August 2006
Volume 47, Issue 8
Free
Lens  |   August 2006
A New Locus for Autosomal Dominant Cataract on Chromosome 19: Linkage Analyses and Screening of Candidate Genes
Author Affiliations
  • J. Bronwyn Bateman
    From the Department of Ophthalmology, Rocky Mountain Lions Eye Institute, Denver, Colorado;
    The Children’s Hospital, University of Colorado School of Medicine, Denver, Colorado; the
    Eleanor Roosevelt Institute, Denver, Colorado; the
  • Leslie Richter
    From the Department of Ophthalmology, Rocky Mountain Lions Eye Institute, Denver, Colorado;
    Eleanor Roosevelt Institute, Denver, Colorado; the
  • Pamela Flodman
    Department of Pediatrics, University of California, Irvine, California;
  • Douglas Burch
    From the Department of Ophthalmology, Rocky Mountain Lions Eye Institute, Denver, Colorado;
  • Sandra Brown
    Department of Pediatrics, University of California, Irvine, California;
  • Philip Penrose
    Eleanor Roosevelt Institute, Denver, Colorado; the
    California Presbyterian Medical Center, San Francisco, California; and the
  • Otis Paul
    California Presbyterian Medical Center, San Francisco, California; and the
  • David D. Geyer
    Scheie Eye Institute and
  • David G. Brooks
    Division of Medical Genetics, University of Pennsylvania, Philadelphia, Pennsylvania.
  • M. Anne Spence
    Department of Pediatrics, University of California, Irvine, California;
Investigative Ophthalmology & Visual Science August 2006, Vol.47, 3441-3449. doi:10.1167/iovs.05-1035
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      J. Bronwyn Bateman, Leslie Richter, Pamela Flodman, Douglas Burch, Sandra Brown, Philip Penrose, Otis Paul, David D. Geyer, David G. Brooks, M. Anne Spence; A New Locus for Autosomal Dominant Cataract on Chromosome 19: Linkage Analyses and Screening of Candidate Genes. Invest. Ophthalmol. Vis. Sci. 2006;47(8):3441-3449. doi: 10.1167/iovs.05-1035.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

purpose. To map and identify the mutated gene for autosomal dominant cataract (ADC) in family ADC4.

methods. Ophthalmic evaluations were performed on an American family with ADC and a panel of polymorphic DNA sequence-tagged site (STS) markers for known ADC loci and other genome-wide polymorphic markers were used to map the gene; two-point lod scores were calculated. Fine mapping was undertaken in the chromosomal regions of maximum lod scores, and candidate genes were sequenced.

results. A four-generation American family with ADC was studied. The only phakic individual exhibited white and vacuolated opacities in the cortical region. This ADC locus mapped to several suggestive chromosomal regions. Assuming full penetrance, the highest calculated maximum lod score was 3.91 with D19S902. On chromosome 12, we sequenced all exons and the exon–intron borders of the membrane intrinsic protein (MIP) gene. On chromosome 19, all exons and the exon–intron borders of genes for lens intrinsic membrane2 (LIM2), ferritin light chain (FTL), and the human homologue of the Drosophila sine oculis homeobox 5 (SIX5) were sequenced, and the 3′ untranslated repeat region (UTR) of the dystrophy (DMPK) gene and both the 5′ and 3′ UTRs of the SIX5 genes were amplified; the promoter for LIM2 was sequenced. For these genes, the sequence matched that in the reference libraries, and the DMPK gene had a normal number of CTG repeats.

conclusions. The mutated gene in ADC4 probably represents a new, not yet identified locus on chromosome 19. In one phakic member, the cortical cataracts were punctate and vacuolated.

Pediatric cataracts are an important and treatable cause of visual impairment in infancy. Because of different definitions of visual impairment and blindness, regional socioeconomic standards and healthcare systems, and study methodology including ascertainment, estimates of the prevalence of blindness and infantile cataract in the United States and worldwide vary. The economic and personal impact of pediatric cataracts is unknown but significant in all cultures, because the predicted number of blind years is greater in children than adults. In developed countries, the prevalence rate varies from 0.63 to 13.6 per 10,000 births 1 2 3 4 or infants under the age of 1 year. 5 6 In the United States, SanGiovanni et al. 6 estimated the prevalence of infantile cataracts to be 13.6 per 10,000 infants under the age of 1 year, based on a database collected prospectively from the late 1960s and early 1970s. Spanning the years 1968 to 1998, Bhatti et al. 3 calculated a U.S. rate of 2.03 infants with cataracts per 10,000 births, based on retrospective analyses. 
The causes of pediatric cataracts are diverse and include infectious agents and genetic defects. For the autosomal dominant form (ADC), neither the incidence nor the prevalence is known. ADC forms are usually bilateral. In developed countries, bilateral isolated cataracts account for between 44% and 66% of infantile cataracts 3 7 ; unilateral, isolated cataracts comprise between 25% and 60%. 3 7 Nearly 90% of bilateral, hereditary cataracts were autosomal dominant, based on a large British study. 7 In Denmark, 46% of bilateral, isolated cataracts were determined to be genetic. 8  
ADC is a clinically and genetically heterogeneous disease. ADCs have been classified clinically on the bases of the morphology, size, color, and location of the opacities in the lens or the name of the investigator describing the cataract or affected family. Although ophthalmologists have developed cataract nomenclature, Francis et al. 9 devised a system for conformity. Wide variations of cataract types among families have been documented including nuclear, 10 anterior polar, 11 posterior polar, 12 coralliform, 13 blue dot cerulean, 14 pulverulent, 15 cortical, 16 zonular, 17 and sutural cataracts. 18 The same phenotype may be caused by mutations of different genes and the identical gene mutation has been reported to cause diverse cataracts in different families. For example, posterior polar cataracts may be caused by mutations of paired-like homeodomain transcription factor 3, 19 a transcription factor on chromosome 10 or the crystallin protein crystallin alpha B 20 on chromosome 11. Conversely, a mutation of the crystallin, beta B2 (475C→T) has been associated with sutural cataract 21 in one family, cerulean cataract 22 in another, and a Coppock-like cataract 23 in a third; morphology was consistent within each family. Despite attempts to categorize hereditary cataracts clinically, there is limited correlation of phenotypes with genetic locus and specific mutation. 
ADCs exhibit high penetrance, and many genetic loci have been identified by linkage and mutational analyses. Twenty-four chromosomal regions have been implicated for ADC, and 15 ADC genes have been identified in these regions, including those encoding for membrane proteins connexins (gap junction, alpha 8 24 25 and gap junction, alpha 3 26 27 28 29 ), membrane junction proteins (major intrinsic protein of lens fiber 30 ), crystallins (gamma C, 31 gamma D, 31 32 33 34 35 36 37 beta A1, 28 35 38 39 40 41 beta B2, 21 22 23 42 beta B1, 43 alpha B, 20 and alpha A [Xi JH, et al. IOVS 2002;43:ARVO E-Abstract 3556], 44 45 ), structural proteins (beaded filament structural protein 2), 46 47 48 intracellular storage proteins (ferritin light chain), 49 50 51 52 53 54 55 56 57 58 transcription factors (paired-like homeodomain transcription factor 3, 19 59 60 paired box gene 6, 61 62 and v-mafmusculoaponeurotic fibrosarcoma oncogene homolog (avian) 63 ), and heat shock proteins (heat shock transcription factor 4). 64 With few exceptions, the mutations are personal, not supporting a founder effect. 
We studied a four-generation family with some members affected with ADC. Ophthalmic evaluations and linkage analyses using genome-wide polymorphic DNA markers were performed, and two-point lod scores were calculated. We undertook fine mapping in the regions of suggestive and statistically significant maximum lod scores and performed multipoint analyses. We screened or sequenced candidate genes. 
Methods
Patients and Clinical Findings
The study adhered to the tenets of the Declaration of Helsinki for research involving human subjects. Informed consent was obtained before examination. A four-generation American family of white ancestry (ADC4; Fig. 1 ) was studied. Individuals 6 and 15 were used for some sequencing studies but not for the linkage analyses. During the study, some new individuals were identified, and one key unaffected individual died. All linkage analyses were performed with sufficient power. 
Individuals were examined by slit lamp biomicroscopy or retroillumination (in the field) after pupillary dilation. Affected status was determined by observed opacities or history of cataract extraction before the age of 50 years. The pedigree showed a vertical pattern of inheritance including male-to-male transmission; both genders were similarly affected. 
Linkage Analyses
Blood samples were collected in acid citrate dextrose (ACD; BD Vacutainer, Franklin Lakes, NJ), and DNA was extracted. We analyzed polymorphic sequence-tagged site (STS) DNA markers using our 1998 ADC Screening Panel and previously described methodology (Table 1) . 39 As the original 1998 Panel had expanded after reports of ADC gene mutations, markers were added and some were analyzed in this family. We used linkage mapping (Prism Linkage Mapping Set, ver. 2.0 and 2.5; Applied Biosystems, Inc. [ABI], Foster City, CA); we performed a genome-wide screening; and we analyzed panels of fluorescent primers for polymorphic STS markers, on average 10 cM apart, as detailed in the user’s manual. The PCR genotypes were analyzed on computer (GeneScan and GeneMapper, ver. 3.5.1 software; ABI). 
Two point lod scores were calculated using the LIPED algorithm (http://linkage.rockefeller.edu/ provided in the public domain by Rockefeller University, New York, NY). 65 A gene frequency of 0.0001 and full penetrance were assumed for the cataract locus. Two-point lod scores were calculated for a full range of θm and θf values. Accurate population-specific allele frequency data are not available for these markers. Therefore, in the regions of interest, we used a range of possible allele frequencies to assess the robustness of the allele frequency assumptions. For these data, the effect on the results was negligible. 
The genome-wide coverage was checked by using both the recombination and physical map locations for each marker. We classified lod scores as suggestive or statistically significant. We assessed regions with suggestive lod scores with additional markers and multipoint analyses, and sequenced good candidate genes in the area. We accepted lod scores greater than 3.0 as statistically significant and indicative of significant evidence for linkage with the marker; for statistically significant lod scores, we sequenced all good candidate genes in the region. 
Multipoint linkage analyses were undertaken using the FASTLINK 66 implementation of the MLINK and LINKMAP programs (http:www.hgmp.mrc.ac.uk/; provided in the public domain by the Human Genome Mapping Project Resources Centre, Cambridge, UK), 67 68 and Genehunter 2.1 (Rockefeller University). 69 For the Genehunter analyses, it was possible to calculate exact multipoint lod scores using the full pedigree and all 14 markers from chromosome 19, by increasing the “max bits” parameter to 24. 
Screening for Candidate Genes
Identification of candidate genes was based on previous reports of mutations of genes causing ADC or on expression and function, using the National Center for Biotechnology Information’s Mapviewer. 70  
We sequenced candidate genes in regions suggestive of linkage on chromosomes 12 and 19 including all exons and exon–intron borders of MIP on chromosome 12 as well as the lens intrinsic membrane2 (LIM2), the homologue of the Drosophila sine oculis homeobox 5 gene (SIX5), and FTL genes on chromosome 19. The 3′ untranslated region of the dystrophia myotonica protein kinase gene (DMPK) on chromosome 19 was sized for CTG repeats. In addition, the LIM2 promoter region and the 5′ and 3′ untranslated regions (UTRs) of the SIX5 gene were sequenced. Primers were designed for the LIM2, MIP, and SIX5 candidate genes based on reference sequences from NCBI 70 and/or Ensembl 71 (Table 2) . Previously described primers and conditions were used to amplify the repeat region in the DMPK gene (UniSTS:34269) and the exons and intron–exon borders of the FTL gene. 72 A minor modification was applied to the FTL PCR; the 5′ UTR and exon 1 were amplified in the same reaction using the forward primer 5′-TCCTTGCCACCGCAGATTG-3′ and the reverse primer 5′-GCAGCTGGAGGAAATTA-3′. For LIM2, PCR products were sequenced from both directions using a dye terminator cycle sequencing kit (Prism FS; ABI) and an automated fluorescence sequencer (model 373; ABI). For DMPK, the 3′ repeat region was amplified (UniSTS:34269) and PCR products were resolved on 2% SFR agarose (Midwest Scientific, St. Louis, MO) gels. For SIX5 and MIP, PCR products were amplified (Taq PCR Core kit; Qiagen, Valencia, CA). PCR reactions were run with 25 ng of genomic DNA, 1.5 mM MgCl2, 0.5 mM dNTP, 0.4 μM each primer, and 0.5 units Taq polymerase. We sequenced PCR products using dye termination chemistry and a genetic analyzer (Big Dye ver. 3.0 or ver. 1.1 terminator kits and both a 3100 Genetic Analyzer and a 3100-Avant Genetic Analyzer; all ABI). Sequence analyses were performed using Consed. 73 Two unaffected and two affected family members were sequenced for the MIP (members 6, 11, 12, and 15) and FTL (members 11, 16, 21, and 22) genes. All family members were sequenced for LIM2 and SIX5, and sized for the DMPK repeat region. Ferritin level was measured in one affected individual (11) in a commercial laboratory. 
Results
Patients and Clinical Findings
Based on office slit lamp biomicroscopy of the only known phakic individual (16), the ADC4 cataracts were irregularly shaped white or spherically shaped vacuolated opacities symmetrically located in the cortical region of lens (Fig. 2) . Phenotypic variability is unknown. 
Linkage Analyses
Both the focused and genome-wide screen employing 268 markers was completed on the family. We excluded linkage to regions of known ADC loci (Table 1)except for chromosome 12 (maximum lod score of 2.71 with D12S102 for θf = θm =0); multipoint analysis did not further support a locus in this suggestive region. For the genome-wide screening, a plausible indication of linkage, based on two-point linkage analysis, was found on chromosome 17 (maximum lod score of 1.55 with D17S1806 for θm = 0.403 and θf = 0.00); multipoint analyses in this region failed to confirm evidence of linkage. All other chromosomal regions were either excluded by the lod score or by multipoint analysis except for areas on chromosome 19. The maximum lod score was on chromosome 19 (3.91 for D19S903, θf = θm = 0; Table 3 ). Therefore, the only remaining region of the genome with evidence for linkage of the cataract and genetic markers is chromosome 19 (data available from the authors by request). Visual inspection of haplotypes (Fig. 1)and multipoint analysis (Fig. 3)indicated that the most likely chromosomal region lies between markers D19S220 and D19S902
Screening of Candidate Genes
MIP on the long arm of chromosome 12 was the candidate gene on our ADC panel and the marker D12S102 is 10.07 Mb distal to this candidate gene. On the long arm of chromosome 19, we identified four candidate genes (LIM2, FTL, DMPK, and SIX5) within 6.83 Mb distal to 19S902. 
For the exons and intron–exon borders sequenced for MIP, LIM2, SIX5, and FTL, our sequence was the same in all individuals tested and matched that in the reference libraries. The LIM2 promoter and the SIX5 5′ and 3′ UTRs matched reference sequences. The number of repeat CTG sequence for DMPK in ranged from four to nine, below the 50 repeats or greater found in individuals affected with myotonic dystrophy. The ferritin level was 30 ng/mL in affected individual 11, within the reference range of 10 to 291 ng/mL. 
Discussion
The clinical features of the cataract in this family are not unique based on the office examination of the one affected phakic member. The prominent vacuoles are suggestive of a water and/or ion transport defect. 
We sequenced the MIP gene on chromosome 12 that was in the region suggestive of linkage. MIP is the predominant membrane protein 74 75 in the lens. The homologous region of human chromosome 12, region q13, is mouse chromosome 10. Mutations of Mip (MP26) cause cataracts in the Fraser (CatFr), 76 77 lens opacity mutations (Lop), 77 hydropic fiber (Hfi), 78 and Tohoku 79 mice. In humans, missense mutations in exon 2 of MIP on the long arm of chromosome 12 (12q13) have been the basis of ADC in previously reported families. 30 80  
We identified the most likely region for the ADC gene in this family on chromosome 19 based on a lod score of 3.91 with D19S903. Fine mapping narrowed the region of the putative gene to a 10-cM (10-Mb) region on chromosome 19 flanked by D19S220 and D19S902. The long arm of chromosome 19 has several interesting candidate genes that are expressed in the lens and are known to cause cataracts in mice and/or humans. We sequenced the exons and the intron–exon borders of the gene encoding MIP on chromosome 12 and genes for LIM2, SIX5, and FTL on chromosome 19 in members of this family; the exons and the intron–exon borders matched the reference sequence in all. The number of CTG repeats in the 3′ untranslated DM1 region of DMPK on chromosome 19 was normal. 
LIM2, an ideal candidate as the protein MP-20 (formerly MP-19) is expressed in the lens, 81 is 20 kDa and has four domains within the membrane. 82 Mutations of the gene in the To3 mouse cause a semidominant congenital cataract 83 84 85 ; transgenic mice have cataracts. 86 Although the function of the protein is uncertain, it may play a role in the cellular transition from proliferation. 87 Zhou et al. 88 found similar proteins from primitive species such as Chlamydia and suggested important functions such as transport or enzymatic activities. In mouse studies, this protein regulates fiber cell differentiation. 89 Mutations of LIM2 have been reported to cause an autosomal recessive presenile cataract in one family. 90  
Cataracts may occur as early as the teenage years in individuals with myotonic dystrophy. Myotonic dystrophy (DM1) is caused by an unstable repeat DNA sequence of triplet nucleotides (CTG) in the 3′ noncoding region of the myotonic dystrophy gene (DMPK) that encodes a serine-threonine protein kinase. An increased number of CTG repeats cause the disease. A second myotonic dystrophy locus is on chromosome 3. It is likely that there are several mechanisms for the disease. Altered splicing of the DMPK transcript may cause retention of the transcript in the nucleus, 91 92 93 94 or the DMPK RNA CUG repeat may exert a toxic gain-of-function on cellular metabolism. 95 Of importance in cataract formation, the expanded CTG nucleotide repeat may alter expression of neighboring genes. The expansion alters local chromatin structure and suppresses the expression of the SIX5 gene, 96 97 98 which is the gene after the 3′ end of the DMPK gene. As cataracts develop in mice with one or two defective copies of the SIX5 gene, 99 100 altered expression of the SIX5 gene may be the basis of cataracts in myotonic dystrophy. SIX5 transcripts are expressed in the adult epithelium of the cornea, lens, and ciliary body as well as the retina and sclera but are not expressed in the fetal eye. 101 We postulated that either an unusual clinical manifestation of myotonic dystrophy (cataracts alone) or a mutation of the SIX5 gene may be the basis for the ADC4 phenotype. However, the sequence of SIX5 gene and the number of repeats in the 3′ noncoding region of the DMPK gene in key members of this family were normal. 
Hyperferritinemia is an ADC disorder with elevated serum levels of the light chain of ferritin. 102 Patients are asymptomatic aside from cataracts; however, there are mild abnormalities on liver biopsy. Many mutations of the light-chain ferritin gene have been reported from diverse regions of the world. 49 50 51 52 53 54 55 56 57 58 72 103 104 105 106 107 We found normal ferritin DNA sequence in two affected individuals and a normal ferritin level in one. 
An autosomal recessive congenital nuclear cataract locus has been mapped recently to the 19q13 region in a large consanguineous Pakistani family 108 ; in this family, the most likely region for the gene is between D19S928 and D19S425, based on homozygosity of the region in four affected siblings. The locus in our family probably maps to a more distal region. As Riazuddin et al. 108 note, the distal obligate crossover event in their family is with marker D19S420. If this marker is taken as the distal flanking marker in their family, there is a small region of overlap with the mapped region between D19S213 and D19S420 (10 Mb) in our family. Although the lod scores in this area of overlap cannot completely exclude the region as containing a causative gene in both families, the most likely interpretation is that a different gene is involved in each family. 
Based on linkage analyses and sequencing data, our ADC4 family with one member affected with irregularly shaped white or spherically shaped vacuolated cortical opacities probably represents a new locus on the short arm of chromosome 19. 
 
Figure 1.
 
Pedigree of ADC4 family with haplotypes in the mapped region of chromosome 19. The pedigree has been modified slightly, to protect the confidentiality of the family. Affected individuals are annotated as solid symbols; numbers indicate individuals studied (examined, samples obtained). Haplotypes in the critical region on chromosome 19 are indicated below each individual studied for linkage in this region, and the conserved region is in a shaded box. *Individuals from whom DNA was collected.
Figure 1.
 
Pedigree of ADC4 family with haplotypes in the mapped region of chromosome 19. The pedigree has been modified slightly, to protect the confidentiality of the family. Affected individuals are annotated as solid symbols; numbers indicate individuals studied (examined, samples obtained). Haplotypes in the critical region on chromosome 19 are indicated below each individual studied for linkage in this region, and the conserved region is in a shaded box. *Individuals from whom DNA was collected.
Table 1.
 
ADC Panel Markers and Lod Scores with ADC4 Locus
Table 1.
 
ADC Panel Markers and Lod Scores with ADC4 Locus
Gene; Protein Mbp, † Gene/Phenotpe Symbols (OMIM) Marker Allele Size Range (bp) PCR Conditions Lod Score
Locus Mbp m = θf = 0) 0.001 0.05 0.1 0.2 0.3 0.4
CCV D1S243 2.2 142-170 1998 Panel −∞ −8.78 −2.18 −1.17 −0.39 −0.12 −0.03
CTPA D1S508 7.5 73-85 1998 Panel −∞ −8.60 −3.22 −2.18 −1.15 −0.58 −0.23
Gap junction protein alpha 8; connexin 50 144.6 CZP1/GJA8 D1S514 120.0 145-157 1998 Panel −∞ −1.50 0.12 0.32 0.42 0.36 0.22
Nuclear cataracts D2S2333 85.4 246-260 TA −∞ −14.39 −4.35 −2.70 −1.23 −0.54 −0.17
Crystallin, gamma C, gamma D 208.8 CRYG D2S72 204.6 159-173 1998 Panel −∞ −14.39 −4.33 −2.66 −1.16 −0.45 −0.11
Beaded filament structural protein 2 133.3 BFSP2 D3S1267 124.5 129-167 TA −∞ −12.29 −3.89 −2.47 −1.17 −0.52 −0.17
Paired-like homeodomain transcription factor 3 104.0 PITX3 D10S2470 N/A 243-267 TA −∞ −2.99 0.21 0.60 0.74 0.58 0.30
Paired box gene 6 31.8 PAX6 PAX6CA/GT 31.8 272-292 TA −∞ −17.69 −5.91 −3.91 −2.04 −1.05 −0.42
Crystallin, alpha B 111.3 CRYAB D11S4176 93.7 224-254 TA −∞ −14.69 −4.61 −2.92 −1.37 −0.60 −0.19
Major intrinsic protein of lens fiber 55.1 MIP D12S90 56.7 166-182 1998 Panel −∞ −2.39 0.77 1.11 1.17 0.94 0.54
Gap junction protein alpha 3; connexin 46 19.6 CZP3/GJA3 D13S1236 21.6 124-132 1998 Panel −∞ −2.70 −1.00 −0.70 −0.40 −0.22 −0.10
CCPSO D15S117 56.3 132-150 1998 Panel −∞ −14.39 −4.35 −2.70 −1.23 −0.54 −0.17
CTM D16S265 62.1 89-117 1998 Panel −∞ −11.69 −3.35 −2.00 −0.84 −0.31 −0.07
Heat-shock transcription factor 4 65.8 HSF4 D16S3095 68.5 150-162 TA −∞ −4.20 −0.90 −0.42 −0.05 0.06 0.06
CTM D16S518 76.7 272-290 1998 Panel −∞ −11.39 −3.05 −1.71 −0.56 −0.09 0.07
CTAA2 D17S849 0.4 251-261 1998 Panel −∞ −11.99 −3.63 −2.26 −1.06 −0.52 −0.23
Crystallin, beta A1 24.6 CCZS D17S805 19.3 216-228 1998 Panel −∞ −11.69 −3.35 −2.00 −0.84 −0.31 −0.07
CCA1 D17S836 74.8 202-210 1998 Panel 0.30 0.30 0.26 0.21 0.13 0.06 0.02
Ferritin 54.2 FTL D19S412 51.7 97-109 TA *
CCP3 D20S917 9.2 141-167 TA *
Crystallin, alpha A 43.5 CRYAA D21S171 44.8 111-133 1998 Panel −∞ −4.50 −1.18 −0.67 −0.25 0.09 −0.02
Crystallin, beta B2 23.9 CRYBB2 D22S258 24.3 177-195 1998 Panel −∞ −12.29 −3.88 −0.04 −1.17 0.52 −0.17
Crystallin, beta B1 25.3 CRYBB1 D22S1167 25.4 266-278 TA −8.10 −3.00 −2.10 −1.19 −0.67 −0.29
Table 2.
 
Primers for LIM2, SIX5, and MIP
Table 2.
 
Primers for LIM2, SIX5, and MIP
Exon PCR Fragment (bp) Direction Sequence 5′–3′
LIM2: Chromosome 19
 1 330 F GTAGGGAGGCTTAAGGGATTTG
R GTTCTGAGCAAGGAATAGGCTG
 2 313 F TTCAAGTCCTGGGGATTCAGCTC
R TCTGGAATACAGGTGTCCTTGGC
 2 178 F CCAGTTCCTCCCTTCAAGTCCTG
R GACCCTGACAGCCGGTACTGC
 3 679 F GGTGTTTATGACACAGAACCAACC
R GTACACCAGCTAGTGTCAGATAG
 3 426 F CATTTTCATCTCAGAGGTAGCAG
R GTACACCAGCTAGTGTCAGATAG
 3 Sequence only I CATTTTCATCTCAGAGGTAGCAG
 4 287 F GCTCTCTGAGGGCCTCCAAAATC
R GGGACACCCTGTCATCTTCCAC
 5 459 F CCACATGAGTCCCACAGCACTG
R TAACAACCTGCCAGGCAGACGG
 5 244 F CTCAGTTCTGGACTGTGGGTTTG
R GACCACCCTTACAGCTGTTTCTC
 Promoter F AGGCTCTGCGACTCAGGTA
R AGAACAGGCCACCACCCAT
SIX5: Chromosome 19
 3′ UTR 1274 F GAGCCCCAGAAATGCGGTTG
R CCGCGGCTCTTGCTGGAAGC
 5′ UTR 1065 F CCTCCTCACTTGCGCTGCTC
R CTCCCTCGGGCTTTCCCCAG
 1 636 F AAGCGCGGCCAGAGGCGGAG
R CAACACCGGGTCGCTGCCAC
679 F GCCACGCCGGCCGCTTGAGC
R CGGGTGCCTGTCCCGTCCAC
 2 954 F GAGCAGCTGGCTGGCTATG
R ACAGCCCCTCCCTCTCCGAGAT
 3 770 F TCTCCACTTCTCTCTGGCTTG
R TCAGCAACCGCATTTCTG
MIP Chromosome 12
 1 270 F AAGGGGACTGTCCACCCAG
R TGGGCTCCACTGATGTGGC
 1 306 F GGCTATGGCATTTGGCTTGG
R CTGCACCAGTCAGGGAGTC
 1 216 F TCCTCTATAAAGGGGACTGTC
R GCCACCTGCAGAACATGCAG
 1 300 F CACTTCTCGTAGTCTCTCTTGCTG
R GCTGATCGCAGTTCCCACATGGC
 2 263 F AGGAGGTAACACTGTGGCAG
R GAATCCTTGAATGAGAAGTTGC
 3 169 F AAGCTGGGGTGCAGTAGGG
R GAGTGCTGGTACAGCAGCC
 4 258 F CAGCGTTGCTGCTCTGTCC
R TCAGCTGGAGCTTCTACAGG
 4 254 F GGGAACCTGTTGAACTGAACA
R TGGGGAGGAAGGGAAGTTTG
 4 201 F CTCAAGAGTATTTCTGAGAGAC
R ACAGTCTCTTTCTTCATCTAGG
 4 279 F GAATATACACATGCTAAGGTGTGG
R AGTCTCTCAAGAAATACTCTTGAGC
Figure 2.
 
Right lens of proband. Left: white flecks were evident in the cortical region of the lens (direct illumination). Center: vacuoles were visible in the cortical region. Right: magnification of vacuoles and white opacities in the cortex. (Courtesy Denice Barsness, CRA, COMT, ROUB, FOPS, California Pacific Medical Center, San Francisco, CA.)
Figure 2.
 
Right lens of proband. Left: white flecks were evident in the cortical region of the lens (direct illumination). Center: vacuoles were visible in the cortical region. Right: magnification of vacuoles and white opacities in the cortex. (Courtesy Denice Barsness, CRA, COMT, ROUB, FOPS, California Pacific Medical Center, San Francisco, CA.)
Table 3.
 
Lod Scores between ADC4 Disease Locus and Polymorphic Markers on Chromosome 19
Table 3.
 
Lod Scores between ADC4 Disease Locus and Polymorphic Markers on Chromosome 19
Marker Mbp Lod Score
m = θf = 0) 0.001 0.05 0.1 0.2 0.3 0.4
D19S216 4.9 −∞ −5.01 −1.63 −1.07 −0.55 −0.29 −0.12
D19S884 8.1 −∞ −2.91 −1.14 −0.79 −0.44 −0.24 −0.10
D19S221 12.6 −∞ −7.89 −2.79 −1.90 −1.02 −0.53 −0.22
D19S226 14.5 −∞ −5.39 −0.51 0.16 0.57 0.56 0.36
D19S414 36.6 0.60 0.60 0.54 0.47 0.34 0.21 0.10
D19S220 43.1 −∞ 0.91 2.32 2.32 1.96 1.39 0.71
D19S223 46.1 1.81 1.80 1.65 1.49 1.13 0.74 0.33
D19S420 48.5 2.71 2.71 2.51 2.30 1.84 1.32 0.71
D19S178 49.1 0.90 0.90 0.84 0.77 0.61 0.44 0.24
D19S903 49.7 3.91 3.91 3.60 3.27 2.56 1.76 0.89
SIX5 51.0
DMPK 51.0
D19S902 53.0 −∞ 0.91 2.32 2.32 1.98 1.45 0.79
FTL 54.2
LIM2 56.6
D19S571 58.0 −∞ −0.60 0.93 1.48 0.96 0.72 0.40
D19S418 60.2 −∞ −5.99 −1.07 −0.35 0.16 0.28 0.20
D19S210 61.7 −∞ −4.67 −1.28 −0.71 −0.24 −0.07 −0.01
Figure 3.
 
Multipoint analysis of mapped regions of chromosome 19.
Figure 3.
 
Multipoint analysis of mapped regions of chromosome 19.
The authors thank Linda Nguyen for assistance with processing the data. 
StollC, AlembikY, DottB, RothMP. Epidemiology of congenital eye malformations in 131,760 consecutive births. Ophthalmic Paediatr Genet. 1992;13:179–186. [CrossRef] [PubMed]
BermejoE, Martinez-FriasML. Congenital eye malformations: clinical-epidemiological analysis of 1,124,654 consecutive births in Spain. Am J Med Genet. 1998;75:497–504. [CrossRef] [PubMed]
BhattiTR, DottM, YoonPW, MooreCA, GambrellD, RasmussenSA. Descriptive epidemiology of infantile cataracts in metropolitan Atlanta, GA, 1968–1998. Arch Pediatr Adolesc Med. 2003;157:341–347. [CrossRef] [PubMed]
WirthMG, Russell-EggittIM, CraigJE, ElderJE, MackeyDA. Aetiology of congenital and paediatric cataract in an Australian population. Br J Ophthalmol. 2002;86:782–786. [CrossRef] [PubMed]
RahiJS, DezateauxC. Measuring and interpreting the incidence of congenital ocular anomalies: lessons from a national study of congenital cataract in the UK. Invest Ophthalmol Vis Sci. 2001;42:1444–1448. [PubMed]
SanGiovanniJP, ChewEY, ReedGF, et al. Infantile cataract in the collaborative perinatal project: prevalence and risk factors. Arch Ophthalmol. 2002;120:1559–1565. [CrossRef] [PubMed]
RahiJS, DezateuxC. Congenital and infantile cataract in the United Kingdom: underlying or associated factors. British Congenital Cataract Interest Group. Invest Ophthalmol Vis Sci. 2000;41:2108–2114. [PubMed]
HaargaardB, WohlfahrtJ, FledeliusHC, RosenbergT, MelbyeM. A nationwide Danish study of 1027 cases of congenital/infantile cataracts: etiological and clinical classifications. Ophthalmology. 2004;111:2292–2298. [CrossRef] [PubMed]
FrancisPJ, BerryV, BhattacharyaSS, MooreAT. The genetics of childhood cataract. J Med Genet. 2000;37:481–488. [CrossRef] [PubMed]
LeeJB, BenedictWL. Hereditary nuclear cataract. AMA Arch Ophthalmol. 1950;44:643–650. [CrossRef] [PubMed]
JaafarMS, RobbRM. Congenital anterior polar cataract: a review of 63 cases. Ophthalmology. 1984;91:249–254. [CrossRef] [PubMed]
TullohCG. Hereditary posterior polar cataract with report of a pedigree. Br J Ophthalmol. 1955;39:374–379. [CrossRef] [PubMed]
GunnRM. Peculiar coralliform cataract with crystals in the lens. Trans Ophthalmol Soc UK. 1895;15:119.
ArmitageMM, KivlinJD, FerrellRE. A progressive early onset cataract gene maps to human chromosome 17q24. Nat Genet. 1995;9:37–40. [CrossRef] [PubMed]
MackayD, IonidesA, BerryV, MooreA, BhattacharyaS, ShielsA. A new locus for dominant “zonular pulverulent” cataract, on chromosome 13. Am J Hum Genet. 1997;60:1474–1478. [CrossRef] [PubMed]
IonidesA, FrancisP, BerryV, et al. Clinical and genetic heterogeneity in autosomal dominant cataract. Br J Ophthalmol. 1999;83:802–808. [CrossRef] [PubMed]
BastiS, HejtmancikJF, PadmaT, et al. Autosomal dominant zonular cataract with sutural opacities in a four-generation family. Am J Ophthalmol. 1996;121:162–168. [CrossRef] [PubMed]
Vanita SinghJR, SarhadiVK, et al. A novel form of “central pouchlike” cataract, with sutural opacities, maps to chromosome 15q21–22. Am J Hum Genet. 2001;68:509–514. [CrossRef] [PubMed]
FinziS, LiYY, MitchellTN, FarrA, SundinO, MaumeneeIH. Posterior polar cataract: clinical spectrum and genetic analysis in a large family (Abstract). American Society of Human Genetics (ASHG); Annual Meeting. 2002;1656.
BerryV, FrancisP, ReddyMA, et al. Alpha-B crystallin gene (CRYAB) mutation causes dominant congenital posterior polar cataract in humans. Am J Hum Genet. 2001;69:1141–1145. [CrossRef] [PubMed]
Vanita SarhadiV, ReisA, et al. A unique form of autosomal dominant cataract explained by gene conversion between beta-crystallin B2 and its pseudogene. J Med Genet. 2001;38:392–396. [CrossRef] [PubMed]
LittM, Carrero-ValenzuelaR, LaMorticellaDM, et al. Autosomal dominant cerulean cataract is associated with a chain termination mutation in the human beta-crystallin gene CRYBB2. Hum Mol Genet. 1997;6:665–668. [CrossRef] [PubMed]
GillD, KloseR, MunierFL, et al. Genetic heterogeneity of the Coppock-like cataract: a mutation in CRYBB2 on chromosome 22q11.2. Invest Ophthalmol Vis Sci. 2000;41:159–165. [PubMed]
ShielsA, MackayD, IonidesA, BerryV, MooreA, BhattacharyaS. A missense mutation in the human connexin50 gene (GJA8) underlies autosomal dominant “zonular pulverulent” cataract, on chromosome 1q. Am J Hum Genet. 1998;62:526–532. [CrossRef] [PubMed]
WilloughbyCE, ArabS, GandhiR, et al. A novel GJA8 mutation in an Iranian family with progressive autosomal dominant congenital nuclear cataract. J Med Genet. 2003;40:E124. [CrossRef] [PubMed]
MackayD, IonidesA, KibarZ, et al. Connexin46 mutations in autosomal dominant congenital cataract. Am J Hum Genet. 1999;64:1357–1364. [CrossRef] [PubMed]
JiangH, JinY, BuL, et al. A novel mutation in GJA3 (connexin46) for autosomal dominant congenital nuclear pulverulent cataract. Mol Vis. 2003;9:579–583. [PubMed]
QiY, JiaH, HuangS, et al. A deletion mutation in the betaA1/A3 crystallin gene (CRYBA1/A3) is associated with autosomal dominant congenital nuclear cataract in a Chinese family. Hum Genet. 2004;114:192–197. [CrossRef] [PubMed]
BennettTM, MackayDS, KnopfHL, ShielsA. A novel missense mutation in the gene for gap-junction protein alpha3 (GJA3) associated with autosomal dominant “nuclear punctate” cataracts linked to chromosome 13q. Mol Vis. 2004;10:376–382. [PubMed]
BerryV, FrancisP, KaushalS, MooreA, BhattacharyaS. Missense mutations in MIP underlie autosomal dominant ‘polymorphic’ and lamellar cataracts linked to 12q. Nat Genet. 2000;25:15–17. [CrossRef] [PubMed]
HeonE, PristonM, SchorderetDF, et al. The gamma-crystallins and human cataracts: a puzzle made clearer. Am J Hum Genet. 1999;65:1261–1267. [CrossRef] [PubMed]
StephanDA, GillandersE, VanderveenD, et al. Progressive juvenile-onset punctate cataracts caused by mutation of the gammaD-crystallin gene. Proc Natl Acad Sci USA. 1999;96:1008–1012. [CrossRef] [PubMed]
NandrotE, SlingsbyC, BasakA, et al. Gamma-D crystallin gene (CRYGD) mutation causes autosomal dominant congenital cerulean cataracts. J Med Genet. 2003;40:262–267. [CrossRef] [PubMed]
MackayDS, AndleyUP, ShielsA. A missense mutation in the gammaD crystallin gene (CRYGD) associated with autosomal dominant “coral-like” cataract linked to chromosome 2q. Mol Vis. 2004;10:155–162. [PubMed]
BurdonKP, WirthMG, MackeyDA, et al. Investigation of crystallin genes in familial cataract, and report of two disease associated mutations. Br J Ophthalmol. 2004;88:79–83. [CrossRef] [PubMed]
XuWZ, ZhengS, XuSJ, HuangW, YaoK, ZhangSZ. Autosomal dominant coralliform cataract related to a missense mutation of the gammaD-crystallin gene. Chin Med J (Engl). 2004;117:727–732. [PubMed]
ShentuX, YaoK, XuW, ZhengS, HuS, GongX. Special fasciculiform cataract caused by a mutation in the gammaD-crystallin gene. Mol Vis. 2004;10:233–239. [PubMed]
KannabiranC, RoganPK, OlmosL, et al. Autosomal dominant zonular cataract with sutural opacities is associated with a splice mutation in the betaA3/A1-crystallin gene. Mol Vis. 1998;4:21. [PubMed]
BatemanJB, GeyerDD, FlodmanP, et al. A new betaA1-crystallin splice junction mutation in autosomal dominant cataract. Invest Ophthalmol Vis Sci. 2000;41:3278–3285. [PubMed]
QiYH, JiaHY, HuangSZ, et al. [Autosomal dominant congenital nuclear cataract caused by a deletion mutation in the beta A1-crystallin gene]. Zhonghua Yi Xue Yi Chuan Xue Za Zhi. 2003;20:486–489. [PubMed]
FerriniW, SchorderetDF, Othenin-GirardP, UfferS, HeonE, MunierFL. CRYBA3/A1 gene mutation associated with suture-sparing autosomal dominant congenital nuclear cataract: a novel phenotype. Invest Ophthalmol Vis Sci. 2004;45:1436–1441. [CrossRef] [PubMed]
SanthiyaST, ManisastrySM, RawlleyD, et al. Mutation analysis of congenital cataracts in Indian families: identification of SNPS and a new causative allele in CRYBB2 gene. Invest Ophthalmol Vis Sci. 2004;45:3599–3607. [CrossRef] [PubMed]
MackayDS, BoskovskaOB, KnopfHL, LampiKJ, ShielsA. A nonsense mutation in CRYBB1 associated with autosomal dominant cataract linked to human chromosome 22q. Am J Hum Genet. 2002;71:1216–1221. [CrossRef] [PubMed]
LittM, KramerP, LaMorticellaDM, MurpheyW, LovrienEW, WeleberRG. Autosomal dominant congenital cataract associated with a missense mutation in the human alpha crystallin gene CRYAA. Hum Mol Genet. 1998;7:471–474. [CrossRef] [PubMed]
MackayDS, AndleyUP, ShielsA. Cell death triggered by a novel mutation in the alphaA-crystallin gene underlies autosomal dominant cataract linked to chromosome 21q. Eur J Hum Genet. 2003;11:784–793. [CrossRef] [PubMed]
JakobsPM, HessJF, FitzGeraldPG, KramerP, WeleberRG, LittM. Autosomal-dominant congenital cataract associated with a deletion mutation in the human beaded filament protein gene BFSP2. Am J Hum Genet. 2000;66:1432–1436. [CrossRef] [PubMed]
ConleyYP, ErturkD, KeverlineA, et al. A juvenile-onset, progressive cataract locus on chromosome 3q21–q22 is associated with a missense mutation in the beaded filament structural protein-2. Am J Hum Genet. 2000;66:1426–1431. [CrossRef] [PubMed]
ZhangQ, GuoX, XiaoX, YiJ, JiaX, HejtmancikJF. Clinical description and genome wide linkage study of Y-sutural cataract and myopia in a Chinese family. Mol Vis. 2004;10:890–900. [PubMed]
BeaumontC, LeneuveP, DevauxI, et al. Mutation in the iron responsive element of the L ferritin mRNA in a family with dominant hyperferritinaemia and cataract. Nat Genet. 1995;11:444–446. [CrossRef] [PubMed]
GirelliD, OlivieriO, De FranceschiL, CorrocherR, BergamaschiG, CazzolaM. A linkage between hereditary hyperferritinaemia not related to iron overload and autosomal dominant congenital cataract. Br J Haematol. 1995;90:931–934. [CrossRef] [PubMed]
Aguilar-MartinezP, BironC, MasmejeanC, JeanjeanP, SchvedJF. A novel mutation in the iron responsive element of ferritin L-subunit gene as a cause for hereditary hyperferritinemia-cataract syndrome (Letter; comment). Blood. 1996;88:1895. [PubMed]
CazzolaM, BergamaschiG, TononL, et al. Hereditary hyperferritinemia-cataract syndrome: relationship between phenotypes and specific mutations in the iron-responsive element of ferritin light-chain mRNA (see comments). Blood. 1997;90:814–821. [PubMed]
GirelliD, CorrocherR, BiscegliaL, et al. Hereditary hyperferritinemia-cataract syndrome caused by a 29-base pair deletion in the iron responsive element of ferritin L-subunit gene. Blood. 1997;90:2084–2088. [PubMed]
MartinME, FargionS, BrissotP, PellatB, BeaumontC. A point mutation in the bulge of the iron-responsive element of the L ferritin gene in two families with the hereditary hyperferritinemia–cataract syndrome (see comments). Blood. 1998;91:319–323. [PubMed]
MumfordAD, VulliamyT, LindsayJ, WatsonA. Hereditary hyperferritinemia-cataract syndrome: two novel mutations in the L-ferritin iron-responsive element (Letter; comment). Blood. 1998;91:367–368. [PubMed]
McLeodJL, CraigJ, GumleyS, RobertsS, KirklandMA. Mutation spectrum in Australian pedigrees with hereditary hyperferritinaemia-cataract syndrome reveals novel and de novo mutations. Br J Haematol. 2002;118:1179–1182. [CrossRef] [PubMed]
GarderetL, HermelinB, GorinNC, RosmorducO. Hereditary hyperferritinemia-cataract syndrome: a novel mutation in the iron-responsive element of the L-ferritin gene in a French family. Am J Med. 2004;117:138–139. [PubMed]
SimsekS, NanayakkaraPW, KeekJM, FaberLM, BruinKF, PalsG. Two Dutch families with hereditary hyperferritinaemia-cataract syndrome and heterozygosity for an HFE-related haemochromatosis gene mutation. Neth J Med. 2003;61:291–295. [PubMed]
SeminaEV, FerrellRE, Mintz-HittnerHA, et al. A novel homeobox gene PITX3 is mutated in families with autosomal-dominant cataracts and ASMD. Nat Genet. 1998;19:167–170. [CrossRef] [PubMed]
YangZ, PelleranoG, Valdez-GuerreroME, et al. A novel mutation in PITX3 associated with an autosomal dominant form of congenital cataract (Abstract). ASHG Annual Meeting. 2002.2080.
GlaserT, JepealL, EdwardsJG, YoungSR, FavorJ, MaasRL. PAX6 gene dosage effect in a family with congenital cataracts, aniridia, anophthalmia and central nervous system defects (published correction appears in Nat Genet. 1994;8:203). Nat Genet. 1994;7:463–471. [CrossRef] [PubMed]
AzumaN, YamaguchiY, HandaH, HayakawaM, KanaiA, YamadaM. Missense mutation in the alternative splice region of the PAX6 gene in eye anomalies. Am J Hum Genet. 1999;65:656–663. [CrossRef] [PubMed]
VanitaV, SinghD, RobinsonPN, SperlingK, SinghJR. A novel mutation in the DNA-binding domain of MAF at 16q23.1 associated with autosomal dominant “cerulean cataract” in an Indian family. Am J Med Genet A. 2006;140:558–566. [PubMed]
BuL, JinY, ShiY, et al. Mutant DNA-binding domain of HSF4 is associated with autosomal dominant lamellar and Marner cataract. Nat Genet. 2002;31:276–278. [CrossRef] [PubMed]
OttJ. A computer program for linkage analysis of general human pedigrees. Am J Hum Genet. 1976;28:528–529. [PubMed]
CottinghamRW, Jr, IduryRM, SchafferAA. Faster sequential genetic linkage computations. Am J Hum Genet. 1993;53:252–263. [PubMed]
LathropGM, LalouelJM. Easy calculations of lod scores and genetic risks on small computers. Am J Hum Genet. 1984;36:460–465. [PubMed]
LathropGM, LalouelJM, WhiteRL. Construction of human linkage maps: likelihood calculations for multilocus linkage analysis. Genet Epidemiol. 1986;3:39–52. [CrossRef] [PubMed]
KruglyakL, DalyMJ, Reeve-DalyMP, LanderES. Parametric and nonparametric linkage analysis: a unified multipoint approach. Am J Hum Genet. 1996;58:1347–1363. [PubMed]
National Center For BioTechnology Information (NCBI).National Institutes of Health Bethesda, MD.: http://www.ncbi.nlm.nih.gov/ 2005.
HubbardT, BarkerD, BirneyE, et al. The Ensembl genome database project. Nucleic Acids Res. 2002;30:38–41.Available at http://www.ensembl.org/ 2005. [CrossRef] [PubMed]
GirelliD, CorrocherR, BiscegliaL, et al. Molecular basis for the recently described hereditary hyperferritinemia-cataract syndrome: a mutation in the iron-responsive element of ferritin L-subunit gene (the “Verona mutation”) (see comments). Blood. 1995;86:4050–4053. [PubMed]
SeattleSNPs. NHLBI (National Heart, Lung, and Blood Institute) Program for Genomic Applications. 2005;University of Washington, Fred Hutchinson Cancer Research Center Seattle, WA.Available at http://pga.mbt.washington.edu.
PisanoMM, ChepelinskyAB. Genomic cloning, complete nucleotide sequence, and structure of the human gene encoding the major intrinsic protein (MIP) of the lens. Genomics. 1991;11:981–990. [CrossRef] [PubMed]
GorinMB, YanceySB, ClineJ, RevelJP, HorwitzJ. The major intrinsic protein (MIP) of the bovine lens fiber membrane: characterization and structure based on cDNA cloning. Cell. 1984;39:49–59. [CrossRef] [PubMed]
ShielsA, GriffinCS. Aberrant expression of the gene for lens major intrinsic protein in the CAT mouse. Curr Eye Res. 1993;12:913–921. [CrossRef] [PubMed]
ShielsA, BassnettS. Mutations in the founder of the MIP gene family underlie cataract development in the mouse. Nat Genet. 1996;12:212–215. [CrossRef] [PubMed]
SidjaninDJ, Parker-WilsonDM, Neuhauser-KlausA, et al. A 76-bp deletion in the Mip gene causes autosomal dominant cataract in Hfi mice. Genomics. 2001;74:313–319. [CrossRef] [PubMed]
OkamuraT, MiyoshiI, TakahashiK, et al. Bilateral congenital cataracts result from a gain-of-function mutation in the gene for aquaporin-0 in mice. Genomics. 2003;81:361–368. [CrossRef] [PubMed]
GeyerDD, SpenceMA, JohannesM, et al. Novel single base deletional mutation in major intrinsic protein (MIP) in autosomal dominant cataract. Am J Ophthalmol. 2006;141:761–763. [CrossRef] [PubMed]
TenbroekE, ArnesonM, JarvisL, LouisC. The distribution of the fiber cell intrinsic membrane proteins MP20 and connexin46 in the bovine lens. J Cell Sci. 1992;103:245–257. [PubMed]
ArnesonML, LouisCF. Structural arrangement of lens fiber cell plasma membrane protein MP20. Exp Eye Res. 1998;66:495–509. [CrossRef] [PubMed]
KerscherS, GlenisterPH, FavorJ, LyonMF. Two new cataract loci, Ccw and To3, and further mapping of the Npp and Opj cataracts in the mouse. Genomics. 1996;36:17–21. [CrossRef] [PubMed]
KerscherS, ChurchRL, BoydY, LyonMF. Mapping of four mouse genes encoding eye lens-specific structural, gap junction, and integral membrane proteins: Cryba1 (crystallin beta A3/A1), Crybb2 (crystallin beta B2), Gja8 (MP70), and Lim2 (MP19). Genomics. 1995;29:445–450. [CrossRef] [PubMed]
SteeleEC, Jr, KerscherS, LyonMF, et al. Identification of a mutation in the MP19 gene, Lim2, in the cataractous mouse mutant To3. Mol Vis. 1997;3:5. [PubMed]
SteeleEC, Jr, WangJH, LoWK, SapersteinDA, LiX, ChurchRL. Lim2(To3) transgenic mice establish a causative relationship between the mutation identified in the lim2 gene and cataractogenesis in the To3 mouse mutant. Mol Vis. 2000;6:85–94. [PubMed]
TaylorV, WelcherAA, ProgramAE, SuterU. Epithelial membrane protein-1, peripheral myelin protein 22, and lens membrane protein 20 define a novel gene family. J Biol Chem. 1995;270:28824–28833. [CrossRef] [PubMed]
ZhouL, LiX, ChurchRL. The mouse lens fiber-cell intrinsic membrane protein MP19 gene (Lim2) and granule membrane protein GMP-17 gene (Nkg7): Isolation and sequence analysis of two neighboring genes. Mol Vis. 2001;7:79–88. [PubMed]
ZhouL, ChenT, ChurchRL. Temporal expression of three mouse lens fiber cell membrane protein genes during early development. Mol Vis. 2002;8:143–148. [PubMed]
PrasE, Levy-NissenbaumE, BakhanT, et al. A missense mutation in the LIM2 gene is associated with autosomal recessive presenile cataract in an inbred Iraqi Jewish family. Am J Hum Genet. 2002;70:1363–1367. [CrossRef] [PubMed]
DavisBM, McCurrachME, TanejaKL, SingerRH, HousmanDE. Expansion of a CUG trinucleotide repeat in the 3′ untranslated region of myotonic dystrophy protein kinase transcripts results in nuclear retention of transcripts. Proc Natl Acad Sci USA. 1997;94:7388–7393. [CrossRef] [PubMed]
WangJ, PegoraroE, MenegazzoE, et al. Myotonic dystrophy: evidence for a possible dominant-negative RNA mutation. Hum Mol Genet. 1995;4:599–606. [CrossRef] [PubMed]
TiscorniaG, MahadevanMS. Myotonic dystrophy: the role of the CUG triplet repeats in splicing of a novel DMPK exon and altered cytoplasmic DMPK mRNA isoform ratios. Mol Cell. 2000;5:959–967. [CrossRef] [PubMed]
PhillipsMF, RogersMT, BarnetsonR, et al. PROMM:the expanding phenotype: a family with proximal myopathy, myotonia and deafness. Neuromuscul Disord. 1998;8:439–446. [CrossRef] [PubMed]
MankodiA, LogigianE, CallahanL, et al. Myotonic dystrophy in transgenic mice expressing an expanded CUG repeat. Science. 2000;289:1769–1773. [CrossRef] [PubMed]
OttenAD, TapscottSJ. Triplet repeat expansion in myotonic dystrophy alters the adjacent chromatin structure. Proc Natl Acad Sci USA. 1995;92:5465–5469. [CrossRef] [PubMed]
KlesertTR, OttenAD, BirdTD, TapscottSJ. Trinucleotide repeat expansion at the myotonic dystrophy locus reduces expression of DMAHP. Nat Genet. 1997;16:402–406. [CrossRef] [PubMed]
ThorntonCA, WymerJP, SimmonsZ, McClainC, MoxleyRT, 3rd. Expansion of the myotonic dystrophy CTG repeat reduces expression of the flanking DMAHP gene. Nat Genet. 1997;16:407–409. [CrossRef] [PubMed]
KlesertTR, ChoDH, ClarkJI, et al. Mice deficient in Six5 develop cataracts: implications for myotonic dystrophy. Nat Genet. 2000;25:105–109. [CrossRef] [PubMed]
SarkarPS, AppukuttanB, HanJ, et al. Heterozygous loss of Six5 in mice is sufficient to cause ocular cataracts. Nat Genet. 2000;25:110–114. [CrossRef] [PubMed]
WinchesterCL, FerrierRK, SermoniA, ClarkBJ, JohnsonKJ. Characterization of the expression of DMPK and SIX5 in the human eye and implications for pathogenesis in myotonic dystrophy. Hum Mol Genet. 1999;8:481–492. [CrossRef] [PubMed]
BonneauD, Winter-FuseauI, LoiseauMN, et al. Bilateral cataract and high serum ferritin: a new dominant genetic disorder?. J Med Genet. 1995;32:778–779. [CrossRef] [PubMed]
CazzolaM, CremonesiL, PapaioannouM, et al. Genetic hyperferritinaemia and reticuloendothelial iron overload associated with a three base pair deletion in the coding region of the ferroportin gene (SLC11A3). Br J Haematol. 2002;119:539–546. [CrossRef] [PubMed]
CurtisAR, FeyC, MorrisCM, et al. Mutation in the gene encoding ferritin light polypeptide causes dominant adult-onset basal ganglia disease. Nat Genet. 2001;28:350–354. [CrossRef] [PubMed]
GirelliD, BozziniC, ZecchinaG, et al. Clinical, biochemical and molecular findings in a series of families with hereditary hyperferritinaemia-cataract syndrome. Br J Haematol. 2001;115:334–340. [CrossRef] [PubMed]
LachlanKL, TempleIK, MumfordAD. Clinical features and molecular analysis of seven British kindreds with hereditary hyperferritinaemia cataract syndrome. Eur J Hum Genet. 2004;12:790–796. [CrossRef] [PubMed]
PhillipsJD, WarbyCA, KushnerJP. Identification of a novel mutation in the L-ferritin IRE leading to hereditary hyperferritinemia-cataract syndrome (Abstract). Am J Med Genet. A. 2005;134:77–79.
RiazuddinSA, YasmeenA, ZhangQ, et al. A new locus for autosomal recessive nuclear cataract mapped to chromosome 19q13 in a Pakistani family. Invest Ophthalmol Vis Sci. 2005;46:623–626. [CrossRef] [PubMed]
Figure 1.
 
Pedigree of ADC4 family with haplotypes in the mapped region of chromosome 19. The pedigree has been modified slightly, to protect the confidentiality of the family. Affected individuals are annotated as solid symbols; numbers indicate individuals studied (examined, samples obtained). Haplotypes in the critical region on chromosome 19 are indicated below each individual studied for linkage in this region, and the conserved region is in a shaded box. *Individuals from whom DNA was collected.
Figure 1.
 
Pedigree of ADC4 family with haplotypes in the mapped region of chromosome 19. The pedigree has been modified slightly, to protect the confidentiality of the family. Affected individuals are annotated as solid symbols; numbers indicate individuals studied (examined, samples obtained). Haplotypes in the critical region on chromosome 19 are indicated below each individual studied for linkage in this region, and the conserved region is in a shaded box. *Individuals from whom DNA was collected.
Figure 2.
 
Right lens of proband. Left: white flecks were evident in the cortical region of the lens (direct illumination). Center: vacuoles were visible in the cortical region. Right: magnification of vacuoles and white opacities in the cortex. (Courtesy Denice Barsness, CRA, COMT, ROUB, FOPS, California Pacific Medical Center, San Francisco, CA.)
Figure 2.
 
Right lens of proband. Left: white flecks were evident in the cortical region of the lens (direct illumination). Center: vacuoles were visible in the cortical region. Right: magnification of vacuoles and white opacities in the cortex. (Courtesy Denice Barsness, CRA, COMT, ROUB, FOPS, California Pacific Medical Center, San Francisco, CA.)
Figure 3.
 
Multipoint analysis of mapped regions of chromosome 19.
Figure 3.
 
Multipoint analysis of mapped regions of chromosome 19.
Table 1.
 
ADC Panel Markers and Lod Scores with ADC4 Locus
Table 1.
 
ADC Panel Markers and Lod Scores with ADC4 Locus
Gene; Protein Mbp, † Gene/Phenotpe Symbols (OMIM) Marker Allele Size Range (bp) PCR Conditions Lod Score
Locus Mbp m = θf = 0) 0.001 0.05 0.1 0.2 0.3 0.4
CCV D1S243 2.2 142-170 1998 Panel −∞ −8.78 −2.18 −1.17 −0.39 −0.12 −0.03
CTPA D1S508 7.5 73-85 1998 Panel −∞ −8.60 −3.22 −2.18 −1.15 −0.58 −0.23
Gap junction protein alpha 8; connexin 50 144.6 CZP1/GJA8 D1S514 120.0 145-157 1998 Panel −∞ −1.50 0.12 0.32 0.42 0.36 0.22
Nuclear cataracts D2S2333 85.4 246-260 TA −∞ −14.39 −4.35 −2.70 −1.23 −0.54 −0.17
Crystallin, gamma C, gamma D 208.8 CRYG D2S72 204.6 159-173 1998 Panel −∞ −14.39 −4.33 −2.66 −1.16 −0.45 −0.11
Beaded filament structural protein 2 133.3 BFSP2 D3S1267 124.5 129-167 TA −∞ −12.29 −3.89 −2.47 −1.17 −0.52 −0.17
Paired-like homeodomain transcription factor 3 104.0 PITX3 D10S2470 N/A 243-267 TA −∞ −2.99 0.21 0.60 0.74 0.58 0.30
Paired box gene 6 31.8 PAX6 PAX6CA/GT 31.8 272-292 TA −∞ −17.69 −5.91 −3.91 −2.04 −1.05 −0.42
Crystallin, alpha B 111.3 CRYAB D11S4176 93.7 224-254 TA −∞ −14.69 −4.61 −2.92 −1.37 −0.60 −0.19
Major intrinsic protein of lens fiber 55.1 MIP D12S90 56.7 166-182 1998 Panel −∞ −2.39 0.77 1.11 1.17 0.94 0.54
Gap junction protein alpha 3; connexin 46 19.6 CZP3/GJA3 D13S1236 21.6 124-132 1998 Panel −∞ −2.70 −1.00 −0.70 −0.40 −0.22 −0.10
CCPSO D15S117 56.3 132-150 1998 Panel −∞ −14.39 −4.35 −2.70 −1.23 −0.54 −0.17
CTM D16S265 62.1 89-117 1998 Panel −∞ −11.69 −3.35 −2.00 −0.84 −0.31 −0.07
Heat-shock transcription factor 4 65.8 HSF4 D16S3095 68.5 150-162 TA −∞ −4.20 −0.90 −0.42 −0.05 0.06 0.06
CTM D16S518 76.7 272-290 1998 Panel −∞ −11.39 −3.05 −1.71 −0.56 −0.09 0.07
CTAA2 D17S849 0.4 251-261 1998 Panel −∞ −11.99 −3.63 −2.26 −1.06 −0.52 −0.23
Crystallin, beta A1 24.6 CCZS D17S805 19.3 216-228 1998 Panel −∞ −11.69 −3.35 −2.00 −0.84 −0.31 −0.07
CCA1 D17S836 74.8 202-210 1998 Panel 0.30 0.30 0.26 0.21 0.13 0.06 0.02
Ferritin 54.2 FTL D19S412 51.7 97-109 TA *
CCP3 D20S917 9.2 141-167 TA *
Crystallin, alpha A 43.5 CRYAA D21S171 44.8 111-133 1998 Panel −∞ −4.50 −1.18 −0.67 −0.25 0.09 −0.02
Crystallin, beta B2 23.9 CRYBB2 D22S258 24.3 177-195 1998 Panel −∞ −12.29 −3.88 −0.04 −1.17 0.52 −0.17
Crystallin, beta B1 25.3 CRYBB1 D22S1167 25.4 266-278 TA −8.10 −3.00 −2.10 −1.19 −0.67 −0.29
Table 2.
 
Primers for LIM2, SIX5, and MIP
Table 2.
 
Primers for LIM2, SIX5, and MIP
Exon PCR Fragment (bp) Direction Sequence 5′–3′
LIM2: Chromosome 19
 1 330 F GTAGGGAGGCTTAAGGGATTTG
R GTTCTGAGCAAGGAATAGGCTG
 2 313 F TTCAAGTCCTGGGGATTCAGCTC
R TCTGGAATACAGGTGTCCTTGGC
 2 178 F CCAGTTCCTCCCTTCAAGTCCTG
R GACCCTGACAGCCGGTACTGC
 3 679 F GGTGTTTATGACACAGAACCAACC
R GTACACCAGCTAGTGTCAGATAG
 3 426 F CATTTTCATCTCAGAGGTAGCAG
R GTACACCAGCTAGTGTCAGATAG
 3 Sequence only I CATTTTCATCTCAGAGGTAGCAG
 4 287 F GCTCTCTGAGGGCCTCCAAAATC
R GGGACACCCTGTCATCTTCCAC
 5 459 F CCACATGAGTCCCACAGCACTG
R TAACAACCTGCCAGGCAGACGG
 5 244 F CTCAGTTCTGGACTGTGGGTTTG
R GACCACCCTTACAGCTGTTTCTC
 Promoter F AGGCTCTGCGACTCAGGTA
R AGAACAGGCCACCACCCAT
SIX5: Chromosome 19
 3′ UTR 1274 F GAGCCCCAGAAATGCGGTTG
R CCGCGGCTCTTGCTGGAAGC
 5′ UTR 1065 F CCTCCTCACTTGCGCTGCTC
R CTCCCTCGGGCTTTCCCCAG
 1 636 F AAGCGCGGCCAGAGGCGGAG
R CAACACCGGGTCGCTGCCAC
679 F GCCACGCCGGCCGCTTGAGC
R CGGGTGCCTGTCCCGTCCAC
 2 954 F GAGCAGCTGGCTGGCTATG
R ACAGCCCCTCCCTCTCCGAGAT
 3 770 F TCTCCACTTCTCTCTGGCTTG
R TCAGCAACCGCATTTCTG
MIP Chromosome 12
 1 270 F AAGGGGACTGTCCACCCAG
R TGGGCTCCACTGATGTGGC
 1 306 F GGCTATGGCATTTGGCTTGG
R CTGCACCAGTCAGGGAGTC
 1 216 F TCCTCTATAAAGGGGACTGTC
R GCCACCTGCAGAACATGCAG
 1 300 F CACTTCTCGTAGTCTCTCTTGCTG
R GCTGATCGCAGTTCCCACATGGC
 2 263 F AGGAGGTAACACTGTGGCAG
R GAATCCTTGAATGAGAAGTTGC
 3 169 F AAGCTGGGGTGCAGTAGGG
R GAGTGCTGGTACAGCAGCC
 4 258 F CAGCGTTGCTGCTCTGTCC
R TCAGCTGGAGCTTCTACAGG
 4 254 F GGGAACCTGTTGAACTGAACA
R TGGGGAGGAAGGGAAGTTTG
 4 201 F CTCAAGAGTATTTCTGAGAGAC
R ACAGTCTCTTTCTTCATCTAGG
 4 279 F GAATATACACATGCTAAGGTGTGG
R AGTCTCTCAAGAAATACTCTTGAGC
Table 3.
 
Lod Scores between ADC4 Disease Locus and Polymorphic Markers on Chromosome 19
Table 3.
 
Lod Scores between ADC4 Disease Locus and Polymorphic Markers on Chromosome 19
Marker Mbp Lod Score
m = θf = 0) 0.001 0.05 0.1 0.2 0.3 0.4
D19S216 4.9 −∞ −5.01 −1.63 −1.07 −0.55 −0.29 −0.12
D19S884 8.1 −∞ −2.91 −1.14 −0.79 −0.44 −0.24 −0.10
D19S221 12.6 −∞ −7.89 −2.79 −1.90 −1.02 −0.53 −0.22
D19S226 14.5 −∞ −5.39 −0.51 0.16 0.57 0.56 0.36
D19S414 36.6 0.60 0.60 0.54 0.47 0.34 0.21 0.10
D19S220 43.1 −∞ 0.91 2.32 2.32 1.96 1.39 0.71
D19S223 46.1 1.81 1.80 1.65 1.49 1.13 0.74 0.33
D19S420 48.5 2.71 2.71 2.51 2.30 1.84 1.32 0.71
D19S178 49.1 0.90 0.90 0.84 0.77 0.61 0.44 0.24
D19S903 49.7 3.91 3.91 3.60 3.27 2.56 1.76 0.89
SIX5 51.0
DMPK 51.0
D19S902 53.0 −∞ 0.91 2.32 2.32 1.98 1.45 0.79
FTL 54.2
LIM2 56.6
D19S571 58.0 −∞ −0.60 0.93 1.48 0.96 0.72 0.40
D19S418 60.2 −∞ −5.99 −1.07 −0.35 0.16 0.28 0.20
D19S210 61.7 −∞ −4.67 −1.28 −0.71 −0.24 −0.07 −0.01
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×