May 2008
Volume 49, Issue 5
Free
Cornea  |   May 2008
Estrogen and Progesterone Control of Gene Expression in the Mouse Meibomian Gland
Author Affiliations
  • Tomo Suzuki
    From the Schepens Eye Research Institute and the
    Department of Ophthalmology, Harvard Medical School, Boston, Massachusetts; and the
  • Frank Schirra
    From the Schepens Eye Research Institute and the
    Department of Ophthalmology, Harvard Medical School, Boston, Massachusetts; and the
  • Stephen M. Richards
    From the Schepens Eye Research Institute and the
    Department of Ophthalmology, Harvard Medical School, Boston, Massachusetts; and the
  • Roderick V. Jensen
    Department of Physics, University of Massachusetts, Boston, Massachusetts.
  • David A. Sullivan
    From the Schepens Eye Research Institute and the
    Department of Ophthalmology, Harvard Medical School, Boston, Massachusetts; and the
Investigative Ophthalmology & Visual Science May 2008, Vol.49, 1797-1808. doi:10.1167/iovs.07-1458
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Tomo Suzuki, Frank Schirra, Stephen M. Richards, Roderick V. Jensen, David A. Sullivan; Estrogen and Progesterone Control of Gene Expression in the Mouse Meibomian Gland. Invest. Ophthalmol. Vis. Sci. 2008;49(5):1797-1808. doi: 10.1167/iovs.07-1458.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

purpose. The purpose of the study was to test the hypothesis that estrogen and progesterone regulate gene expression in the meibomian gland.

methods. Meibomian glands were obtained from young adult, ovariectomized mice that were administered 17β-estradiol, progesterone, 17β-estradiol plus progesterone, or vehicle for 14 days. Glands were pooled according to treatment, processed for the extraction of RNA, and analyzed for differentially expressed mRNAs by using mouse gene microarrays. Bioarray data were evaluated with sophisticated bioinformatics software and statistical programs. The expression of selected genes was confirmed with gene chips and quantitative real-time PCR techniques.

results. The findings show that 17β-estradiol, progesterone, or both hormones administered together significantly influenced the expression of numerous genes in the mouse meibomian gland. Notable were the effects of 17β-estradiol on genes related to lipid metabolism, tyrosine kinases, immune factors, extracellular matrix components, steroidogenesis, and prolactin dynamics. Also very significant were the actions of progesterone or 17β-estradiol plus progesterone on ribosome or localization gene ontologies, respectively. The various hormone treatments led to many analogous, opposite, or unique effects on gene expression.

conclusions. These findings support the study hypothesis that estrogen and progesterone modulate gene expression in the meibomian gland.

The preocular tear film plays a critical role in maintaining ocular surface integrity, defending against microbial challenge, and preserving visual acuity. 1 These functions, in turn, are dependent on the composition and stability of the tear film structure, which includes an underlying mucin foundation, a middle aqueous component, and an overlying lipid layer. 1 Instability or deficiency of the tear film may severely influence ocular health. If not managed with artificial tear substitutes or tear film conservation therapy, these disorders may lead to intractable desiccation and ulceration of the corneal epithelium, an increased incidence of infectious disease, and ultimately, pronounced visual impairment. 1  
Throughout the world, countless people have tear film dysfunctions that are collectively diagnosed as dry eye syndromes. 1 Most individuals with dry eye syndromes are women (Caffery B et al. IOVS 1996;37:ARVO Abstract 335). 1 2 3 4 5 6 7 8 9 10 In fact, being of the female sex has been termed a risk factor for the development of dry eye (Caffery B et al., IOVS, 1996;37:ARVO Abstract S72). However, the mechanism(s) involved in this sex-associated difference in the prevalence of dry eye syndromes is unknown. We hypothesize that this difference is due, at least in part, to the effects of endogenous or exogenous estrogens on the meibomian gland. 
This tissue, which is a large sebaceous gland, produces the tear film’s lipid layer and is very important in preventing the evaporation and promoting the stability of the tear film. 1 11 12 13 14 Conversely, meibomian gland dysfunction (MGD), and the resulting lipid insufficiency, leads to instability and evaporation of the tear film, 1 11 15 16 17 and MGD is believed to be the major cause of dry eye syndromes in the world. 18  
Recent research suggests that estrogen therapy in postmenopausal women may promote both MGD and evaporative dry eye. Thus, an epidemiologic evaluation of 25,665 postmenopausal women demonstrated that women using estrogen replacement therapy have a significantly higher prevalence of severe dry eye symptoms and clinically diagnosed dry eye syndrome, compared with women who never used the treatment. 19 Similarly, an assessment of 44,257 women with dry eye showed that one of the highest prevalences of comorbid conditions was the use of estrogen replacement therapy. 20 We hypothesize that this estrogen effect is due primarily to a suppression of meibomian gland function. We also hypothesize that this hormone action is mediated through specific nuclear receptors, which in turn regulate gene expression in the meibomian gland. Consistent with these hypotheses is the finding that the meibomian gland contains estrogen receptor mRNA and protein. 21 22 23 In addition, we have discovered that hormone replacement therapy containing estrogens is associated with a significant alteration in the polar lipid profile of meibomian gland secretions in postmenopausal women (Sullivan BD, Sullivan DA, unpublished data, 2002). 
The purpose of the present investigation was to determine whether estrogen modulates gene expression in the meibomian gland. For comparison, we examined whether progesterone, alone or in combination with estrogen, may also affect gene activity in this tissue. 
Materials and Methods
Animals and Hormone Treatment
Age-matched, young adult BALB/c mice, that had been ovariectomized when 8 weeks old, were purchased from Taconic Laboratories (Germantown, NY). The animals were maintained in constant-temperature rooms with a fixed light–dark period of 12 hours’ duration. Ten days after surgery, pellets containing vehicle (cholesterol, methylcellulose, and lactose), 17β-estradiol (0.5 mg), progesterone (10 mg), or a combination of 17β-estradiol and progesterone were implanted subcutaneously (SC) in the ovariectomized mice. The pellets were obtained from Innovative Research of America (Sarasota, FL) and were designed for the constant release of placebo or physiological amounts of sex steroid (i.e., as in pregnancy) 24 25 26 27 for 3 weeks. After 14 days of treatment, mice (n = 7–20 mice/condition/experiment) were killed by CO2, inhalation, and meibomian glands were removed from the upper and lower lids under direct visualization with a biomicroscope. This surgical procedure involved making a small incision near the inner corner of the eyelid, separating skin and SC tissue from the inner to outer aspect of the lid, and then removing skin from the meibomian glands by cutting at the mucocutaneous junction. After these steps, the palpebral conjunctiva was removed from the meibomian glands, and the glands were dissected from the remaining tissue by starting at the outer lid corner and carefully avoiding an adjacent vein. The isolated meibomian glands were pooled according to group (n = 14–40 glands/sample) and processed for RNA analysis. All experiments with mice were approved by the Institutional Animal Care and Use Committee of The Schepens Eye Research Institute and adhered to the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. 
Molecular Biological Procedures
To assess the influence of 17β-estradiol and progesterone on meibomian gland gene expression, we extracted total RNA from the tissues (TRIzol reagent; Invitrogen Corp., Carlsbad, CA). When indicated, samples were exposed to RNase-free DNase (Invitrogen), evaluated spectrophotometrically at 260 nm to determine concentration, and analyzed on 6.7% formaldehyde/1.3% agarose (Invitrogen-Gibco, Grand Island, NY) gels to confirm RNA integrity. The RNA samples were then processed by using several different procedures. 
The primary method for evaluating gene expression involved the use of gene microarrays (∼10,000 genes; CodeLink Uniset Mouse I Bioarrays; GE Healthcare, Piscataway, NJ). For this procedure, glandular RNA samples were further purified (RNAqueous spin columns; Ambion, Austin, TX), and the integrity of these preparations was verified with a bioanalyzer (RNA 6000 Nano LabChip with a model 2100 Bioanalyzer; Agilent Technologies, Palo Alto, CA). The RNA samples were then processed for the bioarray hybridization, according to reported techniques. 28 Briefly, cDNA was synthesized from RNA (2 μg) with a kit (CodeLink Expression Assay Reagent Kit; GE Healthcare) and purified (QIAquick purification kit; Qiagen, Valencia, CA). After the samples were dried, cRNA was generated with a kit (CodeLink Expression Assay Reagent Kit; GE Healthcare), recovered (RNeasy kit; Qiagen), and quantified with a UV spectrophotometer. Fragmented, biotin-labeled cRNA was then incubated and shaken (300 rpm shaker) on a bioarray at 37°C for 18 hours. After this period, the bioarray was washed, exposed to streptavidin-Alexa 647, and scanned (ScanArray Express software and a ScanArray Express HT scanner; Packard BioScience, Meriden, CT), with the laser set at 635 nm, laser power at 100%, and photomultiplier tube voltage at 60%. Scanned image files were examined by using image and data-analysis software (CodeLink; GE Healthcare), which yielded both raw and normalized hybridization signal intensities for each array spot. The spot intensities (∼10,000) on the microarray image were normalized to a median of 1. Standardized data, with signal intensities exceeding 0.50, were evaluated (GeneSifter.Net software; VizX Laboratories LLC, Seattle, WA). This comprehensive software program also produced gene ontology and z-score reports. These ontologies included biological processes, molecular functions, and cellular components and were organized according to the guidelines of the Gene Ontology Consortium (http://www.geneontology.org/GO.doc.html). 29 Gene expression data were analyzed with and without log transformation, and statistical evaluation of the data was performed with Student’s t-test (two-tailed, unpaired). The data from the individual bioarrays (n = 6) are accessible for download from the National Center for Biotechnology Information’s Gene Expression Omnibus (http://www.genesifter.net/web/dataCenter.html/ NCBI, Bethesda, MD) via series accession number GSE5783. 
Differentially expressed mRNAs were also examined on gene chips (GEM 1, >8000 genes; GEM 2, >9500 genes; Incyte Genomics, Inc., St. Louis, MO), which have over 4700 sequences in common with the CodeLink arrays. For these studies RNA samples were further purified on spin columns (RNAqueous; Ambion, Inc.), and poly(A) mRNA was isolated from meibomian gland RNA samples (400 μg; MicroPoly(A)Pure mRNA Isolation Kit; Ambion, Inc.). The mRNA concentration was determined (RiboGreen RNA Quantitation Kit; Invitrogen-Molecular Probes, Eugene, OR), according to Incyte’s instructions. After assigning mRNA samples (750 ng) for use with either the cy3 or cy5 probes, preparations were suspended in TE buffer, put in siliconized microfuge tubes (RNase-Free; Ambion), and shipped on dry ice to Incyte for hybridization. Gene chip data were sent electronically to the Harvard Center for Genomic Research (Cambridge, MA), downloaded into a data analysis system (Resolver Gene Expression Data Analysis System, ver. 2.0; Rosetta Inpharmatics, Kirkland, WA), normalized, and analyzed as previously described. 28  
Real-Time PCR Procedures
The differential expression of selected genes was confirmed by using quantitative real-time PCR (qPCR). Sense and antisense primers (Table 1)were designed on computer (Primer Express Software, ver. 1.5a; Applied Biosystems, Inc. [ABI], Foster City, CA). The qPCR reactions were conducted according to the manufacturer’s protocol, with aliquots of meibomian gland cDNA (0.01–0.3 μL cDNA), optimal primer concentrations, and master mix (Applied Biosystems’ SYBR Green PCR Master Mix, MicroAmp Optical 96-Well Reaction Plates, ABI PRISM Optical Adhesive Covers, and the GeneAmp 7900 HT Sequence Detection System). Gene expression was calculated according to the relative standard curve method as outlined by the manufacturer (User Bulletin 2 ABI Prism 7700 Sequence Detection System; Applied Biosystems), and then standardizing data to that of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA. Dissociation curves were monitored to verify the absence of secondary PCR products. 
Results
To determine the effect of “female” sex steroids on gene expression in the meibomian gland, we isolated tissues from ovariectomized mice (n = 7/treatment group) who had been treated for 14 days with 17β-estradiol, progesterone, both hormones in combination or placebo. Glands were processed for evaluation (Uniset Mouse I Bioarrays; CodeLink; GeneSifter software; VizX Labs). 
Analysis of non- and log-transformed data from three different studies showed that 17β-estradiol and progesterone have a highly significant influence on gene expression in the meibomian gland. As demonstrated in Table 2 , these hormones, whether administered individually or together, significantly modified the expression of numerous genes. The nature of these sex steroids’ effects was dependent on the treatment, with 17β-estradiol up (48.3%)- and down (51.7%)-regulating approximately the same number of genes, whereas progesterone predominantly decreased gene expression (i.e., with 17β-estradiol: 63% of genes ↓; without 17β-estradiol: 83% of genes ↓; Table 2 ). Those genes that demonstrated the greatest hormone-induced differences in terms of ratios are listed in Tables 3 4 and 5 . Genes that showed the greatest alterations in statistical significance included those increased or decreased by 17β-estradiol (neurotrophic tyrosine kinase, receptor, type 2 ↑, P < 0.00002; arginine vasopressin receptor 1A ↓, P < 0.0003), progesterone (gastric intrinsic factor ↑, P < 0.0003; desmoplakin ↓, P < 0.006), and 17β-estradiol plus progesterone (α1 microglobulin/bikunin↑, P < 0.00002; cell division cycle 6 homologue ↓, P < 0.0004). 
Exposure to these sex steroids had striking effects on many biological process, molecular function, and cellular component ontologies in the meibomian gland. For instance, 17β-estradiol, progesterone, and the combined sex steroid administration all significantly influenced the expression of more than 60 genes associated with cellular metabolism, binding, and intracellular organelles (Table 6)
Quite notable was the impact of 17β-estradiol on genes related to lipid metabolism and/or lipid binding (Tables 7 8) , as well as to tyrosine kinases (e.g., ↑ growth arrest specific 6), immune factors (e.g., ↑ interleukin 1 receptor, type II), extracellular matrix (ECM) components (e.g., ↓ secreted acidic cysteine rich glycoprotein), steroidogenesis (e.g., ↑ cytochrome P450, family 7, subfamily b, polypeptide 1; CYP7B1), and prolactin dynamics (e.g., ↑ prolactin receptor, ↑ signal transducer and activator of transcription 5A; STAT5A; Tables 3 7 8 ). Estrogen treatment also exerted significant influences on genes in a variety of KEGG (Kyoto Encyclopedia of Genes and Genomes) pathways. These actions included an overall suppression of genes in pathways linked to fatty acid metabolism (e.g., ↓ hydroxyacyl-coenzyme A dehydrogenase; z-score = 2.77), cell cycle (e.g., ↓ TGF-b3; z-score = 3.02) and cytokine-cytokine receptor interactions (e.g., ↓ TGF-b3, ↓ vascular endothelial growth factor A; z-score = 2.16), an upregulation of genes in the Jak-Stat signaling pathway (↑ growth hormone receptor, ↑ STAT5A; z-score = 2.68), and an alteration of genes in the MAPK signaling pathway (↑ fibroblast growth factor receptor 1, ↓ TGF-b3). 
Progesterone stimulated the expression of genes involved in transport, ATP binding and organelle membranes, and reduced the activity of genes linked to protein biosynthesis, structural molecules, and ribosomes (Table 9) . The most dramatic effect of progesterone was the suppression of genes associated with ribosome biogenesis, assembly, and structure. For example, progesterone downregulated 29 genes related to structural constituents of ribosomes and upregulated none (Table 10)
Combined 17β-estradiol and progesterone treatment exerted a significant effect on many ontologies that were similar to, or different from, those modulated by 17β-estradiol or progesterone alone (Table 11) . A distinctive result was the influence of combined hormone administration on 71 genes in the localization ontology. Of these genes, 39 were also affected by either 17β-estradiol or progesterone treatment. However, the remaining 42 genes were altered only by combined hormone exposure (Table 12)
In these experiments the administration of 17β-estradiol, progesterone, or both steroids together led to many analogous, opposite, or unique effects on gene expression (Table 13) . There were genes significantly upregulated by 17β-estradiol (nuclear FMRP interacting protein 1, EIA) and 17β-estradiol plus progesterone (EIA) that were downregulated by progesterone. Moreover, there were genes that were only stimulated (e.g., cytosolic phosphoenolpyruvate carboxykinase 1, programed cell death 4) or suppressed (e.g., RAR-related orphan receptor gamma, chemokine [C-C motif] ligand 17) by combined 17β-estradiol and progesterone treatment. 
To verify in part the CodeLink Bioarray data, additional meibomian gland mRNA samples (n = 20 mice/group/experiment) were processed for GEM-1 and -2 gene chip analyses. These methods identified genes on GEM chips that were influenced by 17β-estradiol (n = 42 genes), progesterone (n = 20 genes), or combined hormone (n = 14 genes) exposure, and that met our evaluation criteria (i.e., GEM signal intensity ≥ 100; expression ratio ≥ 1.8 or ≤ -1.8). However, only seven of these genes were common to both the GEM and CodeLink platforms. Consequently, to confirm further the CodeLink results, various genes were examined by qPCR. This experimental approach verified the action of hormones on the specified genes (Table 14)
Discussion
In our study, 17β-estradiol, progesterone, or both hormones combined significantly altered the expression of numerous genes in the mouse meibomian gland. The various hormone treatments induced analogous, opposite, or unique effects on gene activity. These data support our hypothesis that estrogen and progesterone modulate gene transcription in the meibomian gland. 
Estrogen treatment had a significant impact on a wide variety of meibomian gland genes. For example, 17β-estradiol upregulated genes encoding epoxide hydrolase 2, cytoplasmic, which plays a role in xenobiotic metabolism 30 and glutathione peroxidase 3, a secreted protein that protects cells and enzymes from oxidative damage. 30 In addition, 17β-estradiol downregulated genes for carbonic anhydrase 6, which is involved in the reversible hydration of carbon dioxide. 30 and arginine vasopressin receptor 1A, which stimulates glycogenolysis and suppresses fluid secretion. 30  
Of particular interest was the effect of 17β-estradiol on genes related to tyrosine kinases, immune factors, ECM components, steroidogenesis, prolactin dynamics, and lipid metabolism. With regard to tyrosine kinases, 17β-estradiol upregulated genes for fibroblast growth factor receptor 1 (a member of the tyrosine kinase superfamily), 30 neurotrophic tyrosine kinase receptor type 2 (a membrane tyrosine-protein kinase receptor involved in nervous system development and/or maintenance), 30 and growth arrest specific 6 (a ligand for tyrosine-protein kinase receptors whose signaling is implicated in cell growth, migration, adhesion, and survival). 30 In contrast, 17β-estradiol downregulated the gene for neural precursor cell expressed developmentally downregulated gene 9 (coordinates tyrosine-kinase-based signaling of cell adhesion). 30  
As concerns immune factors, estradiol increased the expression of genes for (1) interleukin 1 receptor type II, which is the receptor for IL-1α, IL-1β, and IL-1 receptor antagonist protein 30 ; and (2) IL-4 receptor α, which is the receptor for both IL-4 and -13. IL-4 promotes Th2 cell differentiation, and both IL-4 and -13 modulate IgE, chemokine, and mucus production at sites of allergic inflammation. 30 Estrogen is also known to enhance IL4 receptor mRNA levels in the rat uterus. 32 (3) α1 microglobulin/bikunin, which was the most highly upregulated (>280-fold), is a lipocalin with immunosuppressive properties. 33 It also functions as an inter-α-trypsin inhibitor and blocks trypsin, plasmin, and lysosomal granulocytic elastase. 30 Bikunin is a small chondroitin sulfate proteoglycan that occurs as the light chain of inter-α-trypsin inhibitor family members. 30 (4) STAT5A, which is a transcription factor mediating the action of specific cytokines, growth factors, and hormones on gene expression and has been implicated in breast cancer development. 34 Similarly, 17β-estradiol upregulated the gene for stanniocalcin 2, which is known to be estrogen-responsive and coexpressed with the estrogen receptor in human breast cancer. 35  
17β-estradiol exerted effects on several genes associated with the ECM. This hormone downregulated genes for matrix metallopeptidase 3 (degrades fibronectin, laminin, gelatins and proteoglycans 30 ), cathepsin K (degrades extracellular matrix 30 ), secreted acidic cysteine rich glycoprotein (regulates the ECM 27 ), and procollagen, type I, -α1, and -α2 and upregulated the gene for tissue inhibitor of metalloproteinase 4 (inhibits matrix metalloproteinases). For comparison, estrogen is also known to decrease cathepsin K in mouse osteoclasts, 36 and ovariectomy is associated with an increased expression of genes for secreted acidic cysteine rich glycoprotein; procollagen, type I, -α1 and -α2; as well as glutathione peroxidase 3, in mouse adipose tissue. 37  
17β-Estradiol upregulated a variety of genes involved in steroidogenic pathways, including cytochrome P450, family 17, subfamily a, polypeptide 1 (CYP17A1), CYP7B1, 11β-hydroxysteroid dehydrogenase 1, and 17β-hydroxysteroid dehydrogenase 7 (17β-HSD1). The CYP17A1 promotes DHEA formation, 30 whereas CYP7B1 diverts DHEA from the sex hormone biosynthetic pathway. 30 17β-HSD1 converts estrone to biologically active estradiol 38 and also associates with the prolactin receptor. 39 Estrogen downregulated the gene for androgen-binding protein η, a secretoglobin originally identified in the mouse lacrimal gland. 40  
Estrogen also modulated genes associated with prolactin dynamics. 17β-Estradiol significantly increased the mRNA levels of the prolactin receptor, as well as those for STAT5A, which is known to activate prolactin-induced transcription. 30 Prolactin, in turn, regulates estrogen receptor expression, and this action requires both intact STAT5 binding sites and functional STAT5. 41 In addition, prolactin may directly repress expression of fatty acid synthase through STAT5A binding. 42  
A prominent effect of 17β-estradiol was the regulation of genes related to lipid metabolism. 17β-Estradiol treatment enhanced the expression of genes encoding monoacylglycerol O-acyltransferase 1, which catalyzes the formation of diacylglycerol, 30 and phosphatidylcholine transfer protein, which replenishes the plasma membrane with phosphatidylcholines. 43 Estrogen also decreased the genes encoding acyl-Coenzyme A oxidase 2, branched chain, which is involved in the degradation of long-branched fatty acids 30 and carboxylesterase 3, a lipase. 44 Given these hormone actions, one might conclude that 17β-estradiol promotes lipid elaboration. 
However, most of estrogen’s effects were not consistent with this conclusion. Rather, 17β-estradiol appeared to have an overall negative influence on lipid production. Thus, estrogen administration stimulated the expression of several genes involved in lipid and/or fatty acid catabolism, including the anti-lipogenic STAT5A, 36 growth hormone receptor (growth hormone decreases fatty acid synthase activity 45 ), WNT1 inducible signaling pathway protein 2, phospholipase A2 (group VII), and adiponectin. Further, 17β-estradiol downregulated genes involved in lipid synthesis (i.e., acyl-CoA synthetase bubblegum family member 1), 30 lipid mobilization (i.e., arylacetamide deacetylase), 46 lipid processing (i.e., hydroxyacyl-coenzyme A dehydrogenase), lipid formation, and membrane trafficking (phospholipase D1). 47 48 A decline in phospholipase D1 may also lead to a reduction in the generation of phosphatidic acid, which is an intracellular lipid mediator of many biological functions. 48  
Given these antagonistic effects, it might be anticipated that estrogen administration would suppress lipid synthesis in the meibomian gland and promote both MGD and evaporative dry eye. In support of this hypothesis, estrogens have been demonstrated to cause a significant decrease in the size, activity and lipid synthesis of sebaceous glands in multiple species. 49 50 51 52 53 54 55 56 In fact, estrogen has been termed the prototype agent for the suppression of sebum production, 55 and for years estrogen treatment was used to reduce sebaceous gland function and secretion in humans. 50 53 54 57 58 59 Such an estrogen action in the meibomian gland could account for the increased prevalence of dry eye syndromes in postmenopausal women taking estrogen replacement therapy. 19 60 61 62 63 64 In addition, estrogen–meibomian gland interactions may explain why estrogen treatment of women in several studies led to tear film instability, foreign body sensation, contact lens intolerance, and ocular surface dryness. 61 65  
Progesterone had a unique effect on the meibomian gland, which is known to contain progesterone receptors and respond to this hormone with an apparent change in morphology. 21 22 66 Most genes influenced by this progesterone were downregulated and were different from those modulated by estradiol. In addition, the magnitude of progesterone’s action was moderate, with changes in gene expression predominately less than threefold. Progesterone upregulated a variety of genes related to transcription (e.g., jun-B oncogene and MAP kinase-interacting serine/threonine kinase 1), cytokines (e.g., interleukin 8 receptor, β), peroxisomes (e.g., acyl-coenzyme A dehydrogenase, short chain), and desmosomes (e.g., desmoplakin). This effect on desmoplakin, which helps to anchor intermediate filaments, 30 is also elicited by progesterone in breast cancer cells. 67 68 In contrast, progesterone downregulated a diverse array of genes, such as those associated with immune processes (e.g., nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4, and β2 microglobulin), gluconeogenesis (e.g., glucose-6-phosphatase catalytic), and energy transduction (e.g., creatine kinase, brain). Creatine kinase is also found in sebaceous glands and many different epithelia, presumably because of the manifold energy requirements of these cells (e.g., high proliferation rates, active ion pumps, and transport processes). 69  
By far, the most impressive effect of progesterone in the meibomian gland was the downregulation of all genes related to ribosome biogenesis, assembly, and structure. The z-score for progesterone’s action on ribosome structural constituents alone exceeded 20, which is extraordinarily high. This hormone effect suggests that progesterone may have an overall suppressive impact on protein, macromolecule, and cellular biosynthesis in the meibomian gland. For comparison, progesterone was once thought to be the tropic hormone responsible for sebaceous gland secretion in women (i.e., analogous to androgens in men), 50 given that sebum production was significantly increased by progestin treatment. 50 70 71 However, other groups have reported that progestin administration has no effect on sebaceous gland output, 70 72 and yet others found that these hormones decrease sebaceous gland function by inhibiting local androgen metabolism and action. 73 74 75 76 One explanation for these conflicting results is that progestin’s effects on different types of sebaceous glands appear to be significantly influenced by dose, endocrine environment, and sex. 76 77 78 79  
Many of the effects of combined estradiol and progesterone treatment on meibomian gland gene expression duplicated those of estradiol or progesterone treatment alone. Unique actions included downregulation of certain immune-related genes (e.g., RAR-related orphan receptor gamma and chemokine [C-C motif] ligand 17), and upregulation of genes associated with gluconeogenesis (e.g., phosphoenolpyruvate carboxykinase 1, cytosolic), and topoisomerase inhibition (e.g., programmed cell death 4; PDCD4). The PDCD4 gene transcribes a tumor suppressor protein that inhibits protein synthesis, AP-1-dependent transcription and cell proliferation and promotes apoptosis. 80 81 82 83 Combined estrogen and progestin administration also induced a unique upregulation of genes involved with the localization ontology. The reason for this influence is unclear. 
In summary, our study demonstrates that 17β-estradiol and progesterone have a significant impact on meibomian gland gene expression. We believe that these sex steroid effects, and in particular those of estrogen, contribute to the sex-associated difference (i.e., female predominance) in the prevalence of dry eye syndromes. 
 
Table 1.
 
Oligonucleotide Primers for Real-Time PCR Confirmation of Selected Gene Expression
Table 1.
 
Oligonucleotide Primers for Real-Time PCR Confirmation of Selected Gene Expression
Accession Number mRNA Orientation Nucleotide Sequence (5′ → 3′)
NM_031161 Cholecystokinin Sense TGGACCCCAGCCATAGAATAAGT
Antisense TTGTTTCCTCATTCCACCTCCT
M32599 Glyceraldehyde-3-phosphate dehydrogenase Sense CATGGCCTTCCGTGTTCCTA
Antisense CTGGTCCTCAGTGTAGCCCAA
NM_019521 Growth arrest-specific 6 Sense TCGTCATCTCTGTGGCCCTAGT
Antisense AGACAGTGACCGTGTGTTCCTG
NM_010555 Interleukin-1 receptor, type II Sense AGAAACGCATCCCACTGTGAG
Antisense TTCTTTCAGGTCAGGGCACACT
NM_010557 Interleukin-4 receptor-α Sense* TGTGAGGGTCAGATCCCAGATA
Antisense GGATTCCCGTGAGCTCTCCT
NM_008768 Orosomucoid 1 Sense TTGGAAGCTCAGAACCCAGAA
Antisense TTTGAATTGCCTGCCTGTACTC
Table 2.
 
Effect of 17β-Estradiol and/or Progesterone on Gene Expression in the Meibomian Gland
Table 2.
 
Effect of 17β-Estradiol and/or Progesterone on Gene Expression in the Meibomian Gland
Treatment Genes ↑ Genes ↓ Total
17β-Estradiol
 No transformation 72 80 152
 Log transformation 82 87 169
 Total 86 92 178
Progesterone
 No transformation 26 121 147
 Log transformation 25 134 159
 Total 28 139 167
17β-Estradiol+progesterone
 No transformation 107 164 271
 Log transformation 101 188 289
 Total 116 194 310
Table 3.
 
17β-Estradiol’s Effect on Gene Expression Ratios in the Mouse Meibomian Gland
Table 3.
 
17β-Estradiol’s Effect on Gene Expression Ratios in the Mouse Meibomian Gland
Accession Number Gene Ratio P Ontology
E2 > Placebo
 NM_007443 α1-Microglobulin/bikunin 281.37 0.0002 Transport
 NM_008411 CUB and zona pellucida-like domains 1 37.18 0.0002 Cell cycle
 NM_015764 Gene regulated by estrogen in breast cancer protein 12.01 0.0017 Electron transport
 NM_010555 Interleukin 1 receptor, type II 10.58 0.0016 Cell surface receptor linked signal transduction
 NM_011488 Signal transducer and activator of transcription 5A 4.72 0.0003 Regulation of transcription, signal transduction
 NM_011491 Stanniocalcin 2 4.40 0.0082 Protein binding
 NM_008161 Glutathione peroxidase 3 3.90 0.0185 Response to oxidative stress
 NM_008745 Neurotrophic tyrosine kinase, receptor, type 2 3.31 0.0000 Vasculogenesis
 NM_019521 Growth arrest specific 6 3.29 0.0044 Regulation of cell growth
 NM_013809 Olfactory-specific steroid hydroxylase 3.04 0.0476 Electron transport
 NM_007940 Epoxide hydrolase 2, cytoplasmic 2.92 0.0068 Immune response
 NM_010557 Interleukin 4 receptor, α 2.92 0.0114 Aromatic compound metabolism
Placebo > E2
 U08020 Procollagen, type I, α1 3.02 0.0044 Phosphate transport
 NM_013707 Keratin-associated protein 14 2.51 0.0441 Intermediate filament
 NM_020563 Androgen-binding protein ε 2.49 0.0253 Extracellular space
 NM_007743 Procollagen, type I, α2 2.48 0.0375 Phosphate transport
 BC005742 Solute carrier family 24 (sodium/potassium/calcium exchanger), member 3 2.42 0.0103 Transport
 NM_008118 Gastric intrinsic factor 2.32 0.0361 Transport
 NM_023383 Arylacetamide deacetylase 2.23 0.0355 Metabolism
 NM_009242 Secreted acidic cysteine rich glycoprotein 2.15 0.0135 Copper ion binding
 NM_017464 Neural precursor cell expressed, developmentally down-regulated gene 9 2.13 0.0262 Regulation of cell growth
 NM_016847 Arginine vasopressin receptor 1A 2.10 0.0003 Signal transduction
 NM_016879 Keratin complex 2, basic, gene 18 1.99 0.0398 Structural molecule activity
 NM_007727 Contactin 1 1.92 0.0182 DNA methylation
Table 4.
 
Progesterone’s Impact on Gene Expression Ratios in the Mouse Meibomian Gland
Table 4.
 
Progesterone’s Impact on Gene Expression Ratios in the Mouse Meibomian Gland
Accession Number Gene Ratio P Ontology
Prog > Plac
 NM_008416 Jun-B oncogene 2.24 0.0436 Regulation of progression through cell cycle
 NM_007383 Acyl-coenzyme A dehydrogenase, short chain 1.89 0.0435 Electron transport
 U62559 Solute carrier family 20, member 2 1.76 0.0221 Phosphate transport
 AK009006 Predicted: desmoplakin 1.72 0.0060 Mitochondrion
 NM_009382 Thymus cell antigen 1, theta 1.65 0.0320 External side of plasma membrane
 NM_023057 RIKEN cDNA B230120H23 gene 1.55 0.0278 Protein amino acid phosphorylation
 NM_021461 MAP kinase-interacting serine/threonine kinase 1 1.43 0.0167 Regulation of protein biosynthesis
 NM_022885 Solute carrier family 30 (zinc transporter), member 5 1.42 0.0471 Cation transport
 NM_012043 Immunoglobulin superfamily containing leucine- rich repeat 1.41 0.0133 Extracellular space
 NM_009320 Sodium-dependent taurine transporter 1.39 0.0321 β-Alanine transport
 AK012109 F-box and leucine-rich repeat protein 20 1.38 0.0155 Ubiquitin cycle
Plac > Prog
 NM_008118 Gastric intrinsic factor 3.09 0.0003 Ion transport
 NM_008218 Hemoglobin alpha, adult chain 1 2.24 0.0425 Oxygen transport
 NM_021273 Creatine kinase, brain 2.21 0.0125 Creatine kinase activity
 NM_008061 Glucose-6-phosphatase, catalytic 1.78 0.0326 Glycogen biosynthesis
 NM_023699 Nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4 1.52 0.0099 Regulation of transcription, DNA-dependent
 NM_011356 Frizzled-related protein 1.46 0.0078 Wnt receptor signaling pathway
 NM_013891 SAM pointed domain containing ets transcription factor 1.42 0.0248 Regulation of transcription, DNA-dependent
 NM_053171 CUB and sushi multiple domains 1 1.41 0.0262 Integral to membrane
 NM_009056 Regulatory factor X, 2 1.40 0.0406 Regulation of transcription, DNA-dependent
 NM_011568 THO complex 4 1.38 0.0257 Nuclear mRNA splicing, via spliceosome
 NM_023133 Ribosomal protein S19 1.37 0.0381 Protein biosynthesis
Table 5.
 
17β-Estradiol+Progesterone’s Impact on Gene Expression Ratios in the Mouse Meibomian Gland
Table 5.
 
17β-Estradiol+Progesterone’s Impact on Gene Expression Ratios in the Mouse Meibomian Gland
Accession Number Gene Ratio P Ontology
E2+Pr > Plac
 NM_007443 α1-Microglobulin/bikunin 185.81 0.0000 Transport
 NM_008411 CUB and zona pellucida-like domains 1 29.54 0.0011 Cell cycle
 NM_015764 Gene regulated by estrogen in breast cancer protein 12.48 0.0010 Electron transport
 NM_010555 Interleukin 1 receptor, type II 9.78 0.0021 Cell surface receptor linked signal transduction
 NM_010171 Coagulation factor III 3.84 0.0002 Wound healing
 NM_011488 Signal transducer and activator of transcription 5A 3.65 0.0002 Transcription
 NM_011491 Stanniocalcin 2 3.53 0.0011 Protein binding
 NM_011044 Phosphoenolpyruvate carboxykinase 1, cytosolic 3.44 0.0324 Gluconeogenesis
 NM_019521 Growth arrest specific 6 3.28 0.0016 Regulation of cell growth
 NM_011050 Programmed cell death 4 2.93 0.0217 Isomerase activity
 NM_008161 Glutathione peroxidase 3 2.9 0.0128 Response to oxidative stress
 NM_011169 Prolactin receptor 2.87 0.0463 Regulation of epithelial cell differentiation
Plac > E2+Pr
 NM_008118 Gastric intrinsic factor 2.76 0.0456 Ion transport
 NM_011281 RAR-related orphan receptor γ 2.25 0.0196 Regulation of transcription, DNA-dependent
 NM_021273 Creatine kinase, brain 2.19 0.0257 Creatine kinase activity
 NM_011332 Chemokine (C-C motif) ligand 17 2.18 0.0190 Chemotaxis
 U08020 Procollagen, type I, α1 2.08 0.0275 Phosphate transport
 NM_011799 Cell division cycle 6 homologue (S. cerevisiae), transcript variant 1 2.03 0.0004 DNA replication
 NM_008102 GTP cyclohydrolase 1 1.96 0.0079 Tetrahydrobiopterin biosynthesis
 NM_016669 Crystallin, μ, mRNA 1.91 0.0378 Sensory organ development
 AK007683 Clq and tumor necrosis factor related protein 2 1.89 0.0260 Activation of MAPK activity
 D00622 Low density lipoprotein receptor-related protein associated protein 1 1.87 0.0034 Low-density lipoprotein receptor binding
 NM_009242 Secreted acidic cysteine rich glycoprotein 1.86 0.0138 Copper ion binding
 M55181 Preproenkephalin 1 1.83 0.0170 Neuropeptide signaling pathway
Table 6.
 
Influence of Sex Steroid Treatment on the Expression of Gene Ontologies in the Meibomian Gland
Table 6.
 
Influence of Sex Steroid Treatment on the Expression of Gene Ontologies in the Meibomian Gland
Ontology E2 Prog E2+Prog
Total Total Total
Biological processes
 Cellular metabolism 36 33 69 70 11 81 72 40 112
 Cellular physiological process 48 45 93 18 89 107 64 99 163
 Cellular process 57 53 110 19 99 118 76 121 197
 Metabolism 40 37 77 11 73 84 44 77 121
 Physiological process 56 55 111 18 94 112 70 118 188
 Primary metabolism 34 29 63 10 66 76 38 64 102
Molecular function
 Binding 45 47 92 14 65 79 64 105 169
 Catalytic activity 36 34 70 11 32 43 40 62 102
Cellular components
 Cell 50 55 105 18 98 116 66 116 182
 Intracellular 35 42 77 13 80 93 43 86 129
 Intracellular organelle 31 33 64 11 73 84 33 72 105
Table 7.
 
Highest and Lowest Expression of Gene Ontologies in the Meibomian Glands of Placebo- or 17β-Estradiol-Treated Mice
Table 7.
 
Highest and Lowest Expression of Gene Ontologies in the Meibomian Glands of Placebo- or 17β-Estradiol-Treated Mice
Ontology Gene List E2 Genes ↑ PI Genes ↑ Array Genes E2 z-Score PI z-Score
Biological process
 Lipid metabolism 18 13 5 315 6.25 1.31
 Response to stimulus 24 17 7 995 2.96 −0.72
 Generation of precursor metabolites and energy 13 8 5 346 2.89 1.09
 Electron transport 10 6 4 237 2.74 1.3
 Cell development 10 5 5 215 2.28 2.24
 Organ morphogenesis 13 7 6 352 2.25 1.63
 Biosynthesis 15 11 4 656 2.25 −0.84
 Morphogenesis 20 10 10 608 2.07 2.02
 Organismal physiological process 19 13 6 870 2.02 −0.71
 Regulation of cellular physiological process 27 8 19 1739 −2.19 0.95
 Regulation of cellular metabolism 17 4 13 1265 −2.39 0.51
 Transcription 14 3 11 1194 −2.57 0.07
 Nucleobase, nucleoside, nucleotide and nucleic acid metabolism 19 6 13 1766 −2.83 −0.86
 Morphogenesis 20 10 10 608 2.07 2.02
 Cell development 10 5 5 215 2.28 2.24
 Cellular morphogenesis 10 4 6 231 1.38 2.76
Molecular function
 Oxidoreductase activity 19 11 8 492 3.29 1.71
 Catalytic activity 70 36 34 2946 2.44 1.73
 DNA binding 10 3 7 1137 −2.43 −1.15
 Nucleic acid binding 15 6 9 1596 −2.45 −1.65
 Hydrolase activity, acting on ester bonds 13 6 7 344 1.73 2.23
 Receptor binding 13 5 8 366 1 2.62
 Structural molecule activity 11 3 8 355 −0.09 2.71
 Transferase activity 13 10 3 1039 0.27 −2.28
Cellular component
 Extracellular space 53 25 28 1529 3.92 4.09
 Endoplasmic reticulum 15 7 8 369 2.33 2.53
 Cytoplasmic part 37 20 17 1620 2.06 0.54
 Cell 101 47 54 6371 −2.1 −1.95
Table 8.
 
Influence of 17β-Estradiol on the Expression of Meibomian Gland Genes Related to Lipid Metabolism and/or Lipid Binding
Table 8.
 
Influence of 17β-Estradiol on the Expression of Meibomian Gland Genes Related to Lipid Metabolism and/or Lipid Binding
17β-Estradiol > placebo
 Adiponectin, C1Q and collagen domain containing
 Aldehyde dehydrogenase family 1, subfamily A7
 Aldo-keto reductase family 1, member C20
 Cytochrome P450, family 17, subfamily a, polypeptide 1
 Cytochrome P450, family 7, subfamily b, polypeptide 1
 Endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor 7
 Growth hormone receptor
 Hydroxysteroid (17-β) dehydrogenase 7
 Hydroxysteroid 11-β dehydrogenase 1
 Monoacylglycerol O-acyltransferase 1
 Oxysterol binding protein-like 3
 Phosphatidylcholine transfer protein
 Phospholipase A2, group VII
 Signal transducer and activator of transcription 5A
WNT1 inducible signaling pathway protein 2
Placebo > 17β-estradiol
 Acyl-CoA synthetase bubblegum family member 1
 Acyl-coenzyme A oxidase 2, branched chain
 Arylacetamide deacetylase
 C1q and tumor necrosis factor-related protein 2
 Carboxylesterase 3
 L-3-hydroxyacyl-Coenzyme A dehydrogenase, short chain
 Phosphatidylcholine-specific phospholipase D1
 Phospholipase D1
 T-cell lymphoma invasion and metastasis 1
Table 9.
 
Highest and Lowest Expression of Gene Ontologies in the Meibomian Glands of Placebo- or Progesterone-Treated Mice
Table 9.
 
Highest and Lowest Expression of Gene Ontologies in the Meibomian Glands of Placebo- or Progesterone-Treated Mice
Ontology Gene List Pr Genes ↑ Pl Genes ↑ Array Genes Pr z-Score Pl z-Score
Biological process
 Transport 29 11 18 1548 3.86 −1.24
 Localization 33 11 22 1753 3.41 −0.98
 Protein modification 13 5 8 821 2.04 −1.32
 Protein biosynthesis 35 2 33 318 1.3 13.31
 Macromolecule biosynthesis 37 2 35 359 1.11 13.18
 Cellular biosynthesis 42 2 40 577 0.4 11.18
 Ribosome biogenesis 10 0 10 78 −0.46 8.26
 Cytoplasm organization and biogenesis 10 0 10 92 −0.5 7.43
 Cellular macromolecule metabolism 50 6 44 1592 0.99 4.69
 Cellular protein metabolism 49 6 43 1571 1.03 4.55
 Organelle organization and biogenesis 15 1 14 529 −0.35 2.25
 Metabolism 84 11 73 4097 0.08 2.24
 Biopolymer metabolism 18 5 13 1438 0.69 −2.08
Molecular function
 ATP binding 9 5 4 764 2.41 −2.14
 Structural constituent of ribosome 29 0 29 116 −0.54 21.98
 Structural molecule activity 30 0 30 355 −0.96 11.7
 RNA binding 13 0 13 321 −0.91 4.19
 Signal transducer activity 13 3 10 1344 −0.18 −2.2
 Binding 79 14 65 5552 0.21 −2.5
Cellular component
 Organelle membrane 10 3 7 350 2.27 0.91
 Ribosome 29 0 29 119 −0.56 21.2
 Ribonucleoprotein complex 30 0 30 245 −0.81 14.46
 Cytosol 22 0 22 214 −0.75 11.04
 Non–membrane-bound organelle 33 0 33 770 −1.49 7.02
 Protein complex 42 1 41 1102 −1.18 6.91
 Intracellular part 89 11 78 4230 0.05 3.42
 Organelle 81 10 71 3786 0.12 3.26
 Extracellular space 16 3 13 1529 −0.53 −2.16
 Membrane 41 11 30 3078 1.43 −2.81
Table 10.
 
Progesterone Downregulation of Meibomian Gland Genes Encoding Structural Constituents of Ribosomes
Table 10.
 
Progesterone Downregulation of Meibomian Gland Genes Encoding Structural Constituents of Ribosomes
Mitochondrial ribosomal protein L20 Ribosomal protein L35
Mitochondrial ribosomal protein S6 Ribosomal protein L36a
Ribosomal protein L5 Ribosomal protein L36a-like
Ribosomal protein L6 Ribosomal protein L37
Ribosomal protein L7 Ribosomal protein L37a
Ribosomal protein L11 Ribosomal protein S3
Ribosomal protein L12 Ribosomal protein S8
Ribosomal protein L14 Ribosomal protein S17
Ribosomal protein L15 Ribosomal protein S19
Ribosomal protein L18A Ribosomal protein S23
Ribosomal protein L19 Ribosomal protein S26
Ribosomal protein L21 Ribosomal protein S27
Ribosomal protein L23 Ribosomal protein S27a
Ribosomal protein L29 Ribosomal protein, large P2
Ribosomal protein L31
Table 11.
 
Highest and Lowest Expression of Gene Ontologies in the Meibomian Glands of Placebo- or 17β-Estradiol+Progesterone-Treated Mice
Table 11.
 
Highest and Lowest Expression of Gene Ontologies in the Meibomian Glands of Placebo- or 17β-Estradiol+Progesterone-Treated Mice
Ontology Gene List E2+Prog Genes ↑ Pl Genes ↑ Array Genes E2+Prog z-Score Pl z-Score
Biological Process
 Lipid metabolism 23 16 7 315 6.48 0.38
 Localization 71 31 40 1753 2.53 1.22
 Transport 64 28 36 1548 2.5 1.27
 Catabolism 15 8 7 321 2.19 0.33
 Macromolecule metabolism 57 18 39 2297 −2.2 −0.99
 Regulation of physiological process 46 11 35 1816 −2.68 −0.02
 Regulation of transcription 26 4 22 1165 −2.92 −0.12
 Regulation of cellular metabolism 29 4 25 1265 −3.17 0.12
 Nucleobase, nucleoside, nucleotide and nucleic acid metabolism 36 6 30 1766 −3.81 −0.82
 Electron transport 15 6 9 237 1.92 2.12
 Protein transport 18 5 13 373 0.26 2.24
 Protein localization 20 5 15 411 0.04 2.6
Molecular Function
 Iron ion binding 10 6 4 184 2.76 0.27
 Magnesium ion binding 14 6 8 194 2.61 2.29
 Protein-tyrosine kinase activity 11 6 5 231 2.13 0.29
 Transcription regulator activity 13 2 11 753 −2.37 −0.94
 DNA binding 25 4 21 1137 −2.7 −0.16
 Nucleic acid binding 37 7 30 1596 −2.94 −0.09
 Ligase activity 11 3 8 165 0.84 2.79
Cellular component
 Extracellular space 59 26 33 1529 2.33 0.84
 Cytoplasmic part 64 26 38 1620 2.01 1.5
 Organelle 105 33 72 3786 −2.21 0.04
 Cell 179 65 114 6371 −2.38 −1.68
 Nucleus 47 10 37 2168 −3.53 −0.77
 Mitochondrion 27 8 19 531 0.83 2.95
Table 12.
 
Effects of Combined 17β-Estradiol and Progesterone on the Expression of Meibomian Gland Genes in the Localization Ontology
Table 12.
 
Effects of Combined 17β-Estradiol and Progesterone on the Expression of Meibomian Gland Genes in the Localization Ontology
17β-Estradiol+Progesterone > Placebo Placebo > 17β-Estradiol + Progesterone
Acyl-Coenzyme A dehydrogenase, short chain Acyl-coenzyme A dehydrogenase family, member 9
Adaptor-related protein complex AP-4, sigma 1 Acyl-coenzyme A oxidase 2, branched chain
Alpha 1 microglobulin/bikunin Adaptor-related protein complex 2, β1 subunit
Ankyrin 1, erythroid Blocked early in transport 1 homolog (S. cerevisiae)-like
ATP-binding cassette, sub-family D (ALD), member 4 C1q and tumor necrosis factor related protein 2
CD34 antigen Cytochrome b5 type B
Cholecystokinin Cytochrome P450, family 2, subfamily b, polypeptide 9
Cysteine-rich hydrophobic domain 2 Cytochrome P450, family 2, subfamily e, polypeptide 1
Cytochrome P450, family 17, subfamily a, polypeptide 1 Exportin 5
Cytochrome P450, family 2, subfamily g, polypeptide 1 Gastric intrinsic factor
Cytochrome P450, family 7, subfamily b, polypeptide 1 Glucose-fructose oxidoreductase domain containing 2
Double cortin and calcium/calmodulin-dependent protein kinase-like 1 Immunoglobulin superfamily, member 4B
Fatty acid binding protein 3, muscle and heart Isoprenylcysteine carboxyl methyltransferase
Ficolin A KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2
Gene regulated by estrogen in breast cancer protein Lin-7 homolog B (C. elegans)
Growth hormone receptor Metallothionein 4
Orosomucoid 1 Mitochondrial ribosomal protein S17
Oxysterol binding protein-like 3 Nischarin
Phosphatidylcholine transfer protein Nucleoporin 93
Phosphatidylinositol transfer protein, beta Potassium large conductance calcium-activated channel, subfamily M, β member
Potassium inwardly-rectifying channel, subfamily J, member 6 Procollagen, type I, α1
RAB20, member RAS oncogene family Prostaglandin D2 synthase (brain)
Solute carrier family 15 (H+/peptide transporter), member 2 Protein tyrosine phosphatase, nonreceptor type 9
Solute carrier family 20, member 2 Purinergic receptor P2X, ligand-gated ion channel, 1
Solute carrier family 30 (zinc transporter), member 5 Retinol binding protein 4, plasma
Solute carrier family 6 (neurotransmitter transporter, taurine), member 6 S100 calcium binding protein A3
Syntaxin 7 Solute carrier family 24 (sodium/potassium/calcium exchanger), member 3
Tocopherol (α) transfer protein Solute carrier family 39 (zinc transporter), member 7
Transmembrane 9 superfamily member 2 Synaptotagmin III
Ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1 Translocase of inner mitochondrial membrane 22 homolog (yeast)
Vesicle transport through interaction with t-SNAREs homolog 1A (yeast) Transmembrane emp24 protein transport domain containing 9
Transmembrane emp24-like trafficking protein 10 (yeast)
Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, β pol
Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, ε
Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, η poly
Ubiquitin-like 1 (sentrin) activating enzyme E1B
Ubiquitin-like, containing PHD and RING finger domains, 1
Vacuolar protein sorting 25 (yeast)
Vascular endothelial growth factor A
XPA binding protein 1
Table 13.
 
Analogous and Opposite Effects of 17β-Estradiol and Progesterone on Gene Expression in the Meibomian Gland
Table 13.
 
Analogous and Opposite Effects of 17β-Estradiol and Progesterone on Gene Expression in the Meibomian Gland
Treatment 1 Treatment 2 T1 ↑, T2 ↑ T1 ↓, T2 ↓ T1 ↑, T2 ↓ T1 ↓, T2 ↑
17β-Estradiol Progesterone 7 9 2 0
17β-Estradiol 17β-Estradiol+progesterone 45 46 0 0
Progesterone 17β-Estradiol+progesterone 12 31 0 1
Table 14.
 
Confirmation of Selected CodeLink Microarray and GEM Chip Results
Table 14.
 
Confirmation of Selected CodeLink Microarray and GEM Chip Results
Gene/Treatment Treatment/Placebo Ratio
CodeLink GEM qPCR
Cholecystokinin
 17β-Estradiol 2.23 1.72 2.77
 Progesterone ND 0.92 0.93
 E2+Prog 1.64 1.32 1.73
Growth arrest-specific 6
 17β-Estradiol 3.29 1.67 2.43
 Progesterone ND 1.12 0.96
 E2+Prog 3.28 1.53 4.39
Interleukin 1 receptor, type
 17β-Estradiol 10.58 13.21
 Progesterone ND 0.93
 E2+Prog 9.78 11.75
Interleukin 4 receptor, α
 17β-Estradiol 2.92 1.54 5.80
 Progesterone ND 1.20 2.52
 E2+Prog 2.19 1.57 7.49
Orosomucoid 1
 17β-Estradiol 2.38 2.23 2.02
 Progesterone ND 0.83 0.44
 E2+Prog 2.09 1.45 2.28
The authors thank Michael J. Lombardi, Patricia Rowely, and Nathaniel S. Treister (Schepens Eye Research Institute) for technical assistance and the Harvard Center for Genomic Research for help with processing GEM-1 and -2 data. 
International Dry Eye Workshop. 2007 Report. (DEWS). Ocul Surf. 2007;5(2)65–202. [CrossRef]
CafferyBE, RichterD, SimpsonT, FonnD, DoughtyM, GordonK. CANDEES: The Canadian dry eye epidemiology study. Adv Exp Med Biol. 1998;438:805–806. [PubMed]
McCartyCA, BansalAK, LivingstonPM, StanislavskyYL, TaylorHR. The epidemiology of dry eye in Melbourne. Aust Ophthalmol. 1998;105(6)1114–1119. [CrossRef]
SchaumbergDA, SullivanDA, DanaMR. Epidemiology of dry eye syndrome. Adv Exp Med Biol. 2002;506:989–998. [PubMed]
SchaumbergDA, SullivanDA, BuringJE, DanaMR. Prevalence of dry eye syndrome among US women. Am J Ophthalmol. 2003;136(2)318–326. [CrossRef] [PubMed]
AlbietzJM. Prevalence of dry eye subtypes in clinical optometry practice. Optom Vis Sci. 2000;77(7)357–363. [CrossRef] [PubMed]
ChiaEM, MitchellP, RochtchinaE, LeeAJ, MarounR, WangJJ. Prevalence and associations of dry eye syndrome in an older population: the Blue Mountains Eye Study. Clin Exp Ophthalmol. 2003;31(3)229–232. [CrossRef]
LinPY, TsaiSY, ChengCY, LiuJH, ChouP, HsuWM. Prevalence of dry eye among an elderly Chinese population in Taiwan: the Shihpai Eye Study. Ophthalmology. 2003;110(6)1096–1101. [CrossRef] [PubMed]
VersuraP, ProfazioV, CelliniM, TorreggianiA, CaramazzaR. Eye discomfort and air pollution. Ophthalmologica. 1999;213(2)103–109. [CrossRef] [PubMed]
LekhanontK, RojanapornD, ChuckRS, VongthongsriA. Prevalence of dry eye in Bangkok. Thailand Cornea. 2006;25(10)1162–1167. [CrossRef]
DriverPJ, LempMA. Meibomian gland dysfunction. Surv Ophthalmol. 1996;40(5)343–367. [CrossRef] [PubMed]
McCulleyJP, ShineWE. The lipid layer of tears: dependent on meibomian gland function. Exp Eye Res. 2004;78(3)361–365. [CrossRef] [PubMed]
CraigJP, TomlinsonA. Importance of the lipid layer in human tear film stability and evaporation. Optom Vis Sci. 1997;74(1)8–13. [CrossRef] [PubMed]
BronAJ, TiffanyJM, GouveiaSM, YokoiN, VoonLW. Functional aspects of the tear film lipid layer. Exp Eye Res. 2004;78(3)347–360. [CrossRef] [PubMed]
ShineWE, McCulleyJP. Keratoconjunctivitis sicca associated with meibomian secretion polar lipid abnormality. Arch Ophthalmol. 1998;116(7)849–852. [CrossRef] [PubMed]
FoulksGN, BronAJ. Meibomian gland dysfunction: a clinical scheme for description, diagnosis, classification, and grading. Ocul Surf. 2003;1(3)107–126. [CrossRef] [PubMed]
MathersW. Evaporation from the ocular surface. Exp Eye Res. 2004;78(3)389–394. [CrossRef] [PubMed]
ShimazakiJ, SakataM, TsubotaK. Ocular surface changes and discomfort in patients with meibomian gland dysfunction. Arch Ophthalmol. 1995;113(19)1266–1270. [CrossRef] [PubMed]
SchaumbergDA, BuringJE, SullivanDA, DanaMR. Hormone replacement therapy and dry eye syndrome. JAMA. 2001;286(17)2114–2119. [CrossRef] [PubMed]
PharMetrics/NDC Health Information Services. Prevalence and treatment of dry eye in a managed care population. Draft Report. 2000;
WickhamLA, GaoJ, TodaI, RochaEM, OnoM, SullivanDA. Identification of androgen, estrogen and progesterone receptor mRNAs in the eye. Acta Ophthalmol. 2000;78(2)146–153. [CrossRef]
EsmaeliB, HarveyJT, HewlettB. Immunohistochemical evidence for estrogen receptors in meibomian glands. Ophthalmology. 2000;107(1)180–184. [CrossRef] [PubMed]
Auw-HaedrichC, FeltgenN. Estrogen receptor expression in meibomian glands and its correlation with age and dry-eye parameters. Graefes Arch Clin Exp Ophthalmol. 2003;241(9)705–709. [CrossRef] [PubMed]
RosenblumWI, El-SabbanF, AllenAD, NelsonGH, BhatnagarAS, ChoiS. Effects of estradiol on platelet aggregation in mouse mesenteric arterioles and ex vivo. Thromb Res. 1985;39:253–262. [CrossRef] [PubMed]
ThompsonMA, LasleyBL, BarkleyMS, CxekalaNM, MonfortSL, FitzGeraldRC. HPLC separation of anti-estrogen and estrogen receptor binding components of mouse plasma. Steroids. 1985;46(1)609–618. [CrossRef] [PubMed]
VerduEF, DengY, BercikP, CollinsSM. Modulatory effects of estrogen in two murine models of experimental colitis. Am J Physiol. 2002;283:G27–G36.
CarlingT, KimK-C, YangX-H, ZhangX-K, HuangS. A histone methyltransferase is required for maximal response to female sex hormones. Mol Cell Biol. 2004;24(16)7032–7042. [CrossRef] [PubMed]
RichardsSM, JensenRV, LiuM, et al. Influence of sex on gene expression in the mouse lacrimal gland. Exp Eye Res. 2006;82(1)13–23. [CrossRef] [PubMed]
AshburnerM, BallCA, BlakeJA, et al. Gene ontology: tool for the unification of biology. The Gene Ontology Consortium. Nat Genet. 2000;25(1)25–29. [CrossRef] [PubMed]
National Center for Biotechnology Information, http://www.ncbi.nlm.nih.gov/, and European Molecular Biology Laboratory Bioinformatic Harvester, http://harvester.embl.de/
DonigerSW, SalomonisN, DahlquistKD, VranizanK, LawlorSC, ConklinBR. MAPPFinder: using Gene Ontology and GenMAPP to create a global gene-expression profile from microarray data. Genome Biol. 2003;4(1)R7. [CrossRef] [PubMed]
Rivera-GonzalezR, PetersenDN, TkalcevicG, ThompsonDD, BrownTA. Estrogen-induced genes in the uterus of ovariectomized rats and their regulation by droloxifene and tamoxifen. J Steroid Biochem Mol Biol. 1998;64(1–2)13–24. [CrossRef] [PubMed]
AkerstromB, LogdbergL, BerggardT, OsmarkP, LindqvistA. α(1)-Microglobulin: a yellow-brown lipocalin. Biochim Biophys Acta. 2000;1482(1–2)172–184. [CrossRef] [PubMed]
ShanL, YuM, ClarkBD, SnyderwineEG. Possible role of Stat5a in rat mammary gland carcinogenesis. Breast Cancer Res Treat. 2004;88(3)263–272. [CrossRef] [PubMed]
BourasT, SoutheyMC, ChangAC, et al. Stanniocalcin 2 is an estrogen-responsive gene coexpressed with the estrogen receptor in human breast cancer. Cancer Res. 2002;62(5)1289–1295. [PubMed]
FuruyamaN, FujisawaY. Regulation of collagenolytic cysteine protease synthesis by estrogen in osteoclasts. Steroids. 2000;65(7)371–378. [CrossRef] [PubMed]
YeP, YoshiokaM, GanL, St-AmandJ. Regulation of global gene expression by ovariectomy and estrogen in female adipose tissue. Obes Res. 2005;13(6)1024–1030. [CrossRef] [PubMed]
NokelainenP, PeltoketoH, VihkoR, VihkoP. Expression cloning of a novel estrogenic mouse 17 β-hydroxysteroid dehydrogenase/17-ketosteroid reductase (m17HSD7), previously described as a prolactin receptor-associated protein (PRAP) in rat. Mol Endocrinol. 1998;12(7)1048–1059. [PubMed]
DuanWR, LinzerDIH, GiboriG. Cloning and characterization of an ovarian-specific protein that associates with the short form of the prolactin receptor. J Biol Chem. 1996;271(26)15602–15607. [CrossRef] [PubMed]
RemingtonSG, NelsonJD. Secretoglobins: sexually dimorphic expression of androgen-binding protein mRNA in mouse lacrimal glands. Invest Ophthalmol Vis Sci. 2005;46(1)31–38. [CrossRef] [PubMed]
FrasorJ, ParkK, ByersM, et al. Differential roles for signal transducers and activators of transcription 5a and 5b in PRL stimulation of ERα and ERβ transcription. Mol Endocrinol. 2001;15(12)2172–2181. [PubMed]
HoganJC, StephensJM. The regulation of fatty acid synthase by STAT5A. Diabetes. 2005;54(7)1968–1975. [CrossRef] [PubMed]
BaezJM, BarbourSE, CohenDE. Phosphatidylcholine transfer protein promotes apolipoprotein A-I-mediated lipid efflux in chinese hamster ovary cells. J Biol Chem. 2002;277(8)6198–6206. [CrossRef] [PubMed]
SoniKG, LehnerR, MetalnikovP, et al. Carboxylesterase 3 is a major adipocyte lipase. J Biol Chem. 2004;279(39)40683–40689. [CrossRef] [PubMed]
KerstenS. Mechanisms of nutritional and hormonal regulation of lipogenesis. EMBO Rep. 2001;2(4)282–286. [CrossRef] [PubMed]
TrickettJI, PatelDD, KnightBL, SaggersonED, GibbonsGF, PeaseRJ. Characterization of the rodent genes for arylacetamide deacetylase, a putative microsomal lipase, and evidence for transcriptional regulation. J Biol Chem. 2001;276(43)39522–39532. [CrossRef] [PubMed]
AnderssonL, BostromP, EricsonJ, et al. PLD1 and ERK2 regulate cytosolic lipid droplet formation. J Cell Sci. 2006;119:2246–2257. [CrossRef] [PubMed]
SzumiloM, Rahden-StaronI. Phospholipase D in mammalian cells: structure, properties, physiological and pathological role (in Polish). Postepy Hig Med Dosw (Online). 2006;60:421–430. [PubMed]
ThodyAJ, ShusterS. Control and function of sebaceous glands. Physiol Rev. 1989;69(2)383–416. [PubMed]
PochiPE, StraussJS. Endocrinologic control of the development and activity of the human sebaceous gland. J Invest Dermatol. 1974;62(3)191–201. [CrossRef] [PubMed]
WirthH, GloorM, KimmelW. Influence of cyproterone acetate and estradiol on cell kinetics in the sebaceous gland of the golden hamster ear. Arch Dermatol Res. 1980;268(3)277–281. [CrossRef] [PubMed]
SchaferG, KrauseW. The effect of estradiol on the sebaceous gland of the hamster ear and its antagonism by tamoxifen. Arch Dermatol Res. 1985;277(3)230–234. [CrossRef] [PubMed]
SweeneyTM, SzarnickiRJ, StraussJS, PochiPE. The effect of estrogen and androgen on the sebaceous gland turnover time. J Invest Dermatol. 1969;53(1)8–10. [CrossRef] [PubMed]
StraussJS, KligmanAM, PochiPE. The effect of androgens and estrogens on human sebaceous glands. J Invest Dermatol. 1962;39:139–155. [CrossRef] [PubMed]
Sansone-BazzanoG, ReisnerRM, BazzanoG. A possible mechanism of action of estrogen at the cellular level in a model sebaceous gland. J Invest Dermatol. 1972;59(4)299–304. [CrossRef] [PubMed]
AzziL, El-AlfyM, LabrieF. Gender differences and effects of sex steroids and dehydroepiandrosterone on androgen and oestrogen α receptors in mouse sebaceous glands. Br J Dermatol. 2006;154(1)21–27. [CrossRef] [PubMed]
PochiPE. Acne: endocrinologic aspects. Cutis. 1982;30(2)212–222. [PubMed]
SaihanEM, BurtonJL. Sebaceous gland suppression in female acne patients by combined glucocorticoid-oestrogen therapy. Br J Dermatol. 1980;103(2)139–142. [CrossRef] [PubMed]
PochiPE, StraussJS. Sebaceous gland inhibition from combined glucocorticoid-estrogen treatment. Arch Dermatol. 1976;112(8)1108–1109. [CrossRef] [PubMed]
ErdemU, OzdegirmenciO, SobaciE, SobaciG, GoktolgaU, DagliS. Dry eye in post-menopausal women using hormone replacement therapy. Maturitas. 2007;56(3)257–262. [CrossRef] [PubMed]
GurwoodAS, GurwoodI, GubmanDT, BrzezickLJ. Idiosyncratic ocular symptoms associated with the estradiol transdermal estrogen replacement patch system. Optom Vis Sci. 1995;72(1)29–33. [PubMed]
VerbeckB. Augenbefunde und Stoffwechselverhalten bei Einnahme von Ovulationshemmern. Klin Monatsbl Augenheilkd. 1973;162(5)612–621. [PubMed]
ChristT, MarquardtR, StodtmeisterR, PillunatLE. Zur Beeinflussung der Tränenfilmaufreiβzeit durch hormonale Kontrazeptiva. Fortschr Ophthalmol. 1986;83(1)108–111. [PubMed]
BrennanNA, EfronN. Symptomatology of HEMA contact lens wear. Optom Vis Sci. 1989;66(12)834–838. [CrossRef] [PubMed]
RubenM. Contact lenses and oral contraceptives. BMJ. 1966;1(5495)1110.
SuzukiT, SullivanBD, LiuM, et al. Estrogen and progesterone effects on the morphology of the mouse meibomian gland. Adv Exp Med Biol. 2002;506:483–488. [PubMed]
PangH, RowanBG, Al-DhaheriM, FaberLE. Epidermal growth factor suppresses induction by progestin of the adhesion protein desmoplakin in T47D breast cancer cells. Breast Cancer Res. 2004;6(3)R239–R245. [CrossRef] [PubMed]
KesterHA, van der LeedeBM, van der SaagPT, van der BurgB. Novel progesterone target genes identified by an improved differential display technique suggest that progestin-induced growth inhibition of breast cancer cells coincides with enhancement of differentiation. J Biol Chem. 1997;272(26)16637–16643. [CrossRef] [PubMed]
SchlattnerU, MockliN, SpeerO, WernerS, WallimannT. Creatine kinase and creatine transporter in normal, wounded, and diseased skin. J Invest Dermatol. 2002;118(3)416–423. [CrossRef] [PubMed]
CabezaM, MirandaR. Stimulatory effect of progesterone and 5 beta-progesterone on lipid synthesis in hamster flank organs. Steroids. 1997;62(12)782–788. [CrossRef] [PubMed]
ThodyAJ, ShusterS. Control of sebaceous gland function in the rat by α-melanocyte-stimulating hormone. J Endocrinol. 1975;64:503–510. [CrossRef] [PubMed]
SmithJG, BrunotFR. Hormonal effects on aged human sebaceous glands. Acta Derm Venereol (Stockh). 1961;41:61–65.
MatiasJR, MalloyVL, OrentreichN. Synergistic antiandrogenic effects of topical combinations of 5α-reductase and androgen receptor inhibitors in the hamster sebaceous glands. J Invest Dermatol. 1988;91(5)429–433. [CrossRef] [PubMed]
NuckBA, FogelsonSL, LuckyAW. Topical minoxidil does not act as an antiandrogen in the flank organ of the golden Syrian hamster. Arch Dermatol. 1987;123(1)59–61. [CrossRef] [PubMed]
ForemanMI, DevittH, ClanachanI. Inhibition of dihydrotestosterone-mediated hamster sebaceous gland hypertrophy by progesterone. Br J Dermatol. 1984;110(2)185–186. [CrossRef] [PubMed]
GirardJ, BarbierA, LafilleC. Inhibition of testosterone metabolism and lipogenesis in animal sebaceous glands by progesterone. Arch Dermatol Res. 1980;269(3)281–290. [CrossRef] [PubMed]
HinksWM, ThodyAJ, ShusterS. Effect of progesterone on sebaceous gland activity in the rat. J Endocrinol. 1975;64(3)48P–49P. [PubMed]
PalP, BhattacharyyaSP. Influence of progesterone on the activity of sebaceous gland in rat. Indian J Dermatol. 1985;30(4)11–19.
Lely van derMA. The nature of the action of progesterone on the sebaceous gland of the rat. Dermatologica. 1966;133(5)452–455. [CrossRef] [PubMed]
ZhangH, OzakiI, MizutaT, et al. Involvement of programmed cell death 4 in transforming growth factor-beta1-induced apoptosis in human hepatocellular carcinoma. Oncogene. 2006;25(45)6101–6112. [CrossRef] [PubMed]
YangHS, MatthewsCP, ClairT, et al. Tumorigenesis suppressor Pdcd4 down-regulates mitogen-activated protein kinase kinase kinase kinase 1 expression to suppress colon carcinoma cell invasion. Mol Cell Biol. 2006;26(4)1297–1306. [CrossRef] [PubMed]
PalamarchukA, EfanovA, MaximovV, AqeilanRI, CroceCM, PekarskyY. Akt phosphorylates and regulates Pdcd4 tumor suppressor protein. Cancer Res. 2005;65(24)11282–11286. [CrossRef] [PubMed]
GokeR, GregelC, GokeA, ArnoldR, SchmidtH, Lankat-ButtgereitB. Programmed cell death protein 4 (PDCD4) acts as a tumor suppressor in neuroendocrine tumor cells. Ann N Y Acad Sci. 2004;1014:220–221. [CrossRef] [PubMed]
Table 1.
 
Oligonucleotide Primers for Real-Time PCR Confirmation of Selected Gene Expression
Table 1.
 
Oligonucleotide Primers for Real-Time PCR Confirmation of Selected Gene Expression
Accession Number mRNA Orientation Nucleotide Sequence (5′ → 3′)
NM_031161 Cholecystokinin Sense TGGACCCCAGCCATAGAATAAGT
Antisense TTGTTTCCTCATTCCACCTCCT
M32599 Glyceraldehyde-3-phosphate dehydrogenase Sense CATGGCCTTCCGTGTTCCTA
Antisense CTGGTCCTCAGTGTAGCCCAA
NM_019521 Growth arrest-specific 6 Sense TCGTCATCTCTGTGGCCCTAGT
Antisense AGACAGTGACCGTGTGTTCCTG
NM_010555 Interleukin-1 receptor, type II Sense AGAAACGCATCCCACTGTGAG
Antisense TTCTTTCAGGTCAGGGCACACT
NM_010557 Interleukin-4 receptor-α Sense* TGTGAGGGTCAGATCCCAGATA
Antisense GGATTCCCGTGAGCTCTCCT
NM_008768 Orosomucoid 1 Sense TTGGAAGCTCAGAACCCAGAA
Antisense TTTGAATTGCCTGCCTGTACTC
Table 2.
 
Effect of 17β-Estradiol and/or Progesterone on Gene Expression in the Meibomian Gland
Table 2.
 
Effect of 17β-Estradiol and/or Progesterone on Gene Expression in the Meibomian Gland
Treatment Genes ↑ Genes ↓ Total
17β-Estradiol
 No transformation 72 80 152
 Log transformation 82 87 169
 Total 86 92 178
Progesterone
 No transformation 26 121 147
 Log transformation 25 134 159
 Total 28 139 167
17β-Estradiol+progesterone
 No transformation 107 164 271
 Log transformation 101 188 289
 Total 116 194 310
Table 3.
 
17β-Estradiol’s Effect on Gene Expression Ratios in the Mouse Meibomian Gland
Table 3.
 
17β-Estradiol’s Effect on Gene Expression Ratios in the Mouse Meibomian Gland
Accession Number Gene Ratio P Ontology
E2 > Placebo
 NM_007443 α1-Microglobulin/bikunin 281.37 0.0002 Transport
 NM_008411 CUB and zona pellucida-like domains 1 37.18 0.0002 Cell cycle
 NM_015764 Gene regulated by estrogen in breast cancer protein 12.01 0.0017 Electron transport
 NM_010555 Interleukin 1 receptor, type II 10.58 0.0016 Cell surface receptor linked signal transduction
 NM_011488 Signal transducer and activator of transcription 5A 4.72 0.0003 Regulation of transcription, signal transduction
 NM_011491 Stanniocalcin 2 4.40 0.0082 Protein binding
 NM_008161 Glutathione peroxidase 3 3.90 0.0185 Response to oxidative stress
 NM_008745 Neurotrophic tyrosine kinase, receptor, type 2 3.31 0.0000 Vasculogenesis
 NM_019521 Growth arrest specific 6 3.29 0.0044 Regulation of cell growth
 NM_013809 Olfactory-specific steroid hydroxylase 3.04 0.0476 Electron transport
 NM_007940 Epoxide hydrolase 2, cytoplasmic 2.92 0.0068 Immune response
 NM_010557 Interleukin 4 receptor, α 2.92 0.0114 Aromatic compound metabolism
Placebo > E2
 U08020 Procollagen, type I, α1 3.02 0.0044 Phosphate transport
 NM_013707 Keratin-associated protein 14 2.51 0.0441 Intermediate filament
 NM_020563 Androgen-binding protein ε 2.49 0.0253 Extracellular space
 NM_007743 Procollagen, type I, α2 2.48 0.0375 Phosphate transport
 BC005742 Solute carrier family 24 (sodium/potassium/calcium exchanger), member 3 2.42 0.0103 Transport
 NM_008118 Gastric intrinsic factor 2.32 0.0361 Transport
 NM_023383 Arylacetamide deacetylase 2.23 0.0355 Metabolism
 NM_009242 Secreted acidic cysteine rich glycoprotein 2.15 0.0135 Copper ion binding
 NM_017464 Neural precursor cell expressed, developmentally down-regulated gene 9 2.13 0.0262 Regulation of cell growth
 NM_016847 Arginine vasopressin receptor 1A 2.10 0.0003 Signal transduction
 NM_016879 Keratin complex 2, basic, gene 18 1.99 0.0398 Structural molecule activity
 NM_007727 Contactin 1 1.92 0.0182 DNA methylation
Table 4.
 
Progesterone’s Impact on Gene Expression Ratios in the Mouse Meibomian Gland
Table 4.
 
Progesterone’s Impact on Gene Expression Ratios in the Mouse Meibomian Gland
Accession Number Gene Ratio P Ontology
Prog > Plac
 NM_008416 Jun-B oncogene 2.24 0.0436 Regulation of progression through cell cycle
 NM_007383 Acyl-coenzyme A dehydrogenase, short chain 1.89 0.0435 Electron transport
 U62559 Solute carrier family 20, member 2 1.76 0.0221 Phosphate transport
 AK009006 Predicted: desmoplakin 1.72 0.0060 Mitochondrion
 NM_009382 Thymus cell antigen 1, theta 1.65 0.0320 External side of plasma membrane
 NM_023057 RIKEN cDNA B230120H23 gene 1.55 0.0278 Protein amino acid phosphorylation
 NM_021461 MAP kinase-interacting serine/threonine kinase 1 1.43 0.0167 Regulation of protein biosynthesis
 NM_022885 Solute carrier family 30 (zinc transporter), member 5 1.42 0.0471 Cation transport
 NM_012043 Immunoglobulin superfamily containing leucine- rich repeat 1.41 0.0133 Extracellular space
 NM_009320 Sodium-dependent taurine transporter 1.39 0.0321 β-Alanine transport
 AK012109 F-box and leucine-rich repeat protein 20 1.38 0.0155 Ubiquitin cycle
Plac > Prog
 NM_008118 Gastric intrinsic factor 3.09 0.0003 Ion transport
 NM_008218 Hemoglobin alpha, adult chain 1 2.24 0.0425 Oxygen transport
 NM_021273 Creatine kinase, brain 2.21 0.0125 Creatine kinase activity
 NM_008061 Glucose-6-phosphatase, catalytic 1.78 0.0326 Glycogen biosynthesis
 NM_023699 Nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4 1.52 0.0099 Regulation of transcription, DNA-dependent
 NM_011356 Frizzled-related protein 1.46 0.0078 Wnt receptor signaling pathway
 NM_013891 SAM pointed domain containing ets transcription factor 1.42 0.0248 Regulation of transcription, DNA-dependent
 NM_053171 CUB and sushi multiple domains 1 1.41 0.0262 Integral to membrane
 NM_009056 Regulatory factor X, 2 1.40 0.0406 Regulation of transcription, DNA-dependent
 NM_011568 THO complex 4 1.38 0.0257 Nuclear mRNA splicing, via spliceosome
 NM_023133 Ribosomal protein S19 1.37 0.0381 Protein biosynthesis
Table 5.
 
17β-Estradiol+Progesterone’s Impact on Gene Expression Ratios in the Mouse Meibomian Gland
Table 5.
 
17β-Estradiol+Progesterone’s Impact on Gene Expression Ratios in the Mouse Meibomian Gland
Accession Number Gene Ratio P Ontology
E2+Pr > Plac
 NM_007443 α1-Microglobulin/bikunin 185.81 0.0000 Transport
 NM_008411 CUB and zona pellucida-like domains 1 29.54 0.0011 Cell cycle
 NM_015764 Gene regulated by estrogen in breast cancer protein 12.48 0.0010 Electron transport
 NM_010555 Interleukin 1 receptor, type II 9.78 0.0021 Cell surface receptor linked signal transduction
 NM_010171 Coagulation factor III 3.84 0.0002 Wound healing
 NM_011488 Signal transducer and activator of transcription 5A 3.65 0.0002 Transcription
 NM_011491 Stanniocalcin 2 3.53 0.0011 Protein binding
 NM_011044 Phosphoenolpyruvate carboxykinase 1, cytosolic 3.44 0.0324 Gluconeogenesis
 NM_019521 Growth arrest specific 6 3.28 0.0016 Regulation of cell growth
 NM_011050 Programmed cell death 4 2.93 0.0217 Isomerase activity
 NM_008161 Glutathione peroxidase 3 2.9 0.0128 Response to oxidative stress
 NM_011169 Prolactin receptor 2.87 0.0463 Regulation of epithelial cell differentiation
Plac > E2+Pr
 NM_008118 Gastric intrinsic factor 2.76 0.0456 Ion transport
 NM_011281 RAR-related orphan receptor γ 2.25 0.0196 Regulation of transcription, DNA-dependent
 NM_021273 Creatine kinase, brain 2.19 0.0257 Creatine kinase activity
 NM_011332 Chemokine (C-C motif) ligand 17 2.18 0.0190 Chemotaxis
 U08020 Procollagen, type I, α1 2.08 0.0275 Phosphate transport
 NM_011799 Cell division cycle 6 homologue (S. cerevisiae), transcript variant 1 2.03 0.0004 DNA replication
 NM_008102 GTP cyclohydrolase 1 1.96 0.0079 Tetrahydrobiopterin biosynthesis
 NM_016669 Crystallin, μ, mRNA 1.91 0.0378 Sensory organ development
 AK007683 Clq and tumor necrosis factor related protein 2 1.89 0.0260 Activation of MAPK activity
 D00622 Low density lipoprotein receptor-related protein associated protein 1 1.87 0.0034 Low-density lipoprotein receptor binding
 NM_009242 Secreted acidic cysteine rich glycoprotein 1.86 0.0138 Copper ion binding
 M55181 Preproenkephalin 1 1.83 0.0170 Neuropeptide signaling pathway
Table 6.
 
Influence of Sex Steroid Treatment on the Expression of Gene Ontologies in the Meibomian Gland
Table 6.
 
Influence of Sex Steroid Treatment on the Expression of Gene Ontologies in the Meibomian Gland
Ontology E2 Prog E2+Prog
Total Total Total
Biological processes
 Cellular metabolism 36 33 69 70 11 81 72 40 112
 Cellular physiological process 48 45 93 18 89 107 64 99 163
 Cellular process 57 53 110 19 99 118 76 121 197
 Metabolism 40 37 77 11 73 84 44 77 121
 Physiological process 56 55 111 18 94 112 70 118 188
 Primary metabolism 34 29 63 10 66 76 38 64 102
Molecular function
 Binding 45 47 92 14 65 79 64 105 169
 Catalytic activity 36 34 70 11 32 43 40 62 102
Cellular components
 Cell 50 55 105 18 98 116 66 116 182
 Intracellular 35 42 77 13 80 93 43 86 129
 Intracellular organelle 31 33 64 11 73 84 33 72 105
Table 7.
 
Highest and Lowest Expression of Gene Ontologies in the Meibomian Glands of Placebo- or 17β-Estradiol-Treated Mice
Table 7.
 
Highest and Lowest Expression of Gene Ontologies in the Meibomian Glands of Placebo- or 17β-Estradiol-Treated Mice
Ontology Gene List E2 Genes ↑ PI Genes ↑ Array Genes E2 z-Score PI z-Score
Biological process
 Lipid metabolism 18 13 5 315 6.25 1.31
 Response to stimulus 24 17 7 995 2.96 −0.72
 Generation of precursor metabolites and energy 13 8 5 346 2.89 1.09
 Electron transport 10 6 4 237 2.74 1.3
 Cell development 10 5 5 215 2.28 2.24
 Organ morphogenesis 13 7 6 352 2.25 1.63
 Biosynthesis 15 11 4 656 2.25 −0.84
 Morphogenesis 20 10 10 608 2.07 2.02
 Organismal physiological process 19 13 6 870 2.02 −0.71
 Regulation of cellular physiological process 27 8 19 1739 −2.19 0.95
 Regulation of cellular metabolism 17 4 13 1265 −2.39 0.51
 Transcription 14 3 11 1194 −2.57 0.07
 Nucleobase, nucleoside, nucleotide and nucleic acid metabolism 19 6 13 1766 −2.83 −0.86
 Morphogenesis 20 10 10 608 2.07 2.02
 Cell development 10 5 5 215 2.28 2.24
 Cellular morphogenesis 10 4 6 231 1.38 2.76
Molecular function
 Oxidoreductase activity 19 11 8 492 3.29 1.71
 Catalytic activity 70 36 34 2946 2.44 1.73
 DNA binding 10 3 7 1137 −2.43 −1.15
 Nucleic acid binding 15 6 9 1596 −2.45 −1.65
 Hydrolase activity, acting on ester bonds 13 6 7 344 1.73 2.23
 Receptor binding 13 5 8 366 1 2.62
 Structural molecule activity 11 3 8 355 −0.09 2.71
 Transferase activity 13 10 3 1039 0.27 −2.28
Cellular component
 Extracellular space 53 25 28 1529 3.92 4.09
 Endoplasmic reticulum 15 7 8 369 2.33 2.53
 Cytoplasmic part 37 20 17 1620 2.06 0.54
 Cell 101 47 54 6371 −2.1 −1.95
Table 8.
 
Influence of 17β-Estradiol on the Expression of Meibomian Gland Genes Related to Lipid Metabolism and/or Lipid Binding
Table 8.
 
Influence of 17β-Estradiol on the Expression of Meibomian Gland Genes Related to Lipid Metabolism and/or Lipid Binding
17β-Estradiol > placebo
 Adiponectin, C1Q and collagen domain containing
 Aldehyde dehydrogenase family 1, subfamily A7
 Aldo-keto reductase family 1, member C20
 Cytochrome P450, family 17, subfamily a, polypeptide 1
 Cytochrome P450, family 7, subfamily b, polypeptide 1
 Endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor 7
 Growth hormone receptor
 Hydroxysteroid (17-β) dehydrogenase 7
 Hydroxysteroid 11-β dehydrogenase 1
 Monoacylglycerol O-acyltransferase 1
 Oxysterol binding protein-like 3
 Phosphatidylcholine transfer protein
 Phospholipase A2, group VII
 Signal transducer and activator of transcription 5A
WNT1 inducible signaling pathway protein 2
Placebo > 17β-estradiol
 Acyl-CoA synthetase bubblegum family member 1
 Acyl-coenzyme A oxidase 2, branched chain
 Arylacetamide deacetylase
 C1q and tumor necrosis factor-related protein 2
 Carboxylesterase 3
 L-3-hydroxyacyl-Coenzyme A dehydrogenase, short chain
 Phosphatidylcholine-specific phospholipase D1
 Phospholipase D1
 T-cell lymphoma invasion and metastasis 1
Table 9.
 
Highest and Lowest Expression of Gene Ontologies in the Meibomian Glands of Placebo- or Progesterone-Treated Mice
Table 9.
 
Highest and Lowest Expression of Gene Ontologies in the Meibomian Glands of Placebo- or Progesterone-Treated Mice
Ontology Gene List Pr Genes ↑ Pl Genes ↑ Array Genes Pr z-Score Pl z-Score
Biological process
 Transport 29 11 18 1548 3.86 −1.24
 Localization 33 11 22 1753 3.41 −0.98
 Protein modification 13 5 8 821 2.04 −1.32
 Protein biosynthesis 35 2 33 318 1.3 13.31
 Macromolecule biosynthesis 37 2 35 359 1.11 13.18
 Cellular biosynthesis 42 2 40 577 0.4 11.18
 Ribosome biogenesis 10 0 10 78 −0.46 8.26
 Cytoplasm organization and biogenesis 10 0 10 92 −0.5 7.43
 Cellular macromolecule metabolism 50 6 44 1592 0.99 4.69
 Cellular protein metabolism 49 6 43 1571 1.03 4.55
 Organelle organization and biogenesis 15 1 14 529 −0.35 2.25
 Metabolism 84 11 73 4097 0.08 2.24
 Biopolymer metabolism 18 5 13 1438 0.69 −2.08
Molecular function
 ATP binding 9 5 4 764 2.41 −2.14
 Structural constituent of ribosome 29 0 29 116 −0.54 21.98
 Structural molecule activity 30 0 30 355 −0.96 11.7
 RNA binding 13 0 13 321 −0.91 4.19
 Signal transducer activity 13 3 10 1344 −0.18 −2.2
 Binding 79 14 65 5552 0.21 −2.5
Cellular component
 Organelle membrane 10 3 7 350 2.27 0.91
 Ribosome 29 0 29 119 −0.56 21.2
 Ribonucleoprotein complex 30 0 30 245 −0.81 14.46
 Cytosol 22 0 22 214 −0.75 11.04
 Non–membrane-bound organelle 33 0 33 770 −1.49 7.02
 Protein complex 42 1 41 1102 −1.18 6.91
 Intracellular part 89 11 78 4230 0.05 3.42
 Organelle 81 10 71 3786 0.12 3.26
 Extracellular space 16 3 13 1529 −0.53 −2.16
 Membrane 41 11 30 3078 1.43 −2.81
Table 10.
 
Progesterone Downregulation of Meibomian Gland Genes Encoding Structural Constituents of Ribosomes
Table 10.
 
Progesterone Downregulation of Meibomian Gland Genes Encoding Structural Constituents of Ribosomes
Mitochondrial ribosomal protein L20 Ribosomal protein L35
Mitochondrial ribosomal protein S6 Ribosomal protein L36a
Ribosomal protein L5 Ribosomal protein L36a-like
Ribosomal protein L6 Ribosomal protein L37
Ribosomal protein L7 Ribosomal protein L37a
Ribosomal protein L11 Ribosomal protein S3
Ribosomal protein L12 Ribosomal protein S8
Ribosomal protein L14 Ribosomal protein S17
Ribosomal protein L15 Ribosomal protein S19
Ribosomal protein L18A Ribosomal protein S23
Ribosomal protein L19 Ribosomal protein S26
Ribosomal protein L21 Ribosomal protein S27
Ribosomal protein L23 Ribosomal protein S27a
Ribosomal protein L29 Ribosomal protein, large P2
Ribosomal protein L31
Table 11.
 
Highest and Lowest Expression of Gene Ontologies in the Meibomian Glands of Placebo- or 17β-Estradiol+Progesterone-Treated Mice
Table 11.
 
Highest and Lowest Expression of Gene Ontologies in the Meibomian Glands of Placebo- or 17β-Estradiol+Progesterone-Treated Mice
Ontology Gene List E2+Prog Genes ↑ Pl Genes ↑ Array Genes E2+Prog z-Score Pl z-Score
Biological Process
 Lipid metabolism 23 16 7 315 6.48 0.38
 Localization 71 31 40 1753 2.53 1.22
 Transport 64 28 36 1548 2.5 1.27
 Catabolism 15 8 7 321 2.19 0.33
 Macromolecule metabolism 57 18 39 2297 −2.2 −0.99
 Regulation of physiological process 46 11 35 1816 −2.68 −0.02
 Regulation of transcription 26 4 22 1165 −2.92 −0.12
 Regulation of cellular metabolism 29 4 25 1265 −3.17 0.12
 Nucleobase, nucleoside, nucleotide and nucleic acid metabolism 36 6 30 1766 −3.81 −0.82
 Electron transport 15 6 9 237 1.92 2.12
 Protein transport 18 5 13 373 0.26 2.24
 Protein localization 20 5 15 411 0.04 2.6
Molecular Function
 Iron ion binding 10 6 4 184 2.76 0.27
 Magnesium ion binding 14 6 8 194 2.61 2.29
 Protein-tyrosine kinase activity 11 6 5 231 2.13 0.29
 Transcription regulator activity 13 2 11 753 −2.37 −0.94
 DNA binding 25 4 21 1137 −2.7 −0.16
 Nucleic acid binding 37 7 30 1596 −2.94 −0.09
 Ligase activity 11 3 8 165 0.84 2.79
Cellular component
 Extracellular space 59 26 33 1529 2.33 0.84
 Cytoplasmic part 64 26 38 1620 2.01 1.5
 Organelle 105 33 72 3786 −2.21 0.04
 Cell 179 65 114 6371 −2.38 −1.68
 Nucleus 47 10 37 2168 −3.53 −0.77
 Mitochondrion 27 8 19 531 0.83 2.95
Table 12.
 
Effects of Combined 17β-Estradiol and Progesterone on the Expression of Meibomian Gland Genes in the Localization Ontology
Table 12.
 
Effects of Combined 17β-Estradiol and Progesterone on the Expression of Meibomian Gland Genes in the Localization Ontology
17β-Estradiol+Progesterone > Placebo Placebo > 17β-Estradiol + Progesterone
Acyl-Coenzyme A dehydrogenase, short chain Acyl-coenzyme A dehydrogenase family, member 9
Adaptor-related protein complex AP-4, sigma 1 Acyl-coenzyme A oxidase 2, branched chain
Alpha 1 microglobulin/bikunin Adaptor-related protein complex 2, β1 subunit
Ankyrin 1, erythroid Blocked early in transport 1 homolog (S. cerevisiae)-like
ATP-binding cassette, sub-family D (ALD), member 4 C1q and tumor necrosis factor related protein 2
CD34 antigen Cytochrome b5 type B
Cholecystokinin Cytochrome P450, family 2, subfamily b, polypeptide 9
Cysteine-rich hydrophobic domain 2 Cytochrome P450, family 2, subfamily e, polypeptide 1
Cytochrome P450, family 17, subfamily a, polypeptide 1 Exportin 5
Cytochrome P450, family 2, subfamily g, polypeptide 1 Gastric intrinsic factor
Cytochrome P450, family 7, subfamily b, polypeptide 1 Glucose-fructose oxidoreductase domain containing 2
Double cortin and calcium/calmodulin-dependent protein kinase-like 1 Immunoglobulin superfamily, member 4B
Fatty acid binding protein 3, muscle and heart Isoprenylcysteine carboxyl methyltransferase
Ficolin A KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2
Gene regulated by estrogen in breast cancer protein Lin-7 homolog B (C. elegans)
Growth hormone receptor Metallothionein 4
Orosomucoid 1 Mitochondrial ribosomal protein S17
Oxysterol binding protein-like 3 Nischarin
Phosphatidylcholine transfer protein Nucleoporin 93
Phosphatidylinositol transfer protein, beta Potassium large conductance calcium-activated channel, subfamily M, β member
Potassium inwardly-rectifying channel, subfamily J, member 6 Procollagen, type I, α1
RAB20, member RAS oncogene family Prostaglandin D2 synthase (brain)
Solute carrier family 15 (H+/peptide transporter), member 2 Protein tyrosine phosphatase, nonreceptor type 9
Solute carrier family 20, member 2 Purinergic receptor P2X, ligand-gated ion channel, 1
Solute carrier family 30 (zinc transporter), member 5 Retinol binding protein 4, plasma
Solute carrier family 6 (neurotransmitter transporter, taurine), member 6 S100 calcium binding protein A3
Syntaxin 7 Solute carrier family 24 (sodium/potassium/calcium exchanger), member 3
Tocopherol (α) transfer protein Solute carrier family 39 (zinc transporter), member 7
Transmembrane 9 superfamily member 2 Synaptotagmin III
Ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1 Translocase of inner mitochondrial membrane 22 homolog (yeast)
Vesicle transport through interaction with t-SNAREs homolog 1A (yeast) Transmembrane emp24 protein transport domain containing 9
Transmembrane emp24-like trafficking protein 10 (yeast)
Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, β pol
Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, ε
Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, η poly
Ubiquitin-like 1 (sentrin) activating enzyme E1B
Ubiquitin-like, containing PHD and RING finger domains, 1
Vacuolar protein sorting 25 (yeast)
Vascular endothelial growth factor A
XPA binding protein 1
Table 13.
 
Analogous and Opposite Effects of 17β-Estradiol and Progesterone on Gene Expression in the Meibomian Gland
Table 13.
 
Analogous and Opposite Effects of 17β-Estradiol and Progesterone on Gene Expression in the Meibomian Gland
Treatment 1 Treatment 2 T1 ↑, T2 ↑ T1 ↓, T2 ↓ T1 ↑, T2 ↓ T1 ↓, T2 ↑
17β-Estradiol Progesterone 7 9 2 0
17β-Estradiol 17β-Estradiol+progesterone 45 46 0 0
Progesterone 17β-Estradiol+progesterone 12 31 0 1
Table 14.
 
Confirmation of Selected CodeLink Microarray and GEM Chip Results
Table 14.
 
Confirmation of Selected CodeLink Microarray and GEM Chip Results
Gene/Treatment Treatment/Placebo Ratio
CodeLink GEM qPCR
Cholecystokinin
 17β-Estradiol 2.23 1.72 2.77
 Progesterone ND 0.92 0.93
 E2+Prog 1.64 1.32 1.73
Growth arrest-specific 6
 17β-Estradiol 3.29 1.67 2.43
 Progesterone ND 1.12 0.96
 E2+Prog 3.28 1.53 4.39
Interleukin 1 receptor, type
 17β-Estradiol 10.58 13.21
 Progesterone ND 0.93
 E2+Prog 9.78 11.75
Interleukin 4 receptor, α
 17β-Estradiol 2.92 1.54 5.80
 Progesterone ND 1.20 2.52
 E2+Prog 2.19 1.57 7.49
Orosomucoid 1
 17β-Estradiol 2.38 2.23 2.02
 Progesterone ND 0.83 0.44
 E2+Prog 2.09 1.45 2.28
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×