November 2013
Volume 54, Issue 12
Free
Cornea  |   November 2013
Development of Genetically Modified Eliminable Human Dermal Fibroblast Feeder Cells for Ocular Surface Regeneration Medicine
Author Affiliations & Notes
  • Yingli Li
    Department of Ophthalmology, Osaka University Medical School, Suita, Japan
  • Tomoyuki Inoue
    Department of Ophthalmology, Ehime University, Ehime, Japan
  • Fumihiko Takamatsu
    Department of Ophthalmology, Osaka University Medical School, Suita, Japan
  • Naoyuki Maeda
    Department of Ophthalmology, Osaka University Medical School, Suita, Japan
  • Yuichi Ohashi
    Department of Ophthalmology, Ehime University, Ehime, Japan
  • Kohji Nishida
    Department of Ophthalmology, Osaka University Medical School, Suita, Japan
  • Correspondence: Tomoyuki Inoue, Department of Ophthalmology, Ehime University School of Medicine, Shitsukawa, Toon-City, Ehime, 791-0295, Japan; tomonoue@m.ehime-u.ac.jp
Investigative Ophthalmology & Visual Science November 2013, Vol.54, 7522-7531. doi:10.1167/iovs.13-12870
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Yingli Li, Tomoyuki Inoue, Fumihiko Takamatsu, Naoyuki Maeda, Yuichi Ohashi, Kohji Nishida; Development of Genetically Modified Eliminable Human Dermal Fibroblast Feeder Cells for Ocular Surface Regeneration Medicine. Invest. Ophthalmol. Vis. Sci. 2013;54(12):7522-7531. doi: 10.1167/iovs.13-12870.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

Purpose.: Cultured human corneal limbal stem/progenitor cells are usually established and maintained on feeder layers. However, animal feeder cells are associated with viral infection, pathogen transmission, and xenogenic contamination. All feeder cells also can be mixed easily into cell-sheet production, causing self-contamination. We developed a line of labeled, immortalized, eliminable human dermal fibroblast cells to eliminate these problems.

Methods.: The enhanced green fluorescent protein gene, human-derived telomerase reverse transcriptase gene, and herpes simplex virus thymidine kinase gene were transfected into human dermal fibroblast cells to establish labeled, immortalized, eliminable feeder cells. Established eliminable dermal fibroblasts (TERT+TK-D) were treated with mitomycin, cocultured with human limbal stem/progenitor cells to regenerate epithelium sheets, and compared with 3T3 feeder cells.

Results.: Established TERT+TK-D feeder cells maintained immortalization, visualization, and eliminable characteristics during 6 months of continuous passages. The colony-forming efficiency of limbal stem/progenitor cells was similar in the TERT+TK-D group (11.77 ± 0.21%) and the 3T3 group (12.8 ± 1.61%) (P = 0.332). All cell sheets were well stratified into 4 to 5 layers. The TERT+TK-D group colonies and epithelial cell sheets showed weaker staining of corneal epithelium differentiation marker K3 than the 3T3 group and quantitative analysis of mRNA transcripts. Moreover, PCR analysis against the long terminal repeat sequence of the lentiviral vector integrated into the genetically modified feeder cells showed no contamination of ganciclovir-treated regeneration epithelial sheets.

Conclusions.: Genetically modified, labeled, immortalized, eliminable human dermal feeder cells are promising substitutes for 3T3 feeder cells for xenogeny-free ocular surface regeneration.

Introduction
Both limbal stem/progenitor cells and oral epithelial cells have been used successfully in ocular surface regeneration medicine to treat severe ocular surface disorders. 14 However, the murine 3T3 fibroblast feeder cells used in the technique can transmit murine diseases to patients. Recent reports have indicated that human embryonic stem cell lines cultured on murine feeder cells express the murine xenoantigen Neu5Gc and can induce immune reactions in humans. 5,6 Therefore, it is necessary to find an effective and safe human-derived feeder cell to substitute for the murine 3T3 cells. 
Several recent studies have reported that a promising alternative to murine 3T3 cells might be human dermal fibroblasts used as a feeder layer to coculture with limbal and oral epithelial cells, which have the ability to maintain the growth and stem cell characteristics of corneal and oral epithelium. 7,8 However, the finite proliferative lifespan of normal human cells cultured in vitro could prevent clinical application of dermal fibroblast feeder cells because of increasing workload and costs. Moreover, all kinds of feeder cells can mix easily into cell-sheet production, causing self-contamination. 
We have previously 9 developed a new culture technique of eliminable, feeder-assisted target cell-sheet production and reported the efficacy of the genetically modified human-derived feeder cell line with the properties of immortalization, labeling, and elimination. In the current study, our goal was to develop a genetically modified human dermal fibroblast feeder cell line with immortalization, labeling, and elimination characteristics. We compared the characteristics of the epithelial colonies and sheets that were cocultured with genetically modified dermal fibroblast cells and 3T3 fibroblast cells. We found that genetically modified dermal fibroblast cells maintained the ability to support limbal stem/progenitor cell growth and differentiation and prevented feeder cell self-contamination. The genetically modified, labeled, immortalized, eliminable human dermal feeder cell is a promising alternative for 3T3 feeder cells in the clinical application of xenogeny-free ocular surface regeneration. 
Methods
Development of Genetically Modified Dermal Fibroblast Feeder Cells
As previously described, 9 lentiviral vectors were constructed by using Gateway Technology (Invitrogen, Gaithersburg, MD). Replication-defective, self-inactivating lentiviral vectors with a phosphoglycerate kinase (PGK) promoter–neomycin resistance gene (pLentiNeo) or a PGK promoter–puromycin resistance gene (pLentiPuro) were prepared as destination vectors. The human-derived telomerase reverse transcriptase gene (TERT) and an internal ribosome entry site (IRES), enhanced green fluorescent protein gene (EGFP), were cloned into a pENTR1A vector (Invitrogen), resulting in pENTR-TERT-IRES-EGFP. The herpes simplex virus thymidine kinase gene (HSV-TK) was cloned into the pENTR1A vector, resulting in pENTR-TK. LR recombination reactions were performed with the entry vectors (pENTR-TERT-IRES-EGFP or pENTR-TK) and the destination vectors (pLentiNeo or pLentiPuro) to create lentiviral expression vectors pLenti-TERT-IRES-EGFP-Neo and pLenti-TK-Puro. The lentivirus was produced by cotransfecting 293T cells with the lentiviral expression vector Plp/VSVG (encoding the Varicella-Zoster virus (VZV)-G envelope protein) and the packaging constructs pLP1 and pLP2 (Invitrogen). Concentrated lentivirus was used to infect human dermal fibroblast cells. 
TERT+EGFP+TK-transduced dermal fibroblast cells were produced in 2 steps (Fig. 1). First, normal human dermal fibroblasts (KF-4009) (Kurabo, Osaka, Japan) were used for infection with lentivirus pLenti-TERT-IRES-EGFP-Neo and selected by 800 μg/mL G418 (Invitrogen) to produce TERT+EGFP-transduced dermal fibroblast cells. The TERT+EGFP-transduced dermal fibroblast cells then were used for infection with lentivirus pLenti-TK-Puro and selected by 1 μg/mL puromycin (Sigma, St. Louis, MO) to produce TERT+EGFP+TK-transduced dermal fibroblast cells (TERT+TK-D). Developed TERT+TK-D cells were maintained in Fibrolife S2 cell culture medium (Lifeline Cell Technology, Walkersville, MD) supplemented with 1% penicillin–streptomycin (Invitrogen). 
Figure 1
 
A flow chart of the development of TERT+TK-D feeder cells. TERT+TK-D feeder cells are produced in 2 steps. First, normal human dermal fibroblasts (D) are infected with lentivirus (pLenti-TERT-IRES-EGFP-Neo). After infection, selection by 800 μg/mL G418 is performed and TERT+EGFP-transduced human dermal fibroblasts are produced. Second, TERT+EGFP-transduced human dermal fibroblasts are infected with lentivirus (pLenti-TK-Puro). After infection, selection by 1 μg/mL puromycin is performed and TERT+EGFP+TK-transduced dermal fibroblasts (TERT+TK-D) are produced.
Figure 1
 
A flow chart of the development of TERT+TK-D feeder cells. TERT+TK-D feeder cells are produced in 2 steps. First, normal human dermal fibroblasts (D) are infected with lentivirus (pLenti-TERT-IRES-EGFP-Neo). After infection, selection by 800 μg/mL G418 is performed and TERT+EGFP-transduced human dermal fibroblasts are produced. Second, TERT+EGFP-transduced human dermal fibroblasts are infected with lentivirus (pLenti-TK-Puro). After infection, selection by 1 μg/mL puromycin is performed and TERT+EGFP+TK-transduced dermal fibroblasts (TERT+TK-D) are produced.
Ganciclovir Cytotoxicity
To evaluate the cytotoxicity of ganciclovir (GCV) (Invitrogen, San Diego, CA), TERT+TK-D cells were plated in 96-well plates at a density of 5000 cells/well. After 24 hours, the cells were treated with GCV at increasing concentrations (0, 5, 25, and 125 μg/mL) and incubated at 37°C in 5% CO2 for 1 to 6 days. Cellular viability was measured by using the Cell Counting Kit-8 (CCK-8; Dojindo, Tokyo, Japan) every 24 hours according to the manufacturer's protocol. Background referred to the absorbance of medium alone. Control referred to the absorbance in cells not treated with GCV. The cytotoxic effect was indicated as the percentage of surviving cells. 
Preparation of Feeder Layers
TERT+TK-D cells and 3T3 cells were inactivated mitotically by incubation with 8 μg/mL mitomycin C (MMC) (Kyowa Hakko, Tokyo, Japan) for 2 hours at 37°C. The cells were washed thoroughly and reseeded in 6-well plates or type I collagen gel (Collagen Gel Culturing Kit; Nitta Gelatin, Osaka, Japan)–coated Transwell inserts (Corning, Cambridge, MA) at 0.5 × 104 cells/cm2 (TERT+TK-D) or 2 × 104 cells/cm2 (3T3) as the feeder layers. 
Isolation of Limbal Epithelial Cells
Research corneas were obtained from the Northwest Lions Eye Bank (Seattle, WA). The endothelial cells were removed from the remaining corneal scleral rims after keratoplasty and then incubated with 2.4 U/mL Dispase solution (BD Biosciences, Bedford, MA) for 1 hour at 37°C and treated with 0.02% ethylenediaminetetraacetic acid (EDTA) solution (Nacalai Tesque, Kyoto, Japan) for 2 minutes at room temperature. The epithelial cells including the limbal zones were scraped with sterile surgical forceps. The collected cells were incubated with 0.25% trypsin-EDTA (Invitrogen, Grand Island, NY) for 15 minutes at 37°C. Obtained epithelial cells were suspended in keratinocyte culture medium (KCM) composed of Dulbecco's modified eagle medium and Ham's F12 medium (DMEM/F12, 3:1), 5% fetal bovine serum (FBS) (Invitrogen), 1 nM cholera toxin (Calbiochem, La Jolla, CA), 2 nM triiodothyronine (Takeda, Osaka, Japan), 0.4 μg/mL hydrocortisone (Kowa, Tokyo, Japan), 1% insulin-transferrin-selenium supplement (Invitrogen), 100 U/mL penicillin, and 100 μg/mL streptomycin (Invitrogen). Collected epithelial cells were used for a colony-forming assay or limbal epithelial cell-sheet regeneration. Our research adhered to the tenets of the Declaration of Helsinki. 
Colony-Forming Assay
Primary limbal epithelial cells were seeded at a density of 1000 cells/well in 6-well plates on MMC-treated TERT+TK-D or 3T3 feeder layers and incubated for 10 to 13 days as previously described. The colonies were fixed with 10% neutral buffered formalin and stained with 1% rhodamine B (Wako, Osaka, Japan). The colony-forming efficiency (CFE) was calculated as the percentage of colonies (or colony with a diameter > 2 mm) that formed divided by the total number of viable cells seeded. 
Preparation of Limbal Epithelial Cell Sheets
Primary limbal epithelial cells were inoculated on the feeder cells containing a collagen gel–coated Transwell insert at 1 to 2×105 cells/insert. The cells were submerged in a KCM culture for 12 days and then exposed to 25 μg/mL GCV KCM medium as air-lifting culture for 6 to 8 days to promote epithelial stratification. For the GCV-untreated TERT+TK-D feeder cell group, epithelial cell sheets were continuously maintained in KCM medium for air-lifting culture. The medium was changed every 2 days. 
Reverse Transcription–PCR and Quantitative PCR
Total RNA was extracted by using RNeasy Mini Kit (Qiagen, Valencia, CA), according to the manufacturer's instructions. Complementary DNAs (cDNAs) were synthesized from total RNA by using the first Strand cDNA Synthesis System (Origene, Rockville, MD) for PCR and quantitative PCR. The PCR procedure was as follows: initial denaturation of 94°C for 5 minutes, denaturation at 94°C for 30 seconds, extension of 60°C for 30 seconds, 72°C for 30 seconds, and a final extension of 10 minutes at 72°C for a total of 35 cycles. Polymerase chain reaction products were run on a 2% agarose gel and scanned by using an ultraviolet gel doc. The specific primers for PCR are listed in the Table. The expressions of various genes were normalized by using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an internal control. Quantitative PCR was carried out by using Taqman probes and the Applied Biosystems 7900 HT sequence detection system instrument (Applied Biosystems, Foster City, CA). The primers for ΔNp63 (Hs00978339_m1), keratin 3 (K3) gene (Hs00365080_m1), and GAPDH (Hs99999905_m1) were obtained from Applied Biosystems. The cycling conditions were 10 seconds at 95°C followed by 45 two-step cycles (15 seconds at 95°C and 1 minute at 60°C). The quantification data were analyzed by using the Sequence Detection System software (Applied Biosystems) with GAPDH as an internal control. The final results are expressed as the average value of 3 experiments. 
Table
 
Primers Used in Reverse Transcription–PCR
Table
 
Primers Used in Reverse Transcription–PCR
Gene Primer Sequence, 5′→3′ Product Size, bp
HGF Forward: GCCTGAAAGATATCCCGACA 523
Reverse: TTCCATGTTCTTGTCCCACA
KGF Forward: AGGCTCAAGTTGCACCAGGCA 495
Reverse: TGTGTGTCGCTCAGGGCTGGA
EPR Forward: AGGAGGATGGAGATGCTCTG 498
Reverse: TCAGACTTGCGGCAACTCTG
BDNF Forward: AACAATAAGGACGCAGACTT 222
Reverse: TGCAGTCTTTTTGTCTGCCG
bFGF Forward: AAGAGCGACCCTCACATCAAGCTA 236
Reverse: TACTGCCCAGTTCGTTTCAGTGC
N-cad Forward: CACCCAACATGTTTACAATCAACAATGAGAC 444
Reverse: CTGCAGCAACAGTAAGGACAAACATCCTATT
GAPDH Forward: TCCAGAACATCATCCCTGCCTCTA 255
Reverse: TGTTGAAGTCAGAGGAGACCACCTG
PCR Analysis of Feeder Cell Contamination
Portions of the GCV-treated and GCV-untreated TERT+TK-D feeder cell–cocultured epithelial sheets were harvested. Genome DNAs were extracted with QIAamp DNA Mini Kit (Qiagen) according to the manufacturer's instructions. The long terminal repeat (LTR) sequence, which is specific to the lentivirus vector, was integrated into the TERT+TK-D feeder cells. The following primers were used to target the LTR sequence: forward primer, 5′-AAGGGCTAATTCACTCCCAA-3′, and reverse primer, 5′-TGCGTCGAGAGAGCTCTGGTTT-3′, with the GAPDH sequence as an internal control. The PCR reaction was performed as previously described. 
Histology and Immunofluorescence Staining
Harvested cell sheets were embedded in Tissue-Tek OCT compound (Sakura Finechemical Co., Tokyo, Japan) for hematoxylin-eosin and immunofluorescence staining. Hematoxylin-eosin staining was performed according to standard protocols for histologic examination. For immunofluorescence staining, sections and cells were fixed in 4% paraformaldehyde at 4°C for 30 minutes followed by blocking in 4% nonfat milk and 0.3% Triton X-100 in phosphate-buffered saline (PBS) for 1 hour at room temperature. The samples then were incubated overnight at 4°C with the following primary antibodies: anti-K3 (AE5) (1:100; Progen Biotechnik, Heidelberg, Germany), anti–keratin12 (1:100; Santa Cruz Biotechnology, Santa Cruz, CA), and anti-P63 (4A4) (1:100; Santa Cruz Biotechnology). After washing with PBS, the samples were incubated for 1 hour with Alexa 568 or FITC-conjugated secondary antibody (1:200; Invitrogen) and finally counterstained with 4′,6-diamidino-2-phenylindole (Sigma) and viewed under a Zeiss fluorescence microscopy (Axiovert 200M; Carl Zeiss Jena Gmbh, Jena Germany). The same concentration of corresponding normal, nonspecific IgG was used as a negative control. 
Statistics
Statistical analysis was performed by using SPSS 16.0 software (SPSS, Inc., Chicago, IL). Data were analyzed by using an independent samples t-test; P < 0.05 was considered statistically significant. 
Results
Gene Expression Pattern of Human Dermal Fibroblasts
The gene expression pattern of dermal fibroblasts was similar to that of the corneal stromal fibroblasts (Fig. 2). They both expressed cytokine hepatocyte growth factor (HGF), keratinocyte growth factor (KGF), epiregulin (EPR), brain-derived neurotrophic factor (BDNF), fibroblast growth factor 2 (bFGF), and adhesion molecule N-cadherin (N-cad). 
Figure 2
 
Comparison of gene expression in in vitro cultured dermal fibroblasts and in corneal stromal fibroblasts by reverse transcription–PCR. Similar to corneal stromal cells, dermal fibroblasts express many factors to maintain stem/progenitor cells and epithelial cell growth. D, dermal fibroblasts; S, corneal stromal fibroblasts; NT, no reverse transcriptase.
Figure 2
 
Comparison of gene expression in in vitro cultured dermal fibroblasts and in corneal stromal fibroblasts by reverse transcription–PCR. Similar to corneal stromal cells, dermal fibroblasts express many factors to maintain stem/progenitor cells and epithelial cell growth. D, dermal fibroblasts; S, corneal stromal fibroblasts; NT, no reverse transcriptase.
Characteristics of TERT+TK-D Feeder Cells
After transducing the human-derived TERT gene, the EGFP gene, and the HSV-TK gene, the TERT+TK-D cells were developed. To test the immortalization ability of TERT+TK-D cells, genetically modified cells were continuously passaged for 6 months (>50 generations). After multiple passages, the cells still exhibited a fibroblast-like morphology like primary human dermal fibroblast cells (Fig. 3A), expressed green fluorescence under ultraviolet illumination (Fig. 3B), and were sensitive to GCV (Fig. 3C). Reverse transcription–PCR revealed expression of the TK gene and lentivirus vector special LTR sequence in TERT+TK-D cells but not in normal human dermal fibroblast cells (Fig. 3D). TERT+TK-D cells passaged over the long term, exceeding the normal lifespan, showed a vigorous ability to divide (Fig. 3E). A GCV cytotoxicity assay showed that the drug killed the TERT+TK-D cells in a dose-dependent manner. In the 25 μg/mL-GCV group, almost all cells were positive for apoptosis in 6 days (Fig. 3F). 
Figure 3
 
The characteristics of TERT+TK-D feeder cells. (A) The cell morphology of TERT+EGFP+TK-transduced human dermal fibroblast cells (TERT+TK-D). (B) TERT+TK-D feeder cells expressed green fluorescence under ultraviolet illumination. (C) The TERT+TK-D feeder cells are eliminated at day 6 by 25 μg/mL GCV. (D) The TK and LTR sequence are detected in TERT+TK-D feeder cells by PCR analysis, while dermal fibroblasts are not detected. (E) The cell growth curve of the TERT+TK-D feeder cells. (F) The sensitivity of the TERT+TK-D cells to a GCV assay shows that the minimal lethal dose of GCV is 25 μg/mL. TK, herpes simplex virus thymidine kinase. Scale bar: 200 μm.
Figure 3
 
The characteristics of TERT+TK-D feeder cells. (A) The cell morphology of TERT+EGFP+TK-transduced human dermal fibroblast cells (TERT+TK-D). (B) TERT+TK-D feeder cells expressed green fluorescence under ultraviolet illumination. (C) The TERT+TK-D feeder cells are eliminated at day 6 by 25 μg/mL GCV. (D) The TK and LTR sequence are detected in TERT+TK-D feeder cells by PCR analysis, while dermal fibroblasts are not detected. (E) The cell growth curve of the TERT+TK-D feeder cells. (F) The sensitivity of the TERT+TK-D cells to a GCV assay shows that the minimal lethal dose of GCV is 25 μg/mL. TK, herpes simplex virus thymidine kinase. Scale bar: 200 μm.
Colony-Forming Assay and Characterization
To compare the ability of TERT+TK-D and 3T3 cells to support colony formation, 3T3 feeder cells were divided into 2 groups at a density of 2 × 104 cells/cm2 (gold standard density) and 0.5 × 104 cells/cm2. At 10 to 13 days, the primary limbal stem/progenitor cells formed typical cell colonies in all groups (Figs. 4A, 4B). The TERT+TK-D group (CFE, 11.77 ± 0.21%) formed more colonies and typical epithelial cell morphology, in comparison with the 3T3 cell group with the same density (CFE, 5.7 ± 0.89%) (P < 0.001), and the same as the 2 × 104 cells/cm2 3T3 cell group (CFE, 12.8 ± 1.61%) (P = 0.332). More large colonies (diameter > 2 mm) formed in the TERT+TK-D group (diameter ≥ 2 mm; CFE, 3.37 ± 0.35%) than in the 0.5 × 104 cells/cm2 3T3 cell group (diameter ≥ 2 mm; CFE, 1.3 ± 0.26%) (P = 0.01) and in the 2 × 104 cells/cm2 3T3 cell group (diameter ≥ 2 mm, CFE, 2.07 ± 0.06%) (P = 0.03) (Fig. 4C). 
Figure 4
 
Colony-forming assay. Primary limbal epithelial cells form typical cell colonies on the genetically modified dermal fibroblast (TERT+TK-D) and 3T3 fibroblast feeder layers after 10 to 13 days' culture. (A, B) The TERT+TK-D group shows more colony formation and typical epithelial cell morphology, compared with the 3T3 cell group at the same density and 2 × 104 cells/cm2 3T3 cell group. (C) CFE analysis shows that the TERT+TK-D group forms more large colonies (diameter > 2 mm) and has a CFE similar to that of the 2 × 104 cells/cm2 3T3 cell group. Scale bar: 200 μm. *P < 0.05.
Figure 4
 
Colony-forming assay. Primary limbal epithelial cells form typical cell colonies on the genetically modified dermal fibroblast (TERT+TK-D) and 3T3 fibroblast feeder layers after 10 to 13 days' culture. (A, B) The TERT+TK-D group shows more colony formation and typical epithelial cell morphology, compared with the 3T3 cell group at the same density and 2 × 104 cells/cm2 3T3 cell group. (C) CFE analysis shows that the TERT+TK-D group forms more large colonies (diameter > 2 mm) and has a CFE similar to that of the 2 × 104 cells/cm2 3T3 cell group. Scale bar: 200 μm. *P < 0.05.
On the ninth day of culture, the limbal epithelial cell colonies were fixed and stained for immunofluorescence with corneal epithelium differentiation marker K3 and putative limbal stem/progenitor cell marker ΔNp63. Colonies were selected for measurement of the transcript levels of K3 and ΔNp63 by using quantitative real-time PCR analysis. The epithelial cells in both groups were positive for expression of K3 and ΔNp63 marker (Figs. 5A, 5B), while limbal epithelial cells in the TERT+TK-D group had less positive staining of K3 than the 3T3 group. Real-time PCR (Fig. 5C) confirmed that expression of K3 in the epithelial cells in the TERT+TK-D group was significantly lower (P = 0.01) than in the cells in the 3T3 group. However, no significant difference in ΔNp63 expression (P = 0.982) was detected. 
Figure 5
 
Characterization of limbal epithelial stem/progenitor colonies. (A) Compared with the 3T3 feeder cell group, coculture of limbal epithelial cells in the TERT+TK-D feeder cells group shows lower positive staining of differentiated corneal epithelial cell marker K3. (B) There is no significant difference in expression of limbal stem/progenitor cell marker ΔNp63 and (C) quantitative analysis of mRNA transcripts. Scale bar, 200 μm. *P < 0.05.
Figure 5
 
Characterization of limbal epithelial stem/progenitor colonies. (A) Compared with the 3T3 feeder cell group, coculture of limbal epithelial cells in the TERT+TK-D feeder cells group shows lower positive staining of differentiated corneal epithelial cell marker K3. (B) There is no significant difference in expression of limbal stem/progenitor cell marker ΔNp63 and (C) quantitative analysis of mRNA transcripts. Scale bar, 200 μm. *P < 0.05.
PCR Analysis of Feeder Cell Contamination
The flow chart shows the procedures for harvesting GCV-treated and GCV-untreated TERT+TK-D feeder cell–cocultured epithelial cell sheets (Fig. 6). Limbal epithelial cells cocultured with TERT+TK-D feeder layers were submerged in a KCM culture for 12 days and then submitted to a process referred to as air-lifting for 6 to 8 days to promote epithelial stratification. The epithelial cell sheets of the GCV-treated TERT+TK-D group were treated with 25 μg/mL GCV during the final 6 to 8 days to eliminate the feeder cells, while the epithelial cell sheets of the GCV-untreated TERT+TK-D feeder cell group were continuously maintained in KCM medium for air-lifting culture. Genome DNAs were extracted from GCV-treated and GCV-untreated TERT+TK-D feeder cell–cocultured epithelial cell sheets. Polymerase chain reaction analysis was performed to detect the LTR sequence, which is specific to the lentiviral vector and was integrated into the lentivirus-infected cells. Both cell sheets were positive for expression of the internal control GAPDH gene, but the LTR sequence was detected only in the GCV-untreated epithelial cell sheets. In the GCV-treated epithelial cell sheets, the lentiviral vector special sequence LTR was not detected (Fig. 7). 
Figure 6
 
A flow chart of the procedures for harvesting GCV-treated and GCV-untreated TERT+TK-D feeder cell–cocultured epithelial cell sheets. Primary limbal epithelial cells are inoculated on TERT+TK-D feeder cells containing a collagen gel–coated Transwell insert. The cells are submerged in a culture of 5% FBS-KCM for 12 days and then undergo the process of air-lifting for 6 days to promote epithelial stratification. For the GCV-treated group, 25 μg/mL of GCV is added to the medium during the last 6 to 8 days to kill the TERT+TK-D feeder cells. The harvested epithelium sheet after eliminating feeder cell layer can be easily peeled by using surgical forceps for transplantation or immunohistochemistry assay.
Figure 6
 
A flow chart of the procedures for harvesting GCV-treated and GCV-untreated TERT+TK-D feeder cell–cocultured epithelial cell sheets. Primary limbal epithelial cells are inoculated on TERT+TK-D feeder cells containing a collagen gel–coated Transwell insert. The cells are submerged in a culture of 5% FBS-KCM for 12 days and then undergo the process of air-lifting for 6 days to promote epithelial stratification. For the GCV-treated group, 25 μg/mL of GCV is added to the medium during the last 6 to 8 days to kill the TERT+TK-D feeder cells. The harvested epithelium sheet after eliminating feeder cell layer can be easily peeled by using surgical forceps for transplantation or immunohistochemistry assay.
Figure 7
 
PCR analysis of the LTR sequence. PCR is performed against an LRT sequence of lentiviral vector integrated into genetically modified feeder cells and a GAPDH sequence as a positive control. The LRT sequence is detected in the GCV-untreated TERT+TK-D feeder cell–cocultured epithelial cell sheet but not in the GCV-treated cocultured cell sheet.
Figure 7
 
PCR analysis of the LTR sequence. PCR is performed against an LRT sequence of lentiviral vector integrated into genetically modified feeder cells and a GAPDH sequence as a positive control. The LRT sequence is detected in the GCV-untreated TERT+TK-D feeder cell–cocultured epithelial cell sheet but not in the GCV-treated cocultured cell sheet.
Characterization of Cultured Limbal Epithelial Cell Sheets
Limbal stem/progenitor cells were cocultured with TERT+TK-D or 3T3 feeder cells to form epithelial cell sheets. The cells were submerged in a culture in KCM for 12 days and then underwent air-lifting in 25 μg/mL GCV KCM medium for 6 to 8 days to promote epithelial stratification. After 2 to 3 weeks' culture, both groups formed 4 to 5 layers of epithelial cell sheets (Fig. 8A). Limbal epithelial cells and 3T3 feeder cells grew well under 25 μg/mL GCV condition, which is a safety concentration for normal cells, whereas TERT+TK-D feeder cells in the TERT+TK-D group diminished in 6 days by ganciclovir treatment. Immunofluorescence analyses showed that the cell sheets in both groups expressed corneal epithelial cell differentiation marker K3 10 (Fig. 8B), putative corneal epithelial stem cell marker ΔNp63 11 (Fig. 8C), and corneal epithelium specific marker K12 12 (Fig. 8D). Compared with the 3T3 group, the epithelial cell sheets in the TERT+TK-D group had lower expression of K3 and higher expression of ΔNp63 in the basal and wing cells. No difference in K12 staining was detected. 
Figure 8
 
Characterization of cultured limbal epithelial cell sheets. (A) Both the TERT+TK-D cells and 3T3 cells support stratification of limbal epithelial cells after 2 to 3 weeks' culture. (A) The TERT+TK-D cells support formation of 4 to 5 layers of epithelium and 3T3 feeder cells. (B) Moreover, the epithelial cell sheet cocultured with the TERT+TK-D feeder cells has lower expression of K3 and (C) higher expression of ΔNp63 in both basal cells and wing cells. (D) The K12 staining does not differ significantly. Scale bar: 200 μm.
Figure 8
 
Characterization of cultured limbal epithelial cell sheets. (A) Both the TERT+TK-D cells and 3T3 cells support stratification of limbal epithelial cells after 2 to 3 weeks' culture. (A) The TERT+TK-D cells support formation of 4 to 5 layers of epithelium and 3T3 feeder cells. (B) Moreover, the epithelial cell sheet cocultured with the TERT+TK-D feeder cells has lower expression of K3 and (C) higher expression of ΔNp63 in both basal cells and wing cells. (D) The K12 staining does not differ significantly. Scale bar: 200 μm.
Discussion
Our results confirmed that genetically modified, immortalized, visualized, eliminable human dermal fibroblast feeder cells maintained the ability to support limbal stem/progenitor cell growth and differentiation and prevented feeder cell self-contamination. 
To avoid the use of animal-derived feeder cells, human-derived feeder cells, such as mesenchymal stem cells, 13,14 corneal stromal fibroblasts, 15,16 and dermal fibroblasts 7 have been studied widely as substitutes for 3T3 fibroblasts. Oie et al. 7 report that dermal fibroblasts have been used successfully in oral mucosal epithelial cell-sheet culture for ocular surface reconstruction. Sharma et al. 8 have compared human dermal fibroblasts and mesenchymal stem cells, with 3T3 fibroblasts, as feeder layers for the vivo expansion of human limbal and oral epithelium. The investigators have found that dermal fibroblasts are comparable to 3T3 fibroblasts and superior to mesenchymal stem cells in the cultivation of epithelium. In the current study, we found that the gene expression pattern of dermal fibroblasts was similar to that of corneal stromal fibroblasts. Dermal fibroblasts expressed many genes required for maintenance and proliferation of limbal epithelial cells like corneal stromal fibroblast cells, 17 that is, HGF, 18 KGF, 18 EPR, 19 BDNF, 20 bFGF, 21 and N-cad. 22 In a preliminary experiment, we also compared human dermal fibroblasts with corneal stromal fibroblasts and found that the CFE of the limbal stem/progenitor cells cocultured on dermal fibroblasts was significantly higher than on corneal stromal fibroblasts (data not shown). Therefore, human dermal fibroblasts could be a promising alternative to 3T3 fibroblasts. 
To use human dermal fibroblasts as feeder cells, the hTERT gene 23 was transduced into cells to prevent replicative senescence. In the current study, immortalized dermal fibroblast cells were maintained for more than 6 months (over 50 generations in in vitro culture). After extended continuous passaging, the cells still showed a vigorous ability to divide, visible under ultraviolet illumination, and were killed by GCV. Immortalization treatment greatly facilitates cellular storage and access, reducing the cost of primary culture and decreasing the risk of repeats using lentivirus. The TK gene 24 also was transduced into the hTERT and EGFP–transduced dermal fibroblast cells to eliminate unknown infections and contamination from xenogeneic feeder cells. In the current study, GCV-treated epithelial sheets, when cocultured with TERT+TK-D feeder cells, were uncontaminated by feeder cells, compared with GCV-untreated epithelial sheets, which were cultured under the same conditions by detecting the LTR sequence. The eliminable feeder cells are convenient for use whether they are mixed or in a contact culture system when feeder cells are needed. Moreover, the eliminable character of feeder cells also reduced the unknown risks induced by the transduced exogenous genes and increased the safety of using genetically modified cells. 
Sharma et al. 8 have compared normal human dermal fibroblasts with 3T3 feeder cells for the expansion of limbal epithelial cells. They found that colony-forming efficiency and stem cell marker expression of limbal epithelial cells on dermal fibroblasts are comparable to cells grown on 3T3 feeder cells. Our experiment showed that TERT, EGFP, and TK–transduced dermal fibroblast cells maintained the fibroblast morphology and vigorous dividing ability of the early-generation normal dermal fibroblast cells. The gene-modified dermal fibroblasts also maintained the same ability of supporting limbal epithelial cell growth as nonmodified dermal fibroblast cells. The epithelial cell sheets stratified into 4 to 5 layers on both the TERT+TK-D and 3T3 feeder layers. The CFE of the limbal stem/progenitor cells in the TERT+TK-D group was similar to that of the standard-density 3T3 group as reported previously. 8 Interestingly, the TERT+TK-D group formed more large colonies (diameter ≥ 2 mm) than the standard-density 3T3 group, and the CFE was higher than that of the same-density 3T3 group. Moreover, immunohistochemistry and real-time PCR analyses found that the TERT+TK-D group had lower expression of the corneal epithelium differentiation marker K3, compared with the 3T3 group, and the TERT+TK-D feeder cells better maintained the undifferentiated state of the epithelium. 
Bullock et al. 25 have recently reported using human dermal fibroblasts to develop xenobiotic-free human skin keratinocytes. Rodriguez-Piza et al. 26 have successfully derived primary cultures of human dermal fibroblasts under xeno-free conditions and showed that they can be used as both the cell source for induced pluripotent stem cell generation and as autologous feeder cells to support their growth. In the current study, we focused only on the development, characterization, and feeder effect of the genetically modified dermal fibroblasts. The current results suggest that genetically modified dermal fibroblasts maintain the feeder effect and become more convenient, economical, and safer. Future research should be performed under xeno-free conditions by substituting commonly used ingredients with products of human origin, such as human serum instead of FBS. 27 Meanwhile, the use of genetically modified dermal fibroblasts should be investigated widely in other regenerative treatments, for example, in coculture with oral epithelial cells or keratinocytes. 
In summary, we developed genetically modified, labeled, immortalized, and eliminable human dermal fibroblast feeder cells and confirmed that their use is effective and safe. These findings suggest that genetically modified feeder cells could be a promising alternative feeder for human regeneration medicine. 
Acknowledgments
Supported partially by Grant-in-Aid for Scientific Research (TI). The authors alone are responsible for the content and writing of the paper. 
Disclosure: Y. Li, None; T. Inoue, P; F. Takamatsu, None; N. Maeda, None; Y. Ohashi, None; K. Nishida, None 
References
Rama P Matuska S Paganoni G Spinelli A De Luca M Pellegrini G. Limbal stem-cell therapy and long-term corneal regeneration. New Engl J Med . 2010; 363: 147–155. [CrossRef] [PubMed]
Koizumi N Inatomi T Suzuki T Sotozono C Kinoshita S. Cultivated corneal epithelial stem cell transplantation in ocular surface disorders. Ophthalmology . 2001; 108: 1569–1574. [CrossRef] [PubMed]
Nishida K Yamato M Hayashida Y Corneal reconstruction with tissue-engineered cell sheets composed of autologous oral mucosal epithelium. New Engl J Med . 2004; 351: 1187–1196. [CrossRef] [PubMed]
Takeda K Nakamura T Inatomi T Sotozono C Watanabe A Kinoshita S. Ocular surface reconstruction using the combination of autologous cultivated oral mucosal epithelial transplantation and eyelid surgery for severe ocular surface disease. Am J Ophthalmol . 2011; 152: 195–201.e191. [CrossRef] [PubMed]
Martin MJ Muotri A Gage F Varki A. Human embryonic stem cells express an immunogenic nonhuman sialic acid. Nature Med . 2005; 11: 228–232. [CrossRef] [PubMed]
Heiskanen A Satomaa T Tiitinen S N-glycolylneuraminic acid xenoantigen contamination of human embryonic and mesenchymal stem cells is substantially reversible. Stem Cells . 2007; 25: 197–202. [CrossRef] [PubMed]
Oie Y Hayashi R Takagi R A novel method of culturing human oral mucosal epithelial cell sheet using post-mitotic human dermal fibroblast feeder cells and modified keratinocyte culture medium for ocular surface reconstruction. Br J Ophthalmol . 2010; 94: 1244–1250. [CrossRef] [PubMed]
Sharma SM Fuchsluger T Ahmad S Comparative analysis of human-derived feeder layers with 3T3 fibroblasts for the ex vivo expansion of human limbal and oral epithelium. Stem Cell Rev . 2012; 8: 696–705. [CrossRef] [PubMed]
Takamatsu F Inoue T Li Y New culture technique of human eliminable feeder-assisted target cell sheet production. Biochem Biophys Res Commun . 2010; 399: 373–378. [CrossRef] [PubMed]
Robertson DM Li L Fisher S Characterization of growth and differentiation in a telomerase-immortalized human corneal epithelial cell line. Invest Ophthalmol Vis Sci . 2005; 46: 470–478. [CrossRef] [PubMed]
Pellegrini G Dellambra E Golisano O p63 identifies keratinocyte stem cells. Proc Natl Acad Sci U S A . 2001; 98: 3156–3161. [CrossRef] [PubMed]
Chen WYW Mui MM Kao WWY Liu CY Tseng SCG. Conjunctival epithelial-cells do not transdifferentiate in organotypic cultures: expression of K12 keratin is restricted to corneal epithelium. Curr Eye Res . 1994; 13: 765–778. [CrossRef] [PubMed]
Omoto M Miyashita H Shimmura S The use of human mesenchymal stem cell-derived feeder cells for the cultivation of transplantable epithelial sheets. Invest Ophthalmol Vis Sci . 2009; 50: 2109–2115. [CrossRef] [PubMed]
Havasi PNM Soleimani M Bakhshandeh B Parivar K. Mesenchymal stem cells as an appropriate feeder layer for prolonged in vitro culture of human induced pluripotent stem cells. Mol Biol Rep . 2013; 40: 3023–3031. [CrossRef] [PubMed]
Chen SY Hayashida Y Chen MY Xie HT Tseng SC. A new isolation method of human limbal progenitor cells by maintaining close association with their niche cells. Tissue Eng Part C Methods . 2011; 17: 537–548. [CrossRef] [PubMed]
Zhang XM Sun HM Li XR Yuan XY Zhang L Zhao SZ. Utilization of human limbal mesenchymal cells as feeder layers for human limbal stem cells cultured on amniotic membrane. J Tissue Eng Regen Med . 2010; 4: 38–44. [PubMed]
Wilson SE Liu JJ Mohan RR. Stromal-epithelial interactions in the cornea. Prog Retin Eye Res . 1999; 18: 293–309. [CrossRef] [PubMed]
Yu FSX Yin J Xu KP Huang J. Growth factors and corneal epithelial wound healing. Brain Res Bull . 2010; 81: 229–235. [CrossRef] [PubMed]
Morita S Shirakata Y Shiraishi A Human corneal epithelial cell proliferation by epiregulin and its cross-induction by other EGF family members. Mol Vis . 2007; 13: 2119–2128. [PubMed]
You LT Kruse FE Volcker HE. Neurotrophic factors in the human cornea. Invest Ophthalmol Vis Sci . 2000; 41: 692–702. [PubMed]
Yanai R Yamada N Kugimiya N Inui M Nishida T. Mitogenic and antiapoptotic effects of various growth factors on human corneal fibroblasts. Invest Ophthalmol Vis Sci . 2002; 43: 2122–2126. [PubMed]
Hayashi R Yamato M Sugiyama H N-cadherin is expressed by putative stem/progenitor cells and melanocytes in the human limbal epithelial stem cell niche. Stem Cells . 2007; 25: 289–296. [CrossRef] [PubMed]
Bodnar AG Ouellette M Frolkis M Extension of life-span by introduction of telomerase into normal human cells. Science . 1998; 279: 349–352. [CrossRef] [PubMed]
Qiao J Doubrovin M Sauter BV Tumor-specific transcriptional targeting of suicide gene therapy. Gene Ther . 2002; 9: 168–175. [CrossRef] [PubMed]
Bullock AJ Higham MC Macneil S. Use of human fibroblasts in the development of a xenobiotic-free culture and delivery system for human keratinocytes. Tissue Eng . 2006; 12: 245–255. [CrossRef] [PubMed]
Rodriguez-Piza I Richaud-Patin Y Vassena R Reprogramming of human fibroblasts to induced pluripotent stem cells under xeno-free conditions. Stem Cells . 2010; 28: 36–44. [PubMed]
Nakamura T Inatomi T Sotozono C Transplantation of autologous serum-derived cultivated corneal epithelial equivalents for the treatment of severe ocular surface disease. Ophthalmology . 2006; 113: 1765–1772. [CrossRef] [PubMed]
Figure 1
 
A flow chart of the development of TERT+TK-D feeder cells. TERT+TK-D feeder cells are produced in 2 steps. First, normal human dermal fibroblasts (D) are infected with lentivirus (pLenti-TERT-IRES-EGFP-Neo). After infection, selection by 800 μg/mL G418 is performed and TERT+EGFP-transduced human dermal fibroblasts are produced. Second, TERT+EGFP-transduced human dermal fibroblasts are infected with lentivirus (pLenti-TK-Puro). After infection, selection by 1 μg/mL puromycin is performed and TERT+EGFP+TK-transduced dermal fibroblasts (TERT+TK-D) are produced.
Figure 1
 
A flow chart of the development of TERT+TK-D feeder cells. TERT+TK-D feeder cells are produced in 2 steps. First, normal human dermal fibroblasts (D) are infected with lentivirus (pLenti-TERT-IRES-EGFP-Neo). After infection, selection by 800 μg/mL G418 is performed and TERT+EGFP-transduced human dermal fibroblasts are produced. Second, TERT+EGFP-transduced human dermal fibroblasts are infected with lentivirus (pLenti-TK-Puro). After infection, selection by 1 μg/mL puromycin is performed and TERT+EGFP+TK-transduced dermal fibroblasts (TERT+TK-D) are produced.
Figure 2
 
Comparison of gene expression in in vitro cultured dermal fibroblasts and in corneal stromal fibroblasts by reverse transcription–PCR. Similar to corneal stromal cells, dermal fibroblasts express many factors to maintain stem/progenitor cells and epithelial cell growth. D, dermal fibroblasts; S, corneal stromal fibroblasts; NT, no reverse transcriptase.
Figure 2
 
Comparison of gene expression in in vitro cultured dermal fibroblasts and in corneal stromal fibroblasts by reverse transcription–PCR. Similar to corneal stromal cells, dermal fibroblasts express many factors to maintain stem/progenitor cells and epithelial cell growth. D, dermal fibroblasts; S, corneal stromal fibroblasts; NT, no reverse transcriptase.
Figure 3
 
The characteristics of TERT+TK-D feeder cells. (A) The cell morphology of TERT+EGFP+TK-transduced human dermal fibroblast cells (TERT+TK-D). (B) TERT+TK-D feeder cells expressed green fluorescence under ultraviolet illumination. (C) The TERT+TK-D feeder cells are eliminated at day 6 by 25 μg/mL GCV. (D) The TK and LTR sequence are detected in TERT+TK-D feeder cells by PCR analysis, while dermal fibroblasts are not detected. (E) The cell growth curve of the TERT+TK-D feeder cells. (F) The sensitivity of the TERT+TK-D cells to a GCV assay shows that the minimal lethal dose of GCV is 25 μg/mL. TK, herpes simplex virus thymidine kinase. Scale bar: 200 μm.
Figure 3
 
The characteristics of TERT+TK-D feeder cells. (A) The cell morphology of TERT+EGFP+TK-transduced human dermal fibroblast cells (TERT+TK-D). (B) TERT+TK-D feeder cells expressed green fluorescence under ultraviolet illumination. (C) The TERT+TK-D feeder cells are eliminated at day 6 by 25 μg/mL GCV. (D) The TK and LTR sequence are detected in TERT+TK-D feeder cells by PCR analysis, while dermal fibroblasts are not detected. (E) The cell growth curve of the TERT+TK-D feeder cells. (F) The sensitivity of the TERT+TK-D cells to a GCV assay shows that the minimal lethal dose of GCV is 25 μg/mL. TK, herpes simplex virus thymidine kinase. Scale bar: 200 μm.
Figure 4
 
Colony-forming assay. Primary limbal epithelial cells form typical cell colonies on the genetically modified dermal fibroblast (TERT+TK-D) and 3T3 fibroblast feeder layers after 10 to 13 days' culture. (A, B) The TERT+TK-D group shows more colony formation and typical epithelial cell morphology, compared with the 3T3 cell group at the same density and 2 × 104 cells/cm2 3T3 cell group. (C) CFE analysis shows that the TERT+TK-D group forms more large colonies (diameter > 2 mm) and has a CFE similar to that of the 2 × 104 cells/cm2 3T3 cell group. Scale bar: 200 μm. *P < 0.05.
Figure 4
 
Colony-forming assay. Primary limbal epithelial cells form typical cell colonies on the genetically modified dermal fibroblast (TERT+TK-D) and 3T3 fibroblast feeder layers after 10 to 13 days' culture. (A, B) The TERT+TK-D group shows more colony formation and typical epithelial cell morphology, compared with the 3T3 cell group at the same density and 2 × 104 cells/cm2 3T3 cell group. (C) CFE analysis shows that the TERT+TK-D group forms more large colonies (diameter > 2 mm) and has a CFE similar to that of the 2 × 104 cells/cm2 3T3 cell group. Scale bar: 200 μm. *P < 0.05.
Figure 5
 
Characterization of limbal epithelial stem/progenitor colonies. (A) Compared with the 3T3 feeder cell group, coculture of limbal epithelial cells in the TERT+TK-D feeder cells group shows lower positive staining of differentiated corneal epithelial cell marker K3. (B) There is no significant difference in expression of limbal stem/progenitor cell marker ΔNp63 and (C) quantitative analysis of mRNA transcripts. Scale bar, 200 μm. *P < 0.05.
Figure 5
 
Characterization of limbal epithelial stem/progenitor colonies. (A) Compared with the 3T3 feeder cell group, coculture of limbal epithelial cells in the TERT+TK-D feeder cells group shows lower positive staining of differentiated corneal epithelial cell marker K3. (B) There is no significant difference in expression of limbal stem/progenitor cell marker ΔNp63 and (C) quantitative analysis of mRNA transcripts. Scale bar, 200 μm. *P < 0.05.
Figure 6
 
A flow chart of the procedures for harvesting GCV-treated and GCV-untreated TERT+TK-D feeder cell–cocultured epithelial cell sheets. Primary limbal epithelial cells are inoculated on TERT+TK-D feeder cells containing a collagen gel–coated Transwell insert. The cells are submerged in a culture of 5% FBS-KCM for 12 days and then undergo the process of air-lifting for 6 days to promote epithelial stratification. For the GCV-treated group, 25 μg/mL of GCV is added to the medium during the last 6 to 8 days to kill the TERT+TK-D feeder cells. The harvested epithelium sheet after eliminating feeder cell layer can be easily peeled by using surgical forceps for transplantation or immunohistochemistry assay.
Figure 6
 
A flow chart of the procedures for harvesting GCV-treated and GCV-untreated TERT+TK-D feeder cell–cocultured epithelial cell sheets. Primary limbal epithelial cells are inoculated on TERT+TK-D feeder cells containing a collagen gel–coated Transwell insert. The cells are submerged in a culture of 5% FBS-KCM for 12 days and then undergo the process of air-lifting for 6 days to promote epithelial stratification. For the GCV-treated group, 25 μg/mL of GCV is added to the medium during the last 6 to 8 days to kill the TERT+TK-D feeder cells. The harvested epithelium sheet after eliminating feeder cell layer can be easily peeled by using surgical forceps for transplantation or immunohistochemistry assay.
Figure 7
 
PCR analysis of the LTR sequence. PCR is performed against an LRT sequence of lentiviral vector integrated into genetically modified feeder cells and a GAPDH sequence as a positive control. The LRT sequence is detected in the GCV-untreated TERT+TK-D feeder cell–cocultured epithelial cell sheet but not in the GCV-treated cocultured cell sheet.
Figure 7
 
PCR analysis of the LTR sequence. PCR is performed against an LRT sequence of lentiviral vector integrated into genetically modified feeder cells and a GAPDH sequence as a positive control. The LRT sequence is detected in the GCV-untreated TERT+TK-D feeder cell–cocultured epithelial cell sheet but not in the GCV-treated cocultured cell sheet.
Figure 8
 
Characterization of cultured limbal epithelial cell sheets. (A) Both the TERT+TK-D cells and 3T3 cells support stratification of limbal epithelial cells after 2 to 3 weeks' culture. (A) The TERT+TK-D cells support formation of 4 to 5 layers of epithelium and 3T3 feeder cells. (B) Moreover, the epithelial cell sheet cocultured with the TERT+TK-D feeder cells has lower expression of K3 and (C) higher expression of ΔNp63 in both basal cells and wing cells. (D) The K12 staining does not differ significantly. Scale bar: 200 μm.
Figure 8
 
Characterization of cultured limbal epithelial cell sheets. (A) Both the TERT+TK-D cells and 3T3 cells support stratification of limbal epithelial cells after 2 to 3 weeks' culture. (A) The TERT+TK-D cells support formation of 4 to 5 layers of epithelium and 3T3 feeder cells. (B) Moreover, the epithelial cell sheet cocultured with the TERT+TK-D feeder cells has lower expression of K3 and (C) higher expression of ΔNp63 in both basal cells and wing cells. (D) The K12 staining does not differ significantly. Scale bar: 200 μm.
Table
 
Primers Used in Reverse Transcription–PCR
Table
 
Primers Used in Reverse Transcription–PCR
Gene Primer Sequence, 5′→3′ Product Size, bp
HGF Forward: GCCTGAAAGATATCCCGACA 523
Reverse: TTCCATGTTCTTGTCCCACA
KGF Forward: AGGCTCAAGTTGCACCAGGCA 495
Reverse: TGTGTGTCGCTCAGGGCTGGA
EPR Forward: AGGAGGATGGAGATGCTCTG 498
Reverse: TCAGACTTGCGGCAACTCTG
BDNF Forward: AACAATAAGGACGCAGACTT 222
Reverse: TGCAGTCTTTTTGTCTGCCG
bFGF Forward: AAGAGCGACCCTCACATCAAGCTA 236
Reverse: TACTGCCCAGTTCGTTTCAGTGC
N-cad Forward: CACCCAACATGTTTACAATCAACAATGAGAC 444
Reverse: CTGCAGCAACAGTAAGGACAAACATCCTATT
GAPDH Forward: TCCAGAACATCATCCCTGCCTCTA 255
Reverse: TGTTGAAGTCAGAGGAGACCACCTG
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×