November 2012
Volume 53, Issue 12
Free
Retina  |   November 2012
Development-Related Splicing Regulates Pituitary Adenylate Cyclase-Activating Polypeptide (PACAP) Receptors in the Retina
Author Affiliations & Notes
  • Mónika Lakk
    From the Department of Experimental Zoology and Neurobiology, University of Pécs, Pécs, Hungary; and the
  • Bence Szabó
    From the Department of Experimental Zoology and Neurobiology, University of Pécs, Pécs, Hungary; and the
  • Béla Völgyi
    From the Department of Experimental Zoology and Neurobiology, University of Pécs, Pécs, Hungary; and the
    Department of Ophthalmology, New York University School of Medicine, New York, New York.
  • Róbert Gábriel
    From the Department of Experimental Zoology and Neurobiology, University of Pécs, Pécs, Hungary; and the
  • Viktória Dénes
    From the Department of Experimental Zoology and Neurobiology, University of Pécs, Pécs, Hungary; and the
  • Corresponding author: Viktória Dénes, Department of Experimental Zoology and Neurobiology, University of Pécs, H-7601 Pécs, Ifjúság Street 6, Hungary; vdenes@gamma.ttk.pte.hu
Investigative Ophthalmology & Visual Science November 2012, Vol.53, 7825-7832. doi:10.1167/iovs.12-10417
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Mónika Lakk, Bence Szabó, Béla Völgyi, Róbert Gábriel, Viktória Dénes; Development-Related Splicing Regulates Pituitary Adenylate Cyclase-Activating Polypeptide (PACAP) Receptors in the Retina. Invest. Ophthalmol. Vis. Sci. 2012;53(12):7825-7832. doi: 10.1167/iovs.12-10417.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

Purpose.: The ubiquitous pituitary adenylate cyclase-activating peptide (PACAP) has a disparate array of functions in development (e.g., proliferation and apoptosis). Among three types of PACAP receptor (VPAC1, VPAC2, and PAC1), PAC1 is subject to alternative splicing that generates isoforms. Although the literature documenting the presence of PACAP receptors in the central nervous system is vast, their expression during development has not been established yet. Here, we performed quantitative analyses on the expression of PACAP receptors during the postnatal development of the rat retina.

Methods.: Retinas were harvested from postnatal days 0 to 20 (P0–P20). Using a comprehensive primer system, expression changes were followed employing quantitative real-time PCR. Changes at the protein level were detected by immunoblotting using anti-VPAC1, -VPAC2, and -PAC1 receptor antibodies.

Results.: The expression of VPAC1 showed increases at P10 and P15. Peaks in VPAC2 expression were observed at P5 and P15. Using splicing variant-specific primers for PAC1 receptor, splicing regulation of Null, Hip, Hop1, and Hiphop1 variants was revealed in correlation with postnatal development. Transcript levels of the Null and Hip variants showed a decline, while Hop1 became the major PACAP receptor by P20. Hiphop1 transcript levels did not display remarkable changes except for a transient increase at P10. Immunoblotting confirmed the presence and expression level changes of the receptors.

Conclusions.: We conclude that both VPAC1 and VPAC2 could have roles at all stages of retinal development, that PACAP acts through a specific set of PAC1 isoforms, and that Hip and Hop1 are predominantly involved in the postnatal development of rat retina.

Introduction
The pituitary adenylate cyclase-activating peptide (PACAP), a member of the secretin/glucagon/VIP family, is a ubiquitous and pleiotropic regulator with a wide range of biological effects (e.g., ontogenesis, pain, circadian rhythm, and behavior). PACAP functions as a hormone/trophic factor and neurotransmitter in the peripheral as well as in the central nervous system. 1 PACAP can exert its various effects via three different receptors: PAC1, VPAC1, and VPAC2. The VPAC1 and VPAC2 receptors exhibit equal affinities for both PACAP and vasoactive intestinal peptide (VIP), whereas the PAC1 receptor binds PACAP with a 100-fold higher affinity than VIP. 24 In rat, six splice variants of the PAC1 receptor have been identified (Null, Hip, Hop1, Hop2, Hiphop1, and Hiphop2), defined by the insertion of two different cassettes in the third intracellular loop. The Null, Hop1, and Hop2 isoforms trigger both adenylate cyclase (AC) and phospholipase C (PLC) activation, whereas the Hip variant activates AC exclusively. Combinations of both cassettes (Hiphop1 and Hiphop2) result in an intermediate phenotype. 5 In addition to the above-mentioned isoforms, two other PAC1 receptor variants (short and very short) have been described as lacking motifs within the extracellular N-terminal domain. 68 First and foremost, PACAP and its receptors have been a focus of neurotoxicity research 912 as a consequence of their strong antiapoptotic effect. However, the expression of both the PACAP gene and its receptors during ontogenesis suggests their involvement in developmental processes. 1315 In fact, a number of functional studies have verified that, in the central nervous system, PACAP contributes to cell proliferation, differentiation, apoptosis, and neurite outgrowth. 1619 Along with its antiapoptotic effect, PACAP can act as a mitogenic regulator, as well as an antimitogenic regulator. 1921 On one hand, it stimulates premature granule cells or PC12 cells to develop processes driving them into differentiation, 19,21 while on the other hand, endogenous PACAP also exerts a mitogenic function in chick neuroblasts or in 8-day-old cultured cerebellar neurons. 17,22 Evidently, the versatile and opposing effects correlate with differential expression of PAC1 receptor isoforms. Therefore, to investigate the roles of PACAP in any neural tissue, it is necessary to first identify the PACAP receptor subtypes expressed in the tissue of interest. 
The development of the complex, highly organized retina is an area of active research. The integration of retinal cells into functional circuits results from temporally overlapping processes (i.e., cell genesis, apoptosis, migration, and synaptogenesis) that are regulated by numerous intrinsic and extrinsic environmental factors. 2329 Although the presence of PACAP receptors and their isoforms in the mammalian retina has been described, 15,30 the physiological function of this peptide has not been established, nor has precise quantitative analysis of the PACAP receptor expression in the retina during postnatal development been carried out. 
The present study aimed to assess the expression levels of three PACAP receptors, PAC1, VPAC1, and VPAC2, to identify the PAC1 receptor splice variants, and to analyze their expression patterns during the developmental time course in the rat retina. We describe the presence and expression levels of the three major receptors, PAC1, VPAC1, and VPAC2, and four PAC1 receptor isoforms, Null, Hip, Hop1, and Hiphop1. We demonstrated for the first time that VPAC1 and VPAC2 receptor transcript levels change significantly during postnatal retina development. Our results also reveal unique expression profiles of Null, Hip, Hop1, and Hiphop1 receptor isoforms and their alterations during retina development. The results suggest a complex PAC1 splicing regulation that may contribute to the key mechanisms of retinal development. 
Methods
Animals and Tissue Preparation
Newborn (postnatal day 0 [P0]) and 1, 3, 5, 10, 15, and 20-day-old (postnatal days P1, P3, P5, P10, P15, and P20) albino Wistar rats were used for this study. Animal handling, housing, and experimental procedures were reviewed and approved by the ethical committee of the University of Pécs (BA02/2000-6/2006), and all animals were treated in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. Animals were anaesthetized by inhalation using isoflurane (Forane; Abbott Laboratories Ltd., Queenborough, UK) or by intraperitoneal injection of thiopental (50 mg/g) and then decapitated. Animals were always sacrificed in the same hour to prevent variations due to the circadian cycle. Eyes were removed, and retinas were dissected in cold phosphate-buffered saline. Upon dissection, tissues were frozen on dry ice and stored at −80 C° until RNA extraction. 
RNA Extraction and Reverse Transcription
For total RNA extraction and purification, homogenizer and spin columns (QIAshredder and RNeasy Plus Mini Kit; Qiagen, Valencia, CA) were used in accordance with the manufacturer's instructions. Total RNA was determined by measuring the optical density at 260 nm with a spectrophotometer (NanoDrop ND 1000; NanoDrop Technologies, Wilmington, DE). Purity was estimated by the absorption ratio at 260/280 nm, which was consistently higher than 1.8. Two micrograms of total RNA was converted into first-strand cDNA using oligo(dT) primer (Fermentas, Glen Burnie, MD) and reverse transcriptase (Maxima II; Fermentas). 
Reverse Transcription-Polymerase Chain Reaction (RT-PCR) and Primers
In order to increase specificity and yield, we employed a modification of RT- PCR called touchdown PCR in which the annealing temperature was gradually lowered to a more permissive temperature during the course of cycling, favoring amplification of the desired product. Amplification was carried out in a 25-μL reaction mixture containing 4 μL cDNA, 50 nM forward primer, 50 nM reverse primer, and PCR master mix (Maxima Hot Start PCR Master Mix; Fermentas). The primers used for the PCR reactions are listed in the Table. For VPAC1, VPAC2, and splice-independent PAC1, primers were designed close to the poly(A) tail on the 3′ noncoding area, whereas primers amplifying PAC1 receptor isoforms were designed to bridge the splice variant-specific exons inserted between exons 14 and 15 of the PAC1 receptor gene and their neighboring exon. 
The amplification products were analyzed by 1.5% agarose gel electrophoresis. Then, amplifications of the desired products were confirmed by sequencing. 
Quantitative Real-Time PCR
Real-time PCR was performed in a 25-μL reaction mixture containing 4 μL cDNA, 5 nM forward primer, 5 nM reverse primer, and 12.5 μL SYBR Green PCR Master Mix (Fermentas). Each sample was analyzed in triplicate. The 2−ΔΔCt (cycle threshold) method for relative quantification of gene expression was used to calculate mRNA expression levels. Fold changes were adjusted considering the efficiency of each primer pair as determined by the method of serial dilution. The P0 samples were used as a basis for relative quantitation results. To normalize fluorescence signals, RPL13a was utilized as an endogenous control. 
Western Blotting
Retinas were harvested from animals on P0, P1, P3, P5, P10, P15, and P20. For protein extraction, tissues were homogenized in 300 μL radioimmunoprecipitation assay (RIPA) buffer (10 mM phosphate buffer pH 7.2, 1% NP-40, 1% Na-deoxycholate, 0.1% SDS, 0.15 M NaCl, 2 mM EDTA, 2 μg/mL aprotinin, 0.5 μg/mL leupeptin, 2mM sodium vanadate, 20 mM sodium fluoride, 0.5 mM dithiothreitol, and 10 mM phenylmethylsulfonyl fluoride) with micropestles on ice for 5 minutes. Thereafter, samples were centrifuged and the supernatants saved. Protein concentration was determined by using a bicinchoninic acid protein assay kit (BCA Protein Assay Kit; Pierce, Rockford, IL). Sample preparation, buffer preparation, gel electrophoresis, and blotting were performed as provided in the NuPAGE Instruction Manual (Invitrogen, Carlsbad, CA). Approximately 25 to 30 μg protein/sample was loaded and run in 10% polyacrylamide gel. For PAC1 receptor detection, membranes were incubated in anti-PACAP receptor type 1 antibody (Pierce) diluted to 1:1000. The antibody recognizes the extracellular N-terminus of PAC1 receptor. For VPAC1 and VPAC2 receptor detection, primary antibodies (Pierce) were used in 1:200 and 1:500 dilution, respectively. The quantitative data were representative of three samples pooled from three animals at each time point. The data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression using mouse anti-GAPDH antibody (1:10,000) (Sigma-Aldrich, Budapest, Hungary). Anti-mouse and anti-rabbit IgG antibodies conjugated with horseradish peroxidase were diluted to 1:10,000. For signal detection, we used chemiluminescence reagent (Western Lightning Chemiluminescence Plus reagent; PerkinElmer, Waltham, MA). The chemiluminescent signal was captured either on high-sensitivity blue-tinted film (Kodak X-OMAT Blue Film XB; Sigma, Budapest, Hungary) or with an imaging system (FluorChem Q Imaging system; ProteinSimple, Santa Clara, CA). The latter allowed a precise and prompt quantification of the chemiluminescent signals. Quantitation analysis was performed using AlphaView Q software (ProteinSimple, Santa Clara, CA). 
Data Analysis
Data are expressed as means ± SD. In all cases, expression values of P0 retinas served as reference groups. Our goal was to identify groups whose means were significantly different from the mean of these reference groups. Therefore, the statistical comparisons were performed by one-way ANOVA analysis followed by post hoc Dunett's test, which is specifically designed for situations where all groups are pitted against one group. A P value of <0.05 was considered statistically significant. 
Results
Expression Profiles of PAC1, VPAC1, and VPAC2 Receptors
Changes of transcript level during postnatal development were compared to the P0 retina as a reference. First, we used primers specific for all PAC1 isoforms. However, no remarkable overall changes could be detected in PAC1 receptor message level (Fig. 1A). The only statistically significant elevation was measured at P1 (1.38 ± 0.07). In later developmental stages, at P3 (1.08 ± 0.24), P5 (0.89 ± 0.04), P10 (1.12 ± 0.13), P15 (0.83 ± 0.06), and P20 (1.04 ± 0.11), the ratio of PAC1 receptor expression relative to that at P0 was constant. 
Figure 1. 
 
Expression changes of the three major PACAP receptors during postnatal retinal development. (A) Results represent the mean fold changes in PAC1 receptor expression from P0 through P20. (B) Compared to P0, gene expression level of VPAC1 receptor displayed no changes at P1 and P5; thereafter it rose, peaking at P15. (C) VPAC2 receptor expression was characterized by a slight and a stronger amount of upregulation at P5 and P15, respectively. Asterisks indicate statistically significant changes (P ≤ 0.05).
Figure 1. 
 
Expression changes of the three major PACAP receptors during postnatal retinal development. (A) Results represent the mean fold changes in PAC1 receptor expression from P0 through P20. (B) Compared to P0, gene expression level of VPAC1 receptor displayed no changes at P1 and P5; thereafter it rose, peaking at P15. (C) VPAC2 receptor expression was characterized by a slight and a stronger amount of upregulation at P5 and P15, respectively. Asterisks indicate statistically significant changes (P ≤ 0.05).
In regard to VPAC1 (Fig. 1B), no significant increase was observed as early as P1 (1.06 ± 0.43) and P5 (1.42 ± 0.61), whereas an upregulation was detected at P10 (2.15 ± 0.53). The expression of VPAC1 receptor further increased at P15 (2.61 ± 0.39). Afterwards, a marked but not statistically significant downregulation could be seen at P20 (1.58 ± 0.45). 
The expression pattern of VPAC2 appeared to be biphasic (Fig. 1C). There was a moderate peak at P5 (3.14 ± 0.14) and another more significant increase at P15 (7.16 ± 2.13); VPAC2 was still elevated at P20 (5.12 ± 2.09) as well. 
Identification of PAC1 Receptor Splicing Variants
Using splice variant-specific primers, a sensitive RT-PCR was utilized to reveal the set of PAC1 isoforms expressed in rat retina. Four time points were chosen (i.e., P0, P5, P15, and P20) in order to cover the postnatal development proportionally. At P0 and P5, Null, Hip, Hop1, and Hiphop1 splice variants were detected (Figs. 2A, 2B). At P15, Null, Hip, and Hop1 displayed expression similar to the levels in the earlier stages, whereas Hiphop1 could be seen only as a faint band (Fig. 2C). Expression of Hip seemed to have ceased by P20 (Fig. 2D). Nontemplate controls are shown in Fig. 2E. 
Figure 2. 
 
Detection of PAC1 receptor isoforms in the developing retina. (A, B) At P0 and P5, expression of Null, Hip, Hop1, and Hiphop1 splice variants was detected by RT-PCR. (C) At P15, Null, Hip, and Hop1 were present in amounts similar to earlier stages, whereas Hiphop1 was hardly represented at this time point. (D) In the mature retina, expression of Hip was negligible, whereas Null, Hop1, and Hiphop1 could be detected. Nontemplate controls are shown in (E).
Figure 2. 
 
Detection of PAC1 receptor isoforms in the developing retina. (A, B) At P0 and P5, expression of Null, Hip, Hop1, and Hiphop1 splice variants was detected by RT-PCR. (C) At P15, Null, Hip, and Hop1 were present in amounts similar to earlier stages, whereas Hiphop1 was hardly represented at this time point. (D) In the mature retina, expression of Hip was negligible, whereas Null, Hop1, and Hiphop1 could be detected. Nontemplate controls are shown in (E).
Expression Patterns of PAC1 Receptor Splice Variants on the Developmental Time Scale
Results obtained from the touchdown PCR indicated that the expression of the individual PAC1 receptor isoforms might display unique profiles. Although RT-PCR is a sensitive method to amplify the desired products, it is not an adequate tool for quantification. Therefore, expression changes were mapped by employing quantitative real-time PCR. 
As a first approach, retinas harvested at P0 were used as reference samples. Consequently, the expression of each PAC1 isoform depicted in Figure 3 was related to its level measured at P0. The Null isoform showed no impressive changes at P1 (1.37 ± 0.06) or P3 (0.9 ± 0.02) but then manifested a decline from P5 (0.64 ± 0.07) to P10 (0.55 ± 0.13), and the message level fell at P15 (0.13 ± 0.02) (Fig. 3A). The Hip isoform had a similar expression pattern (Fig. 3B), with a peak at P1 (1.67 ± 0.29), followed by continuous downregulation by P20 (0.39 ± 0.15). The lowest expression level was detected at P15 (0.15 ± 0.01). The expression levels of the Hop1 splice variant did not change at P1 (1.41 ± 0.07), P3 (1.19 ± 0.01), or P5 (1.46 ± 0.02), but thereafter, the Hop1 message level showed significant increases at P10 (3.33 ± 0.42), P15 (3.35 ± 0.41), and P20 (6.94 ± 1.54) (Fig. 3C). The expression analysis of the Hiphop1 isoform showed one prominent but not statistically significant peak at P10 (5.54 ± 1.06) (Fig. 3D). 
Figure 3. 
 
Changes in the expression profiles of PAC1 receptor isoforms during postnatal retinal development. Expression level measured at P0 served as a reference in the case of each isoform. (A, B) Declines are seen in the expression of both Null and Hip isoforms during postnatal development. (C) In contrast, expression levels of the Hop1 splice variant increase significantly from P10 through P20. The unique expression profile of the Hiphop1 isoform, with a marked elevation at P10, is depicted in (D). Asterisks indicate statistically significant changes (P ≤ 0.05).
Figure 3. 
 
Changes in the expression profiles of PAC1 receptor isoforms during postnatal retinal development. Expression level measured at P0 served as a reference in the case of each isoform. (A, B) Declines are seen in the expression of both Null and Hip isoforms during postnatal development. (C) In contrast, expression levels of the Hop1 splice variant increase significantly from P10 through P20. The unique expression profile of the Hiphop1 isoform, with a marked elevation at P10, is depicted in (D). Asterisks indicate statistically significant changes (P ≤ 0.05).
Ratios of PAC1 Splice Variant Expression in Developmental Stages
Once the expression profile of each individual PAC1 isoform was determined, we investigated the expression of the isoforms in relation to the Null isoform at each time point to reveal the ratios between the PAC1 isoforms. Since the previous experiment showed that none of the isoforms appeared to change between P3 and P5, we investigated only the following time points: P0, P1, P10, P15, and P20. In early development, the Hip splice variant was expressed to the greatest extent at P0 (10.6 ± 3.41) and P1 (5.00 ± 0.64) (Figs. 4A, 4B). The Hop1 transcript became dominant at P10 (14.75 ± 1.15) (Fig. 4C) and P15 (54.49 ± 2.9) (Fig. 4D) and reached its highest level at P20 (80.6 ± 9.59) (Fig. 4E). Although the Hiphop1 variant displayed considerable elevation at P10 compared to its level at P0, among the PACAP variants, it was present in rat retina in the smallest amount. Looking at any time point from P0 to P20, the Hiphop1 message level was lower than that of any other isoform (Figs. 4A–E). 
Figure 4. 
 
Ratios of the different PAC1 receptor isoforms in developmental stages. Expression of the Null isoform served as a reference in all time points. (A, B) Among the four isoforms, the Hip splice variant was expressed to the greatest extent at P0 and P1. (CE) The expression of the Hop1 transcript became dominant in later developmental stages. Its prevalent expression was maintained from P10 through P20. Note that Hiphop1 mRNA, compared to the other PAC1 isoforms, was represented in the smallest amount during retinal development. Asterisks indicate statistically significant changes (P ≤ 0.05).
Figure 4. 
 
Ratios of the different PAC1 receptor isoforms in developmental stages. Expression of the Null isoform served as a reference in all time points. (A, B) Among the four isoforms, the Hip splice variant was expressed to the greatest extent at P0 and P1. (CE) The expression of the Hop1 transcript became dominant in later developmental stages. Its prevalent expression was maintained from P10 through P20. Note that Hiphop1 mRNA, compared to the other PAC1 isoforms, was represented in the smallest amount during retinal development. Asterisks indicate statistically significant changes (P ≤ 0.05).
Detection of PACAP Receptor Proteins in the Rat Retina
To confirm the up- or downregulation of mRNA, immunoblotting with specific antibodies was performed. Unfortunately, there are no commercially available antibodies against PAC1 splice variants. However, due to the presence or absence of the cassettes inserted into the third intracellular loop, isoforms can be separated by polyacrylamide gel electrophoresis. The PAC1 receptor antibody used in our experiments recognizes the extracellular N-terminal sequence; consequently, it binds to all isoforms of the PAC1 receptor that share an identical N-terminal sequence. Since Hop1 and Hip variants have the same molecular mass (56 kDa), they could not be separated, and bands show an additive expression of Hip and Hop1 isoforms (Fig. 5A, tagged as 2). An upregulation of the PAC1 receptor was clearly demonstrated at P15 and P20. Our antibody labeled a protein with the molecular mass of the Null isoform (53 kDa) as well (Fig. 5A, 3), which disappeared by P15 and P20. Evidently, the band around 59 kDa corresponded with the largest PAC1 isoform, namely Hiphop1 (Fig. 5A, 1). The Western blot result showed the presence of the Hiphop1 protein at all time points. 
Figure 5. 
 
Detection of three major PACAP receptor proteins during postnatal retinal development. The bands of GAPDH (37 kDa) used as internal control are shown in the lower row of all panels. (A) Bands that appeared around 75 kDa were identified as Hiphop1 isoform (1), whereas both Hip and Hop1 proteins (2) migrated beneath Hiphop1. The smallest bands, representing the Null isoform (3), gradually disappear during the time course. (B) The amount of VPAC1 receptor protein (47–55 kDa) seems to be unaltered during maturation. (C) Immunoblotting shows that VPAC2 protein (65 kDa) was present in all developmental stages, displaying no changes in its expression. Normalized relative changes (%) in protein level of VPAC1 and −2 are indicated above the experimental bands.
Figure 5. 
 
Detection of three major PACAP receptor proteins during postnatal retinal development. The bands of GAPDH (37 kDa) used as internal control are shown in the lower row of all panels. (A) Bands that appeared around 75 kDa were identified as Hiphop1 isoform (1), whereas both Hip and Hop1 proteins (2) migrated beneath Hiphop1. The smallest bands, representing the Null isoform (3), gradually disappear during the time course. (B) The amount of VPAC1 receptor protein (47–55 kDa) seems to be unaltered during maturation. (C) Immunoblotting shows that VPAC2 protein (65 kDa) was present in all developmental stages, displaying no changes in its expression. Normalized relative changes (%) in protein level of VPAC1 and −2 are indicated above the experimental bands.
To validate our quantitative PCR results on the protein level, immunoblotting was carried out. The Western blot results for VPAC1 receptor (47–55 kDa) expression are shown in Figure 5B. The appearance of multiple bands is the result of glycolization of the receptor's N-terminal sequence. Consistent with the gene expression, VPAC1 receptor protein could be detected at all selected time points. However, the amount of the VPAC1 receptor appeared to display no changes during postnatal retinal development. For quantification, the most intense bands that appeared around 50 kDa were scanned. In Figure 5C, changes in the VPAC2 (65 kDa) protein level are depicted. Similar to VPAC1, VPAC2 receptor appears to be expressed in the newborn as well as in the adult retina. VPAC2 expression showed no significant changes from P0 through P20. 
Discussion
In a wide range of vertebrate species, the expression of the PACAP receptors starts in embryonic stages and continues to be present in the central nervous system through postnatal development. 13,14,31,32 As a result of alternative splicing, nine isoforms of the PAC1 receptor can be involved in developmental processes. 6,7,33 In fact, PACAP exerts diverse, occasionally opposing effects on the developmental processes. Depending on the type of the PAC1 receptor isoform, PACAP can induce precursor cells to exit the cell cycle through activation of the Null isoform 34 or can promote proliferation in neuroblasts that express the Hop isoform. 20 Therefore, the expression pattern of PACAP receptors during postnatal development could determine the effect of their ligand. Changes in PAC1 isoform expression have been reported in the cerebellum and suprachiasmatic nucleus, as well as in the cortex. 30,35,36 However, very little information describing the expression of PACAP receptors in the developing mammalian retina can be found, which provides the rationale for our study. Therefore, we harvested retina tissues on P0, P1, P3, P5, P10, P15, and P20, covering all important developmental stages, to assess the expression changes of the major PACAP receptors. 
Dynamic Changes of PAC1 Receptor Isoforms through Postnatal Retina Development
According to a recent study, PACAP and PAC1 could be detected as early as E16 in the rat retina and they continued to be expressed throughout postnatal development. 15 Among the PAC1 receptor isoforms, the presence of Hop1 transcript has been reported in adult rat retina only, 30 and no quantitative data are available from newborn or developing tissue. In the present study, we not only demonstrated the presence of PAC1 receptors in different developmental stages of the postnatal rat retina but we showed that for quantification of PAC1 receptor expression, the existence of PAC1 receptor isoforms must be taken into account. Primers amplifying all isoforms of PAC1 receptor are not adequate to detect expression changes since the fall in message level of one may be compensated by the rise in another. We found that in the newborn rat retina (e.g., P0 and P1), four PAC1 receptor isoforms, namely, Null, Hip, Hop1, and Hiphop1, were expressed. The dominant isoform at this age was the Hip receptor; however, the message level of this isoform appeared to drop at P5 and its expression was downregulated in the mature retina (e.g., P15 and P20). A similar decline was seen for the Null isoform. The seven cell types which later comprise the adult retina can be characterized by an individual proliferation peak from P0 through P6. 23,28,37 Concurrently, the newborn, postmitotic cells migrate radially, as well as tangentially, to find their destined location. 38,39 In order to establish the proper cell number, many of the postmitotic cells undergo apoptosis, which sweeps through the developing retina in two waves. 24,40,41 The enhanced expression of Hip and Null receptor at this period indicates that these splice variants might be involved in regulating the early developmental processes mentioned above. It is noteworthy that the Null receptor engages dual signaling cascades, activating both AC- and PLC-coupled pathways and intracellular Ca2+ elevation, whereas Hip is coupled only to the AC pathway. 42 Therefore, it is reasonable to assume that these two receptor types might mediate different responses in the developing rat retina. It is important to point out that in spite of their lower expression, a functional role for the other PAC1 isoforms (e.g., Hop1 and Hiphop1) expressed at these time points cannot be excluded. Furthermore, our results showed a splice isoform switching, estimated to occur between P5 and P10, close to the time of eye opening that is scheduled between P10 and P15. In this period, the Hop1 isoform, which is known to have a higher potency for generating cAMP or increase intracellular Ca2+ level than Null or Hip receptors, became the dominant isoform. 42,43 It seems that the period of neurite outgrowth and synapse formation of the inner plexiform layer (IPL) from P3 to P10 44 coincide with an increasing Hop1 expression. Furthermore, the formation of functional neuronal circuitries occurs between P10 and P15. 25,27,44,45 Our finding that a prevalent expression of Hop1 receptors was maintained from P10 through P20 suggests a late-phase role for this particular isoform in the postnatal retina development. Similar to Hop1, a marked but transient upregulation of the Hiphop1 variant was also found to coincide with eye opening. We note that the expression of this particular isoform varied greatly among the samples harvested at the same time points. Moreover, in spite of a prominent peak that appeared at P10, a variable upregulation was measured in all selected stages. Considering that the literature providing data about the Hiphop1 isoform is relatively sparse, the functional role of this particular PAC1 isoform remains to be defined. However, based on our findings, we speculate that Hiphop1 expression might be coupled to special physiological conditions (i.e., nutritional status or hypoxia) or that it might be determined by the genetic background of the individual animals. In addition, Hiphop1 expression seems to be affected by the PACAP level itself, since intravitreal injection of a potent PAC1 antagonist, PACAP6-38, increases the expression of Hiphop1 receptor (unpublished data). 
Since the transcript level might not correlate with protein expression, it was crucial to confirm the existence of PAC1 receptor protein by immunoblot assay. Although specific primary antibodies are not available for PAC1 receptor isoforms, based on their molecular masses, we could identify three bands of PAC1 receptor, suggesting the presence of PAC1 receptor splice variants at the protein level as well. 
Expression Patterns of VPAC1 and VPAC2 Receptors through Postnatal Retina Development
PACAP can act via PAC1, as well as VPAC receptors, which have affinity not only for PACAP but also for VIP. In fact, VPAC1 and −2 receptors are exclusively responsible for mediating the effect of the latter peptide, 46 and thus, their expression could be related to the presence of VIP. Like PACAP, VIP has been reported to stimulate cell division, differentiation, and growth through VPAC receptors in cultured tissues. 4749 With respect to retinal development, the paucity of detailed information on the expression patterns of VPAC1 and −2 receptors is striking. Our analysis revealed statistically significant yet slight increases in transcript levels of VPAC1 during postnatal development. VPAC1 receptor mRNA was first detected at P0, and its level showed modest peaks at P10 and P15. The latter data correlate temporally with the VIP ligand expression, which was first detected by in situ hybridization at P5 and seemed to peak at P15 in retinal amacrine cells. 50 However, our protein expression analysis of VPAC1 showed no convincing difference at either time point compared to the newborn retina, instead showing a uniformly enhanced expression of VPAC1 receptors. In the case of the VPAC2 receptor, we found that VPAC2 transcription also became more manifest in the late phase of retina maturation. Likewise, VPAC1 and VPAC2 protein levels did not show positive correlations with the expression of their messenger. The discrepancy between transcript and protein levels indicates either posttranscriptional regulation or fast cellular degradation of the VPAC receptors. Nevertheless, their enhanced expression in the postnatal retina suggests that VPAC1 and −2 receptors could contribute to retinal development. 
In conclusion, in the present paper, we demonstrated that all receptors of the ubiquitous PACAP and VIP have different time courses of expression, and now it remains to be tested how one or more of them influence development. It is important to point out that in order to study PAC1 receptor expression, one must take into account the existence of splice variants because, as indicated in our results, general PAC1 receptor primers are not adequate to analyze expression changes. Since each PAC1 receptor isoform displays a unique expression profile, we suggest that selective splicing and expression of PAC1 receptor may be a pivotal component of developmental processes. Considering that PAC1 isoforms induce different signaling pathways, their combination or changes in their coexpression in relation to evoked responses could be critical. The observations that the receptors displayed enhanced and differential expression in different stages of the postnatal retina ontogenesis suggest a versatile physiological role for both PACAP and VIP throughout retinal development. 
Table. 
 
Primer Sequences Used for PCR Analysis
Table. 
 
Primer Sequences Used for PCR Analysis
Name Forward Primer (5′–3′) Reverse Primer (5′–3′)
PAC1 CTTCCAGGGCTTTGTGGTGG TGCTCTTGCTCAGGATGGA
Null GGGACACCTACTGTGTGTGTAA GGCCAGCCGTAAGTAGATGC
Hip GCATTCACCCCCTTTCCTACG CCTCCCCATTCAGGAAGCAG
Hop1 CGAGTCCAGCATCTACTTCAGC CACAAGTCTTTCCCTCTTGCTGACG
Hiphop1 CAACGAGTCCAGCATCTACTTCTG CACAAGTCTTTCCCTCTTGCTGACG
VPAC1 GCATTCACCCCCTTTCCTCTG CACAAGTCTTTCCCTCTTGCTGACG
VPAC2 CCCCTTTGGAAGGAACAGTGAG CCCCTTCCCCCAGAGAGATAA
RPL13a CCAGAGGTTTTGGGGTCAGAA GCAGTTGCAGACAAACTGGAGG
Acknowledgments
The authors thank Paul Witkovsky (New York University, New York, NY), who improved the language of our manuscript and provided useful critical comments, Csaba Fekete (University of Pécs, Hungary) for technical advice and support, and Peter Kisfali (University of Pécs, Hungary) for performing DNA sequencing. 
References
Vaudry D Falluel-Morel A Bourgault S Pituitary adenylate cyclase-activating polypeptide and its receptors: 20 years after the discovery. Pharmacol Rev . 2009;61:283–357. [CrossRef] [PubMed]
Gottschall PE Tatsuno I Miyata A Arimura A. Characterization and distribution of binding sites for the hypothalamic peptide, pituitary adenylate cyclase-activating polypeptide. Endocrinology . 1990;127:272–277. [CrossRef] [PubMed]
Lam HC Takahashi K Ghatei MA Kanse SM Polak JM Bloom SR. Binding sites of a novel neuropeptide pituitary-adenylate-cyclase-activating polypeptide in the rat brain and lung. Eur J Biochem . 1990;193:725–729. [CrossRef] [PubMed]
Harmar AJ Arimura A Gozes I International Union of Pharmacology. XVIII. Nomenclature of receptors for vasoactive intestinal peptide and pituitary adenylate cyclase-activating polypeptide. Pharmacol Rev . 1998;50:265–270. [PubMed]
Dickson L Finlayson K. VPAC and PAC receptors: from ligands to function. Pharmacol Ther . 2009;121:294–316. [CrossRef] [PubMed]
Pantaloni C Brabet P Bilanges B Alternative splicing in the N-terminal extracellular domain of the pituitary adenylate cyclase-activating polypeptide (PACAP) receptor modulates receptor selectivity and relative potencies of PACAP-27 and PACAP-38 in phospholipase C activation. J Biol Chem . 1996;271:22146–22151. [CrossRef] [PubMed]
Dautzenberg FM Mevenkamp G Wille S Hauger RL. N-terminal splice variants of the type I PACAP receptor: isolation, characterization and ligand binding/selectivity determinants. J Neuroendocrinol . 1999;11:941–949. [CrossRef] [PubMed]
Ushiyama M Ikeda R Sugawara H Differential intracellular signaling through PAC1 isoforms as a result of alternative splicing in the first extracellular domain and the third intracellular loop. Mol Pharmacol . 2007;72:103–111. [CrossRef] [PubMed]
Vaudry D Rousselle C Basille M Pituitary adenylate cyclase-activating polypeptide protects rat cerebellar granule neurons against ethanol-induced apoptotic cell death. Proc Natl Acad Sci U S A . 2002;99:6398–6403. [CrossRef] [PubMed]
Dohi K Mizushima H Nakajo S Pituitary adenylate cyclase-activating polypeptide (PACAP) prevents hippocampal neurons from apoptosis by inhibiting JNK/SAPK and p38 signal transduction pathways. Regul Pept . 2002;109:83–88. [CrossRef] [PubMed]
Tamas A Gabriel R Racz B Effects of pituitary adenylate cyclase activating polypeptide in retinal degeneration induced by monosodium-glutamate. Neurosci Lett . 2004;372:110–113. [CrossRef] [PubMed]
Dejda A Jolivel V Bourgault S Inhibitory effect of PACAP on caspase activity in neuronal apoptosis: a better understanding towards therapeutic applications in neurodegenerative diseases. J Mol Neurosci . 2008;36:26–37. [CrossRef] [PubMed]
Alexandre D Alonzeau J Bill BR Ekker SC Waschek JA. Expression analysis of PAC1-R and PACAP genes in zebrafish embryos. J Mol Neurosci . 43:94–100. [CrossRef] [PubMed]
Basille M Vaudry D Coulouarn Y Comparative distribution of pituitary adenylate cyclase-activating polypeptide (PACAP) binding sites and PACAP receptor mRNAs in the rat brain during development. J Comp Neurol . 2000;425:495–509. [CrossRef] [PubMed]
Njaine B Martins RA Santiago MF Linden R Silveira MS. Pituitary adenylyl cyclase-activating polypeptide controls the proliferation of retinal progenitor cells through downregulation of cyclin D1. Eur J Neurosci . 2010;32:311–321. [CrossRef] [PubMed]
Meyer DK. The effects of PACAP on neural cell proliferation. Regul Pept . 2006;137:50–57. [CrossRef] [PubMed]
Vaudry D Gonzalez BJ Basille M Fournier A Vaudry H. Neurotrophic activity of pituitary adenylate cyclase-activating polypeptide on rat cerebellar cortex during development. Proc Natl Acad Sci U S A . 1999;96:9415–9420. [CrossRef] [PubMed]
Scharf E May V Braas KM Shutz KC Mao-Draayer Y. Pituitary adenylate cyclase-activating polypeptide (PACAP) and vasoactive intestinal peptide (VIP) regulate murine neural progenitor cell survival, proliferation, and differentiation. J Mol Neurosci . 2008;36:79–88. [CrossRef] [PubMed]
Gonzalez BJ Basille M Vaudry D Fournier A Vaudry H. Pituitary adenylate cyclase-activating polypeptide promotes cell survival and neurite outgrowth in rat cerebellar neuroblasts. Neuroscience . 1997;78:419–430. [CrossRef] [PubMed]
Lu N Zhou R DiCicco-Bloom E. Opposing mitogenic regulation by PACAP in sympathetic and cerebral cortical precursors correlates with differential expression of PACAP receptor (PAC1-R) isoforms. J Neurosci Res . 1998;53:651–662. [CrossRef] [PubMed]
Deutsch PJ Sun Y. The 38-amino acid form of pituitary adenylate cyclase-activating polypeptide stimulates dual signaling cascades in PC12 cells and promotes neurite outgrowth. J Biol Chem . 1992;267:5108–5113. [PubMed]
Erhardt NM Sherwood NM. PACAP maintains cell cycling and inhibits apoptosis in chick neuroblasts. Mol Cell Endocrinol . 2004;221:121–134. [CrossRef] [PubMed]
Reese BE Colello RJ. Neurogenesis in the retinal ganglion cell layer of the rat. Neuroscience . 1992;46:419–429. [CrossRef] [PubMed]
Galli-Resta L Ensini M. An intrinsic time limit between genesis and death of individual neurons in the developing retinal ganglion cell layer. J Neurosci . 1996;16:2318–2324. [PubMed]
Sassoe-Pognetto M Wassle H. Synaptogenesis in the rat retina: subcellular localization of glycine receptors, GABA(A) receptors, and the anchoring protein gephyrin. J Comp Neurol . 1997;381:158–174. [CrossRef] [PubMed]
Galli-Resta L. Patterning the vertebrate retina: the early appearance of retinal mosaics. Semin Cell Dev Biol . 1998;9:279–284. [CrossRef] [PubMed]
Johnson J Tian N Caywood MS Reimer RJ Edwards RH Copenhagen DR. Vesicular neurotransmitter transporter expression in developing postnatal rodent retina: GABA and glycine precede glutamate. J Neurosci . 2003;23:518–529. [PubMed]
Rapaport DH Wong LL Wood ED Yasumura D LaVail MM. Timing and topography of cell genesis in the rat retina. J Comp Neurol . 2004;474:304–324. [CrossRef] [PubMed]
Malicki J. Cell fate decisions and patterning in the vertebrate retina: the importance of timing, asymmetry, polarity and waves. Curr Opin Neurobiol . 2004;14:15–21. [CrossRef] [PubMed]
D'Agata V Cavallaro S. Functional and molecular expression of PACAP/VIP receptors in the rat retina. Brain Res Mol Brain Res . 1998;54:161–164. [CrossRef] [PubMed]
Shuto Y Uchida D Onda H Arimura A. Ontogeny of pituitary adenylate cyclase activating polypeptide and its receptor mRNA in the mouse brain. Regul Pept . 1996;67:79–83. [CrossRef] [PubMed]
Erhardt NM Fradinger EA Cervini LA Rivier JE Sherwood NM. Early expression of pituitary adenylate cyclase-activating polypeptide and activation of its receptor in chick neuroblasts. Endocrinology . 2001;142:1616–1625. [PubMed]
Spengler D Waeber C Pantaloni C Differential signal transduction by five splice variants of the PACAP receptor. Nature . 1993;365:170–175. [CrossRef] [PubMed]
Lu N DiCicco-Bloom E. Pituitary adenylate cyclase-activating polypeptide is an autocrine inhibitor of mitosis in cultured cortical precursor cells. Proc Natl Acad Sci U S A . 1997;94:3357–3362. [CrossRef] [PubMed]
Ajpru S McArthur AJ Piggins HD Sugden D. Identification of PAC1 receptor isoform mRNAs by real-time PCR in rat suprachiasmatic nucleus. Brain Res Mol Brain Res . 2002;105:29–37. [CrossRef] [PubMed]
D'Agata V Cavallaro S Stivala F Canonico PL. Tissue-specific and developmental expression of pituitary adenylate cyclase-activating polypeptide (PACAP) receptors in rat brain. Eur J Neurosci . 1996;8:310–318. [CrossRef] [PubMed]
Morrow EM Chen CM Cepko CL. Temporal order of bipolar cell genesis in the neural retina. Neural Dev . 2008;3:2. [CrossRef] [PubMed]
Reese BE Galli-Resta L. The role of tangential dispersion in retinal mosaic formation. Prog Retin Eye Res . 2002;21:153–168. [CrossRef] [PubMed]
Cook JE Chalupa LM. Retinal mosaics: new insights into an old concept. Trends Neurosci . 2000;23:26–34. [CrossRef] [PubMed]
Pequignot MO Provost AC Salle S Major role of BAX in apoptosis during retinal development and in establishment of a functional postnatal retina. Dev Dyn . 2003;228:231–238. [CrossRef] [PubMed]
Perry VH Henderson Z Linden R. Postnatal changes in retinal ganglion cell and optic axon populations in the pigmented rat. J Comp Neurol . 1983;219:356–368. [CrossRef] [PubMed]
Holighaus Y Mustafa T Eiden LE. PAC1 hop, null and hip receptors mediate differential signaling through cyclic AMP and calcium leading to splice variant-specific gene induction in neural cells. Peptides . 2011;32:1647–1655. [CrossRef] [PubMed]
Lutz EM Ronaldson E Shaw P Johnson MS Holland PJ Mitchell R. Characterization of novel splice variants of the PAC1 receptor in human neuroblastoma cells: consequences for signaling by VIP and PACAP. Mol Cell Neurosci . 2006;31:193–209. [CrossRef] [PubMed]
Webster MJ Rowe MH. Disruption of developmental timing in the albino rat retina. J Comp Neurol . 1991;307:460–474. [CrossRef] [PubMed]
Grunder T Kohler K Guenther E. Distribution and developmental regulation of AMPA receptor subunit proteins in rat retina. Invest Ophthalmol Vis Sci . 2000;41:3600–3606. [PubMed]
Bagnoli P Dal Monte M Casini G. Expression of neuropeptides and their receptors in the developing retina of mammals. Histol Histopathol . 2003;18:1219–1242. [PubMed]
Gressens P Hill JM Gozes I Fridkin M Brenneman DE. Growth factor function of vasoactive intestinal peptide in whole cultured mouse embryos. Nature . 1993;362:155–158. [CrossRef] [PubMed]
Karacay B O'Dorisio MS Summers M Bruce J. Regulation of vasoactive intestinal peptide receptor expression in developing nervous systems. Ann N Y Acad Sci . 2000;921:165–174. [CrossRef] [PubMed]
Iwasaki Y Ikeda K Ichikawa Y Igarashi O. Vasoactive intestinal peptide influences neurite outgrowth in cultured rat spinal cord neurons. Neurol Res . 2001;23:851–854. [CrossRef] [PubMed]
Casini G Molnar M Brecha NC. Vasoactive intestinal polypeptide/peptide histidine isoleucine messenger RNA in the rat retina: adult distribution and developmental expression. Neuroscience . 1994;58:657–667. [CrossRef] [PubMed]
Footnotes
 Supported by the Hungarian Scientific Research Foundation (OTKA K 100144).
Footnotes
 Disclosure: M. Lakk, None; B. Szabó, None; B. Völgyi, None; R. Gábriel, None; V. Dénes, None
Figure 1. 
 
Expression changes of the three major PACAP receptors during postnatal retinal development. (A) Results represent the mean fold changes in PAC1 receptor expression from P0 through P20. (B) Compared to P0, gene expression level of VPAC1 receptor displayed no changes at P1 and P5; thereafter it rose, peaking at P15. (C) VPAC2 receptor expression was characterized by a slight and a stronger amount of upregulation at P5 and P15, respectively. Asterisks indicate statistically significant changes (P ≤ 0.05).
Figure 1. 
 
Expression changes of the three major PACAP receptors during postnatal retinal development. (A) Results represent the mean fold changes in PAC1 receptor expression from P0 through P20. (B) Compared to P0, gene expression level of VPAC1 receptor displayed no changes at P1 and P5; thereafter it rose, peaking at P15. (C) VPAC2 receptor expression was characterized by a slight and a stronger amount of upregulation at P5 and P15, respectively. Asterisks indicate statistically significant changes (P ≤ 0.05).
Figure 2. 
 
Detection of PAC1 receptor isoforms in the developing retina. (A, B) At P0 and P5, expression of Null, Hip, Hop1, and Hiphop1 splice variants was detected by RT-PCR. (C) At P15, Null, Hip, and Hop1 were present in amounts similar to earlier stages, whereas Hiphop1 was hardly represented at this time point. (D) In the mature retina, expression of Hip was negligible, whereas Null, Hop1, and Hiphop1 could be detected. Nontemplate controls are shown in (E).
Figure 2. 
 
Detection of PAC1 receptor isoforms in the developing retina. (A, B) At P0 and P5, expression of Null, Hip, Hop1, and Hiphop1 splice variants was detected by RT-PCR. (C) At P15, Null, Hip, and Hop1 were present in amounts similar to earlier stages, whereas Hiphop1 was hardly represented at this time point. (D) In the mature retina, expression of Hip was negligible, whereas Null, Hop1, and Hiphop1 could be detected. Nontemplate controls are shown in (E).
Figure 3. 
 
Changes in the expression profiles of PAC1 receptor isoforms during postnatal retinal development. Expression level measured at P0 served as a reference in the case of each isoform. (A, B) Declines are seen in the expression of both Null and Hip isoforms during postnatal development. (C) In contrast, expression levels of the Hop1 splice variant increase significantly from P10 through P20. The unique expression profile of the Hiphop1 isoform, with a marked elevation at P10, is depicted in (D). Asterisks indicate statistically significant changes (P ≤ 0.05).
Figure 3. 
 
Changes in the expression profiles of PAC1 receptor isoforms during postnatal retinal development. Expression level measured at P0 served as a reference in the case of each isoform. (A, B) Declines are seen in the expression of both Null and Hip isoforms during postnatal development. (C) In contrast, expression levels of the Hop1 splice variant increase significantly from P10 through P20. The unique expression profile of the Hiphop1 isoform, with a marked elevation at P10, is depicted in (D). Asterisks indicate statistically significant changes (P ≤ 0.05).
Figure 4. 
 
Ratios of the different PAC1 receptor isoforms in developmental stages. Expression of the Null isoform served as a reference in all time points. (A, B) Among the four isoforms, the Hip splice variant was expressed to the greatest extent at P0 and P1. (CE) The expression of the Hop1 transcript became dominant in later developmental stages. Its prevalent expression was maintained from P10 through P20. Note that Hiphop1 mRNA, compared to the other PAC1 isoforms, was represented in the smallest amount during retinal development. Asterisks indicate statistically significant changes (P ≤ 0.05).
Figure 4. 
 
Ratios of the different PAC1 receptor isoforms in developmental stages. Expression of the Null isoform served as a reference in all time points. (A, B) Among the four isoforms, the Hip splice variant was expressed to the greatest extent at P0 and P1. (CE) The expression of the Hop1 transcript became dominant in later developmental stages. Its prevalent expression was maintained from P10 through P20. Note that Hiphop1 mRNA, compared to the other PAC1 isoforms, was represented in the smallest amount during retinal development. Asterisks indicate statistically significant changes (P ≤ 0.05).
Figure 5. 
 
Detection of three major PACAP receptor proteins during postnatal retinal development. The bands of GAPDH (37 kDa) used as internal control are shown in the lower row of all panels. (A) Bands that appeared around 75 kDa were identified as Hiphop1 isoform (1), whereas both Hip and Hop1 proteins (2) migrated beneath Hiphop1. The smallest bands, representing the Null isoform (3), gradually disappear during the time course. (B) The amount of VPAC1 receptor protein (47–55 kDa) seems to be unaltered during maturation. (C) Immunoblotting shows that VPAC2 protein (65 kDa) was present in all developmental stages, displaying no changes in its expression. Normalized relative changes (%) in protein level of VPAC1 and −2 are indicated above the experimental bands.
Figure 5. 
 
Detection of three major PACAP receptor proteins during postnatal retinal development. The bands of GAPDH (37 kDa) used as internal control are shown in the lower row of all panels. (A) Bands that appeared around 75 kDa were identified as Hiphop1 isoform (1), whereas both Hip and Hop1 proteins (2) migrated beneath Hiphop1. The smallest bands, representing the Null isoform (3), gradually disappear during the time course. (B) The amount of VPAC1 receptor protein (47–55 kDa) seems to be unaltered during maturation. (C) Immunoblotting shows that VPAC2 protein (65 kDa) was present in all developmental stages, displaying no changes in its expression. Normalized relative changes (%) in protein level of VPAC1 and −2 are indicated above the experimental bands.
Table. 
 
Primer Sequences Used for PCR Analysis
Table. 
 
Primer Sequences Used for PCR Analysis
Name Forward Primer (5′–3′) Reverse Primer (5′–3′)
PAC1 CTTCCAGGGCTTTGTGGTGG TGCTCTTGCTCAGGATGGA
Null GGGACACCTACTGTGTGTGTAA GGCCAGCCGTAAGTAGATGC
Hip GCATTCACCCCCTTTCCTACG CCTCCCCATTCAGGAAGCAG
Hop1 CGAGTCCAGCATCTACTTCAGC CACAAGTCTTTCCCTCTTGCTGACG
Hiphop1 CAACGAGTCCAGCATCTACTTCTG CACAAGTCTTTCCCTCTTGCTGACG
VPAC1 GCATTCACCCCCTTTCCTCTG CACAAGTCTTTCCCTCTTGCTGACG
VPAC2 CCCCTTTGGAAGGAACAGTGAG CCCCTTCCCCCAGAGAGATAA
RPL13a CCAGAGGTTTTGGGGTCAGAA GCAGTTGCAGACAAACTGGAGG
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×