Free
Cornea  |   June 2014
Extracellular Matrix Alterations in Late-Onset Fuchs' Corneal Dystrophy
Author Notes
  • Department of Ophthalmology, Friedrich-Alexander University Erlangen-Nuremberg, Erlangen, Germany 
  • Correspondence: Julia M. Weller, Department of Ophthalmology, University Hospital Erlangen, Schwabachanlage 6, 91054 Erlangen, Germany; julia.weller@uk-erlangen.de
Investigative Ophthalmology & Visual Science June 2014, Vol.55, 3700-3708. doi:10.1167/iovs.14-14154
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Julia M. Weller, Matthias Zenkel, Ursula Schlötzer-Schrehardt, Bjoern O. Bachmann, Theofilos Tourtas, Friedrich E. Kruse; Extracellular Matrix Alterations in Late-Onset Fuchs' Corneal Dystrophy. Invest. Ophthalmol. Vis. Sci. 2014;55(6):3700-3708. doi: 10.1167/iovs.14-14154.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

Purpose.: To characterize the alterations of extracellular matrix proteins in Descemet's membranes (DM) of patients with late-onset Fuchs' corneal dystrophy (FCD) and to differentiate them from nonspecific alterations in pseudophakic bullous keratopathy (PBK).

Methods.: Human DM–endothelial cell complexes were obtained from patients with late-onset FCD (n = 40), PBK (n = 6), and control eyes (n = 5). Gene expression profiles of endothelial cells were compared using a commercial real-time PCR array and quantitative real-time PCR assays for confirmation of differentially expressed genes. A total of 24 extracellular matrix proteins were also localized in cryosections of corneal specimens from FCD (n = 10), PBK (n = 4), and control eyes (n = 5) by immunohistochemistry.

Results.: Polymerase chain reaction array analysis revealed a significant upregulation of 27 out of 84 extracellular matrix–related genes including collagens, proteoglycans, glycoproteins, cell adhesion molecules, and matrix metalloproteinases in FCD specimens as compared to normal controls, which could be partly confirmed and quantified by real-time PCR. Comparative analysis of FCD and PBK specimens showed a significant and consistent FCD-specific upregulation of collagen types I, III, and XVI; fibronectin; agrin; clusterin; transforming growth factor beta-induced (TGFBI); and integrin α4 (3- to 18-fold, P < 0.05). Immunohistochemistry revealed an increased labeling of collagen (types III, VII, XV, XVI), agrin, fibulin-2, TGFBI, versican, and clusterin in the DM of FCD specimens compared to PBK specimens.

Conclusions.: The findings provide evidence for a specific upregulation, production, and deposition of collagen types III and XVI, agrin, TGFBI, and clusterin in late-onset FCD and thus point to the importance of matrix alterations in the pathophysiology of FCD.

Introduction
Fuchs' corneal dystrophy (FCD) is the most common hereditary disease of the corneal endothelium, leading to decreased, blurred vision and, if untreated, to blindness and pain. In early-onset FCD, different mutations in the COL8A2 (collagen type VIII α2) gene have been found. 14 In late-onset FCD, which is far more common, four chromosomal loci (FCD1–4) have been detected by analysis of families with autosomal dominant inheritance of FCD. 58 Recently, polymorphisms in the TCF4 (transcription factor 4) and CLU (clusterin) genes have been associated with late-onset FCD 9 as well as missense mutations in the LOXHD1 (Lipoxygenase homology domains 1), 10 the SLC4A11 (solute carrier family 4, sodium borate transporter, member 11), 11 and the AGBL1 (ATP/GTP-binding protein-like 1) genes. 12 Apart from genetic factors, the eminent role of oxidative stress and apoptosis of corneal endothelial cells (EC) in the pathophysiology of FCD has been highlighted in recent years. 1320 Nonetheless, currently there is no cure for FCD apart from corneal transplantation, which creates the need to better understand the pathophysiology of FCD in order to find more specific therapeutic targets. 
A characteristic and early clinical sign of both early- and late-onset FCD is the formation of mushroom- or wart-like excrescences of Descemet's membrane (DM), so called guttae, which is accompanied by decrease of EC density. These alterations start usually in the center of DM with single guttae and spread gradually to the periphery. 21,22 The formation of guttae as the most characteristic and pathognomonic feature of FCD, which may reflect an abnormal extracellular matrix (ECM) metabolism of corneal EC, has not been investigated in detail. 
Corneal EC produce various ECM components of DM as a specialized basement membrane. During fetal development, an anterior banded layer is formed, covered posteriorly by a nonbanded layer that gradually increases in thickness during the lifetime. Descemet's membrane is composed of different collagens (types VI, VIII, XII, XVIII), glycoproteins (e.g., fibronectin, laminin, osteonectin), and proteoglycans (e.g., versican). 23 The ECM components are distributed inhomogeneously within DM, with some ECM proteins concentrated on the stromal side (e.g., fibronectin, vitronectin) and others mainly on the endothelial side of DM (e.g., osteonectin). 23 Beyond that, the composition of ECM components in DM changes during life 24 and in various pathologic conditions involving any disturbance of or damage to the corneal endothelium, such as pseudophakic bullous keratopathy (PBK). 25,26 Histopathologic manifestation of corneal endothelial impairment is the formation of an additional fibrous layer, also termed posterior collagenous layer (PCL), which is deposited on the posterior surface of DM proper. 26 Although an altered composition of DM with increased deposition of collagen types IV and VIII, fibronectin, and laminin has also been described in corneal specimens from FCD patients, 2731 these alterations may reflect merely nonspecific changes of a corneal endothelial damage during later stages of the disease, instead of disease-specific genetically determined alterations. So far, only one study has differentiated between specific ECM alterations in FCD and PBK, but it focused on immunohistochemical studies of a few DM components only. 32 Therefore, the purpose of our study was to perform a comprehensive analysis of the ECM composition of DM on the mRNA and protein level and to identify FCD-specific alterations by comparing ECM expression levels with those of PBK and normal corneas. 
Patients and Methods
Tissue Specimens
For RNA extraction with on-column DNase digestion step (RNeasy Micro kit; Qiagen, Hilden, Germany), DM–EC complexes were obtained from patients with late-onset FCD (n = 40, mean age 70.3 ± 9.7 years) or PBK (n = 6, mean age 70.2 ± 11.3 years) during Descemet's membrane endothelial keratoplasty (DMEK). After paracentesis, DM was stripped from the corneal stroma with a hook (Price Endothelial Keratoplasty Hook; Moria SA, Antony, France) as previously described.33 Ten of 40 FCD specimens (mean age 69.1 ± 10.3 years) were processed in toto; 30 of 40 FCD specimens (mean age 70.7 ± 9.6 years) were divided into a central 5-mm portion and a peripheral rim and analyzed separately in order to detect differences in expression levels between the corneal center and periphery. Due to the low amount of RNA in the divided specimen, the central and peripheral samples of 10 individuals with FCD were pooled (n = 3). The specimens were directly transferred into RNA extraction buffer (RLT; Qiagen) and snap frozen in liquid nitrogen. 
Two different tissue samples were used as controls (n = 5, mean age 70.6 ± 10.1 years). Firstly, DM–EC complexes were obtained from two eyes with posterior malignant melanoma of the uvea and intact anterior segment by DM stripping after enucleation. Secondly, three donor eyes that could not be used for corneal transplantation due to contraindications (dementia, malignoma of the hematopoietic system) were obtained, and DM was stripped using the same technique used to prepare the grafts for DMEK. 33  
There was no significant difference in the age of the patients of the three study groups (FCD, PBK, control; Mann-Whitney U test P = 0.87). 
For immunohistochemistry, corneal specimens were obtained during penetrating keratoplasty from patients with FCD (n = 10, mean age 73.3 ± 7.9 years), from those with PBK (n = 4, mean age 77.7 ± 5.4 years), and from normal donor eyes (n = 5, mean age 74.5 ± 5.7 years) without any history of ocular disease, then cryopreserved in optimum cutting temperature compound (Sakura Finetec, Staufen, Germany). 
The study was approved by the institutional review board and followed the tenets of the Declaration of Helsinki. Informed consent was obtained from the subjects after explanation of the nature of the study. 
Real-Time RT-PCR
First-strand cDNA synthesis and preamplification of cDNA for 12 cycles was performed using 50 ng total RNA and the RT2 PreAMP cDNA synthesis kit (Qiagen). Expression of endothelial mRNAs was investigated using the RT2 Profiler PCR-Array Human Extracellular Matrix and Adhesion Molecules (Qiagen) according to the manufacturer's recommendations, and analyzed using RT2 Profiler PCR Array Data Analysis Tool version 3.2. 
Differentially expressed genes were confirmed by specific PCR assays. First-strand cDNA synthesis was performed using 50 ng total RNA, 200 U Superscript II reverse transcriptase (Invitrogen, Karlsruhe, Germany), and 200 ng random primers (Invitrogen) in a 20-μL reaction volume. Quantitative real-time PCR was carried out with the MyIQ Thermal Cycler and software (Biorad, Munich, Germany). The PCR reactions (20 μL) contained 2 μL cDNA, 3 mM MgCl2, 0.8 μM each upstream and downstream primer, and 0.3 μM universal probe (Roche, Mannheim, Germany) in 1× TaqMan Probe Mastermix (Roche). All samples were analyzed in duplicates with a program of 95°C for 10 minutes and 40 cycles of 95°C for 10 seconds, 60°C for 30 seconds. For quantification, standard curves using serial dilutions (102–107 copies) of plasmid-cloned amplicons were run in parallel. For normalization of gene expression levels, ratios relative to the housekeeping gene GAPDH were calculated. Primer sequences (Eurofins, Anzing, Germany) are given in Table 1
Table 1
 
Primers Used for Quantitative Real-Time PCR
Table 1
 
Primers Used for Quantitative Real-Time PCR
Gene Accession No. Product Probe Sequence, 5′–3′
GAPDH NM_002046 66 bp No. 60 AGCCACATCGCTCAGACAC
GCCCAATACGACCAAATCC
Clusterin NM_001831 65 bp No. 71 CAGATGTACTGCAATGGAACAAA
CATGTGGACTTTGCTACACACC
Col4A2 NM_001846 74 bp No. 29 TCCCTATAGACCACTGGGTTTG
GCAAGGCTGACAATGATGTCTA
Col5A1 NM_000093 88 bp No. 6 TTTGTCCTTTTCTCCTGTCATTT
AGAACGGGACACATTTTGAAG
Col6A1 NM_001848 76 bp No. 18 CAGACATAAATCTCGGCGACT
CTGTAGGGCCAAGGTCCA
Col8A2 NM_005202 65 bp No. 13 TCACCCCAGCCAGGTATC
GCGTGCACCTTGTTCAGAG
Fibronectin NM_002026 97 bp No. 39 TTGCTCTTTTCTAACCATTGTAATTCT
TATTTCCCTTGCAGGCAATC
ITGAL NM_002209 84 bp No. 45 GGGAACCACGTCTGCTAACT
TGGACAGAATTTCACATTTATTGG
ITGA4 NM_000885 64 bp No. 32 TGATTTTGAAATTTAACTGCTCTGG
CAGATTTCATAAGTCTGCCTTGATT
TGFBI NM_000358 77 bp No. 78 ACAGTTTTTGTAAAGCCCTTGC
CATTTGACAGAACATTTCAACTCAT
VCAN NM_004385 73 bp No. 12 ATGTTTAAAGAAAAACCTGTAATGGA
CTCTTCTTCAAGTTGCTCTAAACTGA
Immunohistochemistry
Immunohistochemistry was performed as previously described. 23 Cyrosections 5 μm thick were incubated with primary antibodies against agrin (T. Sasaki, Erlangen, Germany), clusterin (Merck Millipore, Darmstadt, Germany), fibrillin-1 (Merck Millipore), fibronectin (Sigma-Aldrich, St. Louis, MO, USA), fibulin-1 (T. Sasaki), fibulin-2 (T. Sasaki), collagen I (SouthernBiotech, Birmingham, AL, USA), collagen III (Merck Millipore), collagen IV (SouthernBiotech), collagen V (Merck Millipore), collagen VI (Merck Millipore), collagen VII (D. Reinhardt, Montreal, Canada), collagen VIII (Santa Cruz Biotechnology, Dallas, TX, USA), collagen XII (Assay Biotech, Sunnyvale, CA, USA), collagen XV (T. Sasaki), collagen XVI (Assay Biotech), collagen XVII (L. Bruckner-Tudermann, Freiburg, Germany), collagen XVIII (T. Sasaki), laminin-1 (M. Paulsson, Cologne, Germany), osteopontin (Abcam, Cambridge, UK), tenascin-C (Dako, Glostrup, Denmark), TGFBI (Sigma-Aldrich), versican (Acris, San Diego, CA, USA), and vitronectin (Merck Millipore) overnight at 4°C. Alexa 488-conjugated secondary antibodies (goat anti-rabbit/-mouse; Molecular Probes, Eugene, OR) were applied for the detection of antibody binding, and cell nuclei were stained using propidium iodide. In negative control experiments, the primary antibody was replaced by PBS or equimolar concentrations of an irrelevant primary antibody. 
Statistical Analysis
Data are presented as means ± SD. Statistical evaluation of significant differences between groups of eyes was performed with Student's t-test for pairwise comparison. P < 0.05 was considered statistically significant. 
Results
Differential Gene Expression
As a first step to investigate the molecular mechanisms underlying FCD, we used real-time PCR array technology to simultaneously monitor mRNA expression levels of 84 genes related to ECM metabolism in DM specimens from patients with late-onset FCD (n = 4) compared with normal controls (n = 4). Genes were considered as differentially expressed when their expression levels exceeded a 2-fold increase over control in all four FCD specimens. 
The majority of the gene products tested (70%) displayed equal expression in diseased and normal specimens. Genes that were significantly upregulated in FCD specimens included collagens (collagen types IV, V, VI, VII; upregulation: 3- to 42-fold, P < 0.05), glycoproteins (fibronectin 1, laminin α2 chain, laminin γ1 chain, osteonectin; upregulation: 2- to 400-fold, P < 0.05), proteoglycans (versican; upregulation: 351-fold, P < 0.05), cell adhesion molecules (neural cell adhesion molecule 1, integrin α1, α3, α4, αL, β1, β3, β4; upregulation: 2- to 24-fold, P < 0.05), matrix metalloproteinases (MMP) and inhibitors (dysintegrin and matrix metallopeptidase with thrombospondin motif 1 and 8, MMP 9, 10, 11, 14, tissue inhibitor of MMP 1; upregulation: 2- to 22-fold, P < 0.05), and profibrotic growth factors (connective tissue growth factor; upregulation: 5-fold, P < 0.05). Transforming growth factor beta-induced (TGFBI) showed a 3-fold upregulation with a borderline significance (P = 0.06). Highest expression levels were observed for fibronectin (400-fold) and versican (351-fold). Differentially expressed gene products are summarized in Table 2
Table 2
 
Real-Time PCR Array: Differentially Expressed Gene Products in Endothelial Specimens From FCD Patients as Compared to Unaffected Controls (n = 4)
Table 2
 
Real-Time PCR Array: Differentially Expressed Gene Products in Endothelial Specimens From FCD Patients as Compared to Unaffected Controls (n = 4)
Gene Product Gene Symbol Fold Change P Value
A dysintegrin and matrix metallopeptidase with thrombospondin motif 1 ADAMTS1 2.02 0.04
A dysintegrin and matrix metallopeptidase with thrombospondin motif 8 ADAMTS8 2.09 0.05
Collagen type 4 α2 COL4A2 37.50 0.02
Collagen type 5 α1 COL5A1 42.15 0.05
Collagen type 6 α1 COL6A1 3.77 0.02
Collagen type 7 α1 COL7A1 3.02 0.05
Versican VCAN 351.24 0.03
Connective tissue growth factor CTGF 4.71 0.04
Fibronectin FN1 398.50 0.05
Integrin α1 ITGA1 2.34 0.02
Integrin α3 ITGA3 6.12 0.01
Integrin α4 ITGA4 5.97 0.06
Integrin αL ITGAL 7.14 0.01
Integrin β1 ITGB1 2.41 0.01
Integrin β3 ITGB3 23.96 0.01
Integrin β4 ITGB4 3.96 0.02
Laminin α2 LAMA2 6.91 0.03
Laminin γ1 LAMC1 2.38 0.04
Matrix metalloproteinase 10 MMP10 21.51 0.01
Matrix metalloproteinase 11 MMP11 3.43 0.01
Matrix metalloproteinase 14 MMP14 2.61 0.02
Matrix metalloproteinase 9 MMP9 21.58 0.01
Neural cell adhesion molecule 1 NCAM1 2.71 0.05
Sarcoglycan SGCE 3.31 0.04
Osteonectin ON 2.28 0.04
Transforming growth factor beta-induced TGFBI 3.21 0.06
Tissue inhibitor of matrix metalloproteinase 1 TIMP1 1.80 0.04
C-type lectin domain family 3, member B CLEC3B 4.73 0.01
To verify the PCR array data and to quantify the expression levels of ECM-related genes, quantitative real-time PCR assays were performed for a subset of genes using specimens from patients with late-onset FCD (n = 10) and unaffected controls (n = 5). Specimens from patients with PBK (n = 6) were analyzed in parallel to exclude nonspecific findings due to endothelial damage. Apart from genes that had shown a significant and consistent differential expression in the PCR array, we included the following groups of target genes in the specific PCR analysis: (1) agrin, collagen type XVI, and fibulin-2, which had previously been identified as specific basement membrane components of the limbal niche 34,35 ; (2) collagen type VIII, which has been genetically associated with early-onset FCD 14 ; (3) collagen type I, which showed a 13-fold, though nonsignificant upregulation in the PCR array (P = 0.14) and represents an important structural protein of the corneal stroma 36 ; (4) collagen type III, which is known to be involved in corneal wound healing 36,37 ; and (5) the extracellular chaperone clusterin, which has been shown to be upregulated in FCD and localized in guttae. 9,29  
This approach confirmed a significant upregulation of collagen type IV α2 (30-fold, P < 0.0001), collagen type V α1 (17-fold, P < 0.0001), collagen type VI α1 (4-fold, P < 0.02), and versican (6-fold, P < 0.0001) in FCD as compared to controls (Table 3). However, these genes were also upregulated to the same or to an even higher extent in PBK specimens (3- to 160-fold, P < 0.001 to P < 0.05) as compared to controls, possibly reflecting a nonspecific endothelial dysfunction. In contrast, agrin (6-fold, P < 0.001), clusterin (3-fold, P = 0.002), collagen type I α1 (18-fold, P = 0.008), collagen type III α1 (13-fold, P = 0.04), collagen type XVI α1 (8-fold, P = 0.03), fibronectin 1 (6-fold, P < 0.001), integrin α4 (4-fold, P < 0.005), and TGFBI (3-fold, P = 0.006) displayed a FCD-specific upregulation as compared to both PBK and control specimens (Table 3; Fig. 1). Collagen type VIII α2 and fibulin-2 displayed no differential expression in FCD, PBK, and control specimens. 
Figure 1
 
Real-time PCR. Quantitative determination of mRNA levels in corneal endothelial specimens from patients with Fuchs' corneal dystrophy (FCD, n = 5), pseudophakic bullous keratopathy (PBK, n = 3), and control specimens (n = 4) using real-time PCR technology. Data were normalized to GAPDH and are expressed as molecules of interest per molecules GAPDH, together with the relative fold change in FCD or PBK as compared with control specimens (expression levels of TGFBI: ×104; others: ×103; P < 0.05).
Figure 1
 
Real-time PCR. Quantitative determination of mRNA levels in corneal endothelial specimens from patients with Fuchs' corneal dystrophy (FCD, n = 5), pseudophakic bullous keratopathy (PBK, n = 3), and control specimens (n = 4) using real-time PCR technology. Data were normalized to GAPDH and are expressed as molecules of interest per molecules GAPDH, together with the relative fold change in FCD or PBK as compared with control specimens (expression levels of TGFBI: ×104; others: ×103; P < 0.05).
Table 3
 
PCR Assay: Differentially Expressed Gene Products in Endothelial Specimens From FCD Patients as Compared to Unaffected Controls (Co) and PBK (PCR Assay)
Table 3
 
PCR Assay: Differentially Expressed Gene Products in Endothelial Specimens From FCD Patients as Compared to Unaffected Controls (Co) and PBK (PCR Assay)
Gene Product Fold Change FCD/Co P Value Fold Change FCD/PBK P Value
Agrin 5.6 0.0001 4.2 0.001
Clusterin 3.1 0.002 11.2 0.001
Col 1A1 18.3 0.008 20 0.023
Col 3A1 13.4 0.04 8.4 0.04
Col 4A2 30.3 0.001 1.2 NS
Col 5A1 17.3 0.001 0.2 NS
Col 6A1 4.3 0.002 0.03 0.01
Col 8A2 1.1 NS 1.42 NS
Col 16A1 8.3 0.03 1.9 0.04
Fibronectin 5.9 0.001 23.4 0.003
Fibulin-2 3.7 NS 1 NS
ITGA4 3.7 0.005 6.6 0.033
TGFBI 3 0.006 6.3 0.002
Versican 5.8 0.001 0.29 NS
Differences in Gene Expression Between Central and Peripheral Cornea
Because the clinical signs of guttae are often more marked in the central cornea, 22 we performed a refined differential expression analysis of the central (5 mm diameter) and peripheral portions of DM (pooled RNA from 10 specimens, n = 3). Polymerase chain reaction analysis of the target genes for clusterin, TGFBI, collagen type I, collagen type III, fibronectin, agrin, and integrin α4, which had shown a FCD-specific upregulation in the former analyses, revealed no significant differences in expression levels between the central and peripheral regions of DM in late-onset FCD but only a general tendency for elevated expression levels in the center of DM (Fig. 2). 
Figure 2
 
Comparison of gene expression in central and peripheral cornea. Comparison of gene expression in the endothelial cells from the central versus peripheral cornea (pooled RNA from 10 FCD corneas, n = 3): no significant differences in the gene expression between central and peripheral endothelial cells.
Figure 2
 
Comparison of gene expression in central and peripheral cornea. Comparison of gene expression in the endothelial cells from the central versus peripheral cornea (pooled RNA from 10 FCD corneas, n = 3): no significant differences in the gene expression between central and peripheral endothelial cells.
Immunolocalization of ECM Proteins
To visualize the distribution of 24 selected ECM proteins (collagen types I, III, IV, V, VI, VII, VIII, XII, XV, XVI, XVII, XVIII; laminin-1; fibronectin; vitronectin; agrin; osteopontin; fibrillin-1; fibulin-1/2; tenascin-C; versican; TGFBI; clusterin) including those specifically upregulated in FCD (Table 3), indirect immunofluorescence was performed using corneal buttons from patients with FCD and PBK and normal donor eyes as controls. 
The DM of normal corneas showed a positive linear staining for collagen types III, IV, VIII, XII, XV, XVIII, laminin-1, fibronectin, agrin, fibrillin-1, and fibulin-1 along the endothelial side and for collagen types IV, VI, VII, XVI, XVII, fibronectin, vitronectin, osteopontin, fibrillin-1, fibulin-2, TGFBI, versican, and clusterin along the stromal side of DM. No immunostaining of DM was found for collagen types I and V as well as tenascin-C. 
In FCD specimens, increased labeling could be observed for collagen types I, III, IV, V, VI, VII, XII, XV, XVI, XVIII, laminin-1, fibronectin, vitronectin, agrin, tenascin-C, fibrillin-1, fibulin-1/2, versican, TGFBI, and clusterin in the PCL of DM, whereas the guttae proper did not reveal any particular staining pattern. In PBK specimens, increased staining was found on the endothelial face of DM (PCL) for collagen types I, III, IV, V, XII, XVIII, clusterin, fibrillin-1, fibronectin, fibulin-1, fibulin-2, laminin-1, osteopontin, tenascin-C, TGFBI, and vitronectin; staining on the stromal face of DM was found for collagen types VII, XVII, and versican; no staining was observed for agrin and collagen types VI, VIII, XV, XVI. Labeling intensity was generally stronger in the central regions than in the peripheral regions of DM. The staining reaction in the central area of DM was considerably more pronounced for collagen types III, VII, XV, XVI, agrin, fibulin-2, TGFBI, versican, and clusterin in FCD specimens compared to PBK specimens (Fig. 3). A patchy immunoreaction for collagen type III was additionally observed within DM proper in FCD specimens only (Fig. 3). 
Figure 3
 
Immunohistochemistry. Immunolocalization of nine ECM components (agrin, clusterin, collagen types III, VII, XV, XVI, fibulin-2, TGFBI, and clusterin) in control, FCD, and PBK corneas that showed an overexpression in FCD compared to PBK.
Figure 3
 
Immunohistochemistry. Immunolocalization of nine ECM components (agrin, clusterin, collagen types III, VII, XV, XVI, fibulin-2, TGFBI, and clusterin) in control, FCD, and PBK corneas that showed an overexpression in FCD compared to PBK.
With the molecular biological and immunohistologic data combined, the ECM components collagen types III and XVI, agrin, TGFBI, and clusterin showed a FCD-specific upregulation in EC on both the mRNA and protein levels. 
Discussion
The findings of this study provide evidence for an increased disease-specific expression of ECM components in late-onset FCD. Alterations in the structure and composition of the ECM within DM in FCD, for example, an increased immunolabeling for collagen type IV, laminin, and fibronectin, have been previously described. 27,31 In addition, excessive deposition of collagens forming abnormal posterior banded and fibrillar layers has been reported. 30 In both FCD and other pathologic conditions like PBK, a PCL mainly consisting of collagen types IV and VIII and fibronectin is produced and deposited on the posterior surface, leading to thickening of the DM complex. This PCL is thought to be produced by EC that underwent transdifferentiation into myofibroblasts and to be the result of a common final pathway in endothelial dysfunction. 25,26,38  
However, little is known about the mRNA expression of ECM-related genes in EC of corneas with FCD. Serial analysis of gene expression (SAGE) performed by Gottsch et al. 39 detected a number of differentially expressed genes related to apoptosis and oxidative stress, but did not specifically focus on ECM metabolism, which has been addressed in the present study. 
Using a commercial PCR array for targets of ECM metabolism and specific PCR assays, a wide range of genes could be identified that were consistently upregulated in corneal EC of FCD patients compared to normal corneas. Comparison of FCD specimens to PBK specimens using quantitative PCR assays revealed that only part of these genes, that is, collagen types I, III, and XVI, TGFBI, agrin, fibronectin, clusterin, and integrin α4, were specifically upregulated in FCD. These findings could be largely confirmed by immunohistochemistry showing increased immunoreactivity for agrin, collagen type III, collagen type XVI, TGFBI, and clusterin in FCD corneas compared to PBK and normal corneas. However, it cannot be decided definitely from the present investigations whether the observed matrix alterations are primary or secondary to additional comodulating factors, such as oxidative stress, hypoxia, and EC loss. 
Subgroup analysis of gene expression levels showed no significant differences between central and peripheral parts of the cornea, but a trend for increased expression of target genes in the center of DM. These findings support the clinical observation that guttae formation is usually more pronounced in the center than in the periphery of the cornea. 
Some targets (collagen types IV, V, VI, versican) showed a nonspecific upregulation in EC of specimens from both FCD and PBK patients. These nonspecific findings of our PCR assays might be explained by a common final pathway in endothelial dysfunction. There are possible confounders influencing the results obtained in this study: 
  1.  
    Interindividual differences due to different stages of the disease: Due to improved surgical techniques for corneal transplantation, 40 patients with FCD undergo corneal transplantation if they are handicapped by blurred vision due to central guttae without corneal edema. In contrast, patients with PBK are not symptomatic in the beginning and thereby do not undergo transplantation before a relevant corneal edema and epithelial bullous keratopathy have developed.
  2.  
    Interindividual differences due to different genetic etiologies causing FCD might lead to a differential ECM pattern within the patients with FCD.
Immunohistochemistry confirmed specific upregulation of agrin, collagen type III, collagen type XVI, TGFBI, and clusterin on the protein level in FCD specimens, particularly within the PCL, whereas collagen type I, fibronectin, and integrin α4 showed similar expression patterns in FCD and PBK specimens. Possible explanations for this discrepancy in the expression on mRNA and on protein level might be the following: (1) RNA analysis requires vital cells, whereas deposited ECM components can be detected by immunohistochemistry even if there is no active cell metabolism left at the time of examination; (2) vital EC in the corneal periphery with normal ECM production outbalance the minority of remaining, damaged EC in the central cornea. Therefore, the RNA of vital peripheral EC is overrepresented in the PCR analysis; (3) the heterogeneous nature of late-onset FCD with four known chromosomal loci might result in different expression patterns. 
Fuchs' corneal dystrophy–specific upregulation was found for collagen types III and XVI, TGFBI, agrin, and clusterin on both RNA and protein level. Notably, collagen type III could be immunolocalized not only to the PCL, but also to DM proper and to guttae, indicating that collagen type III is produced during earlier stages of the disease than the other ECM proteins. 
In agreement with our findings, an increased expression of TGFBI and clusterin by the corneal endothelium of FCD patients has been previously reported: Jurkunas et al. 28,29 provided evidence for an increased expression of clusterin on the mRNA level and for a deposition of clusterin protein within guttae. In contrast, Kuot et al. 9 found clusterin staining only in the stromal aspect of DM, not in the posterior nonbanded layer or in guttae, whereas in our specimens the staining was most intense within the PCL. Similar discrepancies for the localization of a DM component have been reported for TGFBI, which was localized on the stromal side of guttae by Jurkunas et al., 28 on the posterior aspect of DM by Kuot et al., 9 and within the PCL in our study. The functional role of overexpressed clusterin in FCD might be its association with apoptosis. 28,29 Furthermore, it mediates aggregation of cells under stress conditions and formation of cell–cell junctions. 41 Transforming growth factor beta-induced induces cell adhesion by interaction with ECM components, for example, collagens, fibronectin, and integrins. 9,28  
In addition to the established involvement of clusterin and TGFBI in FCD, the present study provided evidence for an overexpression of collagen types III (13-fold) and XVI (8-fold) as well as agrin (6-fold), which has not been described so far. 
Collagen type III, a component of the corneal stroma, 36 is known to be upregulated in corneal stromal wound healing. 37 Deposition of collagen type III in the PCL has been found in corneas with PBK, 42 but not in FCD up to now. Its upregulation in EC in FCD might be an early sign of the fibroblastic transdifferentiation of EC, resulting in a fibrotic reaction triggering a focal “wound healing” associated with upregulation of collagen type III. 
Collagen type XVI belongs to the fibril-associated collagens with interrupted triple helices (FACIT) and is produced by skin fibroblasts as well as intestinal myofibroblasts. 43,44 It has been described as a specialized ECM component of the corneal limbal stem cell niche. 34 We found an upregulation of collagen type XVI in corneal EC. The functional impact of this overexpression remains unclear so far. In fibrotic skin diseases, collagen type XVI is upregulated, too. 45 Therefore, upregulation of collagen type XVI in FCD might be a sign of a fibrotic retrocorneal reaction. Inhibition of collagen type XVI reduces the integrin-mediated adhesion and thereby the invasiveness of cancer cells. 46 Hypothetically, the cell–cell interaction and adhesion of EC in FCD might be influenced by the upregulation of collagen type XVI that we found. 
Agrin is a proteoglycan that is well known as a mediator of synaptogenesis and formation of neuromuscular junctions: It plays a crucial role not only in the development of the central nervous system, 47 but also in the formation of synapses in the embryonic retina. 48 Furthermore, agrin has nonneuronal functions and is expressed by mesenchymal stem cells and osteoblasts in the bone marrow 49 and is involved in the activation of lymphocytes via the receptor α-dystroglycan. 50 The removal of agrin from the synaptic membranes is mediated by MMP 3, 51 and agrin is target for degradation by MMP 1, 7, 11, and 14. 52 The interaction between agrin and MMPs, which were both upregulated in DM-EC of FCD patients in the present study, might be part of the pathophysiology of FCD. In the human eye, agrin has been identified in basement membranes of the sclera, choroid, and retina, especially in the internal limiting membrane and in retinal blood vessels, 53,54 and was found to be upregulated in diabetes. 55 Since oxidative stress is involved in the pathophysiology of both diabetes 56 and FCD, 1318 similar pathways might result in the upregulation of agrin in both conditions. Agrin has been also shown to be part of the basement membrane of the limbal epithelium, 34,35 but its expression by corneal EC or its presence in the PCL of DM has not been reported before. 
At present, the functional impact of increased deposition of collagen type III, collagen type XVI, and agrin on corneal EC can only be speculated about and may involve effects on cell proliferation, cell migration, and cell function. In the central nervous system, an inhibition of α3-Na+-K+-ATPase (sodium, potassium, and adenosine triphosphatase) by agrin has been reported. 57,58 Na+-K+-ATPase is abundant in the corneal endothelium and necessary to maintain its pump function. Since reduced pump function of the corneal endothelium is a hallmark of FCD, increased expression and deposition of agrin might be associated with this alteration. On the other hand, upregulation of agrin may be an attempt to compensate for reduced endothelial pump function and the resulting corneal edema, since the long glycosaminoglycan side chains of agrin have a high water-binding capacity. 55  
Despite the current lack of any functional data, the present study provides evidence for a FCD-specific upregulation of agrin, collagen types III and XVI, clusterin, and TGFBI in corneal EC in late-onset FCD, which supports the notion of an involvement of ECM alterations in the pathophysiology of FCD. On the basis of the findings described, further studies are required to elucidate the functional effect of these ECM components on corneal EC, their signaling pathways, and their interactions with other pathogenetic factors such as oxidative stress using appropriate in vitro models. 
Acknowledgments
The authors thank Elke Meyer and Angelika Mößner for technical assistance. 
Disclosure: J.M. Weller, None; M. Zenkel, None; U. Schlötzer-Schrehardt, None; B.O. Bachmann, None; T. Tourtas, None; F.E. Kruse, None 
References
Gottsch JD Sundin OH Liu SH Inheritance of a novel COL8A2 mutation defines a distinct early-onset subtype of fuchs corneal dystrophy. Invest Ophthalmol Vis Sci . 2005; 46: 1934–1939. [CrossRef] [PubMed]
Biswas S Munier FL Yardley J Missense mutations in COL8A2, the gene encoding the alpha2 chain of type VIII collagen, cause two forms of corneal endothelial dystrophy. Hum Mol Genet . 2001; 10: 2415–2423. [CrossRef] [PubMed]
Liskova P Prescott Q Bhattacharya SS Tuft SJ. British family with early-onset Fuchs' endothelial corneal dystrophy associated with p.L450W mutation in the COL8A2 gene. Br J Ophthalmol . 2007; 91: 1717–1718. [CrossRef] [PubMed]
Mok JW Kim HS Joo CK. Q455 V mutation in COL8A2 is associated with Fuchs' corneal dystrophy in Korean patients. Eye . 2009; 23: 895–903. [CrossRef] [PubMed]
Sundin OH Jun AS Broman KW Linkage of late-onset Fuchs corneal dystrophy to a novel locus at 13pTel-13q12.13. Invest Ophthalmol Vis Sci . 2006; 47: 140–145. [CrossRef] [PubMed]
Sundin OJ Broman KW Chang HH Vito ECL Stark WJ Gottsch JD. A common locus for late-onset Fuchs corneal dystrophy maps to 18q21.2-q21.32. Invest Ophthalmol Vis Sci . 2006; 47: 3919–3926. [CrossRef] [PubMed]
Riazuddin SA Eghrari AO Al-Saif A Linkage of a mild late-onset phenotype of Fuchs corneal dystrophy to a novel locus at 5q33.1-q35.2. Invest Ophthalmol Vis Sci . 2009; 50: 5667–5671. [CrossRef] [PubMed]
Riazuddin SA Zaghloul NA Al-Saif A Missense mutations in TCF8 cause late-onset Fuchs corneal dystrophy and interact with FCD4 on chromosome 9p. Am J Hum Genet . 2010; 86: 45–53. [CrossRef] [PubMed]
Kuot A Hewitt AW Griggs K Association of TCF4 and CLU polymorphisms with Fuchs' endothelial dystrophy and implication of CLU and TGFBI proteins in the disease process. Eur J Hum Genet . 2012; 20: 632–638. [CrossRef] [PubMed]
Riazuddin SA Parker DS McGlumphy EJ Mutations in LOXHD1, a recessive-deafness locus, cause dominant late-onset Fuchs corneal dystrophy. Am J Hum Genet . 2012; 90: 533–539. [CrossRef] [PubMed]
Vithana EN Morgan PE Ramprasad V SLC4A11 mutations in Fuchs endothelial corneal dystrophy. Hum Mol Genet . 2008; 17: 656–666. [CrossRef] [PubMed]
Riazuddin SA Vasanth S Katsanis N Gottsch JD. Mutations in AGBL1 cause dominant late-onset Fuchs corneal dystrophy and alter protein-protein interaction with TCF4. Am J Hum Genet . 2013; 93: 758–764. [CrossRef] [PubMed]
Jurkunas UV Bitar MS Funaki T Azizi B. Evidence of oxidative stress in the pathogenesis of fuchs endothelial corneal dystrophy. Am J Pathol . 2010; 177: 2278–2289. [CrossRef] [PubMed]
Buddi R Lin B Atilano SR Zorapapel NC Kenney MC Brown DJ. Evidence of oxidative stress in human corneal diseases. J Histochem Cytochem . 2002; 50: 341–351. [CrossRef] [PubMed]
Azizi B Ziaei A Fuchsluger T Schmedt T Chen Y Jurkunas UV. p53-regulated increase in oxidative-stress--induced apoptosis in Fuchs endothelial corneal dystrophy: a native tissue model. Invest Ophthalmol Vis Sci . 2011; 52: 9291–9297. [CrossRef] [PubMed]
Bitar MS Liu C Ziaei A Chen Y Schmedt T Jurkunas UV. Decline in DJ-1 and decreased nuclear translocation of Nrf2 in Fuchs endothelial corneal dystrophy. Invest Ophthalmol Vis Sci . 2012; 53: 5806–5813. [CrossRef] [PubMed]
Matthaei M Meng H Meeker AK Eberhart CG Jun AS. Endothelial Cdkn1a (p21) overexpression and accelerated senescence in a mouse model of Fuchs endothelial corneal dystrophy. Invest Ophthalmol Vis Sci . 2012; 53: 6718–6727. [CrossRef] [PubMed]
Czarny P Kasprzak E Wielgorski M DNA damage and repair in Fuchs endothelial corneal dystrophy. Mol Biol Rep . 2013; 40: 2977–2983. [CrossRef] [PubMed]
Ziaei A Schmedt T Chen Y Jurkunas UV. Sulforaphane decreases endothelial cell apoptosis in Fuchs endothelial corneal dystrophy: a novel treatment. Invest Ophthalmol Vis Sci . 2013; 54: 6724–6734. [CrossRef] [PubMed]
Kim EC Meng H Jun AS. Lithium treatment increases endothelial cell survival and autophagy in a mouse model of Fuchs endothelial corneal dystrophy. Br J Ophthalmol . 2013; 97: 1068–1073. [CrossRef] [PubMed]
Repp DJ Hodge DO Baratz KH McLaren JW Patel SV. Fuchs' endothelial corneal dystrophy: subjective grading versus objective grading based on the central-to-peripheral thickness ratio. Ophthalmology . 2013; 120: 687–694. [CrossRef] [PubMed]
Krachmer JH Purcell JJ Young CW Bucher KD. Corneal endothelial dystrophy. A study of 64 families. Arch Ophthalmol . 1978; 96: 2036–2039. [CrossRef] [PubMed]
Schlötzer-Schrehardt U Bachmann BO Laaser K Cursiefen C Kruse FE. Characterization of the cleavage plane in Descemet's membrane endothelial keratoplasty. Ophthalmology . 2011; 118: 1950–1957. [CrossRef] [PubMed]
Kabosova A Azar DT Bannikov GA Compositional differences between infant and adult human corneal basement membranes. Invest Ophthalmol Vis Sci . 2007; 48: 4989–4999. [CrossRef] [PubMed]
Ljubimov AV Burgeson RE Butkowski RJ Extracellular matrix alterations in human corneas with bullous keratopathy. Invest Ophthalmol Vis Sci . 1996; 37: 997–1007. [PubMed]
Akhtar S Bron AJ Hawksworth NR Bonshek RE Meek KM. Ultrastructural morphology and expression of proteoglycans, betaig-h3-tenascin-C, fibrillin-1, and fibronectin in bullous keratopathy. Br J Ophthalmol . 2001; 85: 720–731. [CrossRef] [PubMed]
Gottsch JD Zhang C Sundin OH Bell WR Stark WJ Green WR. Fuchs corneal dystrophy: aberrant collagen distribution in an L450 W mutant of the COL8A2 gene. Invest Ophthalmol Vis Sci . 2005; 46: 4504–4511. [CrossRef] [PubMed]
Jurkunas UV Bitar M Rawe I. Colocalization of increased transforming growth factor beta induced protein and clusterin in Fuchs endothelial corneal dystrophy. Invest Ophthalmol Vis Sci . 2009; 50: 1129–1136. [CrossRef] [PubMed]
Jurkunas U Bitar MS Rawe I Harris DL Colby K Joyce NC. Increased clusterin expression in Fuchs' endothelial dystrophy. Invest Ophthalmol Vis Sci . 2008; 49: 2946–2955. [CrossRef] [PubMed]
Bourne WM Johnson DH Campbell RJ. The ultrastructure of Descemet's membrane. III. Fuchs' dystrophy. Arch Ophthalmol . 1982; 100: 1952–1955. [CrossRef] [PubMed]
Zhang C Bell WR Sundin OH Immunohistochemistry and electron microscopy of early-onset fuchs corneal dystrophy in three cases with the same L450W COL8A2 mutation. Trans Am Ophthalmol Soc . 2006; 104: 85–97. [PubMed]
Ljubimov AV Atilano SR Garner MH Maguen E Nesburn AB Kenney MC. Extracellular matrix and Na+,K+-ATPase in human corneas following cataract surgery. Cornea . 2002; 21: 74–80. [CrossRef] [PubMed]
Kruse FE Laaser K Cursiefen C A stepwise approach to donor preparation and insertion increases safety and outcome of Descemet's membrane endothelial keratoplasty. Cornea . 2011; 30: 580–587. [PubMed]
Schlötzer-Schrehardt U Dietrich T Saito K Characterization of extracellular matrix components in the limbal epithelial stem cell compartment. Exp Eye Res . 2007; 85: 845–860. [CrossRef] [PubMed]
Dietrich-Ntoukas T Hofmann-Rummelt C Kruse FE Schlötzer-Schrehardt U. Comparative analysis of the basement membrane composition of the human limbus epithelium and amniotic membrane epithelium. Cornea . 2012; 31: 564–569. [CrossRef] [PubMed]
Newsome DA Gross J Hassell JR. Human corneal stroma contains three distinct collagens. Invest Ophthalmol Vis Sci . 1982; 22: 376–381. [PubMed]
Melles GR SundarRaj N Binder PS Immunohistochemical analysis of unsutured and sutured corneal wound healing. Curr Eye Res . 1995; 14: 809–817. [CrossRef] [PubMed]
Heindl LM Schlötzer-Schrehardt U Cursiefen C Bachmann BO Hofmann-Rummelt C Kruse FE. Myofibroblast metaplasia after descemet membrane endothelial keratoplasty. Am J Ophthalmol . 2011; 151: 1019–1023. [CrossRef] [PubMed]
Gottsch JD Bowers AL Margulies EH Serial analysis of gene expression in the corneal endothelium of Fuchs' dystrophy. Invest Ophthalmol Vis Sci . 2003; 44: 594–599. [CrossRef] [PubMed]
Tourtas T Laaser K Bachmann BO Cursiefen C Kruse FE. Descemet membrane endothelial keratoplasty versus descemet stripping automated endothelial keratoplasty. Am J Ophthalmol . 2012; 153: 1082–1090. [CrossRef] [PubMed]
Silkensen JR Schwochau GB Rosenberg ME. The role of clusterin in tissue injury. Biochem Cell Biol . 1994; 72: 483–488. [CrossRef] [PubMed]
Delaigue O Arbeille B Rossazza C Lemesle M Roingeard P. Quantitative analysis of immunogold labellings of collagen types I, III, IV and VI in healthy and pathological human corneas. Graefes Arch Clin Exp Ophthalmol . 1995; 233: 331–338. [CrossRef] [PubMed]
Grässel S Timpl R Tan EM Chu ML. Biosynthesis and processing of type XVI collagen in human fibroblasts and smooth muscle cells. Eur J Biochem . 1996; 242: 576–584. [CrossRef] [PubMed]
Ratzinger S Eble JA Pasoldt A Collagen XVI induces formation of focal contacts on intestinal myofibroblasts isolated from the normal and inflamed intestinal tract. Matrix Biol . 2010; 29: 177–193. [CrossRef] [PubMed]
Akagi A Tajima S Ishibashi A Yamaguchi N Nagai Y. Expression of type XVI collagen in human skin fibroblasts: enhanced expression in fibrotic skin diseases. J Invest Dermatol . 1999; 113: 246–250. [CrossRef] [PubMed]
Bauer R Ratzinger S Wales L Inhibition of collagen XVI expression reduces glioma cell invasiveness. Cell Physiol Biochem . 2011; 27: 217–226. [CrossRef] [PubMed]
Daniels MP. The role of agrin in synaptic development, plasticity and signaling in the central nervous system. Neurochem Int . 2012; 61: 848–853. [CrossRef] [PubMed]
Kröger S Horton SE Honig LS. The developing avian retina expresses agrin isoforms during synaptogenesis. J Neurobiol . 1996; 29: 165–182. [CrossRef] [PubMed]
Mazzon C Anselmo A Cibella J The critical role of agrin in the hematopoietic stem cell niche. Blood . 2011; 118: 2733–2742. [CrossRef] [PubMed]
Zhang J Wang Y Chu Y Agrin is involved in lymphocytes activation that is mediated by alpha-dystroglycan. FASEB J . 2006; 20: 50–58. [CrossRef] [PubMed]
VanSaun M Werle MJ. Matrix metalloproteinase-3 removes agrin from synaptic basal lamina. J Neurobiol . 2000; 43: 140–149. [CrossRef] [PubMed]
Patel TR Butler G McFarlane A Xie I Overall CM Stetefeld J. Site specific cleavage mediated by MMPs regulates function of agrin. PLoS One . 2012; 7: e43669. [CrossRef] [PubMed]
Candiello J Cole GJ Halfter W. Age-dependent changes in the structure, composition and biophysical properties of a human basement membrane. Matrix Biol . 2010; 29: 402–410. [CrossRef] [PubMed]
Keenan TD Clark SJ Unwin RD Ridge LA Day AJ Bishop PN. Mapping the differential distribution of proteoglycan core proteins in the adult human retina, choroid, and sclera. Invest Ophthalmol Vis Sci . 2012; 53: 7528–7538. [CrossRef] [PubMed]
To M Goz A Camenzind L Diabetes-induced morphological, biomechanical, and compositional changes in ocular basement membranes. Exp Eye Res . 2013; 116: 298–307. [CrossRef] [PubMed]
Maritim AC Sanders RA Watkins JB III. Diabetes, oxidative stress, and antioxidants: a review. J Biochem Mol Toxicol . 2003; 17: 24–38. [CrossRef] [PubMed]
Tidow H Aperia A Nissen P. How are ion pumps and agrin signaling integrated? Trends Biochem Sci . 2010; 35: 653–659. [CrossRef] [PubMed]
Hilgenberg LG Su H Gu H O'Dowd DK Smith MA. Alpha3Na+/K+-ATPase is a neuronal receptor for agrin. Cell . 2006; 125: 359–369. [CrossRef] [PubMed]
Figure 1
 
Real-time PCR. Quantitative determination of mRNA levels in corneal endothelial specimens from patients with Fuchs' corneal dystrophy (FCD, n = 5), pseudophakic bullous keratopathy (PBK, n = 3), and control specimens (n = 4) using real-time PCR technology. Data were normalized to GAPDH and are expressed as molecules of interest per molecules GAPDH, together with the relative fold change in FCD or PBK as compared with control specimens (expression levels of TGFBI: ×104; others: ×103; P < 0.05).
Figure 1
 
Real-time PCR. Quantitative determination of mRNA levels in corneal endothelial specimens from patients with Fuchs' corneal dystrophy (FCD, n = 5), pseudophakic bullous keratopathy (PBK, n = 3), and control specimens (n = 4) using real-time PCR technology. Data were normalized to GAPDH and are expressed as molecules of interest per molecules GAPDH, together with the relative fold change in FCD or PBK as compared with control specimens (expression levels of TGFBI: ×104; others: ×103; P < 0.05).
Figure 2
 
Comparison of gene expression in central and peripheral cornea. Comparison of gene expression in the endothelial cells from the central versus peripheral cornea (pooled RNA from 10 FCD corneas, n = 3): no significant differences in the gene expression between central and peripheral endothelial cells.
Figure 2
 
Comparison of gene expression in central and peripheral cornea. Comparison of gene expression in the endothelial cells from the central versus peripheral cornea (pooled RNA from 10 FCD corneas, n = 3): no significant differences in the gene expression between central and peripheral endothelial cells.
Figure 3
 
Immunohistochemistry. Immunolocalization of nine ECM components (agrin, clusterin, collagen types III, VII, XV, XVI, fibulin-2, TGFBI, and clusterin) in control, FCD, and PBK corneas that showed an overexpression in FCD compared to PBK.
Figure 3
 
Immunohistochemistry. Immunolocalization of nine ECM components (agrin, clusterin, collagen types III, VII, XV, XVI, fibulin-2, TGFBI, and clusterin) in control, FCD, and PBK corneas that showed an overexpression in FCD compared to PBK.
Table 1
 
Primers Used for Quantitative Real-Time PCR
Table 1
 
Primers Used for Quantitative Real-Time PCR
Gene Accession No. Product Probe Sequence, 5′–3′
GAPDH NM_002046 66 bp No. 60 AGCCACATCGCTCAGACAC
GCCCAATACGACCAAATCC
Clusterin NM_001831 65 bp No. 71 CAGATGTACTGCAATGGAACAAA
CATGTGGACTTTGCTACACACC
Col4A2 NM_001846 74 bp No. 29 TCCCTATAGACCACTGGGTTTG
GCAAGGCTGACAATGATGTCTA
Col5A1 NM_000093 88 bp No. 6 TTTGTCCTTTTCTCCTGTCATTT
AGAACGGGACACATTTTGAAG
Col6A1 NM_001848 76 bp No. 18 CAGACATAAATCTCGGCGACT
CTGTAGGGCCAAGGTCCA
Col8A2 NM_005202 65 bp No. 13 TCACCCCAGCCAGGTATC
GCGTGCACCTTGTTCAGAG
Fibronectin NM_002026 97 bp No. 39 TTGCTCTTTTCTAACCATTGTAATTCT
TATTTCCCTTGCAGGCAATC
ITGAL NM_002209 84 bp No. 45 GGGAACCACGTCTGCTAACT
TGGACAGAATTTCACATTTATTGG
ITGA4 NM_000885 64 bp No. 32 TGATTTTGAAATTTAACTGCTCTGG
CAGATTTCATAAGTCTGCCTTGATT
TGFBI NM_000358 77 bp No. 78 ACAGTTTTTGTAAAGCCCTTGC
CATTTGACAGAACATTTCAACTCAT
VCAN NM_004385 73 bp No. 12 ATGTTTAAAGAAAAACCTGTAATGGA
CTCTTCTTCAAGTTGCTCTAAACTGA
Table 2
 
Real-Time PCR Array: Differentially Expressed Gene Products in Endothelial Specimens From FCD Patients as Compared to Unaffected Controls (n = 4)
Table 2
 
Real-Time PCR Array: Differentially Expressed Gene Products in Endothelial Specimens From FCD Patients as Compared to Unaffected Controls (n = 4)
Gene Product Gene Symbol Fold Change P Value
A dysintegrin and matrix metallopeptidase with thrombospondin motif 1 ADAMTS1 2.02 0.04
A dysintegrin and matrix metallopeptidase with thrombospondin motif 8 ADAMTS8 2.09 0.05
Collagen type 4 α2 COL4A2 37.50 0.02
Collagen type 5 α1 COL5A1 42.15 0.05
Collagen type 6 α1 COL6A1 3.77 0.02
Collagen type 7 α1 COL7A1 3.02 0.05
Versican VCAN 351.24 0.03
Connective tissue growth factor CTGF 4.71 0.04
Fibronectin FN1 398.50 0.05
Integrin α1 ITGA1 2.34 0.02
Integrin α3 ITGA3 6.12 0.01
Integrin α4 ITGA4 5.97 0.06
Integrin αL ITGAL 7.14 0.01
Integrin β1 ITGB1 2.41 0.01
Integrin β3 ITGB3 23.96 0.01
Integrin β4 ITGB4 3.96 0.02
Laminin α2 LAMA2 6.91 0.03
Laminin γ1 LAMC1 2.38 0.04
Matrix metalloproteinase 10 MMP10 21.51 0.01
Matrix metalloproteinase 11 MMP11 3.43 0.01
Matrix metalloproteinase 14 MMP14 2.61 0.02
Matrix metalloproteinase 9 MMP9 21.58 0.01
Neural cell adhesion molecule 1 NCAM1 2.71 0.05
Sarcoglycan SGCE 3.31 0.04
Osteonectin ON 2.28 0.04
Transforming growth factor beta-induced TGFBI 3.21 0.06
Tissue inhibitor of matrix metalloproteinase 1 TIMP1 1.80 0.04
C-type lectin domain family 3, member B CLEC3B 4.73 0.01
Table 3
 
PCR Assay: Differentially Expressed Gene Products in Endothelial Specimens From FCD Patients as Compared to Unaffected Controls (Co) and PBK (PCR Assay)
Table 3
 
PCR Assay: Differentially Expressed Gene Products in Endothelial Specimens From FCD Patients as Compared to Unaffected Controls (Co) and PBK (PCR Assay)
Gene Product Fold Change FCD/Co P Value Fold Change FCD/PBK P Value
Agrin 5.6 0.0001 4.2 0.001
Clusterin 3.1 0.002 11.2 0.001
Col 1A1 18.3 0.008 20 0.023
Col 3A1 13.4 0.04 8.4 0.04
Col 4A2 30.3 0.001 1.2 NS
Col 5A1 17.3 0.001 0.2 NS
Col 6A1 4.3 0.002 0.03 0.01
Col 8A2 1.1 NS 1.42 NS
Col 16A1 8.3 0.03 1.9 0.04
Fibronectin 5.9 0.001 23.4 0.003
Fibulin-2 3.7 NS 1 NS
ITGA4 3.7 0.005 6.6 0.033
TGFBI 3 0.006 6.3 0.002
Versican 5.8 0.001 0.29 NS
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×