium. Nat Genet. 2000;25:25–29. [CrossRef] [PubMed]
DennisG, Jr, ShermanBT, HosackDA, et al. DAVID: Database for Annotation, Visualization, and Integrated Discovery. Genome Biol. 2003;4:R70. [CrossRef] [PubMed]
KhatriP, BhavsarP, BawaG, DraghiciS. Onto-Tools: an ensemble of web-accessible, ontology-based tools for the functional design and interpretation of high-throughput gene expression experiments. Nucleic Acids Res. 2004;32:W449–W456. [CrossRef] [PubMed]
PfafflMW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001;29:2002–2007.
PfafflMW. Quantification strategies in real-time PCR.BustinSA eds. A-Z of Quantitative PCR. 2004;1–23.International University Line La Jolla, CA.Chap. 3:
MeitingerD, HuntDM, ShihD, FoxJC, HuntRC. Vitreous-induced modulation of integrins in retinal pigment epithelial cells: effects of fibroblast growth factor-2. Exp Eye Res. 2001;73:681–692. [CrossRef] [PubMed]
HayED. An overview of epithelio-mesenchymal transformation. Acta Anat. 1995;154:8–20. [CrossRef] [PubMed]
De CraeneB, Van RoyF, BerxG. Unraveling signalling cascades for the Snail family of transcription factors. Cell Signal. 2005;17:535–547. [CrossRef] [PubMed]
BirchmeierC, BirchmeierW, Brand-SaberiB. Epithelial-mesenchymal transitions in cancer progression. Acta Anat. 1996;156:217–226. [CrossRef] [PubMed]
HintonDR, HeS, JinML, BarronE, RyanSJ. Novel growth factors involved in the pathogenesis of proliferative vitreoretinopathy. Eye. 2002;16:422–428. [CrossRef] [PubMed]
HiscottP, HaganS, HeathcoteL, et al. Pathobiology of epiretinal and subretinal membranes: possible roles for the matricellular proteins thrombospondin 1 and osteonectin (SPARC). Eye. 2002;16:393–403. [CrossRef] [PubMed]
TanakaY, UtsumiJ, MatsuiM, et al. Purification, molecular cloning, and expression of a novel growth-promoting factor for retinal pigment epithelial cells, REF-1/TFPI-2. Invest Ophthalmol Vis Sci. 2004;45:245–252. [CrossRef] [PubMed]
ChenC, YoungBA, ColemanCS, PeggAE, SheppardD. Spermidine/spermine N1-acetyltransferase specifically binds to the integrin alpha9 subunit cytoplasmic domain and enhances cell migration. J Cell Biol. 2004;167:161–170. [CrossRef] [PubMed]
HartungRA, ParapuramSK, GantiR, HuntDM, ChalamKV, HuntRC. Vitreous induces an anti-oxidant response mediated in part by TGF-beta and reactive oxygen species generation in human retinal pigment epithelial cells. Mol Vis. 2007;13:66–78. [PubMed]
BostLM, Aotaki-KeenAE, HjelmelandLM. Coexpression of FGF-5 and bFGF by the retinal pigment epithelium in vitro. Exp Eye Res. 1992;55:727–734. [CrossRef] [PubMed]
HannekenA, BairdA. Soluble forms of the high-affinity fibroblast growth factor receptor in human vitreous fluid. Invest Ophthalmol Vis Sci. 1995;36:1192–1196. [PubMed]
SaikaS. TGFbeta pathobiology in the eye. Lab Invest. 2006;86:106–115. [CrossRef] [PubMed]
ChowersI, LiuD, FarkasRH, et al. Gene expression variation in the adult human retina. Hum Mol Genet. 2003;12:2881–2893. [CrossRef] [PubMed]
ChuPG, WeissLM. Keratin expression in human tissues and neoplasms. Histopathology. 2002;40:403–439. [CrossRef] [PubMed]
BirchmeierC, BirchmeierW. Molecular aspects of mesenchymal-epithelial interactions. Ann Rev Cell Biol. 1993;9:511–540. [CrossRef] [PubMed]
SavagnerP, KusewittDF, CarverEA, et al. Developmental transcription factor Slug is required for effective re-epithelialization by adult keratinocytes. J Cell Physiol. 2005;202:858–866. [CrossRef] [PubMed]
ComeC, ArnouxV, BibeauF, SavagnerP. Roles of the transcription factors Snail and Slug during mammary morphogenesis and breast carcinoma progression. J Mammary Gland Biol Neoplasia. 2004;9:183–193. [CrossRef] [PubMed]
FrischSM, RuoslahtiE. Integrins and anoikis. Curr Opin Cell Biol. 1997;9:701–706. [CrossRef] [PubMed]
Martinez-MoralesJR, RodrigoI, BovolentaP. Eye development: a view from the retina pigmented epithelium. Bioessays. 2004;26:766–777. [CrossRef] [PubMed]
ZavadilJ, BottingerEP. TGF-beta and epithelial-to-mesenchymal transitions. Oncogene. 2005;24:5764–5774. [CrossRef] [PubMed]
ArmstrongEJ, BischoffJ. Heart valve development: endothelial cell signaling and differentiation. Circ Res. 2004;95:459–470. [CrossRef] [PubMed]
SaikaS, Kono-SaikaS, TanakaT, et al. Smad3 is required for dedifferentiation of retinal pigment epithelium following retinal detachment in mice. Lab Invest. 2004;84:1245–1258. [CrossRef] [PubMed]
ConnorTB, Jr, RobertsAB, SpornMB, et al. Correlation of fibrosis and transforming growth factor-beta type 2 levels in the eye. J Clin Invest. 1989;83:1661–1666. [CrossRef] [PubMed]
GaudricA, Glacet-BernardA, ClementG, FalquerhoL, BarritaultD, CoscasG. Transforming growth factor beta in the vitreous of patients with epiretinal proliferation. Ophtalmologie. 1990;4:51–52. [PubMed]
EsserP, HeimannK, Bartz-SchmidtKU, et al. Apoptosis in proliferative vitreoretinal disorders: possible involvement of TGF-beta-induced RPE cell apoptosis. Exp Eye Res. 1997;65:365–378. [CrossRef] [PubMed]
KonCH, OcclestonNL, AylwardGW, KhawPT. Expression of vitreous cytokines in proliferative vitreoretinopathy: a prospective study. Invest Ophthalmol Vis Sci. 1999;40:705–712. [PubMed]
El GhrablyI, PoweDG, OrrG, et al. Apoptosis in proliferative vitreoretinopathy. Invest Ophthalmol Vis Sci. 2004;45:1473–1479. [CrossRef] [PubMed]
PfefferBA, FlandersKC, GuerinCJ, DanielpourD, AndersonD. Transforming growth factor beta 2 is the predominant isoform in the neural retina, retinal pigment epithelium-choroid and vitreous of monkey eye. Exp Eye Res. 1994;59:323–333. [CrossRef] [PubMed]
YueJ, MulderKM. Transforming growth factor-beta signal transduction in epithelial cells. Pharmacol Ther. 2001;91:1–34. [CrossRef] [PubMed]
LeaskA, AbrahamDJ. TGF-beta signaling and the fibrotic response. FASEB J. 2004;18:816–827. [CrossRef] [PubMed]
GrotendorstGR, RahmanieH, DuncanMR. Combinatorial signaling pathways determine fibroblast proliferation and myofibroblast differentiation. FASEB J. 2004;18:469–479. [CrossRef] [PubMed]
HarrisSE, GuoD, HarrisMA, KrishnaswamyA, LichtlerA. Transcriptional regulation of BMP-2 activated genes in osteoblasts using gene expression microarray analysis: role of Dlx2 and Dlx5 transcription factors. Front Biosci. 2003;8:s1249–s1265. [CrossRef] [PubMed]
JiX, ChenD, XuC, HarrisSE, MundyGR, YonedaT. Patterns of gene expression associated with BMP-2-induced osteoblast and adipocyte differentiation of mesenchymal progenitor cell 3T3–F442A. J Bone Miner Metab. 2000;18:132–139. [CrossRef] [PubMed]
Ten DijkeP, KorchynskyiO, ValdimarsdottirG, GoumansMJ. Controlling cell fate by bone morphogenetic protein receptors. Mol Cell Endocrinol. 2003;211:105–113. [CrossRef] [PubMed]
LeeKS, KimHJ, LiQL, et al. Runx2 is a common target of transforming growth factor beta1 and bone morphogenetic protein 2, and cooperation between Runx2 and Smad5 induces osteoblast-specific gene expression in the pluripotent mesenchymal precursor cell line C2C12. Mol Cell Biol. 2000;20:8783–8792. [CrossRef] [PubMed]
HoriuchiK, AmizukaN, TakeshitaS, et al. Identification and characterization of a novel protein, periostin, with restricted expression to periosteum and periodontal ligament and increased expression by transforming growth factor beta. J Bone Miner Res. 1999;14:1239–1249. [CrossRef] [PubMed]
MiyazonoK, MiyazawaK. Id: a target of BMP signaling. Sci STKE. 2002;E40:1–3.
WhitmanM, RafteryL. TGFbeta signaling at the summit. Development. 2005;132:4205–4210. [CrossRef] [PubMed]
Figure 1.
 
The number of genes whose expression is significantly upregulated (▪) or downregulated ( Image not available ) at the mRNA level by vitreous (SAM analysis, < 5% FDR) at each time point are shown.
Figure 1.
 
The number of genes whose expression is significantly upregulated (▪) or downregulated ( Image not available ) at the mRNA level by vitreous (SAM analysis, < 5% FDR) at each time point are shown.
Figure 2.
 
Effect of vitreous on protein expression of tissue plasminogen activator (PLAT). RPE cells (donor 7) were grown for 54 hours in either control medium (AC, GI) or medium with 25% vitreous (DF), with Brefeldin A (5 ng/mL) present from 48 to 54 hours. The cells were then stained with anti-human PLAT antibodies or phalloidin (to stain F-actin) (A, D) staining for PLAT; (G) staining as for PLAT but with the primary antibody omitted; (B, E, H) phalloidin staining; (C, F) merged images of anti-human PLAT and phalloidin-stained cells; (I) merged images in (G) and (H).
Figure 2.
 
Effect of vitreous on protein expression of tissue plasminogen activator (PLAT). RPE cells (donor 7) were grown for 54 hours in either control medium (AC, GI) or medium with 25% vitreous (DF), with Brefeldin A (5 ng/mL) present from 48 to 54 hours. The cells were then stained with anti-human PLAT antibodies or phalloidin (to stain F-actin) (A, D) staining for PLAT; (G) staining as for PLAT but with the primary antibody omitted; (B, E, H) phalloidin staining; (C, F) merged images of anti-human PLAT and phalloidin-stained cells; (I) merged images in (G) and (H).
Figure 3.
 
Effect of vitreous on protein expression of TFPI-2. RPE cells (donor 8) were grown for 24 or 48 hours in either control medium (C24, C48) or medium with 25% vitreous (V24, V48) with Brefeldin A (5 ng/mL) present for the last 6 hours. The extracts were subjected to immunoblotting with anti-human TFPI-2 antibodies.
Figure 3.
 
Effect of vitreous on protein expression of TFPI-2. RPE cells (donor 8) were grown for 24 or 48 hours in either control medium (C24, C48) or medium with 25% vitreous (V24, V48) with Brefeldin A (5 ng/mL) present for the last 6 hours. The extracts were subjected to immunoblotting with anti-human TFPI-2 antibodies.
Figure 4.
 
Vitreous-modulated genes in the TGFβ/BMP pathway. Orange: upregulated by vitreous; blue: downregulated by vitreous; orange/blue: upregulated at earlier times, downregulated at later times. Adapted from KEGG pathway hsa04350.
Figure 4.
 
Vitreous-modulated genes in the TGFβ/BMP pathway. Orange: upregulated by vitreous; blue: downregulated by vitreous; orange/blue: upregulated at earlier times, downregulated at later times. Adapted from KEGG pathway hsa04350.
Figure 5.
 
Effect of vitreous on BMP protein expression. (A) RPE cells (donor 7) were grown for 54 hours in either control medium (A aA c, AgA i) or medium with 25% vitreous (AdA f), with Brefeldin A (5 ng/mL) present from 48 to 54 hours. The cells were then stained using anti-human BMP-2 antibodies or phalloidin (to stain F-actin). (A a, A d) Staining for BMP-2; (A g) staining as for BMP-2 but with the primary antibody omitted; (A b, A e, A h) phalloidin staining; (A c, A f) merged images of anti-BMP-2 and phalloidin-stained cells; (i) images in (g) and (h) merged. (B) RPE cells (donor 9) were grown for 24 or 48 hours in either control medium (c24, c48) or medium with 25% vitreous (v24, v48) with Brefeldin A (5 ng/mL) present from for the last 6 hours. A549 cell extract was the positive control (m). The extracts were subjected to immunoblot analysis with anti-human BMP-2 antibodies.
Figure 5.
 
Effect of vitreous on BMP protein expression. (A) RPE cells (donor 7) were grown for 54 hours in either control medium (A aA c, AgA i) or medium with 25% vitreous (AdA f), with Brefeldin A (5 ng/mL) present from 48 to 54 hours. The cells were then stained using anti-human BMP-2 antibodies or phalloidin (to stain F-actin). (A a, A d) Staining for BMP-2; (A g) staining as for BMP-2 but with the primary antibody omitted; (A b, A e, A h) phalloidin staining; (A c, A f) merged images of anti-BMP-2 and phalloidin-stained cells; (i) images in (g) and (h) merged. (B) RPE cells (donor 9) were grown for 24 or 48 hours in either control medium (c24, c48) or medium with 25% vitreous (v24, v48) with Brefeldin A (5 ng/mL) present from for the last 6 hours. A549 cell extract was the positive control (m). The extracts were subjected to immunoblot analysis with anti-human BMP-2 antibodies.
Table 1.
 
Primers Used in qPCR
Table 1.
 
Primers Used in qPCR
Gene Symbol Sense Primer Antisense Primer E*
Normalization gene
 Ribosomal protein, large, P0 RPLP0 TTAAACCCCCTCGTGGCAATC CCACATTCCCCCGGATATGA 92%
Validation genes
 Integrin, alpha 5 ITGA5 CCCCACCCTCATTCTACTGA GCCCCATTTGAGTTCTGATTC 90%
 Snail homolog 2, Slug SNAI2 AGTGATTATTTCCCCGTATCT GGAGAGAGGCCATTGGGTAGC 94%
 Spermidine/spermine N1-acetyltransferase SAT CATACTGCGGCTGATCAA GCCAATCCACGGGTCATAGGT 98%
 Tissue factor pathway inhibitor 2 TFPI2 CAACGCCAACAATTTCTACAC CGCAGAAGCCCATACAAGTA 93%
 Tissue plasminogen activator PLAT CGATGGCCGCATGACTT CGGGTGTTCCTGGTCACGGTC 96%
 Collagen, type IV, alpha 1 COL4A1 TCACGGGGGAAAACATAAGAC TCGATGAATGGCGCACTT 91%
 Connective tissue growth factor CTGF CATCTTCGGTGGTACGGTGTA CAGGCAGTTGGCTCTAATCATAG 89%
 Thrombospondin 1 THBS1 GCCGGCGTGAAGTGTACTAGC TTGGCCGTGGCATGTTCGAC 97%
 Aggrecanase-2 ADAMTS5 GGTGGTGCTAGGCGACAAG CACATAAATCCTCCCGAGTAA 92%
 Transferrin receptor TFRC GCCCAGCAGAAGCATTATCTT TATAGAAATTGCCCAGTAACC 93%
Additional TGF/BMP pathway genes
 Bone morphogenetic protein 2 BMP2 CCCGACACTGAGACGCTGTTC GGGGAAGCAGCAACGCTAGAA 97%
 Periostin, osteoblast specific factor POSTN CGGATCTTGTGGCCCAATTAG TCCAGTATTTGCCCGTTGTAA 95%
Table 2.
 
Comparison of Vitreous-Induced Changes in mRNA Expression Determined by Microarray Analysis or by qPCR Analysis
Table 2.
 
Comparison of Vitreous-Induced Changes in mRNA Expression Determined by Microarray Analysis or by qPCR Analysis
GenBank Accession and Symbol* Gene Description Microarray Average (Donors 1–3), † QPCR Donors 4–6, ‡
6 h 12 h 24 h 48 h 6 h 12 h 24 h 48 h
Upregulated genes
 NM_002205 Integrin, alpha 5 1.8 2.3 2.1 1.6 2.4 2.6 3.2 1.9
ITGA5 2.4 2.1 1.7 1.1
1.7 1.1 2.3 1.4
 BC014890 Snail homolog 2 (slug) 1.3 1.7 2.4 1.7 2.1 4.7 5.6 3.3
SNAI2 2.0 2.1 2.3 4.1
0.6 0.9 0.9 2.4
 NM_002970 Spermidine/spermine N1-acetyltransferase 2.1 2.1 2.1 1.1 1.2 2.7 2.6 0.9
SAT 3.2 3.5 2.8 3.4
1.9 2.5 2.5 1.0
 NM_006528 Tissue factor pathway inhibitor 2 2.1 2.7 3.4 3.1 2.5 3.0 3.3 3.6
TFPI2 5.3 5.9 5.5 3.0
4.0 5.9 5.8 7.2
 NM_000930 Plasminogen activator, tissue 2.1 3.0 2.3 1.6 4.2 11.6 13.0 2.6
PLAT 4.1 7.8 4.7 2.9
3.5 5.5 2.7 5.6
Downregulated genes
 NM_001845 Collagen, type IV, alpha 1 0.8 0.9 0.5 0.5 0.8 0.7 0.5 0.4
COL4A1 0.9 0.9 0.6 0.3
1.0 0.7 0.7 0.6
 NM_001901 Connective tissue growth factor 1.1 0.7 0.6 0.4 1.3 0.6 0.3 0.3
CTGF 1.1 0.8 0.6 0.4
1.2 0.7 0.7 1.4
 BC015134 Thrombospondin 1 1.0 0.8 0.6 0.4 0.7 0.5 0.3 0.3
 NM_003246 0.9 0.5 0.5 0.4 0.7 0.4 0.3 0.3
THBS1 0.9 0.4 0.5 1.0
 NM_007038 ADAMTS5 (aggrecanase-2) 0.4 0.2 0.2 0.1 0.5 0.2 0.1 0.1
ADAMTS5 0.3 0.2 0.2 0.1
0.5 0.2 0.3 0.1
 NM_003234 Transferrin receptor 0.3 0.5 0.5 0.6 0.2 0.4 0.3 0.3
TFRC 0.2 0.4 0.5 0.6
0.2 0.4 0.5 1.0
Table 3.
 
Pathways Significantly Enriched in the Vitreous-Modulated Gene Sets
Table 3.
 
Pathways Significantly Enriched in the Vitreous-Modulated Gene Sets
Pathway* Gene Set Examined
Stringent SAM (FDR < 5%)
Genes P Genes P
ECM-receptor interaction 6 0.000 14 0.003
Hematopoietic cell lineage 6 0.000 13 0.007
Cytokine-cytokine receptor interaction 9 0.001 23 0.097, †
TGF-beta signaling pathway 5 0.002 12 0.009
Cell communication 5 0.002 16 0.002
Focal adhesion 7 0.007 34 0.000
Complement and coagulation cascades 3 0.038 10 0.024
MAPK signaling pathway 41 0.000
Circadian rhythm 5 0.002
Long-term potentiation 12 0.002
Wnt signaling pathway 18 0.014
Tight junction 15 0.016
Hedgehog signaling pathway 8 0.026
Adherens junction 10 0.038
Table 4.
 
Vitreous-Modulated Genes in the Focal Adhesion Pathway
Table 4.
 
Vitreous-Modulated Genes in the Focal Adhesion Pathway
GenBank Accession Gene Description Symbol Ratio Vitreous/Control*
6 h 12 h 24 h 48 h
Upregulated genes
 NM_001166 Baculoviral IAP repeat-containing 2 BIRC2 1.59 1.59 1.30 0.77
 AK056838 Calpain 2, (m/II) large subunit CAPN2 0.87 1.04 1.87 2.02
 NM_002203 Integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) ITGA2 1.53 1.60 2.33 1.42
 NM_002205 Sorting nexin 11 ITGA5 1.76 2.25 2.08 1.55
 NM_002290 Laminin, alpha 4 LAMA4 1.07 1.10 1.28 1.59
 NM_002291 Laminin, beta 1 LAMB1 1.27 1.61 1.87 1.48
 NM_000228 Laminin, beta 3 LAMB3 2.65 1.63 1.43 1.14
 NM_002293 Laminin, gamma 1 (formerly LAMB2) LAMC1 1.31 1.54 1.03 0.71
 AF022375 Vascular endothelial growth factor VEGF 1.98 1.61 0.60 0.48
Downregulated genes
 NM_001102 Actinin, alpha 1 ACTN1 0.83 0.84 0.72 0.65
 AF070674 Baculoviral IAP repeat-containing 3 BIRC3 2.30 1.47 0.51 0.27
 NM_001749 Calpain, small subunit 1 CAPNS1 1.11 1.47 0.62 1.15
 NM_001759 Cyclin D2 CCND2 1.13 1.07 0.84 0.48
 NM_001854 Collagen, type XI, alpha 1 COL11A1 0.80 0.58 0.58 0.74
 NM_001845 Collagen, type IV, alpha 1 COL4A1 0.83 0.88 0.48 0.46
 AK023345 Diaphanous homolog 1 (Drosophila) DIAPH1 0.85 0.87 0.48 1.83
 AK055601 FERM, RhoGEF and pleckstrin domain protein 2 FARP2 1.13 1.08 0.77 0.66
 AY014272 Actin-like protein FKSG30 0.97 0.87 0.61 0.85
 AK056699 FYN oncogene related to SRC, FGR, YES FYN 0.67 0.58 0.50 0.70
 AF109681 Integrin, alpha 11 ITGA11 1.24 0.88 0.80 0.35
 NM_000419 Integrin, alpha 2b (CD41) ITGA2B 0.74 0.61 0.40 0.28
 NM_002206 Integrin, alpha 7 ITGA7 1.04 0.84 0.59 0.82
 NM_053025 Myosin, light polypeptide kinase MYLK 0.88 0.82 0.66 0.78
 NM_002524 Neuroblastoma RAS viral (v-ras) oncogene homolog NRAS 0.93 0.87 0.89 0.68
 NM_016205 Platelet derived growth factor C PDGFC 0.80 0.79 0.78 0.59
 NM_002609 Platelet-derived growth factor receptor, beta polypeptide PDGFRB 0.75 0.56 0.60 0.95
 NM_014308 Phosphoinositide-3-kinase, regulatory subunit 5, p101 PIK3R5 0.67 0.70 0.54 0.45
 NM_002480 Protein phosphatase 1, regulatory (inhibitor) subunit 12A PPP1R12A 0.85 0.74 0.82 0.65
 AK055431 Protein kinase C, alpha PRKCA 0.82 0.75 0.71 0.67
 NM_002738 Protein kinase C, beta 1 PRKCB1 0.72 1.36 0.92 0.49
 NM_012250 Related RAS viral (r-ras) oncogene homolog 2 RRAS2 1.02 1.05 0.80 0.63
 NM_003246 Thrombospondin 1 THBS1 0.90 0.47 0.47 0.43
 AL049689 Tenascin N TNN 0.74 0.88 1.01 0.66
 AF022375 Vascular endothelial growth factor VEGF 1.98 1.61 0.60 0.48
 NM_003461 Zyxin ZYX 1.07 0.87 0.63 0.76
Table 5.
 
Vitreous-Modulated Genes in the Tight-Junction Pathway
Table 5.
 
Vitreous-Modulated Genes in the Tight-Junction Pathway
GenBank Accession Gene Description Symbol Ratio Vitreous/Control*
6 h 12 h 24 h 48 h
NM_001102 Actinin, alpha 1 ACTN1 0.83 0.84 0.72 0.65
NM_020770 Cingulin CGN 0.88 0.63 0.71 1.03
AF101051 Claudin 1 CLDN1 0.67 0.82 0.71 0.47
NM_001306 Claudin 3 CLDN3 0.66 0.67 0.47 1.02
NM_005231 Cortactin CTTN 0.90 0.91 0.64 0.57
AY014272 Actin-like protein FKSG30 0.97 0.87 0.61 0.85
NM_002069 Guanine nucleotide binding protein, alpha inhibiting activity polypeptide 1 GNAI1 0.68 0.61 0.67 0.56
NM_005799 InaD-like (Drosophila) INADL 0.94 0.80 0.55 0.81
NM_002524 Neuroblastoma RAS viral (v-ras) oncogene homolog NRAS 0.93 0.87 0.89 0.68
NM_016948 Par-6 partitioning defective 6 homolog alpha (C.elegans) PARD6A 1.02 0.81 0.65 0.75
NM_004156 Protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform PPP2CB 1.04 1.02 0.90 0.67
AK055431 Protein kinase C, alpha PRKCA 0.82 0.75 0.71 0.67
NM_002738 Protein kinase C, beta 1 PRKCB1 0.72 1.36 0.92 0.49
AK002107 RAB3B, member RAS oncogene family RAB3B 0.98 1.03 0.96 0.59
NM_012250 Related RAS viral (r-ras) oncogene homolog 2 RRAS2 1.02 1.05 0.80 0.63
Table 6.
 
Vitreous-Modulated Genes in the TGF-β/BMP Pathway
Table 6.
 
Vitreous-Modulated Genes in the TGF-β/BMP Pathway
GenBank Accession Gene Description Symbol Ratio Vitreous/Control*
6 h 12 h 24 h 48 h
Upregulated genes
 NM_001200 Bone morphogenetic protein 2 BMP2 2.13 2.43 1.38 1.02
 NM_004405 Distal-less homeobox 2 DLX2 3.07 1.89 0.62 0.51
 NM_002165 Inhibitor of DNA binding 1 ID1 1.11 1.40 1.86 1.69
 NM_000627 Latent transforming growth factor beta binding protein 1 LTBP1 1.11 1.23 1.65 1.23
 NM_006475 Periostin, osteoblast specific factor POSTN 0.97 1.22 1.78 1.75
 AL353944 Runt-related transcription factor 2 RUNX2 0.80 1.38 1.92 1.59
Downregulated genes
 NM_012342 BMP and activin membrane-bound inhibitor homolog BAMBI 0.49 0.60 0.54 0.82
 NM_001719 Bone morphogenetic protein 7 (osteogenic protein 1) BMP7 0.84 0.75 0.59 0.75
 NM_004405 Distal-less homeobox 2 DLX2 3.07 1.89 0.62 0.51
 BC014469 Cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4) CDKN2B 0.99 0.95 0.56 0.76
 BC014941 Inhibitor of DNA binding 4 ID4 0.37 0.41 0.68 0.51
 NM_006762 Lysosomal associated multispanning membrane protein 5 LAPTM5 0.86 0.79 0.48 0.55
 NM_002467 V-myc myelocytomatosis viral oncogene homolog MYC 1.30 1.07 1.09 0.68
 NM_005380 Neuroblastoma, suppression of tumorigenicity 1 (DAN) NBL1 1.22 1.15 1.01 0.67
 NM_004156 Protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform PPP2CB 1.04 1.02 0.90 0.67
 AK002019 SMAD specific E3 ubiquitin protein ligase 2 SMURF2 1.31 1.24 0.62 0.42
 NM_022739 SMAD specific E3 ubiquitin protein ligase 2 SMURF2 1.38 1.56 0.94 0.39
 AK021874 Transforming growth factor, beta 2 TGFB2 0.64 0.43 0.42 0.51
 NM_003238 Transforming growth factor, beta 2 TGFB2 0.81 0.69 0.66 0.67
 AK002171 Transforming growth factor, beta receptor TGFBR1 0.80 0.68 0.52 0.45
 NM_003246 Thrombospondin 1 THBS1 0.90 0.47 0.47 0.43
 BC015134 Thrombospondin 1 THBS1 0.96 0.82 0.56 0.41
Table 7.
 
Effect of Vitreous Treatment on Expression of BMP-2 and Periostin mRNAs
Table 7.
 
Effect of Vitreous Treatment on Expression of BMP-2 and Periostin mRNAs
GenBank Accession and Symbol* Gene Microarray Average (Donors 1–3)† QPCR Donors 4–6‡
6 h 12 h 24 h 48 h 6 h 12 h 24 h 48 h
NM_001200 Bone morphogenetic protein 2 2.1 2.4 1.4 1.0 3.1 2.6 2.8 0.7
BMP2 3.3 4.3 1.1 1.7
3.0 3.0 0.9 0.9
NM_006475 Periostin, osteoblast specific factor 1.0 1.2 1.8 1.7 1.0 1.0 1.2 1.9
POSTN 2.3 4.6 4.1 6.8
1.1 1.9 1.4 1.4
Appendix A
Appendix B
Appendix C
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×