February 2011
Volume 52, Issue 2
Free
Immunology and Microbiology  |   February 2011
Detection and Gram Discrimination of Bacterial Pathogens from Aqueous and Vitreous Humor Using Real-Time PCR Assays
Author Affiliations & Notes
  • Paulo José Martins Bispo
    From the Laboratório Especial de Microbiologia Clínica (LEMC), Infectious Diseases Division, and
  • Gustavo Barreto de Melo
    the Department of Ophthalmology Universidade Federal de São Paulo (UNIFESP), São Paulo, Brazil.
  • Ana Luisa Hofling-Lima
    the Department of Ophthalmology Universidade Federal de São Paulo (UNIFESP), São Paulo, Brazil.
  • Antonio Carlos Campos Pignatari
    From the Laboratório Especial de Microbiologia Clínica (LEMC), Infectious Diseases Division, and
  • Corresponding author: Antonio Carlos Campos Pignatari, Rua Leandro Dupret 188, Vila Clementino, São Paulo, SP, Brazil 04025-010; pignatari@terra.com.br
Investigative Ophthalmology & Visual Science February 2011, Vol.52, 873-881. doi:10.1167/iovs.10-5712
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to Subscribers Only
      Sign In or Create an Account ×
    • Get Citation

      Paulo José Martins Bispo, Gustavo Barreto de Melo, Ana Luisa Hofling-Lima, Antonio Carlos Campos Pignatari; Detection and Gram Discrimination of Bacterial Pathogens from Aqueous and Vitreous Humor Using Real-Time PCR Assays. Invest. Ophthalmol. Vis. Sci. 2011;52(2):873-881. doi: 10.1167/iovs.10-5712.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

Purpose.: To develop and apply real-time PCR protocols to the detection and classification of the Gram status of bacterial pathogens in aqueous and vitreous humor collected from clinically suspected intraocular infections

Methods.: The analytical specificity of two PCR assays, SYBR Green 16S rDNA–Based Universal PCR (SGRU-PCR), and a Multiplex Gram-Specific TaqMan–Based PCR (MGST-PCR), was determined with 31 clinically important pathogens, including 20 Gram-positive and 11 Gram-negative. Analytical sensitivity was determined with a 10-fold dilution of Staphylococcus epidermidis and Escherichia coli DNA. Assays were further tested on aqueous (n = 10) and vitreous humor (n = 11) samples collected from patients with clinically diagnosed intraocular infections.

Results.: DNA was amplified from all control bacterial isolates when using SGRU-PCR. MGST-PCR correctly classified the Gram status of all these isolates. The SGRU-PCR limit of detection of S. epidermidis and E. coli DNA was 100 fg/μL (E = 0.82 and 0.86; r 2 = 0.99) and for MGST-PCR, 1 pg/μL (E = 0.66 and 0.70; r 2 = 0.99. For clinical intraocular samples, positivity of culture was 47.6% and for real-time PCR assays, 95.2%. Gram classification was achieved in 100% of MGST-PCR-positive samples. Among microbiologically negative samples, real-time PCR assays were positive in 90% of cases. The false-positive rate in control aqueous was 3.2%, and control samples of vitreous were negative.

Conclusions.: The real-time PCR assays demonstrated good correlation, with culture-proven results. With the use of these methods, bacterial detection was improved from 47.6% to 95.3%, demonstrating them to be sensitive, rapid tests for diagnosis of bacterial endophthalmitis.

Bacterial endophthalmitis is a rare but severe intraocular inflammation resulting from the introduction of microorganisms into the posterior segment of the eye. Its associated morbidity can have a dramatic impact on the patient's quality of life, causing a substantial decrease in the ability to perform normal daily activities and compromising psychological health. 1  
Occasionally, clinical signs of intraocular inflammation result from a noninfectious mechanism, such as an immune response, chemical or physical aggression, vasculitis, or neoplasia. Therefore, the correct and early determination of the causative agent of inflammation is important for the prompt initiation of appropriate therapy. 2  
Conventional microbiology methods, such as Gram staining and culture, are routinely used for laboratory characterization of endophthalmitis cases. However, microbiologic methods are time consuming and show poor sensitivity for bacterial detection in aqueous and vitreous humor. 3 6  
Since the introduction of the PCR (polymerase chain reaction) methodology in 1983 by Kerry Mullis, the use of molecular methods in laboratory medicine has increased rapidly. Now, its use is part of the routine processing of many clinical samples in microbiology laboratories, establishing a new era for the diagnosis of infectious diseases. 7 The utilization of PCR for endophthalmitis diagnosis significantly increases the sensitivity of bacterial detection in aqueous and vitreous humor in less time. PCR and nested PCR protocols followed by post-PCR techniques such as RFLP (restriction fragment length polymorphism), DNA-probe hybridization, and DNA sequencing have been applied to the diagnosis of bacterial endophthalmitis. 4,6,8 11  
Real-time PCR technology is an enhancement of the original PCR design. It is a homogeneous method in which DNA amplification and detection of the target sequence occur together, decreasing handling of PCR products and risks of carryover contamination. 12 Real-time PCR protocols for the detection of bacterial DNA in clinical samples of aqueous and vitreous humor have recently been described. 13 15 However, broad-range 16S rDNA-based PCR and probe-based Gram classification with the use of real-time PCR technology for detection of bacterial pathogens from endophthalmitis cases has not yet been extensively described. 
The purpose of this study was to develop and apply a SYBR Green 16S rDNA–Based Universal PCR (SGRU-PCR) and a Multiplex Gram-Specific TaqMan–Based PCR (MGST-PCR) to the detection and Gram status classification of bacterial pathogens in aqueous and vitreous humor collected from eyes with clinically diagnosed endophthalmitis. 
Methods
Bacterial Isolates
A total of 31 bacterial isolates were used for standardization purposes, including American Type Culture Collection (ATCC; Manassas, VA) strains and clinical isolates preferentially isolated from ocular samples (Table 1). Species isolated from ocular samples and other sterile body sites stored in our bacterial collection were identified by standard microbiologic methods, and confirmation was performed with an automated system (Phoenix; BD Diagnostic System, Sparks, MD). 
Table 1.
 
Results of SGUR-PCR and MGST-PCR for Control Isolates Used for Determining Analytical Specificity
Table 1.
 
Results of SGUR-PCR and MGST-PCR for Control Isolates Used for Determining Analytical Specificity
Organisms Isolate Type T m (°C) (SYBR Green) TaqMan Multiplex
GP-ProbeFAM GN-ProbeVIC
Gram-positive
    B. cereus Clinical isolate 84.6 +
    C. jeikeium Clinical isolate 83.4 +
    E. casseliflavus ATCC 700327 82.8 +
    E. faecalis ATCC 29212 84.0 +
    E. faecium ATCC 93011 83.4 +
    P. acnes Clinical isolate 84.7 +
    S. anginosus Clinical isolate 83.8 +
    S. aureus ATCC 29213 83.4 +
    S. bovis Clinical isolate 84.1 +
    S. cohini ATCC 29974 84.3 +
    S. epidermidis ATCC 12228 83.4 +
    S. haemolitycus ATCC 29968 83.8 +
    S. hominis ATCC 29885 84.3 +
    S. mitis Clinical isolate 84.1 +
    S. oralis Clinical isolate 84.1 +
    S. pneumoniae ATCC 49619 84.3 +
    S. pyogenes ATCC 18615 84.4 +
    S. sanguinis Clinical isolate 84.1 +
    S. viridans Clinical isolate 83.8 +
    S. xylosus ATCC 29971 84.6 +
Gram-negative
    A. baumannii ATCC 19606 83.8 +
    A. lwoffii Clinical isolate 84.4 +
    E. aerogenes ATCC 13048 84.7 +
    E. coli ATCC 25922 85.0 +
    H. infuenzae ATCC 49247 83.8 +
    K. pneumoniae ATCC 700603 85.4 +
    M. morganii Clinical isolate 84.4 +
    P. aeruginosa ATCC 27853 83.1 +
    P. mirabilis Clinical isolate 83.9 +
    P. rettgeri Clinical isolate 84.9 +
    S. marcescens Clinical isolate 85.7 +
Fungi
    F. solani ATCC 36031
    C. albicans ATCC 90028
Clinical Samples
A total of 10 aqueous and 11 vitreous humor samples were collected from 14 patients with clinically suspected endogenous (n = 2) and postoperative (n = 12) endophthalmitis seen in our clinic between November 2007 and February 2009. All postoperative patients were using topical moxifloxacin or gatifloxacin at the time of sample collection. Only 1 of 12 patients showed delayed-onset endophthalmitis; all others had acute disease. Two patients with endogenous endophthalmitis were not using topical antibiotics. The study complied with the guidelines of the Declaration of Helsinki, and informed consent was obtained from all subjects. Aqueous and vitreous humor samples were obtained by means of anterior and posterior chamber paracentesis, respectively. Vitreous samples were also collected by vitrectomy through the pars plana. An aliquot of the samples was immediately used for Gram and Giemsa staining and cultured in blood agar, chocolate agar, and thioglycolate broth in aerobic and anaerobic conditions for 14 days. Approximately 100 to 500 μL of the samples was aseptically transferred to a sterile microtube and stored at −20°C for PCR procedures. 
DNA Extraction of Bacterial Isolates
Bacterial DNA was extracted using cultured isolates in 1.5 mL Luria-Bertani broth. The pelleted cells were treated with 450 μL TE buffer (Tris-EDTA, 10 mM Tris-Cl, [pH 7.4] and 1 mM EDTA [pH 8.0]) and boiled for 10 minutes. Afterward, 50 μL lysozyme (5 μg/μL) and 5 μL lysostaphin (20 μg/μL) were added, followed by incubation for 30 minutes at 37°C, followed by the addition of 40 μL proteinase K (20 μg/μL) and 100 μL STE buffer (10 mM Tris-HCl [pH 8.0], 1 mM EDTA[pH 8.0], 150 mM NaCl), and the samples were incubated for another 30 minutes at 37°C. After incubation, 120 μL 5 M potassium acetate was added, and the samples were incubated for 15 minutes at room temperature. The supernatant fraction obtained after 3 minutes of centrifugation (13,000 rpm) was transferred to a clean microcentrifuge tube, followed by the addition of 120 μL isopropanol. After centrifugation for 3 minutes, the pellet was washed with 1 mL 80% ethanol. The supernatant was discarded after centrifugation for 1 minute. DNA was resuspended in 50 μL sterile water (MilliQ; Millipore, Billerica, MA) and quantified by spectrophotometry (model ND-1000; Thermo Scientific, Wilmington, DE). Every bacterial DNA extract was diluted to a working concentration of 10 ng/μL. 
DNA Extraction of Clinical Samples
Total DNA was extracted from aqueous and vitreous humor with a DNA purification kit (QIAamp DNA mini kit; Qiagen, Hilden, Germany) according to the tissue protocol, with a few modifications. In brief, 50 μL of sample was mixed with 180 μL ATL buffer and immediately ground in liquid nitrogen for 1 minute. Extraction was achieved after treatment with proteinase K (10 minutes incubation at 56°C) and AL buffer (10 minutes incubation at 70°C). After spin purification, DNA was eluted with 100 μL EB buffer and stored at −20°C. 
Primer and Probe Design
16S rDNA sequences of the following organisms were obtained from GenBank (http://www.ncbi.nlm.nih.gov/blast/ provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD) and aligned on computer (SeqMan Lasergene Software Package; DNASTAR, Madison, WI): Acinetobacter baumannii (EU221389), Acinetobacter lwoffii (AY176770), Bacillus cereus (EF100618), Citrobacter diversus (AF025372), Citrobacter freundii (AF025365), Corynebacterium spp. (AY259129), Enterobacter aerogenes (AM933751), Enterobacter cloacae (AM778415), Escherichia coli (EU014689), Enterococcus faecium (AB326300), Haemophilus. influenzae (AF076035), Klebsiella oxytoca (AB353048), Klebsiella pneumoniae (AY043391), Morganella morganii (AY043390), Propionibacterium acnes (AF076032), Pseudomonas aeruginosa (EU090892), Proteus mirabilis (EU287466), Proteus vulgaris (AJ301683), Streptococcus anginosus (AY691541), Staphylococcus aureus (BA000017), Staphylococcus epidermidis (AM157417), Staphylococcus haemolyticus (EF522132), Staphylococcus lugdunensis (AB009941), Serratia marcescens (EU233275), Streptococcus mitis (EU200182), Streptococcus mutans (DQ677784), Streptococcus pneumoniae (AF003930), Streptococcus salivarius (AY188352) and Streptococcus viridans (AF076036). The universal primers NT-341Fw and 16S-522Rv were designed by aligning in the conservative region of 16S rDNA, yielding a product of approximately 192 bp. Gram-specific probes were designed by aligning sequences according to their Gram classification and were synthesized using different fluorescent agents to allow a multiplex approach. A primer set and a probe for the β-globin gene was designed for use as an internal control (Table 2). 
Table 2.
 
Primers and Probes
Table 2.
 
Primers and Probes
Name Sequence (5′-3′) Application Product Size (bp)
Primers
    NT-341Fw GACTCCTACGGGAGGC 16S rDNA universal amplification 192
    16S-522Rv GCGGCTGCTGGCAC 16S rDNA universal amplification 192
    Beta-Rv CCAAGAGTCTTCTCTGTCTC Endogenous control 100
    Beta-Fw GAAGTTGGTGGTGAGGCC Endogenous control 100
Probes
    GP-Probe FAM - CTGAYSSAGCAACGCCGCG - MGB Gram-positive classification
    GN-Probe VIC - CCTGAYSCAGCMATGCCGCG - MGB Gram-negative classification
    Beta-Probe NED - AGGTTGGTATCAAGGTTACAAG - MGB Endogenous control
PCR Optimization, Sensitivity, and Specificity
The two Gram-specific probes were initially tested in uniplex reactions to guarantee correct amplification using control strain DNA. The best primer annealing temperature was chosen by testing the primer set in a temperature gradient amplification. Afterward, the multiplex reaction was set up by applying different probe concentrations. Sensitivity was determined for S. epidermidis and E. coli DNA serially diluted from 10 ng/μL to 1 fg/μL. The reaction efficiency (E) was calculated after the construction of a standard curve with the formula E = 10(−1/−slope) −1. 
The specificity of the Gram-specific reaction was determined after correct amplification of each validating strain DNA. To exclude cross-reaction with fungal pathogens, amplification was performed with Candida albicans (ATCC 90028) and Fusarium solani (ATCC 36031) DNA. Aqueous humor (n = 50) of phacoemulsification surgery and vitreous humor (n = 12) obtained from patients with noninfectious intraocular inflammation were used to calculate the proportion of false-negative results. 
Pretreatment of PCR Mixtures with DNaseI
The amplification of contaminant DNA from molecular biology reagents is a recognized drawback for universal 16S rDNA amplification for clinical purposes. 16 For universal bacterial detection in small DNA amounts from clinical samples by using real-time PCR platforms, the simultaneous amplification of sample and contaminant DNA can make it difficult to interpret the results of positive clinical samples. 17 Commercial Taq DNA polymerase preparations can carry a low quantity of E. coli or Thermus aquaticus DNA 10,16 and also Pseudomonas spp., Sphingomonas spp., Moraxella spp., and Acinetobacter spp., in the real-time PCR mix. 18 Therefore, pretreatment of commercial Taq polymerase preparations to remove contaminating bacterial DNA is an essential step for the application of PCR protocols in clinical diagnosis. 
The real-time PCR mix can be pretreated using restriction endonuclease or DNaseI digestion, UV radiation or 8-methoxypsoralen. 17,19,20 The Platinum SYBR Green qPCR Super Mix (Invitrogen) and TaqMan Universal PCR Master Mix (Applied Biosystems, Inc. [ABI], Foster City, CA) were incubated with 5.0, 2.0, 1.0, 0.5, 0.4, 0.3, 0.25, 0.1, and 0.01 U RQ1 RNase-free DNase for 30 minutes at 37°C followed by 50 minutes at 95°C. For each DNaseI concentration, three positive reactions using 10 ng/μL of S. epidermidis and E. coli DNA and three negative reactions were tested. 
Positive and negative control reactions using untreated reagents were also prepared, to allow the evaluation of positive (decontamination) and negative (decrease in efficiency) effects. Comparison of Ct (cycle threshold) values between treated and untreated control samples was made to choose the better DNaseI concentration for each real-time PCR mix treatment. 
SYBR Green 16S rDNA–Based Universal PCR
A 20-μL reaction was set up containing 10 μL Platinum SYBR Green qPCR Super Mix (Platinum Taq DNA polymerase; SYBR Green I dye; Tris-HCl; KCl, 6 mM MgCl2, 400 μM dGTP, 400 μM dATP, 400 μM dCTP, 800 μM dUTP, uracil DNA glycosylase [UDG], and stabilizers), 0.2 μM of each primer NT-341Fw and 16S-522Rv (Table 2), and 2 μL template. Amplification was performed on a real-time PCR system (model 7500; ABI) with the following conditions: 50°C for 2 minutes and 95°C for 10 minutes (UDG) followed by 40 cycles of 95°C for 15 seconds and 60°C for 60 seconds. Melting curve analysis was performed after amplification, by heating samples from 68°C to 95°C, with a gradual increase of 0.5°C/s. The amplification of every five clinical samples was performed in the presence of a negative control, including all PCR reagents, except DNA template and positive control samples, with 10 ng/μL S. epidermidis and E. coli DNA. 
Multiplex Gram-Specific TaqMan–Based PCR
Multiplex real-time PCR for the differentiation of Gram-positive and Gram-negative pathogens was set up using the TaqMan-MGB method (ABI). The reaction consisted of 10 μL TaqMan Universal PCR Master Mix, 0.25 μM of each primer, NT-341Fw and 16S-522Rv, 0.15 μM GN-probe and 0.05 μM GP-probe (ABI), 2 μL of sample and MilliQ (Millipore) sterile water, to a final volume of 20 μL. Amplification was performed in the real-time PCR system (model 7500 ABI) with the following conditions: 50°C for 2 minutes and 95°C for 10 minutes (UDG) followed by 40 cycles of 95°C for 15 seconds and 60°C for 60 seconds. Amplification of the β-globin gene was performed for every clinical sample at the same time of bacterial detection. Negative and positive controls were run in the amplification of every five PCR clinical samples. 
Sequencing of Amplified Products
After the reaction, a 15-μL PCR aliquot was purified with a PCR purification kit (QIAquick; Qiagen). DNA molecules were sequenced in both directions with dye-termination chemistry (Big Dye Terminator; 3000 Genetic analyzer; ABI). The sequences obtained were edited (SeqMan; DNASTAR, Madison, WI) and searched for similarity in GenBank using the BLAST (blastn algorithm) program with automatically adjusted parameters. The minimal percentage to identify genus and species were used as recommended by CLSI document MM18-A. 21  
Results
Analytical Specificity and Sensitivity
Universal amplification was obtained by using the NT-341Fw and 16S-522Rv primer set for control bacterial testing. The T m (melting temperature) variation range was determined to define an experimental range of possible results. In addition, the GP-probe and GN-probe were shown to be quite specific for Gram differentiation when tested with bacterial DNA control samples. No cross-reactivity with F. solani and C. albicans DNA was shown (Table 1). After prior DNaseI treatment, the limit of detection for S. epidermidis and E. coli DNA was 100 fg/μL for SGRU-PCR and 1 pg/μL for MGST-PCR. 
The efficiency of reactions determined using 10-fold dilutions of S. epidermidis and E. coli DNA was 0.82 and 0.86, respectively, with SGRU-PCR, and 0.66 and 0.70 for the MGST-PCR assay (Fig. 1). 
Figure 1.
 
Standard curve derived from SGUR-PCR and MGST-PCR for S. epidermidis (A) and E. coli (B) DNA. Calculations of efficiency for each reaction are shown. Efficiency was calculated from the slope given by regression analysis using the formula: E = 10(−1/−slope) −1.
Figure 1.
 
Standard curve derived from SGUR-PCR and MGST-PCR for S. epidermidis (A) and E. coli (B) DNA. Calculations of efficiency for each reaction are shown. Efficiency was calculated from the slope given by regression analysis using the formula: E = 10(−1/−slope) −1.
Pretreatment of Commercial PCR Mixtures
The treatment of PCR mixtures used in this study showed significant inhibitory effects with high concentrations of DNaseI. On the other hand, low concentrations that do not exhibit inhibitory effects are not sufficient to completely decontaminate the mix. The DNaseI concentrations required to eliminate false-positive amplification are shown in Table 3. In a 20-μL reaction volume, 0.4 U DNaseI for TaqMan Universal PCR Master Mix (ABI) and 0.25 U DNaseI for Platinum SYBR Green qPCR Master Mix (Invitrogen) showed efficient decontamination and a less inhibitory effect when comparing Ct values between treated and untreated mix. 
Table 3.
 
Comparison of Ct Values Using Pretreated and Untreated PCR Mix
Table 3.
 
Comparison of Ct Values Using Pretreated and Untreated PCR Mix
DNase I/Mix (U) Ct
S. epidermidis E. coli NTC
TaqMan Universal PCR Master Mix
    Untreated 17 17 17 15 15 15 32 32 32
    1.0 26 26 26 25 24 25 Neg Neg Neg
    0.5 22 23 23 19 20 19 Neg Neg Neg
    0.4 22 22 22 17 18 18 Neg Neg Neg
Platinum SYBR Green qPCR Super Mix
    Untreated 11 11 11 19 19 19 33 34 33
    2.0 Neg Neg Neg Neg Neg Neg Neg Neg Neg
    1.0 Neg 38 35 Neg Neg Neg Neg Neg Neg
    0.5 23 22 22 35 37 36 Neg Neg Neg
    0.3 36 36 36 26 25 26 Neg Neg Neg
    0.25 14 14 14 22 22 22 Neg Neg 38
Microbiologically Positive Samples
Among the 11 microbiologically positive samples collected from eight eyes, 10 showed positive culture isolation, including 3 S. viridans (two patients), 2 coagulase negative Staphylococcus (CNS) (one patient), 2 Weeksella virosa (one patient), 1 β-hemolytic Streptococcus, 1 P. acnes, and 1 S. pneumoniae. One aqueous humor sample (patient 6) showed only Gram-positive cocci. Every bacteriologically positive sample showed positive 16S rDNA detection by SGUR-PCR, with a Ct variation of 18.7 to 33.6 and T m from 83.3°C to 86.5°C. Gram classification was achieved for all these samples by MGST-PCR. No mixed Gram-positive signal was obtained in five samples (Ct 20.9–33.8) with Streptococcus spp. isolation (patients 1, 3, 4, and 8). Gram-negative signal was obtained in four samples (Ct 23.5–33) including a case of endophthalmitis with positive culture for W. virosa (aqueous and vitreous humor of patient 7) and a case with CNS isolation (aqueous and vitreous humor of patient 2). Direct amplification from this cultured CNS strain showed only Gram-positive signal amplification, demonstrating that no cross-reaction with GN-probe occurred in the clinical sample. Two samples showed mixed Gram-specific amplification, and both were culture positive for Gram-positive organisms. 
Analysis of the sequenced amplicon allowed organism identification for almost all microbiologically positive samples. Only the amplification product from patient 2 did not permit organism identification due to poor-quality sequencing. The sequenced product from a case of delayed postoperative endophthalmitis with P. acnes showed similarity with 16S rDNA sequences of Actinobacteria spp. and Mycobacterium spp., but a RefSeq database search showed 100% identity with P. acnes sequence NC_006085.1 (E = 1e-81) and less than 91% identity with Actinobacteria spp. For the samples in which molecular Gram classification matched the microbiology results, identification using the sequenced products agreed with phenotypic species determination (Table 4). 
Table 4.
 
Results of the Real-time PCR Assays and Organism Identification Based on the 16S rDNA Sequencing of Clinical Aqueous and Vitreous Humor Samples
Table 4.
 
Results of the Real-time PCR Assays and Organism Identification Based on the 16S rDNA Sequencing of Clinical Aqueous and Vitreous Humor Samples
Patient Sample Category Microscopy Culture SGRU-PCR MGST-PCR (Ct) Sequencing
Ct T m (°C) GP-FAM Probe GN-VIC Probe Organism Maximum Identity (%)
Microbiologically positive
    1 Vitreous PO Gram-positivie cocci Viridans Group Streptococci 20.5 84.0 25.0 Negative Streptococcus mitis group* 100
    1 Aqueous PO Gram-positivie cocci Viridans Group Streptococci 26.7 84.0 33.8 Negative Streptococcus mitis group 100
    2 Vitreous PO ND Coagulase-Negative Staphylococci 30.4 83.3 Negative 33.0 Bad file (mixed sequence) ND
    2 Aqueous PO ND Coagulase-Negative Staphylococci 29.3 83.3 Negative 30.2 Bad file (mixed sequence) ND
    3 Vitreous PO Gram-positive cocci Viridans Group Streptococci 22.6 84.3 24.1 Negative Streptococcus spp. 99
    4 Vitreous PO Gram-positive cocci β-hemolytic Streptococci 18.7 83.6 20.9 Negative Streptococcus dysgalactiae 100
    5 Vitreous Delayed PO Negative Propionibacterium acnes 33.6 86.5 30.0 34.9 P. acnes, Actinobacterium spp., Mycobacterium spp. † 100
    6 Aqueous PO Gram-positivie cocci Negative 26.5 83.6 30.2 29.2 Coagulase-negative staphylococci 100
    7 Vitreous PO Gram-negative bacilli Weeksella virosa 24.4 84.0 Negative 23.8 Flavobacteriaceae 99
    7 Aqueous PO Gram-negative bacilli Weeksella virosa 24.6 84.0 Negative 23.5 Flavobacteriaceae 99
    8 Aqueous PO Gram-positivie cocci Streptococcus pneumoniae 19.5 84.0 23.2 Negative S. pneumoniae and S. mitis group 100
Microbiologically negative
    9 Vitreous Endogenous Negative Negative 28.1 83.3 Negative 27.9 Moraxella spp. 100
    10 Vitreous Endogenous ND Negative Negative Negative Negative Negative ND ND
    3 Aqueous PO Negative Negative 31.6 84.0 Negative 33.6 Bad file (mixed sequence) ND
    6 Vitreous PO Negative Negative 20.9 83.3 23.9 Negative Coagulase-negative Staphylococci 99
    11 Vitreous PO Negative Negative 25.2 84.0 31.6 Negative Streptococcus mitis group 100
    11 Aqueous PO Negative Negative 28.7 84.0 31.5 31.3 Streptococcus mitis group 100
    12 Vitreous PO Negative Negative 34.3 79.0 Negative 31.9 Proteus spp. 99
    12 Aqueous PO Negative Negative 32.1 84.0 Negative 28.9 Bad file (mixed sequence) ND
    13 Aqueous PO Negative Negative 30.9 84.0 36.8 31.0 Bad file (mixed sequence) ND
    14 Aqueous PO Negative Negative 32.5 84.3 Negative 34.8 Bad file (mixed sequence) ND
Microbiologically Negative Samples
Ten clinical samples, five aqueous and five vitreous, collected from eyes with suspected intraocular infections were negative by culture and microscopy. Universal amplification by SGRU-PCR was positive in 9 (90%) of these 10 samples (Ct range, 20.9–34.3, and T m, 79.0–84.3). Gram classification was achieved by MGST-PCR for all universal-positive PCR samples, where seven showed Gram-negative (Ct 27.9–34.8) and four Gram-positive (Ct 23.9–36.8) amplification signals. Two samples demonstrated mixed fluorescence signal (aqueous humor from patients 11 and 13). Nevertheless, sequenced amplification products of samples from patient 11 showed 100% identity with the Streptococcus mitis group. Only one sample (patient 10) was negative in the real-time PCR assays. Organism identification using sequenced PCR products was achieved in five samples and included one Moraxella spp., one CNS, one Proteus spp., and two Streptococcus mitis group (Table 4). 
Overall Clinical Samples
In total, 21 clinical samples collected from 14 eyes with suspected endophthalmitis were included. Of those samples, 10 were aqueous humor and 11 vitreous humor. Most cases of intraocular infection were postoperative (12/14; 85.7%), and one of them had delayed onset (P. acnes endophthalmitis case). Only two cases were categorized as endogenous endophthalmitis, both showing negative culture results. 
The sensitivity of microscopy and culture for bacterial detection in clinical samples was 44.4% and 47.6%, respectively. There was no significant difference in sensitivity for microbiologic detection between aqueous and vitreous humor. With the use of real-time PCR assays, the sensitivity of bacterial detection was increased to 95.3% (Table 5). 
Table 5.
 
Sensitivity of Assays Used to Detect Bacterial Pathogens from Aqueous and Vitreous Humor
Table 5.
 
Sensitivity of Assays Used to Detect Bacterial Pathogens from Aqueous and Vitreous Humor
Sample Gram Staining Culture Real-time PCR*
Aqueous humor (n = 10) 4 (50.0) 4 (40.0) 10 (100)
Vitreous humor (n = 11) 4 (40.0) 6 (54.5) 10 (90.9)
Total (n = 21) 8 (44.4)† 10 (47.6) 20 (95.3)
Gram classification was achieved for every universal PCR-positive clinical sample (n = 20, 100%). Seven samples showed only a Gram-positive signal, nine were only Gram-negative, and four demonstrated mixed amplification (Table 6). When the Gram classification results based on phenotypic methods and MGST-PCR were compared, there was total agreement (no mixed signal samples included) in 63.6% of the cases. 
Table 6.
 
Positivity of SGRU-PCR and Gram Differentiation Achieved by MGST-PCR According to the Classic Microbiology Results
Table 6.
 
Positivity of SGRU-PCR and Gram Differentiation Achieved by MGST-PCR According to the Classic Microbiology Results
Microbiology Results* SGRU-PCR MGST-PCR
Gram-Positive Gram-Negative
Positive (n = 11)
    Gram-positive (n = 9) 9 7 4†
    Gram-negative (n = 2) 2 0 2
Negative (n = 10) 9 4‡ 7‡
Total PCR positive 20 11 13
Control Samples
Among the 50 aqueous humor samples collected at the end of phacoemulsification procedures, 2 (4%) samples showed universal 16S rDNA amplification by SGUR-PCR (Ct 39). These two samples did not show a Gram-specific amplification fluorescence signal by MGST-PCR. Amplification of 16S rDNA in all 12 control vitreous humor samples was negative with the real-time PCR assays. 
Discussion
Routinely, the aqueous and vitreous humors are collected from patients with suspected endophthalmitis and processed by culture and microscopy techniques. However, the sensitivity of bacterial detection using these methods can be lower than molecular methods. Gram stain and culture of aqueous and vitreous humor have shown a sensitivity varying between 10% and 56%. 3 6 Moreover, routine microbiologic methods are time consuming, leading to the inappropriate use of broad-spectrum antibiotics for several days. 
The use of a faster and more sensitive method, such as PCR, increases the positivity of bacterial detection in aqueous and vitreous samples and demands less time for the diagnosis if performed in a routine manner. Several investigators have reported the use of the PCR methodology with a significant increase in the percentage of bacterial detection in clinical samples of aqueous and vitreous humor, ranging from 40% to 100%. 3 6,9,11,23,24 In most of these studies, a nested PCR strategy was used, to increase the sensitivity of bacterial detection. However, because of the high sensitivity of this method and the transfer of first-reaction products to a second-reaction tube, the risks of contaminant DNA amplification and cross contamination are substantially increased. 25  
In addition, PCR protocols that include 16S rDNA-based Gram-specific primer and probe sets may help in choosing a more direct antibiotic therapy and have been applied in different settings. 15,26 32 Although nested PCR multiplex and PCR-DNA probe hybridization approaches for Gram differentiation have been developed and applied to the diagnosis of endophthalmitis, 8,33 both methods include at least two post-PCR steps, increasing the turn-around time of the test, the expense of reagents, and risk of cross-contamination. 
The use of real-time PCR for Gram classification directly on clinical samples allows simultaneous amplification and detection by the use of Gram-specific probes labeled with different fluorescent agents in a closed-system reaction. Gram differentiation using the real-time PCR technique has been described as a complementary laboratory technique for the diagnosis of infections in intensive care unit patients, 17 sepsis, 32,34 infectious arthritis, 15 and urinary tract infections in hospitalized patients. 30 Recently, real-time PCR using a universal probe, Gram-positive probe, and eight genus-specific probes was developed for the diagnosis of bacterial endophthalmitis. 13  
In this study, we describe two coupled real-time PCR reactions for universal detection and Gram differentiation of bacteria that causes endophthalmitis. The two sets of reactions showed excellent analytical specificity when tested for the most common ocular bacterial pathogens (Table 1). No cross-reaction was detected when using human and fungal DNA. The limit of detection for S. epidermidis and E. coli DNA was 100 fg/μL when using SGRU-PCR and 1 pg/μL when using MGST-PCR. Even with the lowest concentration of DNaseI enzyme, the master mix pretreatment caused considerable inhibition of the reaction. Efficiency of reaction was approximately 0.8 for SGRU-PCR and 0.70 for MGST-PCR assays. The decrease in analytical sensitivity was attributable to the reduction of Taq polymerase activity, caused by DNaseI inactivation at 95°C for 50 minutes and also to residual DNaseI activity. 19,20,35 The MGST-PCR assay showed lower efficiency of reaction than did SGUR-PCR, most likely because of the simultaneous use of two probes. 24,36,37  
The real-time PCR assays developed in this study were shown to be more sensitive for bacterial detection in aqueous and vitreous humor, compared with routine microbiology techniques. Among the 21 clinical samples included, 44.4% were positive by Gram staining, 47.6% were culture positive and 95.3% were positive with real-time PCR assays. A slight difference in the positivity of culture for vitreous samples (54.5%) compared with that for aqueous humor (40.0%) was observed. Reports demonstrating a better bacterial recovery when culturing vitreous for endophthalmitis diagnosis purposes have been published. 5,6,38,39 A significant difference in the positivity of PCR for bacterial detection in aqueous and vitreous humor was not seen in our work. All aqueous humor samples were PCR-positive, and only one vitreous sample was negative. In general, no significant differences in bacterial detection in aqueous versus vitreous samples have been observed when employing PCR protocols. 4 6,24 A multicenter study that included 100 patients with acute postoperative endophthalmitis showed a slightly lower sensitivity of PCR for aqueous humor (34.6%) compared with vitreous fluid (57%). However, in samples collected after initiation of antibiotic therapy, vitreous humor (70.1%) showed more PCR-positive results than did aqueous (23.4%), when compared with the first collected sample from patients with endophthalmitis not treated with intravitreous antibiotic. 9  
Although the sensitivity of the real-time PCR assays for bacterial detection was similar for aqueous and vitreous samples, poor-quality sequencing (mixed sequences) was more frequently seen in aqueous samples. Analyses of 16S rDNA sequenced product obtained from aqueous humor in a previous report demonstrated unsatisfactory quality when compared with PCR products from vitreous samples. 6  
The isolation of bacterial pathogens from anterior chamber aspirates at the end of intraocular surgery ranges from 2.0% to 46.25%. 40 44 Therefore, the poorer sequencing data yielded for aqueous humor could be the result of mixed amplification from the real pathogen causing infection and a contaminant organism. Even though no considerable sensitivity difference was noted for PCR bacterial detection in the aqueous and vitreous in this and other studies, a vitreous fluid aspirate is preferable for molecular detection and organism identification in cases of postoperative endophthalmitis. 
Molecular Gram classification using MGST-PCR was achieved in 100% of the aqueous and vitreous humor specimens. Among the Gram-positive, culture-proven samples, 77.7% were correctly classified by the GP-probe when compared with phenotypic results. Two samples (aqueous and vitreous from the same patient) showing a Flavobacteriaceae culture growth were correctly classified by the GN-probe. Four samples showed a mixed amplification signal, but three of them yielded quality sequencing data, where Gram-positive organisms were identified. Therefore, although the GN-probe showed 100% analytical specificity, cross-reactions with Gram-positive organisms could have occurred in a small number of clinical samples. 
SGRU-PCR and MGST-PCR were shown to be particularly helpful in bacterial detection in culture-negative samples. Among 10 microbiologically negative samples, nine (90%) were PCR positive, and five gave an interpretable and searchable sequence data. The organisms identified included one Moraxella spp., one CNS, and two Streptococcus mitis group, recognized causative agents of endophthalmitis. Sequencing of PCR-positive/culture-negative samples also included the identification of a Proteus spp. causing postoperative endophthalmitis, which is an uncommon but possible agent in postoperative endophthalmitis. 38,45,46  
Rates of false-positive amplification were low (3.2%) in this study. Only two aqueous humor samples collected at the end of phacoemulsification showed a positive amplification signal by SGUR-PCR, with a high Ct value (39), almost five more than the highest Ct value (35) found for the clinical samples used in this assay. The use of a larger number of clinical samples could help to establish a cutoff value. For now, our results encourage us to set a cutoff of 35 cycles for the SGUR-PCR assay. 
The results presented show that the real-time PCR assays designed in this study provide faster and more sensitive testing for the laboratory diagnosis of bacterial endophthalmitis, helping ophthalmologists to differentiate bacteria from other infectious etiologies of intraocular inflammation and giving additional information about the Gram status of the causative microorganism in a homogenous and closed amplification system. This method could be useful for the prompt initial antibiotic therapy in endophthalmitis cases avoiding intraocular toxicity due to the use of unnecessary antibiotics. Further clinical studies with well-controlled case series to evaluate clinical performance including diagnostic sensitivity and specificity, predictive values, and diagnostic accuracy are warranted. 
Footnotes
 Supported by a grant from Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP), Brazil.
Footnotes
 Disclosure: P.J.M. Bispo, None; G.B. de Melo, None; A.L. Hofling-Lima, None; A.C. Campos Pignatari, None
References
Clark A Ng JQ Morlet N . Quality of life after postoperative endophthalmitis. Clin Exp Ophthalmol. 2008;36:526–531.
Kinnear FB Kirkness CM . Advances in rapid laboratory diagnosis of infectious endophthalmitis. J Hosp Infect. 1995;30(suppl):253–261.
Bagyalakshmi R Madhavan HN Therese KL . Development and application of multiplex polymerase chain reaction for the etiological diagnosis of infectious endophthalmitis. J Postgrad Med. 2006;52:179–182.
Chiquet C Lina G Benito Y . Polymerase chain reaction identification in aqueous humor of patients with postoperative endophthalmitis. J Cataract Refract Surg. 2007;33:635–641.
Lohmann CP Linde HJ Reischl U . Improved detection of microorganisms by polymerase chain reaction in delayed endophthalmitis after cataract surgery. Ophthalmology. 2000;107:1047–1051.
Okhravi N Adamson P Carroll N . PCR-based evidence of bacterial involvement in eyes with suspected intraocular infection. Invest Ophthalmol Vis Sci. 2000;41:3474–3479.
Speers DJ . Clinical applications of molecular biology for infectious diseases. Clin Biochem Rev. 2006;27:39–51.
Anand AR Madhavan HN Therese KL . Use of polymerase chain reaction (PCR) and DNA probe hybridization to determine the Gram reaction of the infecting bacterium in the intraocular fluids of patients with endophthalmitis. J Infect. 2000;41:221–226.
Chiquet C Cornut PL Benito Y . Eubacterial PCR for bacterial detection and identification in 100 acute postcataract surgery endophthalmitis. Invest Ophthalmol Vis Sci. 2008;49:1971–1978.
Okhravi N Adamson P Matheson MM Towler HM Lightman S . PCR-RFLP-mediated detection and speciation of bacterial species causing endophthalmitis. Invest Ophthalmol Vis Sci. 2000;41:1438–1447.
Seal D Reischl U Behr A . Laboratory diagnosis of endophthalmitis: comparison of microbiology and molecular methods in the European Society of Cataract and Refractive Surgeons multicenter study and susceptibility testing. J Cataract Refract Surg. 2008;34:1439–1450.
Whitcombe D Newton CR Little S . Advances in approaches to DNA-based diagnostics. Curr Opin Biotechnol. 1998;9:602–608.
Goldschmidt P Degorge S Benallaoua D . New test for the diagnosis of bacterial endophthalmitis. Br J Ophthalmol. 2009;93:1089–1095.
Goldschmidt P Ferreira CC Degorge S . Rapid detection and quantification of Propionibacteriaceae. Br J Ophthalmol. 2009;93:258–262.
Yang S Ramachandran P Hardick A . Rapid PCR-based diagnosis of septic arthritis by early Gram-type classification and pathogen identification. J Clin Microbiol. 2008;46:1386–1390.
Carroll NM Adamson P Okhravi N . Elimination of bacterial DNA from Taq DNA polymerases by restriction endonuclease digestion. J Clin Microbiol. 1999;37:3402–3404.
Klaschik S Lehmann LE Raadts A Hoeft A Stuber F . Comparison of different decontamination methods for reagents to detect low concentrations of bacterial 16S DNA by real-time-PCR. Mol Biotechnol. 2002;22:231–242.
Mühl H Kochem AJ Disque C Sakka SG . Activity and DNA contamination of commercial polymerase chain reaction reagents for the universal 16S rDNA real-time polymerase chain reaction detection of bacterial pathogens in blood. Diagn Microbiol Infect Dis. 2010;66:41–49.
Corless CE Guiver M Borrow R Edwards-Jones V Kaczmarski EB Fox AJ . Contamination and sensitivity issues with a real-time universal 16S rRNA PCR. J Clin Microbiol. 2000;38:1747–1752.
Silkie SS Tolcher MP Nelson KL . Reagent decontamination to eliminate false-positives in Escherichia coli qPCR. J Microbiol Methods. 2008;72:275–282.
Molecular Diagnostic Methods for Infectious Diseases; Approved Guideline. 2nd ed. Wayne PA: Clinical and Laboratory Standards Institute; 2006: CLSI document MM03–A2.
Facklam R . What happened to the streptococci: overview of taxonomic and nomenclature changes (review). Clin Microbiol Rev. 2002;15:613–630.
Hykin PG Tobal K McIntyre G Matheson MM Towler HM Lightman SL . The diagnosis of delayed post-operative endophthalmitis by polymerase chain reaction of bacterial DNA in vitreous samples. J Med Microbiol. 1994;40:408–415.
Therese KL Anand AR Madhavan HN . Polymerase chain reaction in the diagnosis of bacterial endophthalmitis. Br J Ophthalmol. 1998;82:1078–1082.
Hayden R . In vitro nucleic acid amplification techniques. In: Persing DH Tenover FC Versalovic J eds. Molecular Microbiology: Diagnostic Principles and Practice. Washington, DC: ASM; 2004.
Klaschik S Lehmann LE Raadts A Book M Hoeft A Stuber F . Real-time PCR for detection and differentiation of Gram-positive and gram-negative bacteria. J Clin Microbiol. 2002;40:4304–4307.
Klausegger A Hell M Berger A . Gram type-specific broad-range PCR amplification for rapid detection of 62 pathogenic bacteria. J Clin Microbiol. 1999;37:464–466.
Ohlin A Backman A Bjorkqvist M Molling P Jurstrand M Schollin J . Real-time PCR of the 16S-rRNA gene in the diagnosis of neonatal bacteraemia. Acta Paediatr. 2008;97:1376–1380.
Shang S Chen Z Yu X . Detection of bacterial DNA by PCR and reverse hybridization in the 16S rRNA gene with particular reference to neonatal septicemia. Acta Paediatr. 2001;90:179–183.
Shigemura K Shirakawa T Okada H . Rapid detection and differentiation of Gram-negative and Gram-positive pathogenic bacteria in urine using TaqMan probe. Clin Exp Med. 2005;4:196–201.
Wellinghausen N Wirths B Franz AR Karolyi L Marre R Reischl U . Algorithm for the identification of bacterial pathogens in positive blood cultures by real-time LightCycler polymerase chain reaction (PCR) with sequence-specific probes. Diagn Microbiol Infect Dis. 2004;48:229–241.
Wu YD Chen LH Wu XJ . Gram stain-specific-probe-based real-time PCR for diagnosis and discrimination of bacterial neonatal sepsis. J Clin Microbiol. 2008;46:2613–2619.
Carroll NM Jaeger EE Choudhury S . Detection of and discrimination between gram-positive and gram-negative bacteria in intraocular samples by using nested PCR. J Clin Microbiol. 2000;38:1753–1757.
Gebert S Siegel D Wellinghausen N . Rapid detection of pathogens in blood culture bottles by real-time PCR in conjunction with the pre-analytic tool MolYsis. J Infect. 2008;57:307–316.
Hilali F Saulnier P Chachaty E Andremont A . Decontamination of polymerase chain reaction reagents for detection of low concentrations of 16S rRNA genes. Mol Biotechnol. 1997;7:207–216.
Exner MM Lewinski MA . Sensitivity of multiplex real-time PCR reactions, using the LightCycler and the ABI PRISM 7700 Sequence Detection System, is dependent on the concentration of the DNA polymerase. Mol Cell Probes. 2002;16:351–357.
Mothershed EA Whitney AM . Nucleic acid-based methods for the detection of bacterial pathogens: present and future considerations for the clinical laboratory. Clin Chim Acta. 2006;363:206–220.
Bispo PJ Melo GB d'Azevedo PA Hofling-Lima AL Yu MC Pignatari AC . Culture proven bacterial endophthalmitis: a 6-year review (in Portuguese). Arq Bras Oftalmol. 2008;71:617–622.
Fan JC Niederer RL von Lany H Polkinghorne PJ . Infectious endophthalmitis: clinical features, management and visual outcomes. Clin Exp Ophthalmol. 2008;36:631–636.
Ariyasu RG Nakamura T Trousdale MD Smith RE . Intraoperative bacterial contamination of the aqueous humor. Ophthalmic Surg. 1993;24:367–373.
Bausz M Fodor E Resch MD Kristof K . Bacterial contamination in the anterior chamber after povidone-iodine application and the effect of the lens implantation device. J Cataract Refract Surg. 2006;32:1691–1695.
Samad A Solomon LD Miller MA Mendelson J . Anterior chamber contamination after uncomplicated phacoemulsification and intraocular lens implantation. Am J Ophthalmol. 1995;120:143–150.
Srinivasan R Tiroumal S Kanungo R Natarajan MK . Microbial contamination of the anterior chamber during phacoemulsification. J Cataract Refract Surg. 2002;28:2173–2176.
Tervo T Ljungberg P Kautiainen T . Prospective evaluation of external ocular microbial growth and aqueous humor contamination during cataract surgery. J Cataract Refract Surg. 1999;25:65–71.
Leng T Flynn HWJr Miller D Murray TG Smiddy WE . Endophthalmitis caused by proteus species: antibiotic sensitivities and visual acuity outcomes. Retina. 2009;29:1019–1024.
Ng JQ Morlet N Pearman JW . Management and outcomes of postoperative endophthalmitis since the endophthalmitis vitrectomy study: the Endophthalmitis Population Study of Western Australia (EPSWA)'s fifth report. Ophthalmology. 2005;112:1199–1206.
Figure 1.
 
Standard curve derived from SGUR-PCR and MGST-PCR for S. epidermidis (A) and E. coli (B) DNA. Calculations of efficiency for each reaction are shown. Efficiency was calculated from the slope given by regression analysis using the formula: E = 10(−1/−slope) −1.
Figure 1.
 
Standard curve derived from SGUR-PCR and MGST-PCR for S. epidermidis (A) and E. coli (B) DNA. Calculations of efficiency for each reaction are shown. Efficiency was calculated from the slope given by regression analysis using the formula: E = 10(−1/−slope) −1.
Table 1.
 
Results of SGUR-PCR and MGST-PCR for Control Isolates Used for Determining Analytical Specificity
Table 1.
 
Results of SGUR-PCR and MGST-PCR for Control Isolates Used for Determining Analytical Specificity
Organisms Isolate Type T m (°C) (SYBR Green) TaqMan Multiplex
GP-ProbeFAM GN-ProbeVIC
Gram-positive
    B. cereus Clinical isolate 84.6 +
    C. jeikeium Clinical isolate 83.4 +
    E. casseliflavus ATCC 700327 82.8 +
    E. faecalis ATCC 29212 84.0 +
    E. faecium ATCC 93011 83.4 +
    P. acnes Clinical isolate 84.7 +
    S. anginosus Clinical isolate 83.8 +
    S. aureus ATCC 29213 83.4 +
    S. bovis Clinical isolate 84.1 +
    S. cohini ATCC 29974 84.3 +
    S. epidermidis ATCC 12228 83.4 +
    S. haemolitycus ATCC 29968 83.8 +
    S. hominis ATCC 29885 84.3 +
    S. mitis Clinical isolate 84.1 +
    S. oralis Clinical isolate 84.1 +
    S. pneumoniae ATCC 49619 84.3 +
    S. pyogenes ATCC 18615 84.4 +
    S. sanguinis Clinical isolate 84.1 +
    S. viridans Clinical isolate 83.8 +
    S. xylosus ATCC 29971 84.6 +
Gram-negative
    A. baumannii ATCC 19606 83.8 +
    A. lwoffii Clinical isolate 84.4 +
    E. aerogenes ATCC 13048 84.7 +
    E. coli ATCC 25922 85.0 +
    H. infuenzae ATCC 49247 83.8 +
    K. pneumoniae ATCC 700603 85.4 +
    M. morganii Clinical isolate 84.4 +
    P. aeruginosa ATCC 27853 83.1 +
    P. mirabilis Clinical isolate 83.9 +
    P. rettgeri Clinical isolate 84.9 +
    S. marcescens Clinical isolate 85.7 +
Fungi
    F. solani ATCC 36031
    C. albicans ATCC 90028
Table 2.
 
Primers and Probes
Table 2.
 
Primers and Probes
Name Sequence (5′-3′) Application Product Size (bp)
Primers
    NT-341Fw GACTCCTACGGGAGGC 16S rDNA universal amplification 192
    16S-522Rv GCGGCTGCTGGCAC 16S rDNA universal amplification 192
    Beta-Rv CCAAGAGTCTTCTCTGTCTC Endogenous control 100
    Beta-Fw GAAGTTGGTGGTGAGGCC Endogenous control 100
Probes
    GP-Probe FAM - CTGAYSSAGCAACGCCGCG - MGB Gram-positive classification
    GN-Probe VIC - CCTGAYSCAGCMATGCCGCG - MGB Gram-negative classification
    Beta-Probe NED - AGGTTGGTATCAAGGTTACAAG - MGB Endogenous control
Table 3.
 
Comparison of Ct Values Using Pretreated and Untreated PCR Mix
Table 3.
 
Comparison of Ct Values Using Pretreated and Untreated PCR Mix
DNase I/Mix (U) Ct
S. epidermidis E. coli NTC
TaqMan Universal PCR Master Mix
    Untreated 17 17 17 15 15 15 32 32 32
    1.0 26 26 26 25 24 25 Neg Neg Neg
    0.5 22 23 23 19 20 19 Neg Neg Neg
    0.4 22 22 22 17 18 18 Neg Neg Neg
Platinum SYBR Green qPCR Super Mix
    Untreated 11 11 11 19 19 19 33 34 33
    2.0 Neg Neg Neg Neg Neg Neg Neg Neg Neg
    1.0 Neg 38 35 Neg Neg Neg Neg Neg Neg
    0.5 23 22 22 35 37 36 Neg Neg Neg
    0.3 36 36 36 26 25 26 Neg Neg Neg
    0.25 14 14 14 22 22 22 Neg Neg 38
Table 4.
 
Results of the Real-time PCR Assays and Organism Identification Based on the 16S rDNA Sequencing of Clinical Aqueous and Vitreous Humor Samples
Table 4.
 
Results of the Real-time PCR Assays and Organism Identification Based on the 16S rDNA Sequencing of Clinical Aqueous and Vitreous Humor Samples
Patient Sample Category Microscopy Culture SGRU-PCR MGST-PCR (Ct) Sequencing
Ct T m (°C) GP-FAM Probe GN-VIC Probe Organism Maximum Identity (%)
Microbiologically positive
    1 Vitreous PO Gram-positivie cocci Viridans Group Streptococci 20.5 84.0 25.0 Negative Streptococcus mitis group* 100
    1 Aqueous PO Gram-positivie cocci Viridans Group Streptococci 26.7 84.0 33.8 Negative Streptococcus mitis group 100
    2 Vitreous PO ND Coagulase-Negative Staphylococci 30.4 83.3 Negative 33.0 Bad file (mixed sequence) ND
    2 Aqueous PO ND Coagulase-Negative Staphylococci 29.3 83.3 Negative 30.2 Bad file (mixed sequence) ND
    3 Vitreous PO Gram-positive cocci Viridans Group Streptococci 22.6 84.3 24.1 Negative Streptococcus spp. 99
    4 Vitreous PO Gram-positive cocci β-hemolytic Streptococci 18.7 83.6 20.9 Negative Streptococcus dysgalactiae 100
    5 Vitreous Delayed PO Negative Propionibacterium acnes 33.6 86.5 30.0 34.9 P. acnes, Actinobacterium spp., Mycobacterium spp. † 100
    6 Aqueous PO Gram-positivie cocci Negative 26.5 83.6 30.2 29.2 Coagulase-negative staphylococci 100
    7 Vitreous PO Gram-negative bacilli Weeksella virosa 24.4 84.0 Negative 23.8 Flavobacteriaceae 99
    7 Aqueous PO Gram-negative bacilli Weeksella virosa 24.6 84.0 Negative 23.5 Flavobacteriaceae 99
    8 Aqueous PO Gram-positivie cocci Streptococcus pneumoniae 19.5 84.0 23.2 Negative S. pneumoniae and S. mitis group 100
Microbiologically negative
    9 Vitreous Endogenous Negative Negative 28.1 83.3 Negative 27.9 Moraxella spp. 100
    10 Vitreous Endogenous ND Negative Negative Negative Negative Negative ND ND
    3 Aqueous PO Negative Negative 31.6 84.0 Negative 33.6 Bad file (mixed sequence) ND
    6 Vitreous PO Negative Negative 20.9 83.3 23.9 Negative Coagulase-negative Staphylococci 99
    11 Vitreous PO Negative Negative 25.2 84.0 31.6 Negative Streptococcus mitis group 100
    11 Aqueous PO Negative Negative 28.7 84.0 31.5 31.3 Streptococcus mitis group 100
    12 Vitreous PO Negative Negative 34.3 79.0 Negative 31.9 Proteus spp. 99
    12 Aqueous PO Negative Negative 32.1 84.0 Negative 28.9 Bad file (mixed sequence) ND
    13 Aqueous PO Negative Negative 30.9 84.0 36.8 31.0 Bad file (mixed sequence) ND
    14 Aqueous PO Negative Negative 32.5 84.3 Negative 34.8 Bad file (mixed sequence) ND
Table 5.
 
Sensitivity of Assays Used to Detect Bacterial Pathogens from Aqueous and Vitreous Humor
Table 5.
 
Sensitivity of Assays Used to Detect Bacterial Pathogens from Aqueous and Vitreous Humor
Sample Gram Staining Culture Real-time PCR*
Aqueous humor (n = 10) 4 (50.0) 4 (40.0) 10 (100)
Vitreous humor (n = 11) 4 (40.0) 6 (54.5) 10 (90.9)
Total (n = 21) 8 (44.4)† 10 (47.6) 20 (95.3)
Table 6.
 
Positivity of SGRU-PCR and Gram Differentiation Achieved by MGST-PCR According to the Classic Microbiology Results
Table 6.
 
Positivity of SGRU-PCR and Gram Differentiation Achieved by MGST-PCR According to the Classic Microbiology Results
Microbiology Results* SGRU-PCR MGST-PCR
Gram-Positive Gram-Negative
Positive (n = 11)
    Gram-positive (n = 9) 9 7 4†
    Gram-negative (n = 2) 2 0 2
Negative (n = 10) 9 4‡ 7‡
Total PCR positive 20 11 13
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×