September 2007
Volume 48, Issue 9
Free
Retinal Cell Biology  |   September 2007
Positive Feedback Regulation between MMP-9 and VEGF in Human RPE Cells
Author Affiliations
  • Margrit Hollborn
    From the Department of Ophthalmology and Eye Clinic and the
    Interdisciplinary Center of Clinical Research, University of Leipzig Faculty of Medicine, Leipzig, Germany; and the
  • Christina Stathopoulos
    From the Department of Ophthalmology and Eye Clinic and the
  • Anja Steffen
    Interdisciplinary Center of Clinical Research, University of Leipzig Faculty of Medicine, Leipzig, Germany; and the
  • Peter Wiedemann
    From the Department of Ophthalmology and Eye Clinic and the
  • Leon Kohen
    From the Department of Ophthalmology and Eye Clinic and the
    Department of Ophthalmology, Helios Klinikum Aue, Aue, Germany.
  • Andreas Bringmann
    From the Department of Ophthalmology and Eye Clinic and the
Investigative Ophthalmology & Visual Science September 2007, Vol.48, 4360-4367. doi:10.1167/iovs.06-1234
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Margrit Hollborn, Christina Stathopoulos, Anja Steffen, Peter Wiedemann, Leon Kohen, Andreas Bringmann; Positive Feedback Regulation between MMP-9 and VEGF in Human RPE Cells. Invest. Ophthalmol. Vis. Sci. 2007;48(9):4360-4367. doi: 10.1167/iovs.06-1234.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

purpose. The proteolytic activity of matrix metalloproteinases (MMPs) is involved in pathologic angiogenesis in the eye. However, it is unknown whether MMPs may stimulate the production of the major angiogenic factor, vascular endothelial growth factor (VEGF). The authors investigated whether MMP-2 and MMP-9 alter the expression of VEGF by retinal pigment epithelial (RPE) cells. They also sought to determine the effects of MMPs on cellular proliferation and migration and the effect of triamcinolone acetonide on MMP-9–evoked cellular responses.

methods. Human RPE cell cultures were stimulated with MMP-2 or MMP-9. The gene expression and secretion of MMP-9 and VEGF were determined by real-time RT-PCR and ELISA, respectively. Cellular proliferation was investigated with a bromodeoxyuridine immunoassay, and chemotaxis was examined with a Boyden chamber assay.

results. Under control conditions, RPE cells in vitro expressed a significantly higher amount of mRNA for MMP-2 than for MMP-9. Chemical hypoxia caused upregulation of the gene expression of both MMPs, whereas VEGF increased the gene expression and secretion of MMP-9. The hypoxic expression of MMP-9 was mediated by autocrine VEGF signaling. Exogenous MMP-9 increased the gene expression and secretion of VEGF, whereas MMP-2 reduced the secretion of VEGF. MMP-2 and MMP-9 did not alter the proliferation but stimulated the migration of RPE cells. Triamcinolone fully inhibited the stimulatory effect of MMP-9 on the expression of VEGF and the VEGF-evoked increase in the expression of MMP-9. However, triamcinolone had no effect on the motogenic effect of MMP-9.

conclusions. There is a positive feedback regulation between MMP-9 and VEGF in RPE cells. The hypoxic expression of MMP-9 may stimulate the production and secretion of VEGF under pathologic conditions. Triamcinolone inhibits the positive feedback regulation between MMP-9 and VEGF under hypoxic conditions through inhibition of the gene expression of MMP-9 and the secretion of VEGF.

Pathologic angiogenesis is a characteristic feature of important blinding diseases such as diabetic retinopathy and the exudative form of age-related macular degeneration. Angiogenesis, defined as the sprouting of new vessels from preexisting capillaries, is a complex process comprising endothelial cell proliferation, migration, extracellular proteolysis, tube formation, and vessel remodeling. 1 The vascular endothelial growth factor (VEGF) is the major angiogenic factor in the retina that promotes neovascularization and vascular leakage. 2 3 4 5 6 7 8 However, additional proangiogenic factors and their receptors, which cooperate with VEGF at the level of the target cells or which stimulate the secretion of angiogenic factors by retinal cells, may be necessary for the process of ocular neovascularization. 9 10 11 12 13  
One important event implicated in the migration and proliferation of vascular endothelial cells is the proteolytic degradation of basement membranes and extracellular matrix components by matrix metalloproteinases (MMPs). The secretion of MMPs allows endothelial cells to penetrate their underlying basement membrane and eliminates the contact inhibition that normally blocks endothelial cell proliferation. 14 The expression of MMP-2 and MMP-9 (gelatinases A and B) has been correlated with the progression of neovascular diseases. 15 16 17 18 These proteinases degrade—in addition to many nonmatrix molecules—most extracellular matrix components including type IV collagen, a major component of basement membranes and Bruch membrane, thereby allowing proteolysis-associated migration of endothelial cells. MMP-2 and MMP-9 have been implicated in the induction of retinal neovascularization in the retinopathy of prematurity animal model, in the pathogenesis of diabetic retinopathy, and in choroidal neovascularization (CNV). 19 20 21 22 23 24 25 Neovascularization can be significantly inhibited by application of an MMP-2 or MMP-9 inhibitor. 20 21 22 The retinal pigment epithelium (RPE) expresses both MMP-2 and MMP-9, 26 and it has been shown that growth factors and inflammatory mediators upregulate the expression of MMPs in RPE cells. 27 28 29  
In experimental CNV, the upregulation of MMP-9 has especially been associated with neovascularization. 24 Whereas the normal healthy retina of the mouse displays no or weak expression of MMP-9, MMP-9 is increasingly expressed in the vicinity of laser-induced retinal injury, in the RPE and choroidea, and in inflammatory cells. 24 Mice deficient in MMP-9 display a lower level of laser-induced CNV. 24 In addition to the facilitation of neovascularization at the level of the target cells, MMP-9 may promote pathologic angiogenesis through stimulation of the release of VEGF. In tumors of pancreatic islets, this proteinase increases the bioavailability of VEGF through the mobilization of VEGF from extracellular matrix-associated reservoirs. 30 Despite the facilitating role of MMP-9 in ocular neovascularization, it is unknown whether this proteinase increases the secretion of VEGF from RPE cells and if so, whether this increase is mediated by the stimulation of VEGF production. Therefore, we investigated in cultured human RPE cells whether direct stimulation of the cells with MMP-9 or MMP-2 alters the gene expression and secretion of VEGF. Furthermore, we investigated whether MMP-2 and MMP-9 influence two important cellular responses of RPE cells in proliferative retinopathies—cellular proliferation and migration—and whether the angiostatic steroid triamcinolone acetonide (9α-fluoro-16α-hydroxyprednisolone), which is known to reduce the secretion of VEGF from RPE cells, 31 may inhibit the effects of MMP-9 on the cells. 
Materials and Methods
Materials
Human recombinant VEGF-A165 was purchased from R&D Systems (Minneapolis, MN). Human recombinant MMP-2 and MMP-9 (purified active forms), PD98059, SP600125, SU1498, and LY294002 were obtained from Calbiochem (Bad Soden, Germany). AG1478 was from Alexis (Grünberg, Germany); U0126 and SB203580 were from Tocris (Ellisville, MO). All other substances were from Sigma-Aldrich (Taufkirchen, Germany), unless stated otherwise. The test substances had no effect on cell viability, as determined by trypan blue exclusion (not shown). Apparently, culturing the cells in the presence of MMP-2 or MMP-9 (50 ng/mL each) for up to 24 hours did not alter the cellular morphology (not shown). 
Cell Culture
The use of human material was approved by the Ethics Committee of the University of Leipzig, and the study was performed according to the Declaration of Helsinki. Human RPE cells were obtained from several donors within 48 hours of death and were prepared as described. 32 Cells were suspended in complete Ham F-10 medium containing 10% fetal bovine serum, diagnostic medium (Glutamax II; Invitrogen), and gentamicin and were cultured in tissue culture flasks (Greiner, Nürtingen, Germany) in 95% air/5% CO2 at 37°C. Cells of passages 3 to 5 were used. The epithelial nature of the RPE cells was routinely identified by immunocytochemistry using the monoclonal antibodies AE1 (recognizing most of the acidic type I keratins) and AE3 (recognizing most of the basic type II keratins), both from Chemicon (Hofheim, Germany). All tissue culture components and solutions were purchased from Gibco BRL (Paisley, UK). 
Real-Time RT-PCR
Total RNA was extracted (RNeasy Mini Kit; Qiagen, Hilden, Germany) and was treated with DNase I (Roche, Mannheim, Germany). cDNA was synthesized from 1 μg total RNA using a cDNA synthesis kit (RevertAid H Minus First Strand cDNA Synthesis Kit; Fermentas, St. Leon-Roth, Germany). Semiquantitative real-time RT-PCR was performed (Single-Color Real-Time PCR Detection System; BioRad, Munich, Germany) with the primer pairs described in Table 1 . The PCR solution contained 1 μL cDNA, specific primer set (0.5 μM each), and 10 μL primer (QuantiTect SYBR Green PCR Kit; Qiagen) in a final volume of 20 μL. PCR parameters were initial denaturation and enzyme activation (one cycle at 95°C for 15 minutes); denaturation, amplification, and quantification for 45 cycles at 95°C for 30 seconds, 60°C for 30 seconds, and 72°C for 1 minute; melting curve, 55°C, with the temperature gradually increased (0.5°C) to 95°C. mRNA expression was normalized to the levels of GAPDH mRNA, and the changes were calculated as described. 33 For the calculation of the relative expression changes, we used the fluorescence signal of lower cycles during the log phase of the product formation. Real-time PCR efficiency (E) was calculated according to the equation: E = 10[−1/slope]. Efficiencies of the target genes were found to be similar in the investigated range between 0.5 and 100 ng cDNA (VEGF-A, 2.31; PEDF, 2.21; MMP-2, 2.20; MMP-9, 2.06; GAPDH, 2.30). Amplified PCR products were analyzed routinely by standard agarose gel electrophoresis. 
ELISA
Cells were cultured at 3 × 103 cells per well in 96-well plates (100 μL culture medium per well). At a confluence of approximately 80%, the cells were cultured in serum-free medium for 16 hours. Subsequently, the culture medium was changed, and the cells were stimulated by various factors or MMPs in the absence and presence of triamcinolone. Supernatants were collected after 6 hours, and the levels of total MMP-9 (92-kDa proactive and 83-kDa active forms) or VEGF-A165 in the cultured media (100 and 200 μL, respectively) were determined by ELISA (R&D Systems). 
DNA Synthesis Rate
Cells were seeded at 3 × 103 cells per well in 96-well microtiter plates (Greiner) and were allowed to attach for 48 hours. Thereafter, the cells were growth arrested in medium without serum for 5 hours; subsequently, medium containing 0.5% serum with and without test substances was added for another 24 hours. The proliferation rate was determined by measurement of the DNA synthesis rate. The incorporation of bromodeoxyuridine (BrdU) into the genomic DNA was determined with the use of the Cell Proliferation ELISA BrdU Kit (Roche). BrdU (10 μM) was added to the culture medium 5 hours before fixation. 
Chemotaxis
Chemotaxis was determined with a modified Boyden chamber assay. Suspensions of RPE cells (100 μL; 5 × 105 cells/mL serum-free medium) were seeded onto polyethylene terephthalate filters (diameter, 6.4 mm; pore size, 8 μm; Becton Dickinson, Heidelberg, Germany) coated with fibronectin (50 μg/mL) and gelatin (0.5 mg/mL). Within 16 hours of seeding, the cells attached to the filter and formed a semiconfluent monolayer. Cells were pretreated with blocking substances for 30 minutes, and thereafter the medium was changed to medium without additives in the upper well and medium containing MMP-2 or MMP-9 and the appropriate blockers in the lower well. After incubation for 6 hours, the inserts were washed with buffered saline, fixed with Karnofsky reagent, and stained with hematoxylin. Nonmigrated cells were removed from the filters by gentle scrubbing with a cotton swab. Migrated cells were counted, and the results were expressed relative to the cell migration rate in the absence of test substances. 
Statistical Analysis
Rates of BrdU incorporation and migration are expressed as percentages of untreated control (100%). ELISA data were normalized to the total cellular protein content and were presented as picogram of secreted protein per microgram of cellular protein. For each test, at least three independent experiments were performed in triplicate. Data are expressed as mean ± SEM. Statistical significance (Kruskal-Wallis test followed by Dunn comparison for multiple groups) was accepted at P < 0.05. 
Results
Gene Expression of MMP-2 and MMP-9 in RPE Cells
Human RPE cells expressed mRNAs for MMP-2 and MMP-9 (Fig. 1A) . With real-time PCR, we determined the gene expression levels for both MMPs. Under unstimulated control conditions, cultured RPE cells expressed a significantly (P < 0.001) higher amount of mRNA for MMP-2 than for MMP-9, as indicated by the lower cycle threshold number necessary to detect the MMP-2 transcript compared with the MMP-9 transcript (Fig. 1B) . To determine whether the gene expression of both MMPs is regulated by pathogenic factors, we tested chemical hypoxia induced by CoCl2 (150 μM), oxidative stress evoked by H2O2 (20 μM), high-glucose conditions (with 25 mM glucose in the culture medium), and stimulation of the cultures with VEGF. Chemical hypoxia caused a transient upregulation of the gene expression of MMP-2 and MMP-9 that was apparent after two hours of hypoxia (Figs. 1C 1D)but not after 6 and 24 hours (not shown). Oxidative stress slightly decreased the gene expression of both MMPs (not shown), whereas VEGF induced a transient upregulation of the gene expression of MMP-9 after 2 hours of stimulation (Fig. 1D)and had no effect on the level of MMP-2 mRNA (Fig. 1C) . High-glucose conditions did not alter the gene expression of MMP-2 and MMP-9 (not shown). The data indicated that the gene expression of MMP-2 and MMP-9 in RPE cells was upregulated under hypoxic conditions and that VEGF increased the gene expression of MMP-9. 
Secretion of MMP-9
We found that chemical hypoxia and VEGF increase the gene expression of MMP-9 in RPE cells. To determine whether this increase is associated with the secretion of MMP-9, the content of total MMP-9 protein in the cultured media was measured by ELISA. Similar to the effects on gene expression, chemical hypoxia caused a significant increase in the secretion of MMP-9, whereas conditions involving high glucose or oxidative stress did not alter secretion (Fig. 2A) . VEGF induced a dose-dependent increase in the secretion of MMP-9 (Fig. 2B) . The data indicate that the secretion of MMP-9 by RPE cells is stimulated by VEGF and under hypoxic conditions. Because hypoxia is the primary condition that induces upregulation of VEGF in retinal cells, 4 we tested whether the hypoxic stimulation of MMP-9 secretion is mediated by autocrine VEGF signaling. As shown in Figure 2C , the selective inhibitor of the kinase insert domain-containing (KDR)/flk-1 receptor, SU1498, prevented the increase in MMP-9 secretion induced by chemical hypoxia, suggesting a crucial role of autocrine VEGF signaling in the hypoxic stimulation of MMP-9 secretion. 
MMP-Mediated Regulation of VEGF Expression
With real-time PCR and ELISA, we investigated whether the stimulation of RPE cells by MMP-2 and MMP-9 induces gene expression and secretion of VEGF. As shown in Figure 3 , exogenous MMP-9, but not MMP-2, caused a transient increase in the gene expression of VEGF-A. MMP-9 did not alter the gene expression of various other members of the VEGF family or for their receptors, including VEGF-B, VEGF -C, VEGF -D, flt-1, and KDR (Fig. 3) . Furthermore, MMP-2 and MMP-9 had no effects on the gene expression of the pigment epithelium-derived factor (PEDF; not shown). To determine whether MMPs alter the secretion of VEGF, RPE cells were cultured in the presence of MMP-2 or MMP-9 for 6 hours, and the content of VEGF-A165 in the cultured media was analyzed by ELISA. Cells constitutively released VEGF into the culture media. Exogenous MMP-2 caused a slightly significant (P < 0.05) decrease in the VEGF content of the cultured media (Fig. 4A) . In contrast, stimulation of the cells with MMP-9 caused a significant (P < 0.01) increase in the secretion of VEGF. The stimulatory effect of MMP-9 showed dose dependence at concentrations above 1 ng/mL (Fig. 4B) . The data indicated that MMP-9 stimulated the gene and protein expression of VEGF-A in RPE cells, whereas MMP-2 reduced the secretion of VEGF. Simultaneous administration of both MMPs revealed that the reducing effect of MMP-2 on the secretion of VEGF was overwhelmed by MMP-9 (Fig. 4C)
MMP-Mediated Regulation of Cellular Proliferation and Chemotaxis
To determine further physiological roles of MMPs in RPE cells, the effects of MMP-2 and MMP-9 on cellular proliferation and chemotaxis were examined. Exogenous MMP-2 or MMP-9 in quantities up to 100 ng/mL did not alter the rate of RPE cell proliferation (not shown). On the other hand, both MMPs dose-dependently stimulated the chemotaxis of RPE cells. MMP-9 had a significantly stronger effect than MMP-2 at higher doses (P < 0.01 at 10 ng/mL) (Fig. 5A) . We found that the motogenic effect of MMP-9 on RPE cells was mediated by activation of the p38 mitogen-activated protein kinase, the phosphatidylinositol-3 kinase (PI3K)-Akt, and c-Jun N-terminal kinase (JNK) signal transduction pathways but was apparently independent on activation of the extracellular signal-regulated kinases 1 and 2 (ERK1/2; Fig. 5B ). AG1478, an inhibitor of the epidermal growth factor (EGF) receptor tyrosine kinase, was unable to alter the rate of cell migration, suggesting that transactivation of EGF receptors did not occur. The inhibitor of ERK1/2 activation, PD98059, stimulated cell migration under control conditions (Fig. 5B) . A similar effect was observed with another inhibitor of ERK1/2 activation, UO126 (4 μM; not shown). These data suggest the presence of an inhibitory cross-talk between p38 and ERK1/2 in RPE cells. It has been shown in various cell systems that pharmacologic inhibition of ERK1/2 activation causes an increase in cell migration. 34 35  
Effect of Triamcinolone Acetonide
It is known that the angiostatic steroid triamcinolone acetonide reduces the secretion of VEGF by RPE cells. 31 We found that triamcinolone significantly decreased the secretion of VEGF by RPE cells at control conditions and after stimulation with MMP-2 and MMP-9 (Fig. 4A) . The effect of triamcinolone was dose dependent, with a half-maximal effect at a concentration below 10 nM (Fig. 4D) . Triamcinolone also prevented the MMP-9–evoked increase in the gene expression of VEGF-A (Fig. 3A) . Furthermore, triamcinolone inhibited the hypoxic increase in the gene expression of MMP-2 and MMP-9 (Figs. 1C 1D)and the VEGF-evoked increase in the gene expression of MMP-9 (Fig. 1D) . The secretion of MMP-9 evoked by chemical hypoxia (Fig. 2C)or VEGF (Fig. 2D)was prevented in the presence of triamcinolone. The VEGF-evoked secretion of MMP-9 was fully inhibited at a triamcinolone concentration of 1 μM (Fig. 2D) . It is concluded that triamcinolone inhibits the positive feedback regulation between MMP-9 and VEGF by blockade of the gene expression and secretion of both factors. In contrast, the motogenic effect of MMP-9 was not inhibited by triamcinolone (Fig. 5B)
Discussion
It has been shown that RPE cells in situ secrete VEGF from its basolateral surface to keep the choroidal vessels fenestrated and PEDF from its apical surface to inhibit vascularization of the photoreceptor layer. 36 37 38 Both factors are also survival factors for the respective target cells. Upregulation of VEGF expression by RPE cells under hypoxic conditions is crucially implicated in the pathologic neovascularization that occurs in blinding diseases such as age-related macular degeneration. 7 However, the factors that cause overproduction of VEGF by RPE cells under pathologic conditions are not well characterized. Here we describe the presence of a positive feedback regulation between MMP-9 and VEGF in RPE cells that may contribute to the hypoxic expression of both factors. MMP-9 increases the expression of VEGF in RPE cells by stimulation of the gene transcription and secretion. Conversely, VEGF increases the gene expression and secretion of MMP-9. In contrast to MMP-9, MMP-2 reduces the secretion of VEGF-A (Fig. 4A)
We found that MMP-2 does not regulate the expression of VEGF at the transcriptional level (Fig. 3) , suggesting that the reducing effect of MMP-2 on the secretion of VEGF is likely mediated by posttranscriptional mechanisms. The presence of posttranscriptional or posttranslational regulation is also suggested by the observation that the increases in mRNA expression of MMP-9 and VEGF were generally larger than the increases in protein secretion. It has been shown in different cell systems that the expression of MMP-9 is regulated at various levels, including transcription, mRNA stability, translational efficiency, vesicle transport, and secretion. 39 40 41 A decrease in MMP-9 mRNA stability, for example, has been described to be induced by nitrosative stress. 42 In fibroblasts, hypoxia-induced MMP-9 expression shows an imbalance between mRNA and protein level, which may be subjected to an inhibited translation of mRNA. 43 The cause of the apparent difference in the gene and protein expression of MMP-9 in RPE cells remains to be determined in future experiments. 
MMPs have been implicated in neovascularization because of their support of the migration and proliferation of vascular endothelial cells through the proteolytic degradation of basement membranes and extracellular matrix components. The present finding that MMP-9 causes the upregulation of VEGF expression by RPE cells suggests that this proteinase also may facilitate pathologic neovascularization through stimulation of the production of angiogenic factors. Although hypoxia increases the gene expression of both MMPs (Figs. 1C 1D) , the feedback regulation between MMP-9 and VEGF is assumed to be implicated in the angiogenic switch that occurred in the retinal tissue under hypoxic conditions. This assumption was based on two observations: The gene expression of MMP-9, but not of MMP-2, was elevated by VEGF (Figs. 1C 1D) . The inhibitory effect of MMP-2 on the secretion of VEGF did not increase at higher concentrations, whereas the stimulatory effect of MMP-9 increased dose dependent (Fig. 4B) . Therefore, though the expression of MMPs is increased under hypoxic conditions, the stimulatory effect of MMP-9 on the secretion of VEGF may overcome the inhibitory effect of MMP-2 at higher concentrations (Fig. 4C) , resulting in a net stimulation of VEGF release. The positive feedback regulation of VEGF on the expression of MMP-9 may exacerbate this process. The different dose-dependent regulation of VEGF secretion by MMP-2 and MMP-9 represents a novel component of the angiogenic switch in the retinal tissue under hypoxic conditions. The importance of MMP-9 for pathologic angiogenesis has been shown in experimental CNV. Gene expression patterns of MMP-2 and MMP-9 differ in laser-induced CNV in mice; whereas MMP-2 is constantly expressed after laser-induced rupture of the Bruch membrane both in the choroidal neovascular membrane and in adjacent intact areas, the expression of MMP-9 coincides with the neovascular response. 24 The authors suggest that inflammatory cells are a major provider of MMP-9, which contain preformed MMP-9 in intracellular granules and which are recruited into the neovascular area. 24 It remains to be determined in future experiments whether MMP-9 derived from inflammatory cells may trigger the positive feedback regulation of VEGF and MMP-9 expression in RPE cells. In addition to the stimulation of VEGF release, MMP-9 secreted by RPE cells under hypoxic conditions may have further effects that contribute to pathologic processes. An increased secretion of MMP-9 may cause impairments of the interaction of RPE cells with their extracellular matrix and Bruch membrane, and may cause ruptures and enhanced hydraulic conductivity of Bruch membrane. 26 Furthermore, RPE-derived MMP-9 may contribute to the leakage of retinal endothelium and pigment epithelium through the proteolytic degradation of the tight junction protein occludin 14 44 and to the stimulation of RPE cell migration as a component of the progression of fibrovascular membranes. 
Angiostatic steroids such as triamcinolone acetonide represent a potential treatment of ocular disorders associated with pathologic angiogenesis by inhibiting or stabilizing neovascularization. 45 46 47 The development of laser-induced CNV is reduced by angiostatic steroids, 48 49 and triamcinolone inhibits the migration and tube formation of choroidal endothelial cells. 50 In addition to the anti-inflammatory action of triamcinolone and its reducing effect on vascular edema, the steroid may inhibit neovascularization by the downregulation of angiogenic factors. Triamcinolone reduces the vitreal level of VEGF in patients with diabetic retinopathy 51 and decreases the secretion of VEGF by RPE cells 31 and the transcription of the VEGF gene in vascular smooth muscle cells. 52 It has been shown that triamcinolone reduces the expression of MMP-2 and MMP-9 in choroidal endothelial cells and exerts its inhibitory effects on endothelial cell migration and tube formation, at least in part, by inhibiting MMP-2 activation. 50 Here we show that triamcinolone decreases the gene expression of MMP-2 and MMP-9 and inhibits the secretion of MMP-9 by RPE cells evoked by chemical hypoxia or VEGF. In addition, triamcinolone reduces the gene expression and VEGF secretion after stimulation of the cells with MMP-9. The data suggest that this steroid inhibits the positive feedback regulation between MMP-9 and VEGF in RPE cells under hypoxic conditions through inhibition of the gene expression of both factors. On the other hand, triamcinolone does not inhibit the effect of MMP-9 on the chemotaxis of RPE cells. The observation that, under control conditions, triamcinolone decreased the secretion (Fig. 4A)but not the gene expression of VEGF (Fig. 3)is in agreement with a recent study that showed this steroid acts at the posttranscriptional level. 53 In contrast, triamcinolone decreased both the gene expression (Fig. 3)and the secretion of VEGF (Fig. 4A)after stimulation with MMP-9, suggesting that transcriptional and posttranscriptional mechanisms are involved in the steroid-induced decrease in VEGF production by RPE cells. 
In summary, we show that RPE cells upregulate the expression of MMP-2 and MMP-9 under hypoxic conditions and that MMP-9 but not MMP-2 stimulates the production and secretion of VEGF. It is suggested that MMP-9, in addition to its proteolytic action on basement membranes and extracellular matrix components, facilitates neovascularization by direct stimulation of the expression of angiogenic factors by RPE cells. Inhibition of MMP-9, such as by intravitreal triamcinolone, may be a promising method to increase the efficiency of anti-VEGF therapies of ocular neovascularization. 
 
Table 1.
 
Primer Pairs Used for PCR Experiments
Table 1.
 
Primer Pairs Used for PCR Experiments
Gene and Accession Number Primer Sequence (5′→3′) Amplicon (bp)
h GAPDH GCAGGGGGGAGCCAAAAGGGT 219
XM_006959 TGGGTGGCAGTGATGGCATGG
h VEGF-A CCTGGTGGACATCTTCCAGGAGTA 407
AH001553 CTCACCGCCTCGGCTTGTCACA 347
275
h VEGF-B ACCGGATCATGAGGATCTGCA 223
U52819 CTCTCAAGGCCCCAAACCA
h VEGF-C CTCTCAAGGCCCCAAACCA 152
NM_005429 AGGTCTTGTTCGCTGCCTGA
h VEGF-D GATCGCTGTTCCCATTCCA 152
NM_004469 ATCATGTGTGGCCCACAGAGA
h flt-1 TCCCTTATGATGCCAGCAAGT 161
AF063657 CCCCTCTTTCAGCATTTTCAC
h KDR CTTCGAAGCATCAGCATAAGAAACT 156
AF063658 TGGTCATCAGCCCACTGGAT
h PEDF TGCAGGCCCAGATGAAAGGG 342
M67979 TGAACTCAGAGGTGAGGCTC
h MMP-2 TTGACGGTAAGGACGGACTC 153
NM_004530 ACTTGCAGTACTCCCCATCG
h MMP-9 TTGACAGCGACAAGAAGTGG 179
NM_004994 GCCATTCACGTCGTCCTTAT
Figure 1.
 
Regulation of the gene expression of MMP-2 and MMP-9 in human RPE cells. (A) RT-PCR was carried out to determine the presence of mRNA for GAPDH, VEGF-A, PEDF, MMP-2, and MMP-9 in RPE cell cultures. The negative control (−) was made by adding water instead of cDNA. The presence of gene products was determined after 45 cycles. (B) Evaluation of the mRNA levels by using real-time PCR. Cycle numbers necessary to detect the mRNAs are shown (relative to the cycle number for the detection of GAPDH mRNA). (C, D) Regulation of the gene expression level of MMP-2 (C) and MMP-9 (D) by VEGF (10 ng/mL), CoCl2 (150 μM), and triamcinolone acetonide (triam; 50 μM), respectively. Cultures were stimulated for 2 hours. Mean ± SEM of five to seven independent experiments using cells from different donors. Significant differences compared with untreated control: *P < 0.05; **P < 0.01; P < 0.05; •• P < 0.01; ••• P < 0.001.
Figure 1.
 
Regulation of the gene expression of MMP-2 and MMP-9 in human RPE cells. (A) RT-PCR was carried out to determine the presence of mRNA for GAPDH, VEGF-A, PEDF, MMP-2, and MMP-9 in RPE cell cultures. The negative control (−) was made by adding water instead of cDNA. The presence of gene products was determined after 45 cycles. (B) Evaluation of the mRNA levels by using real-time PCR. Cycle numbers necessary to detect the mRNAs are shown (relative to the cycle number for the detection of GAPDH mRNA). (C, D) Regulation of the gene expression level of MMP-2 (C) and MMP-9 (D) by VEGF (10 ng/mL), CoCl2 (150 μM), and triamcinolone acetonide (triam; 50 μM), respectively. Cultures were stimulated for 2 hours. Mean ± SEM of five to seven independent experiments using cells from different donors. Significant differences compared with untreated control: *P < 0.05; **P < 0.01; P < 0.05; •• P < 0.01; ••• P < 0.001.
Figure 2.
 
Regulation of the secretion of MMP-9 protein by human RPE cells. The concentration of MMP-9 in the cultured media was determined by ELISA and is expressed as picogram secreted protein per microgram cellular protein. (A) The secretion of MMP-9 was stimulated by chemical hypoxia induced by CoCl2 (150 μM) and remained unaltered under conditions of high glucose (25 mM) and oxidative stress (H2O2; 20 and 50 μM, respectively). Under untreated control conditions, the mean MMP-9 content in the cultured media was 0.43 ± 0.02 pg/μg cellular protein. (B) VEGF dose dependently stimulated the secretion of MMP-9. (C) The selective antagonist of KDR, SU1498 (10 μM), and triamcinolone acetonide (triam; 50 μM) prevented the stimulatory effect of CoCl2 (150 μM) on the secretion of MMP-9. (D) Triamcinolone (1 μM) inhibited the stimulatory effect of VEGF (100 ng/mL) on the secretion of MMP-9. Mean ± SEM of four independent experiments using cells from different donors. Significant differences compared with untreated control: *P < 0.05; **P < 0.01; P < 0.05; ••• P < 0.001.
Figure 2.
 
Regulation of the secretion of MMP-9 protein by human RPE cells. The concentration of MMP-9 in the cultured media was determined by ELISA and is expressed as picogram secreted protein per microgram cellular protein. (A) The secretion of MMP-9 was stimulated by chemical hypoxia induced by CoCl2 (150 μM) and remained unaltered under conditions of high glucose (25 mM) and oxidative stress (H2O2; 20 and 50 μM, respectively). Under untreated control conditions, the mean MMP-9 content in the cultured media was 0.43 ± 0.02 pg/μg cellular protein. (B) VEGF dose dependently stimulated the secretion of MMP-9. (C) The selective antagonist of KDR, SU1498 (10 μM), and triamcinolone acetonide (triam; 50 μM) prevented the stimulatory effect of CoCl2 (150 μM) on the secretion of MMP-9. (D) Triamcinolone (1 μM) inhibited the stimulatory effect of VEGF (100 ng/mL) on the secretion of MMP-9. Mean ± SEM of four independent experiments using cells from different donors. Significant differences compared with untreated control: *P < 0.05; **P < 0.01; P < 0.05; ••• P < 0.001.
Figure 3.
 
Effects of MMP-2 and MMP-9 on the gene expression of VEGF in human RPE cells. Regulation of the gene expression of members of the VEGF family and for their receptors, flt-1 and KDR, was investigated after stimulation of the cultures with MMP-2 or MMP-9 (each at 10 ng/mL) for 2, 6, or 24 hours. The effect of MMP-9 on the gene expression of VEGF-A was determined in the presence and absence of triamcinolone acetonide (triam; 50 μM). Mean ± SEM of three to six independent experiments using cells from different donors. Significant difference compared with untreated control: *P < 0.001; •• P < 0.01.
Figure 3.
 
Effects of MMP-2 and MMP-9 on the gene expression of VEGF in human RPE cells. Regulation of the gene expression of members of the VEGF family and for their receptors, flt-1 and KDR, was investigated after stimulation of the cultures with MMP-2 or MMP-9 (each at 10 ng/mL) for 2, 6, or 24 hours. The effect of MMP-9 on the gene expression of VEGF-A was determined in the presence and absence of triamcinolone acetonide (triam; 50 μM). Mean ± SEM of three to six independent experiments using cells from different donors. Significant difference compared with untreated control: *P < 0.001; •• P < 0.01.
Figure 4.
 
MMP-mediated regulation of the secretion of VEGF by human RPE cells. (A) Regulation of the VEGF secretion by MMP-2 and MMP-9. Cultures were stimulated with MMPs (each at 100 ng/mL) for 6 hours, and then the VEGF-A165 protein content in the cultured media was measured by ELISA. Triamcinolone acetonide (50 μM) decreased the secretion of VEGF in the absence and presence of MMPs. Under untreated control conditions, the mean VEGF-A protein content in the cultured media was 1.60 ± 0.08 pg/μg cellular protein. (B) Dose dependencies of the MMP effects on the secretion of VEGF protein. (C) Simultaneous administration of both MMPs revealed that MMP-9 inhibited the reducing effect of MMP-2 on the secretion of VEGF. The MMPs were tested at 10 and 100 ng/mL. (D) Dose dependencies of the inhibitory effect of triamcinolone on the secretion of VEGF under control conditions and after stimulation with MMP-9 (50 ng/mL). Mean ± SEM of three to five independent experiments using cells from different donors. Significant differences compared with untreated control: *P < 0.05; **P < 0.01; ***P < 0.001. Significant differences compared with MMP-9 stimulated controls: P < 0.05; •• P < 0.01; ••• P < 0.001; P < 0.05.
Figure 4.
 
MMP-mediated regulation of the secretion of VEGF by human RPE cells. (A) Regulation of the VEGF secretion by MMP-2 and MMP-9. Cultures were stimulated with MMPs (each at 100 ng/mL) for 6 hours, and then the VEGF-A165 protein content in the cultured media was measured by ELISA. Triamcinolone acetonide (50 μM) decreased the secretion of VEGF in the absence and presence of MMPs. Under untreated control conditions, the mean VEGF-A protein content in the cultured media was 1.60 ± 0.08 pg/μg cellular protein. (B) Dose dependencies of the MMP effects on the secretion of VEGF protein. (C) Simultaneous administration of both MMPs revealed that MMP-9 inhibited the reducing effect of MMP-2 on the secretion of VEGF. The MMPs were tested at 10 and 100 ng/mL. (D) Dose dependencies of the inhibitory effect of triamcinolone on the secretion of VEGF under control conditions and after stimulation with MMP-9 (50 ng/mL). Mean ± SEM of three to five independent experiments using cells from different donors. Significant differences compared with untreated control: *P < 0.05; **P < 0.01; ***P < 0.001. Significant differences compared with MMP-9 stimulated controls: P < 0.05; •• P < 0.01; ••• P < 0.001; P < 0.05.
Figure 5.
 
MMP-2 and MMP-9 are chemoattractants for human RPE cells. (A) Concentration-dependent chemotaxis toward MMP-2 and MMP-9, respectively. Data represent the rates of cellular migration in treated wells compared with those in wells without MMPs (100%). Under untreated control conditions, 216.2 ± 12.3 cells per filter were found to have migrated. (B) Effect of various blocking substances on the chemotaxis of RPE cells, in the absence and presence of MMP-9 (50 ng/mL). The following substances were tested: AG1478 (600 nM; an inhibitor of the EGF receptor tyrosine kinase), PD98059 (20 μM; a MEK1/2 inhibitor), LY294002 (5 μM; a PI3K inhibitor), SB203580 (10 μM; a p38 inhibitor), SP600125 (30 μM; a JNK inhibitor), and triamcinolone acetonide (50 μM). Mean ± SEM of four to six independent experiments using cells from different donors. Significant differences compared with untreated control (100%): *P < 0.05; **P < 0.01; ***P < 0.001. Significant differences compared with MMP-9 stimulated control: P < 0.05; •• P < 0.01.
Figure 5.
 
MMP-2 and MMP-9 are chemoattractants for human RPE cells. (A) Concentration-dependent chemotaxis toward MMP-2 and MMP-9, respectively. Data represent the rates of cellular migration in treated wells compared with those in wells without MMPs (100%). Under untreated control conditions, 216.2 ± 12.3 cells per filter were found to have migrated. (B) Effect of various blocking substances on the chemotaxis of RPE cells, in the absence and presence of MMP-9 (50 ng/mL). The following substances were tested: AG1478 (600 nM; an inhibitor of the EGF receptor tyrosine kinase), PD98059 (20 μM; a MEK1/2 inhibitor), LY294002 (5 μM; a PI3K inhibitor), SB203580 (10 μM; a p38 inhibitor), SP600125 (30 μM; a JNK inhibitor), and triamcinolone acetonide (50 μM). Mean ± SEM of four to six independent experiments using cells from different donors. Significant differences compared with untreated control (100%): *P < 0.05; **P < 0.01; ***P < 0.001. Significant differences compared with MMP-9 stimulated control: P < 0.05; •• P < 0.01.
The authors thank Ute Weinbrecht for excellent technical assistance. 
BeckL, Jr, D'AmorePA. Vascular development: cellular and molecular regulation. FASEB J. 1997;11:365–373. [PubMed]
D'AmorePA. Mechanisms of retinal and choroidal neovascularization. Invest Ophthalmol Vis Sci. 1994;35:3974–3979. [PubMed]
MillerJW, AdamisAP, ShimaDT, et al. Vascular endothelial growth factor/vascular permeability factor is temporally and spatially correlated with ocular angiogenesis in a primate model. Am J Pathol. 1994;145:574–584. [PubMed]
AielloLP, NorthrupJM, KeytBA, TakagiH, IwamotoMA. Hypoxic regulation of vascular endothelial growth factor in retinal cells. Arch Ophthalmol. 1995;113:1538–1544. [CrossRef] [PubMed]
OzakiH, SeoMS, OzakiK, et al. Blockade of vascular endothelial cell growth factor receptor signaling is sufficient to completely prevent retinal neovascularization. Am J Pathol. 2000;156:697–707. [CrossRef] [PubMed]
CampochiaroPA. Retinal and choroidal neovascularization. J Cell Physiol. 2000;184:301–310. [CrossRef] [PubMed]
WitmerAN, VrensenGF, Van NoordenCJ, SchlingemannRO. Vascular endothelial growth factors and angiogenesis in eye disease. Prog Retin Eye Res. 2003;22:1–29. [CrossRef] [PubMed]
WangF, RendahlKG, ManningWC, QuirozD, CoyneM, MillerSS. AAV-mediated expression of vascular endothelial growth factor induces choroidal neovascularization in rat. Invest Ophthalmol Vis Sci. 2003;44:781–790. [CrossRef] [PubMed]
IshidaS, ShinodaK, KawashimaS, OguchiY, OkadaY, IkedaE. Coexpression of VEGF receptors VEGF-R2 and neuropilin-1 in proliferative diabetic retinopathy. Invest Ophthalmol Vis Sci. 2000;41:1649–1656. [PubMed]
CastellonR, HamdiHK, SacerioI, AokiAM, KenneyMC, LjubimovAV. Effects of angiogenic growth factor combinations on retinal endothelial cells. Exp Eye Res. 2002;74:523–535. [CrossRef] [PubMed]
OhH, TakagiH, OtaniA, et al. Selective induction of neuropilin-1 by vascular endothelial growth factor (VEGF): a mechanism contributing to VEGF-induced angiogenesis. Proc Natl Acad Sci USA. 2002;99:383–388. [CrossRef] [PubMed]
OshimaY, OshimaS, NambuH, et al. Increased expression of VEGF in retinal pigmented epithelial cells is not sufficient to cause choroidal neovascularization. J Cell Physiol. 2004;201:393–400. [CrossRef] [PubMed]
YafaiY, IandievI, WiedemannP, ReichenbachA, EichlerW. Retinal endothelial angiogenic activity: effects of hypoxia and glial (Müller) cells. Microcirculation. 2004;11:577–586. [CrossRef] [PubMed]
BehzadianMA, WangXL, WindsorLJ, GhalyN, CaldwellRB. TGF-β increases retinal endothelial cell permeability by increasing MMP-9: possible role of glial cells in endothelial barrier function. Invest Ophthalmol Vis Sci. 2001;42:853–859. [PubMed]
PlantnerJJ, JiangC, SmineA. Increase in interphotoreceptor matrix gelatinase A (MMP-2) associated with age-related macular degeneration. Exp Eye Res. 1998;67:637–645. [CrossRef] [PubMed]
WebsterL, ChignellAH, LimbGA. Predominance of MMP-1 and MMP-2 in epiretinal and subretinal membranes of proliferative vitreoretinopathy. Exp Eye Res. 1999;68:91–98. [CrossRef] [PubMed]
DasA, McGuirePG. Retinal and choroidal angiogenesis: pathophysiology and strategies for inhibition. Prog Retin Eye Res. 2003;22:721–748. [CrossRef] [PubMed]
NodaK, IshidaS, InoueM, et al. Production and activation of matrix metalloproteinase-2 in proliferative diabetic retinopathy. Invest Ophthalmol Vis Sci. 2003;44:2163–2170. [CrossRef] [PubMed]
SteenB, SejersenS, BerglinL, SeregardS, KvantaA. Matrix metalloproteinases and metalloproteinase inhibitors in choroidal neovascular membranes. Invest Ophthalmol Vis Sci. 1998;39:2194–2200. [PubMed]
DasA, McLamoreA, SongW, et al. Retinal neovascularization is suppressed with a matrix metalloproteinase inhibitor. Arch Ophthalmol. 1999;117:498–503. [CrossRef] [PubMed]
MajkaS, McGuireP, ColomboS, et al. The balance between proteinases and inhibitors in a murine model of proliferative retinopathy. Invest Ophthalmol Vis Sci. 2001;42:210–215. [PubMed]
ZhangX, SakamotoT, HataY, et al. Expression of matrix metalloproteinases and their inhibitors in experimental retinal ischemia-reperfusion injury in rats. Exp Eye Res. 2002;74:577–584. [CrossRef] [PubMed]
SivakJM, FiniME. MMPs in the eye: emerging roles for matrix metalloproteinases in ocular physiology. Prog Retin Eye Res. 2002;21:1–14. [CrossRef] [PubMed]
LambertV, MunautC, JostM, et al. Matrix metalloproteinase-9 contributes to choroidal neovascularization. Am J Pathol. 2002;161:1247–1253. [CrossRef] [PubMed]
LambertV, WielockxB, MunautC, et al. MMP-2 and MMP-9 synergize in promoting choroidal neovascularization. FASEB J. 2003;17:2290–2292. [PubMed]
AhirA, GuoL, HussainAA, MarshallJ. Expression of metalloproteinases from human retinal pigment epithelial cells and their effects on the hydraulic conductivity of Bruch's membrane. Invest Ophthalmol Vis Sci. 2002;43:458–465. [PubMed]
EichlerW, FriedrichsU, ThiesA, TratzC, WiedemannP. Modulation of matrix metalloproteinase and TIMP-1 expression by cytokines in human RPE cells. Invest Ophthalmol Vis Sci. 2002;43:2767–2773. [PubMed]
HuntRC, FoxA, Al PakalnisV, et al. Cytokines cause cultured retinal pigment epithelial cells to secrete metalloproteinases and to contract collagen gels. Invest Ophthalmol Vis Sci. 1993;34:3179–3186. [PubMed]
HoffmannS, HeS, EhrenM, RyanSJ, WiedemannP, HintonDR. MMP-2 and MMP-9 secretion by RPE is stimulated by angiogenic molecules found in choroidal neovascular membranes. Retina. 2006;26:454–461. [CrossRef] [PubMed]
BergersG, BrekkenR, McMahonG, et al. Matrix metalloproteinase-9 triggers the angiogenic switch during carcinogenesis. Nat Cell Biol. 2000;2:737–744. [CrossRef] [PubMed]
MatsudaS, GomiF, OshimaY, TohyamaM, TanoY. Vascular endothelial growth factor reduced and connective tissue growth factor induced by triamcinolone in ARPE19 cells under oxidative stress. Invest Ophthalmol Vis Sci. 2005;46:1062–1068. [CrossRef] [PubMed]
EnzmannV, KaufmannA, HollbornM, WiedemannP, GemsaD, KohenL. Effective chemokines and cytokines in the rejection of human retinal pigment epithelium (RPE) cell graft. Transpl Immunol. 1999;7:9–14. [CrossRef] [PubMed]
PfafflM. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001;29:2002–2007.
SurapisitchatJ, HoefenRJ, PiX, YoshizumiM, YanC, BerkBC. Fluid shear stress inhibits TNF-alpha activation of JNK but not ERK1/2 or p38 in human umbilical vein endothelial cells: inhibitory crosstalk among MAPK family members. Proc Natl Acad Sci USA. 2001;98:6476–6481. [CrossRef] [PubMed]
SharmaGD, HeJ, BazanHE. p38 and ERK1/2 coordinate cellular migration and proliferation in epithelial wound healing: evidence of cross-talk activation between MAP kinase cascades. J Biol Chem. 2003;278:21989–21997. [CrossRef] [PubMed]
AdamisAP, ShimaDT, YeoKT, et al. Synthesis and secretion of vascular permeability factor/vascular endothelial growth factor by human retinal pigment epithelial cells. Biochem Biophys Res Commun. 1993;193:631–638. [CrossRef] [PubMed]
BlaauwgeersHGT, HoltkampGM, RuttenH, et al. Polarized vascular endothelial growth factor secretion by human retinal pigment epithelium and localization of vascular endothelial growth factor receptors on the inner choriocapillaris: evidence for a trophic paracrine relation. Am J Pathol. 1999;155:421–428. [CrossRef] [PubMed]
BecerraSP, FarissRN, WuYQ, MontuengaLM, WongP, PfefferBA. Pigment epithelium-derived factor in the monkey retinal pigment epithelium and interphotoreceptor matrix: apical secretion and distribution. Exp Eye Res. 2004;78:223–234. [CrossRef] [PubMed]
Van den SteenPE, DuboisB, NelissenI, et al. Biochemistry and molecular biology of gelatinase B or matrix metalloproteinase-9 (MMP-9). Crit Rev Biochem Mol Biol. 2002;37:375–536. [CrossRef] [PubMed]
JiangY, MuschelRJ. Regulation of matrix metalloproteinase-9 (MMP-9) by translational efficiency in murine prostate carcinoma cells. Cancer Res. 2002;62:1910–1914. [PubMed]
St-PierreY, Van ThemscheC, EstevePO. Emerging features in the regulation of MMP-9 gene expression for the development of novel molecular targets and therapeutic strategies. Curr Drug Targets Inflamm Allergy. 2003;2:206–215. [CrossRef] [PubMed]
EberhardtW, Akoolel-S, RebhanJ, et al. Inhibition of cytokine-induced matrix metalloproteinase 9 expression by peroxisome proliferator-activated receptor alpha agonists is indirect and due to a NO-mediated reduction of mRNA stability. J Biol Chem. 2002;277:33518–33528. [CrossRef] [PubMed]
FählingM, PerlewitzA, DollerA, ThieleBJ. Regulation of collagen prolyl 4-hydroxylase and matrix metalloproteinases in fibrosarcoma cells by hypoxia. Comp Biochem Physiol C Toxicol Pharmacol. 2004;139:119–126. [CrossRef] [PubMed]
GiebelSJ, MenicucciG, McGuirePG, DasA. Matrix metalloproteinases in early diabetic retinopathy and their role in alteration of the blood-retinal barrier. Lab Invest. 2005;85:597–607. [CrossRef] [PubMed]
ChallaJK, GilliesMC, PenfoldPL, GyoryJF, HunyorAB, BillsonFA. Exudative macular degeneration and intravitreal triamcinolone: 18 month follow up. Aust N Z J Ophthalmol. 1998;26:277–281. [CrossRef] [PubMed]
MartidisA, MillerDG, CiullaTA, DanisRP, MoorthyRS. Corticosteroids as an antiangiogenic agent for histoplasmosis-related subfoveal choroidal neovascularization. J Ocul Pharmacol Ther. 1999;15:425–428. [CrossRef] [PubMed]
DanisRP, CiullaTA, PrattLM, AnlikerW. Intravitreal triamcinolone acetonide in exudative age-related macular degeneration. Retina. 2000;20:244–250. [CrossRef] [PubMed]
IshibashiT, MikiK, SorgenteN, PattersonR, RyanSJ. Effects of intravitreal administration of steroids on experimental subretinal neovascularization in the subhuman primate. Arch Ophthalmol. 1985;103:708–711. [CrossRef] [PubMed]
CiullaTA, CriswellMH, DanisRP, HillTE. Intravitreal triamcinolone acetonide inhibits choroidal neovascularization in a laser-treated rat model. Arch Ophthalmol. 2001;119:399–404. [CrossRef] [PubMed]
WangYS, FriedrichsU, EichlerW, HoffmannS, WiedemannP. Inhibitory effects of triamcinolone acetonide on bFGF-induced migration and tube formation in choroidal microvascular endothelial cells. Graefes Arch Clin Exp Ophthalmol. 2002;240:42–48. [CrossRef] [PubMed]
BrooksHL, Jr, CaballeroS, Jr, NewellCK, et al. Vitreous levels of vascular endothelial growth factor and stromal-derived factor 1 in patients with diabetic retinopathy and cystoid macular edema before and after intraocular injection of triamcinolone. Arch Ophthalmol. 2004;122:1801–1807. [CrossRef] [PubMed]
NauckM, KarakiulakisG, PerruchoudAP, PapakonstantinouE, RothM. Corticosteroids inhibit the expression of the vascular endothelial growth factor gene in human vascular smooth muscle cells. Eur J Pharmacol. 1998;341:309–315. [CrossRef] [PubMed]
SearsJE, HoppeG. Triamcinolone acetonide destabilizes VEGF mRNA in Müller cells under continuous cobalt stimulation. Invest Ophthalmol Vis Sci. 2005;46:4336–4341. [CrossRef] [PubMed]
Figure 1.
 
Regulation of the gene expression of MMP-2 and MMP-9 in human RPE cells. (A) RT-PCR was carried out to determine the presence of mRNA for GAPDH, VEGF-A, PEDF, MMP-2, and MMP-9 in RPE cell cultures. The negative control (−) was made by adding water instead of cDNA. The presence of gene products was determined after 45 cycles. (B) Evaluation of the mRNA levels by using real-time PCR. Cycle numbers necessary to detect the mRNAs are shown (relative to the cycle number for the detection of GAPDH mRNA). (C, D) Regulation of the gene expression level of MMP-2 (C) and MMP-9 (D) by VEGF (10 ng/mL), CoCl2 (150 μM), and triamcinolone acetonide (triam; 50 μM), respectively. Cultures were stimulated for 2 hours. Mean ± SEM of five to seven independent experiments using cells from different donors. Significant differences compared with untreated control: *P < 0.05; **P < 0.01; P < 0.05; •• P < 0.01; ••• P < 0.001.
Figure 1.
 
Regulation of the gene expression of MMP-2 and MMP-9 in human RPE cells. (A) RT-PCR was carried out to determine the presence of mRNA for GAPDH, VEGF-A, PEDF, MMP-2, and MMP-9 in RPE cell cultures. The negative control (−) was made by adding water instead of cDNA. The presence of gene products was determined after 45 cycles. (B) Evaluation of the mRNA levels by using real-time PCR. Cycle numbers necessary to detect the mRNAs are shown (relative to the cycle number for the detection of GAPDH mRNA). (C, D) Regulation of the gene expression level of MMP-2 (C) and MMP-9 (D) by VEGF (10 ng/mL), CoCl2 (150 μM), and triamcinolone acetonide (triam; 50 μM), respectively. Cultures were stimulated for 2 hours. Mean ± SEM of five to seven independent experiments using cells from different donors. Significant differences compared with untreated control: *P < 0.05; **P < 0.01; P < 0.05; •• P < 0.01; ••• P < 0.001.
Figure 2.
 
Regulation of the secretion of MMP-9 protein by human RPE cells. The concentration of MMP-9 in the cultured media was determined by ELISA and is expressed as picogram secreted protein per microgram cellular protein. (A) The secretion of MMP-9 was stimulated by chemical hypoxia induced by CoCl2 (150 μM) and remained unaltered under conditions of high glucose (25 mM) and oxidative stress (H2O2; 20 and 50 μM, respectively). Under untreated control conditions, the mean MMP-9 content in the cultured media was 0.43 ± 0.02 pg/μg cellular protein. (B) VEGF dose dependently stimulated the secretion of MMP-9. (C) The selective antagonist of KDR, SU1498 (10 μM), and triamcinolone acetonide (triam; 50 μM) prevented the stimulatory effect of CoCl2 (150 μM) on the secretion of MMP-9. (D) Triamcinolone (1 μM) inhibited the stimulatory effect of VEGF (100 ng/mL) on the secretion of MMP-9. Mean ± SEM of four independent experiments using cells from different donors. Significant differences compared with untreated control: *P < 0.05; **P < 0.01; P < 0.05; ••• P < 0.001.
Figure 2.
 
Regulation of the secretion of MMP-9 protein by human RPE cells. The concentration of MMP-9 in the cultured media was determined by ELISA and is expressed as picogram secreted protein per microgram cellular protein. (A) The secretion of MMP-9 was stimulated by chemical hypoxia induced by CoCl2 (150 μM) and remained unaltered under conditions of high glucose (25 mM) and oxidative stress (H2O2; 20 and 50 μM, respectively). Under untreated control conditions, the mean MMP-9 content in the cultured media was 0.43 ± 0.02 pg/μg cellular protein. (B) VEGF dose dependently stimulated the secretion of MMP-9. (C) The selective antagonist of KDR, SU1498 (10 μM), and triamcinolone acetonide (triam; 50 μM) prevented the stimulatory effect of CoCl2 (150 μM) on the secretion of MMP-9. (D) Triamcinolone (1 μM) inhibited the stimulatory effect of VEGF (100 ng/mL) on the secretion of MMP-9. Mean ± SEM of four independent experiments using cells from different donors. Significant differences compared with untreated control: *P < 0.05; **P < 0.01; P < 0.05; ••• P < 0.001.
Figure 3.
 
Effects of MMP-2 and MMP-9 on the gene expression of VEGF in human RPE cells. Regulation of the gene expression of members of the VEGF family and for their receptors, flt-1 and KDR, was investigated after stimulation of the cultures with MMP-2 or MMP-9 (each at 10 ng/mL) for 2, 6, or 24 hours. The effect of MMP-9 on the gene expression of VEGF-A was determined in the presence and absence of triamcinolone acetonide (triam; 50 μM). Mean ± SEM of three to six independent experiments using cells from different donors. Significant difference compared with untreated control: *P < 0.001; •• P < 0.01.
Figure 3.
 
Effects of MMP-2 and MMP-9 on the gene expression of VEGF in human RPE cells. Regulation of the gene expression of members of the VEGF family and for their receptors, flt-1 and KDR, was investigated after stimulation of the cultures with MMP-2 or MMP-9 (each at 10 ng/mL) for 2, 6, or 24 hours. The effect of MMP-9 on the gene expression of VEGF-A was determined in the presence and absence of triamcinolone acetonide (triam; 50 μM). Mean ± SEM of three to six independent experiments using cells from different donors. Significant difference compared with untreated control: *P < 0.001; •• P < 0.01.
Figure 4.
 
MMP-mediated regulation of the secretion of VEGF by human RPE cells. (A) Regulation of the VEGF secretion by MMP-2 and MMP-9. Cultures were stimulated with MMPs (each at 100 ng/mL) for 6 hours, and then the VEGF-A165 protein content in the cultured media was measured by ELISA. Triamcinolone acetonide (50 μM) decreased the secretion of VEGF in the absence and presence of MMPs. Under untreated control conditions, the mean VEGF-A protein content in the cultured media was 1.60 ± 0.08 pg/μg cellular protein. (B) Dose dependencies of the MMP effects on the secretion of VEGF protein. (C) Simultaneous administration of both MMPs revealed that MMP-9 inhibited the reducing effect of MMP-2 on the secretion of VEGF. The MMPs were tested at 10 and 100 ng/mL. (D) Dose dependencies of the inhibitory effect of triamcinolone on the secretion of VEGF under control conditions and after stimulation with MMP-9 (50 ng/mL). Mean ± SEM of three to five independent experiments using cells from different donors. Significant differences compared with untreated control: *P < 0.05; **P < 0.01; ***P < 0.001. Significant differences compared with MMP-9 stimulated controls: P < 0.05; •• P < 0.01; ••• P < 0.001; P < 0.05.
Figure 4.
 
MMP-mediated regulation of the secretion of VEGF by human RPE cells. (A) Regulation of the VEGF secretion by MMP-2 and MMP-9. Cultures were stimulated with MMPs (each at 100 ng/mL) for 6 hours, and then the VEGF-A165 protein content in the cultured media was measured by ELISA. Triamcinolone acetonide (50 μM) decreased the secretion of VEGF in the absence and presence of MMPs. Under untreated control conditions, the mean VEGF-A protein content in the cultured media was 1.60 ± 0.08 pg/μg cellular protein. (B) Dose dependencies of the MMP effects on the secretion of VEGF protein. (C) Simultaneous administration of both MMPs revealed that MMP-9 inhibited the reducing effect of MMP-2 on the secretion of VEGF. The MMPs were tested at 10 and 100 ng/mL. (D) Dose dependencies of the inhibitory effect of triamcinolone on the secretion of VEGF under control conditions and after stimulation with MMP-9 (50 ng/mL). Mean ± SEM of three to five independent experiments using cells from different donors. Significant differences compared with untreated control: *P < 0.05; **P < 0.01; ***P < 0.001. Significant differences compared with MMP-9 stimulated controls: P < 0.05; •• P < 0.01; ••• P < 0.001; P < 0.05.
Figure 5.
 
MMP-2 and MMP-9 are chemoattractants for human RPE cells. (A) Concentration-dependent chemotaxis toward MMP-2 and MMP-9, respectively. Data represent the rates of cellular migration in treated wells compared with those in wells without MMPs (100%). Under untreated control conditions, 216.2 ± 12.3 cells per filter were found to have migrated. (B) Effect of various blocking substances on the chemotaxis of RPE cells, in the absence and presence of MMP-9 (50 ng/mL). The following substances were tested: AG1478 (600 nM; an inhibitor of the EGF receptor tyrosine kinase), PD98059 (20 μM; a MEK1/2 inhibitor), LY294002 (5 μM; a PI3K inhibitor), SB203580 (10 μM; a p38 inhibitor), SP600125 (30 μM; a JNK inhibitor), and triamcinolone acetonide (50 μM). Mean ± SEM of four to six independent experiments using cells from different donors. Significant differences compared with untreated control (100%): *P < 0.05; **P < 0.01; ***P < 0.001. Significant differences compared with MMP-9 stimulated control: P < 0.05; •• P < 0.01.
Figure 5.
 
MMP-2 and MMP-9 are chemoattractants for human RPE cells. (A) Concentration-dependent chemotaxis toward MMP-2 and MMP-9, respectively. Data represent the rates of cellular migration in treated wells compared with those in wells without MMPs (100%). Under untreated control conditions, 216.2 ± 12.3 cells per filter were found to have migrated. (B) Effect of various blocking substances on the chemotaxis of RPE cells, in the absence and presence of MMP-9 (50 ng/mL). The following substances were tested: AG1478 (600 nM; an inhibitor of the EGF receptor tyrosine kinase), PD98059 (20 μM; a MEK1/2 inhibitor), LY294002 (5 μM; a PI3K inhibitor), SB203580 (10 μM; a p38 inhibitor), SP600125 (30 μM; a JNK inhibitor), and triamcinolone acetonide (50 μM). Mean ± SEM of four to six independent experiments using cells from different donors. Significant differences compared with untreated control (100%): *P < 0.05; **P < 0.01; ***P < 0.001. Significant differences compared with MMP-9 stimulated control: P < 0.05; •• P < 0.01.
Table 1.
 
Primer Pairs Used for PCR Experiments
Table 1.
 
Primer Pairs Used for PCR Experiments
Gene and Accession Number Primer Sequence (5′→3′) Amplicon (bp)
h GAPDH GCAGGGGGGAGCCAAAAGGGT 219
XM_006959 TGGGTGGCAGTGATGGCATGG
h VEGF-A CCTGGTGGACATCTTCCAGGAGTA 407
AH001553 CTCACCGCCTCGGCTTGTCACA 347
275
h VEGF-B ACCGGATCATGAGGATCTGCA 223
U52819 CTCTCAAGGCCCCAAACCA
h VEGF-C CTCTCAAGGCCCCAAACCA 152
NM_005429 AGGTCTTGTTCGCTGCCTGA
h VEGF-D GATCGCTGTTCCCATTCCA 152
NM_004469 ATCATGTGTGGCCCACAGAGA
h flt-1 TCCCTTATGATGCCAGCAAGT 161
AF063657 CCCCTCTTTCAGCATTTTCAC
h KDR CTTCGAAGCATCAGCATAAGAAACT 156
AF063658 TGGTCATCAGCCCACTGGAT
h PEDF TGCAGGCCCAGATGAAAGGG 342
M67979 TGAACTCAGAGGTGAGGCTC
h MMP-2 TTGACGGTAAGGACGGACTC 153
NM_004530 ACTTGCAGTACTCCCCATCG
h MMP-9 TTGACAGCGACAAGAAGTGG 179
NM_004994 GCCATTCACGTCGTCCTTAT
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×