Free
Biochemistry and Molecular Biology  |   June 2012
Functional Characterization of the Human RPGR Proximal Promoter
Author Affiliations & Notes
  • Xinhua Shu
    Department of Life Sciences, Glasgow Caledonian University, Glasgow, United Kingdom;
    MRC Human Genetics Unit, Institute of Genetics and Molecular Medicine, Edinburgh, United Kingdom; and
  • Julie R. Simpson
    MRC Human Genetics Unit, Institute of Genetics and Molecular Medicine, Edinburgh, United Kingdom; and
  • Alan W. Hart
    MRC Human Genetics Unit, Institute of Genetics and Molecular Medicine, Edinburgh, United Kingdom; and
  • Zhihong Zeng
    Genome Damage and Stability Centre, University of Sussex, Brighton, United Kingdom.
  • Sarita Rani Patnaik
    Department of Life Sciences, Glasgow Caledonian University, Glasgow, United Kingdom;
  • Philippe Gautier
    MRC Human Genetics Unit, Institute of Genetics and Molecular Medicine, Edinburgh, United Kingdom; and
  • Emma Murdoch
    MRC Human Genetics Unit, Institute of Genetics and Molecular Medicine, Edinburgh, United Kingdom; and
  • Brian Tulloch
    MRC Human Genetics Unit, Institute of Genetics and Molecular Medicine, Edinburgh, United Kingdom; and
  • Alan F. Wright
    MRC Human Genetics Unit, Institute of Genetics and Molecular Medicine, Edinburgh, United Kingdom; and
  • *Each of the following is a corresponding author: Alan F. Wright, MRC Human Genetics Unit, Institute of Genetics and Molecular Medicine, Edinburgh EH4 2XU, United Kingdom; alan.wright@hgu.mrc.ac.uk.  
  • Xinhua Shu, Department of Life Sciences, Glasgow Caledonian University, 70 Cowcaddens Road, Glasgow G4 0BA, United Kingdom; xinhua.shu@gcu.ac.uk
Investigative Ophthalmology & Visual Science June 2012, Vol.53, 3951-3958. doi:10.1167/iovs.11-8811
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Xinhua Shu, Julie R. Simpson, Alan W. Hart, Zhihong Zeng, Sarita Rani Patnaik, Philippe Gautier, Emma Murdoch, Brian Tulloch, Alan F. Wright; Functional Characterization of the Human RPGR Proximal Promoter. Invest. Ophthalmol. Vis. Sci. 2012;53(7):3951-3958. doi: 10.1167/iovs.11-8811.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

Purpose.: Mutations in the retinitis pigmentosa (RP) GTPase regulator (RPGR) gene account for more than 70% of X-linked RP cases. This study aims to characterize the proximal promoter region of the human RPGR gene.

Methods.: The 5′-flanking region (5 kb) of human RPGR was cloned and sequenced. A potential transcription start site and transcription factor binding motifs were identified by bioinformatic analysis. Constructs containing the putative human RPGR promoter region upstream of a luciferase reporter gene were generated and analyzed by transient transfection and luciferase assays. Transgenic mouse lines carrying a 3-kb human RPGR promoter sequence fused to lacZ were generated and RPGR proximal promoter activity was analyzed by X-gal staining.

Results.: Bioinformatic analyses of the human RPGR 5′-flanking region uncovered potential transcription factor binding sites and a CpG island. Transient transfection assays with RPGR promoter/luciferase reporter constructs revealed a 980-bp fragment (−952 to +28) that produced higher levels of luciferase activity. Mutagenesis identified a putative Sp1 binding site that was critical for regulating transcriptional activity. We generated transgenic mice in which a lacZ reporter gene was controlled by the 3-kb upstream region of RPGR. β-galactosidase expression was predominantly found in mouse retina, brain, and kidney. In the retina, the photoreceptor cell layer showed the strongest β-galactosidase staining.

Conclusions.: Our study defined the human RPGR proximal promoter region in which a 3-kb fragment contained sufficient regulatory elements to control RPGR expression in mouse retina and other tissues. Characterization of the RPGR promoter will facilitate understanding of the functional role of RPGR in the retina and gene therapy of X-linked RP.

Introduction
Retinitis pigmentosa (RP) is a genetically heterogeneous group of retinal degenerations that affect 1 in 4000 in the general population. 1,2 Most cases are inherited in an autosomal dominant, autosomal recessive, X-linked, or mitochondrial manner, but oligogenic inheritance has been established in a small proportion of families. 3 X-linked RP (XLRP) is one of the most consistently severe forms of RP, with a reported average age at onset of 7.2 ± 1.7 years. 4 XLRP affects 10% to 20% of all RP patients 5 and has been genetically mapped to six loci: RP2, RP3, RP6, RP23, RP24, RP34 (http://www.sph.uth.tmc.edu/retnet/). The RPGR gene is mutated in the RP3 form of XLRP, which accounts for 70% to 80% of affected families. 58  
The human RPGR gene is located in chromosomal region Xp21.1 and spans 172 kilobases. 8 There are multiple alternatively spliced transcripts, all of which encode an amino (N)-terminal RCC1-like (RCCL) domain, which is structurally similar to the RCC1 protein, a guanine nucleotide exchange factor for the small guanosine triphosphate–binding protein, Ran. 9 The RPGR gene that was initially identified contained 19 exons (RPGRex1–19), encoding a predicted 90-kDa protein. 6,7 Exons 2 to 11 encode the RCCL domain, whereas exons 12 to 19 encode a carboxyl (C)-terminal domain rich in acidic residues and ending in an isoprenylation anchorage signal. 6,10 Mutations found in RPGRex1–19 account for only 15% to 20% of XLRP patients and subsequent studies revealed many more disease-causing mutations within one or more transcripts containing an alternatively spliced C-terminal exon called ORF15 (RPGR ORF15). 8 Exon ORF15 encodes a repetitive glycine and glutamic acid–rich domain of unknown function and contains a conserved basic C-terminal domain. The ORF15 exon harbors a high frequency of microdeletions, frameshift, and premature stop mutations. 8 In total, 296 RPGR mutations have been identified to date, which can give rise to both central and peripheral retinal dystrophies, including X-linked forms of RP (95% of subjects); human cone-rod, cone, and macular dystrophies (3% of subjects); or syndromal forms of XLRP with hearing loss and primary ciliary dyskinesia (2% of subjects). 11,12  
RPGR interacts with a number of photoreceptor and ciliary proteins. The RCCL domain was shown to interact with the delta subunit of the rod cyclic GMP phosphodiesterase (PDE6D), a highly conserved protein capable of binding several prenylated proteins, including Rab13, Ras, Rap, and Rho6. 13 The RCCL domain also interacts with the RPGR-interacting protein 1 (RPGRIP1), which, like RPGR, is localized to the photoreceptor connecting cilium. 1416 Mutations in RPGRIP1 cause a severe early-onset form of retinal degeneration, Leber's congenital amaurosis. 17,18 The exact function of RPGRIP1 is unknown, but it is necessary for photoreceptor disc formation and morphogenesis. 19 The disease course in the Rpgrip1 knockout (KO) mouse was more severe than that seen in mice lacking RPGR, 19,20 which is consistent with the differential severity of these two disorders in humans. RPGR was absent from the connecting cilia in Rpgrip1 KO mice, suggesting that Rpgrip1 is necessary for the proper localization of RPGR. 19 The C-terminal domain of the RPGRORF15 isoform was found to interact with nucleophosmin, 21 a chaperone involved in many cellular processes, including centrosome duplication, folding of denatured proteins and histone chaperoning. Co-immunoprecipitation studies showed that RPGR interacts with several basal body/axonemal proteins (CEP290/NPHP6, NPHP5, IFT88, gamma-tubulin, 14-3-3 epsilon, RPGRIP1L) and microtubule transport proteins (kinesin II–related proteins KIF3A and KAP3, dynein heavy and intermediate chains, dynactin subunits p150-Glued, and p50-dynamitin), supporting a role for RPGR in microtubular organization and transport between photoreceptor inner and outer segments. 2224  
RPGR is widely expressed and shows a complex expression pattern. At the mRNA level, RPGR transcripts were detected in different tissues, including brain, eye, kidney, lung, and testis in several different species. 2529 At the protein level, RPGR has been detected in retina, trachea, brain, and testis. In human, mouse, and bovine retina, RPGR mainly localizes to photoreceptor connecting cilia, 29 but expression has also been reported in outer segments in some species. 30 RPGR is expressed in the transitional zone of motile cilia and within human and monkey cochlea. 29,31 Overexpression of mouse RPGR results in male infertility because of defects in flagellar formation. 32 The severity of the flagellar defect is correlated with increased RPGR copy number, suggesting that RPGR expression is tightly controlled. Our study aimed to increase our understanding of the regulation of human RPGR expression and to provide appropriate expression in therapeutic strategies for treating patients with RPGR mutations. 
Materials and Methods
Bioinformatic Analysis of Human RPGR Promoter
A 5098 nucleotide bp sequence upstream from human RPGR exon 1 was analyzed using Gene2promoter software (Genomatix, Munich, Germany), which provides access to promoter sequences of all genes annotated in the available genomes and predicts the genomic context of eukaryotic polymerase II promoter sequences (see Supplementary Material and Supplementary Fig. S1). If a transcriptional start site (TSS) is predicted to be within 200 bp downstream of the predicted promoter region, the identified region was marked as a true promoter region. CpG islands in the 5′ flanking region were predicted using CpGplot/CpGreport software (http://www.ebi.ac.uk/Tools/sequence.html). The criteria used to determine a potential island were an observed/expected ratio of CpG greater than 0.6; a %C+%G greater than 50.0%; and a window length longer than 200 bp. Vertebrate transcription factor binding sites were identified using MatInspector software, which is a platform for the identification of transcription factor binding sites in multiple genomes (Genomatix). Conservation of the putative RPGR promoter region during evolution was analyzed using Clustalw software (http://www.ebi.ac.uk/). 
Reporter Constructs
Five fragments that were upstream of the human RPGR exon 1, with progressive 5′ to 3′ deletions, were amplified using human genomic DNA as template (Fig. 2), with five Forward primers and one Reverse primer, as shown in Supplementary Table S1 (see Supplementary Material). The five PCR fragments: 5098 bp (−5070 to +28 bp), 3093 bp (−3065 to +28 bp), 2005 bp (−1977 to +28 bp), 1508 bp (−1480 to +28 bp), and 980 bp (−952 to +28 bp) were ligated into the pGEM-T Easy vector (Promega, Southampton, UK), sequenced, and then subcloned into the pGL3 basic vector (Fig. 2A). An additional 222-bp (−268 to −47 bp) fragment containing two putative Sp1 binding sites was cloned into the pGEM-T Easy vector using RPGR222bp For and RPGR222bp Rev primers (see Supplementary Table S1), then sequenced and subcloned into the bpGL3 basic vector (222bp-Luc). 
Figure 1. 
 
(A) Schematic representation of the 5′ region of the human RPGR gene investigated using reporter constructs generated in the pGL-3 vector. (B) The corresponding activities of the luciferase reporter gene in RPE1 and HEK 293T cell lines. The promoter-less plasmid pGL3-Basic was used as a negative control and the pGL3-Control plasmid containing an SV40 promoter and enhancer was used as a positive control. The Renilla luciferase plasmid was used as an internal control for the normalization of transfection efficiency. The activities of the reporter gene are expressed as -fold change relative to the activity of pGL3-Basic (an activity value of 1.0).
Figure 1. 
 
(A) Schematic representation of the 5′ region of the human RPGR gene investigated using reporter constructs generated in the pGL-3 vector. (B) The corresponding activities of the luciferase reporter gene in RPE1 and HEK 293T cell lines. The promoter-less plasmid pGL3-Basic was used as a negative control and the pGL3-Control plasmid containing an SV40 promoter and enhancer was used as a positive control. The Renilla luciferase plasmid was used as an internal control for the normalization of transfection efficiency. The activities of the reporter gene are expressed as -fold change relative to the activity of pGL3-Basic (an activity value of 1.0).
Figure 2. 
 
Effect of mutating predicted Sp1 sites on RPGR promoter activity in RPE1 and 293T cell lines. (A) The sequence conservation of the two most conserved Sp1 sites (SP1A, SP1B) 5′ of the human RPGR gene in 5 mammalian species. (B) Schematic representation of SP1A and SP1B mutation constructs. (C) The promoter activities of wild-type and SP1A or SP1B mutant reporter constructs. The promoter-less plasmid pGL3-Basic was used as a negative control, the pGL3-control plasmid containing an SV40 promoter was used as a positive control. The Renilla luciferase plasmid was used as an internal control for the normalization of transfection efficiency. The activities of the reporter gene are expressed as -fold change relative to the activity of pGL3-basic (an activity value of 1.0). Compared with wild type, SP1A, SP1B and SP1AB showed significantly reduced activities in both RPE1 and 293T cell lines (** P < 0.0001, t-test).
Figure 2. 
 
Effect of mutating predicted Sp1 sites on RPGR promoter activity in RPE1 and 293T cell lines. (A) The sequence conservation of the two most conserved Sp1 sites (SP1A, SP1B) 5′ of the human RPGR gene in 5 mammalian species. (B) Schematic representation of SP1A and SP1B mutation constructs. (C) The promoter activities of wild-type and SP1A or SP1B mutant reporter constructs. The promoter-less plasmid pGL3-Basic was used as a negative control, the pGL3-control plasmid containing an SV40 promoter was used as a positive control. The Renilla luciferase plasmid was used as an internal control for the normalization of transfection efficiency. The activities of the reporter gene are expressed as -fold change relative to the activity of pGL3-basic (an activity value of 1.0). Compared with wild type, SP1A, SP1B and SP1AB showed significantly reduced activities in both RPE1 and 293T cell lines (** P < 0.0001, t-test).
Mutagenesis of the Sp1 Binding Sites of Human RPGR Promoter
Mutations in two putative Sp1 binding sites in the 222bp-Luc promoter fragment were introduced using a QuickChange site-directed mutagenesis kit (Stratagene, Stockport, UK). Three mutants were generated: Sp1A Mut, Sp1B Mut, and Sp1AB Mut (Fig. 3B). The introduction of the mutations was verified by DNA sequencing. 
Figure 3. 
 
EMSA showing Sp1 binding to its two predicted sites in the RPGR promoter. The gel shift assay was performed with the nuclear extract isolated from HeLa cells and with radiolabeled probes derived from the RPGR promoter region containing putative Sp1 binding sites. The Sp1/DNA complex occurred with wild-type oligonucleotides (WT-probe, Sp1A: lane 2; Sp1B: lane 8), no complex was formed with mutant oligonucleotides (Mut-probe, Sp1Amut: lane 5; Sp1Bmut: lane 11). The anti-Sp1 antibody depletion assay showed ablation of the Sp1/DNA complex (Lanes 3 and 9). In the control (no nuclear extract added), no complex was seen (lanes 1, 4, 7, 10). NB, nonspecific binding.
Figure 3. 
 
EMSA showing Sp1 binding to its two predicted sites in the RPGR promoter. The gel shift assay was performed with the nuclear extract isolated from HeLa cells and with radiolabeled probes derived from the RPGR promoter region containing putative Sp1 binding sites. The Sp1/DNA complex occurred with wild-type oligonucleotides (WT-probe, Sp1A: lane 2; Sp1B: lane 8), no complex was formed with mutant oligonucleotides (Mut-probe, Sp1Amut: lane 5; Sp1Bmut: lane 11). The anti-Sp1 antibody depletion assay showed ablation of the Sp1/DNA complex (Lanes 3 and 9). In the control (no nuclear extract added), no complex was seen (lanes 1, 4, 7, 10). NB, nonspecific binding.
Cell Culture and Transfections
The human telomerase-transformed RPE1 cell line was grown in Dulbecco's modified Eagle's medium (DMEM):F-12 medium supplemented with 10% fetal calf serum (FCS) and penicillin/streptomycin. Human embryonic kidney (HEK) 293T cells were grown in DMEM supplemented with 10% FCS and penicillin/streptomycin. The cells were grown in 24-well plates until confluent and transiently transfected with the RPGR promoter luciferase reporter constructs, together with Renilla luciferase control plasmid, using Lipofectamine 2000 (Invitrogen/Life Technologies, Paisley, UK). The pGL3-Control vector containing SV40 promoter and enhancer sequences was used as a positive control and the empty pGL3-Basic vector as a negative control. 
Luciferase Assays
Cells transiently transfected with the luciferase constructs were cultured for a further 48 hours and washed twice with PBS. Cell lysates were prepared by adding lysis buffer (Passive Lysis buffer; Promega) and incubated for 30 minutes; 20 μL of cell lysates were transferred to a 96-well plate containing 100 μL luciferase assay reagent (LAR II, Promega). The activity of firefly luciferase was measured first and Renilla luciferase activity was measured after addition of 100 μL of Stop & Glo reagent (Promega). Experiments were performed at least three times. 
Electrophoretic Mobility Shift Assay (EMSA)
Nuclear extracts were made from HeLa cells, which have Sp1 expression and are commonly used for Sp1 binding assays. Briefly, 2 × 107 HeLa cells were harvested by trypsinization and resuspended in 1 mL fractionation buffer (15 mM Tris pH 7.5, 0.3 M sucrose, 15 mM NaCl , 5 mM MgCl2, 0.1 mM EGTA, 0.5 mM dithiothreitol [DTT], 0.1 mM phenylmethylsulfonylfluoride). An equal volume of fractionation buffer containing 0.4% IGEPAL (Sigma, Irvine, UK) was added and the suspension was mixed and incubated on ice for 10 minutes. The lysate was then layered onto 5 mL extraction buffer containing 1.2 M sucrose and spun at 10,000g for 20 minutes at 4°C. The top layer containing the cytoplasm was removed, and the nuclear pellet was washed and resuspended in 200 μL PBS. For the depletion of Sp1, 0.1 mg HeLa cell nuclear extract was precleared with 50 μL protein G-Sepharose beads (Sigma) for 2 hours at 4°C, then incubated with 20 μL anti-Sp1 antibody (0.2 μg/μL, sc-59; Santa Cruz Biotech, Santa Cruz, CA) on a carousel at 4°C overnight. This was followed by addition of 30 μL of protein G-Sepharose beads and incubation at 4°C for 1 hour with gentle agitation. The Sp1-binding protein G-Sepharose beads were removed by centrifugation so that the supernatant contained Sp1-depleted nuclear extract. For preparation of the probe, 30-bp oligonucleotides comprising Sp1 binding sequence (wild type or mutant, as underlined below) were commercially synthesized. The oligonucleotide sequences are as follows: Sp1A wild type, 5′-CATTCCCAAGCTCCGCCCCCGTTGCCCGTA-3′; Sp1A Mutant, 5′-CATTCCCAAGCTGAATTCCCGTTGCCCGTA-3′); Sp1B wild type, 5′-GGCCTCCGTTCCCCTCCCCAACGGCGCCTG-3′; Sp1B mutant, 5′-GGCCTCCGTTGAATTCCCCAACGGCGCCTG-3. Those oligonucleotides were annealed and labeled with α-32P dCTP using Klenow DNA polymerase, the 3′-labeled probes were purified by G25-columns (GE Healthcare, Little Chalfont, Buckinghamshire, UK). The Sp1 binding reactions were carried out by incubating the indicated labeled-probe (7.5 nM) with 1 μL of HeLa cell nuclear extract (16 μg/μL) in binding buffer (20 mM Tris pH 7.5, 100 mM NaCl, 0.2 mg/mL BSA, 10% glycerol, 2 mM MgCl2, and 1 mM DTT) at room temperature for 20 minutes. All reactions were terminated by the addition of loading buffer containing 50% glycerol and 5× loading dye (Qiagen, Crawley, West Sussex, UK). The DNA-protein complexes were separated by electrophoresis on a 4% native polyacrylamide gel in 0.4× Tris borate-EDTA (TBE) at 120 V for 2 hours at room temperature, vacuum-dried, and then autoradiographed. 
Generation and Analysis of Transgenic Mice
All studies were performed in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research and under the guidance of the Medical Research Council in Responsibility in the Use of Animals for Medical Research (July 1993) and UK Home Office Project License 60/3785. For each micro-injection session, 10 F1 (B6CBAF1/Crl) female mice (approximately 4 weeks of age) were superovulated by injecting 5 units of pregnant mare serum gonadotropin (National Hormone and Pituitary Program, Bethesda, MD) on day 1 (2 pm) followed by a second intraperitoneal injection of human chorionic gonadotropin on day 3 at 12 noon. At 4 pm on day 3, injected females were mated with F1 (B6CBAF1/Crl) male studs and checked the following morning (day 4) for a copulation plug. Superovulated females were killed on day 4 and embryos were harvested by flushing oviducts with fresh FHM (Millipore) medium and collected embryos were transferred into CO2-equilibrated KSOM medium (Millipore) overlaid with mineral oil (Sigma) and incubated at 37°C in 5% CO2 until required. Batches of 40 to 50 embryos were microinjected with linearized double-stranded DNA (3093 bp RPGR promoter region [−3065 to +28 bp]), fused with a downstream lacZ gene, into one of the pronuclei of the 0.5-day embryo. Injected embryos were incubated overnight at 37°C in 5% CO2 in KSOM medium. On day 5, viable 2-cell embryos were then transferred into 0.5-day pseudopregnant CD1 recipient females. Pregnancies were allowed to go to term and at 3 weeks of age pups were screened to determine positive transgenic founders by PCR using ear clip DNA. Primers for the PCR screen were a forward primer 5′ GTTGCGCAGCCTGAATGGCG 3′ and a reverse primer 5′GCCGTCACTCCAACGCAGCA 3′. Transgenic founders were crossed to CD1 mice to generate F1 progeny. Eyes, brains, kidneys, and lungs were dissected from transgenic mice at the age of 3 months and fixed in 4% paraformaldehyde (PFA) overnight at 4°C. The fixed samples were washed three times in PBS containing 0.01% Na-deoxycholate, 0.02% Nonidet P40, 5 mM EGTA (pH 8.0), and 2 mM MgCl2, stained overnight at 37°C in a solution of 0.5 mg/mL 5-bromo-4-chloro-3-indolyl β-D-galactopyranoside (X-gal) containing 2 mM MgCl2, 5 mM K3Fe(CN)6, 5 mM K4Fe(CN)6, 0.01% Na deoxycholate, and 0.02% NP40. After washing three times, tissues were postfixed in 4% PFA. Sections of the stained eye were cut at a thickness of 6 μm and dewaxed. Images were captured using a microscope and analyzed using IPLab software (Digital Imaging Systems, Bourne End, UK). 
For immunostaining to detect β-galactosidase in the retina of transgenic and nontransgenic mice, the sections were de-waxed, blocked with 2% BSA-PBS, incubated with mouse antirhodopsin antibody (1:200; Abcam, Cambridge, UK ) and rabbit anti-β-galactosidase antibody (1:200; Cortex Biochem, Inc., San Leandro, CA), and subsequently incubated with Texas-Red or FITC-conjugated secondary antibody. Sections were mounted in Vectashield (Vector Laboratories Ltd, Peterborough, UK) containing 4-6-diamidino-2-phenylindole (DAPI). Images were captured using a confocal microscope (LSM 510; Carl Zeiss Inc., Welwyn Garden City, UK). 
Results
Bioinformatic Characterization of the RPGR Upstream Region
To identify a potential promoter in the upstream region of the human RPGR gene, 5094 bp of sequence (−5066 to +28 bp) including RPGR exon 1 was analyzed using Gene2Promoter software (Genomatix). A potential promoter of 641 bp ( −683 to −42 bp) and two TSSs (−142 and −168 bp) were identified. To investigate the predicted TSSs further, expressed sequence tags (ESTs), including the upstream region of RPGR, were searched, and 40 ESTs were found and aligned to the RPGR upstream sequence. Four potential TSSs (−197, −175, −168, and −142 bp) were identified, including the most commonly used 5′ transcription start site (−142 bp), which was 142 nucleotides upstream of the start codon (see Supplementary Fig. S1). 
To identify the regulatory elements in the upstream region of RPGR, 1508 bp (−1480 to +28 bp) of sequence was analyzed using the MatInspector program to search the TRANSFAC database; 142 possible transcription-factor binding sites were identified within the sequence. Some selected consensus sequences for transcription factor binding sites are shown in Supplementary Figure S1 (see Supplementary Fig. S1). The RPGR 5′-upstream region contained three E-box sites (−1486 to −1456, −253 to −241, and −123 to −111 bp); three Octamer sites (−1030 to −1014, −992 to −966, and −588 to −572 bp); three Sp1 sites (−683 to −669, −236 to −226, and −196 to −177 bp) and one AP4 site (−506 to −490 bp). In addition, a possible TATA box was identified at position −715 to −699 bp and a CCAAT box at position −598 to −584 bp. Many blocks of sequences are conserved in the RPGR 5′-upstream region between human and mouse, including most of the above mentioned potential transcription factor binding sites (see Supplementary Fig. S2). 
We screened the RPGR gene upstream sequence of 5098 bp (−5070 to +28 bp) for CpG islands using the CpG island searcher software (http://www.ebi.ac.uk/). One strongly predicted CpG island of 249 bp from −276 to −27 bp was identified with 67.5% CG content. The observed CpG/expected CpG ratio in this region was greater than 0.65 (see Supplementary Fig. S3). This suggests that this CpG island may have an important role in regulating RPGR transcription. 
Analysis of the Transcriptional Activity of the RPGR Upstream Region
To investigate the transcriptional activity of the upstream sequence of the human RPGR gene, a series of luciferase reporter gene constructs were generated in the pGal3 vector (Fig. 1A). The 293T or RPE1 cells were transiently transfected with individual reporter gene constructs or with the pGL3-basic control, together with a Renilla luciferase transfection control plasmid. The luciferase activity data from three independent experiments were normalized for transfection efficiency. In both 293T and RPE1 cell lines, luciferase activities increased progressively with deletions in a 5′ to 3′ direction (Fig. 1), The fragment containing −5070 to +28 bp directed luciferase expression 10.5-fold and 12.2-fold higher than the background pGL3-Basic vector in RPE1 and 293T cells, respectively. The highest luciferase activities of the five constructs was directed by the most proximal fragments of 222 bp (−268 to −47 bp) and 980 bp (−952 to +28 bp), which gave 44-fold higher expression in RPE1 cells and 38.2-fold higher expression in HEK293 T cells than the background pGL3-Basic vector (Fig. 1). 
Definition of Two Sp1 Sites within the RPGR Promoter Region
There are three putative SP1 binding sites in the 1508-bp sequence (−1480 to +28 bp) (see Supplementary Fig. S1). The first putative Sp1 binding site consensus sequence (SP1; −683 to −669 bp) showed less evolutionary conservation than the other two Sp1 binding site consensus sequences, SP1B (−236 to −226 bp) and SP1A (−196 to −187 bp) across mammalian species (Fig. 2A and data not shown). We therefore decided to identify the function of the two most conserved Sp1 binding sites (SP1A and SP1B) in the RPGR promoter by constructing mutated derivatives of these sites in the RPGR promoter fragment (−268 to −47 bp) cloned into the pGL3-Basic vector (Fig. 2B) and transfected into RPE1 and 293T cells. The mutation introduced into Sp1 binding site B (SP1Bmut) reduced luciferase activity by 47.0% in RPE1 cells and 32% in HEK 293T cells, respectively (P < 0.0001). The mutation introduced into Sp1 binding site A (SP1Amut) dramatically reduced luciferase activity, by 70% in RPE1 cells and 80% in HEK 293T cells, respectively (P < 0.0001). The combination of these two mutations, SP1A and SP1B, caused only a slightly greater reduction in luciferase activity, by 90% in RPE1 cells and 84% in HEK 293T cells, compared with the SP1A single mutant (Fig. 2C). This suggests that the predicted Sp1 binding site SP1A is likely to be a critical RPGR promoter element. To demonstrate that Sp1 interacts with the two putative elements, the radiolabeled oligonucleotide probes spanning each of the two Sp1 sites were prepared (sequences shown in Materials and Methods). Gel-shift experiments showed HeLa nuclear extracts produced a band shift when incubated with wild-type probes (SP1A and SP1B), but no band was observed with the mutant probes (SP1A and SP1B mutants) (Fig. 3). The band shift disappeared when Sp1-depleted nuclear extract was incubated with wild-type probes, suggesting Sp1-specific binding (Fig. 3). 
Analysis of RPGR Promoter Region–Driven lacZ Expression in Transgenic Mice
To analyze the expression pattern of lacZ directed by the putative RPGR promoter in vivo, we made a construct containing the upstream sequence (−3065 to +28 bp) of the RPGR gene coupled to the lacZ gene/SV40 poly(A) signal sequence. Microinjection of the construct into fertilized oocytes generated several founder lines. We analyzed the expression of the RPGR promoter-lacZ gene by X-gal staining for β-galactosidase activity in a variety of tissues from the resultant transgenic mice, including brain, lung, kidney, and eye. The transgene was highly expressed in brain (olfactory lobes, cerebrum, cerebellum, and pineal gland, dorsal view) and retina, and was expressed at a lower level in trachea, renal pelvis, and renal cortex (Fig. 4). In sections of the X-gal–stained eyes, the blue signal was seen in retina but not in RPE, choroid, sclera, lens, or cornea. X-gal staining of retinal sections showed that the transgene was mainly expressed in the outer nuclear layer (rods and cones) and demonstrated a dorsal to ventral gradient across the retina. Weaker X-gal staining was also seen in the inner nuclear and ganglion cell layers (Fig. 5). Immunostaining with anti-β-galactosidase antibody showed that β-galactosidase was expressed in the outer nuclear layer at a high level and in the inner nuclear layer at a low level (see Supplementary Fig. S4), consistent with the expression pattern of the transgene detected by lacZ staining. 
Figure 4. 
 
Human RPGR gene 3098-bp upstream promoter-driven lacZ activities in different tissues from transgenic mice. No lacZ staining with X-gal was present in nontransgenic mice.
Figure 4. 
 
Human RPGR gene 3098-bp upstream promoter-driven lacZ activities in different tissues from transgenic mice. No lacZ staining with X-gal was present in nontransgenic mice.
Figure 5. 
 
Dorsal-ventral expression of human RPGR promoter-driven lacZ activity detected by X-gal staining in retinal sections from transgenic mice is shown in (A). Stronger lacZ activity was present in the outer nuclear layer in the dorsal retina (B) than in the ventral retina (C). No dorsal-ventral gradient distribution of lacZ staining was seen in the inner nuclear or ganglion cell layers.
Figure 5. 
 
Dorsal-ventral expression of human RPGR promoter-driven lacZ activity detected by X-gal staining in retinal sections from transgenic mice is shown in (A). Stronger lacZ activity was present in the outer nuclear layer in the dorsal retina (B) than in the ventral retina (C). No dorsal-ventral gradient distribution of lacZ staining was seen in the inner nuclear or ganglion cell layers.
Discussion
In an effort to understand the molecular basis of RPGR gene regulation, we have characterized the proximal promoter region of human RPGR. Mammalian promoters can be separated into two classes: TATA box enriched promoters, in which a TATA box directs transcription from a defined site; and TATA-less promoters, which contain multiple TSSs. 33 The TATA box was the first identified eukaryotic core promoter element and its consensus sequence binds the TATA-box binding protein, which is a subunit of the pre-initiation complex. 33 The TATA box is usually located 25 to 34 bp upstream of the TSS and directs the transcriptional apparatus to a single defined nucleotide position. 33,34 The TATA box is uncommon in vertebrates since only a minority of mouse and human genes have classical TATA box promoters. 33 Most mammalian genes have TATA-less promoters with multiple TSSs spreading over 50 to 100 bp. 35 EST data showed that RPGR has four TSSs and a predicted TATA box (−715 to −699 bp) in its promoter but it is located approximately 500 bp upstream from the four TSSs, suggesting that RPGR has a TATA-less promoter. Genes with TATA-less promoters are usually expressed more widely in tissues than those with a functional TATA box. The expression pattern of RPGR in adult tissues 2528 further supports the nature of the RPGR promoter as a TATA-less promoter. 
CpG islands represent genomic regions of DNA with a high G+C content and a high frequency of CpG dinucleotides. 36 A CpG island is usually defined as a region of at least 200 bp in length, with a GC percentage greater than 50% and an observed/expected CpG ratio greater than 60%. 36 Approximately 70% of human promoters contain a high CpG content and 50% of human promoters are associated with CpG islands. 37 Most promoter-associated CpG islands are unmethylated, whereas methylation of the CpG sites in the promoter of a gene may inhibit its expression. The CpG island–searching software strongly predicted a CpG island in the 5′ region of the human RPGR gene. The four predicted TSSs are in the CpG island, consistent with the broad distribution of TSSs in CpG islands. 34 The multiple TSSs and CpG island in the RPGR promoter region may contribute to the regulation of its expression in different tissues. 
The transcriptional activity of the 5′ flanking region of the human RPGR gene was assayed in the 293T and RPE1 cell lines, which showed that the 980-bp fragment upstream of the ATG start codon had the highest luciferase reporter activity, suggesting that it contains the DNA elements required for RPGR transcription. 33 The transcriptional activity was almost abolished when two predicted Sp1 sites (SP1A, SP1B) were mutated. The position of the Sp1 binding motif (especially SP1A) appears to be critical for the high basal activity of the RPGR promoter. This Sp1 site is also highly conserved during evolution (Fig. 2A) and lies close to the most common TSS (−142 bp). Sp1 is a member of the Sp family of transcription factors, which bind to the consensus GC box element and regulate gene expression during both physiological and pathological processes. 38 Sp1 is ubiquitously expressed in mammalian cell lines and tissues and both Sp1 and Sp4 are expressed in retina. 39,40 Sp1 has a role in regulating the transcription of photoreceptor-specific genes: it can activate the rod opsin promoter and competitively represses Sp4-mediated activation of the β-subunit of rod-specific cGMP-phosphodiesterase (β-PDE) promoter when co-expressed with Sp4. Sp1, Sp3, and Sp4 interact with the photoreceptor-enriched Crx transcription factor and exhibit functional synergy with Crx at the rod opsin promoter but not the β-PDE promoter. 41 Crx is a central regulator of many photoreceptor genes and plays a critical role in photoreceptor cell differentiation and maintenance. 42 Mutations in CRX cause cone-rod dystrophy, RP, and Leber's congenital amaurosis. 43 Crx regulates photoreceptor gene transcription through functional interactions with photoreceptor-specific transcription factors (Nrl, Nr2e3, and Crx) and with ubiquitously expressed transcription factors, such as Sp family members. 41-42 Our results demonstrate that Sp1 regulates RPGR transcription, although other photoreceptor-specific transcription factors, such as Crx and Nrl, may also be involved in its regulation. 
RPGR transcripts have been detected in several tissues from human and other species. 2528 The 3093-bp (−3065 to +28 bp) RPGR promoter can direct the expression of the lacZ reporter gene in retina, brain, kidney, and trachea (Fig. 4), consistent with the known expression pattern of native RPGR. In retina, the 3093-bp RPGR promoter was able to drive lacZ reporter expression, most strongly in the photoreceptor cell layer but also weakly in the inner nuclear and ganglion cell layers (Fig. 5), in agreement with earlier reports. 30,44 One explanation as to why RPGR mutations only affect retinal function despite this gene's wider tissue expression is because RPGR has several different isoforms, only some of which are involved in ocular disease (exon ORF15- containing isoforms). RPGR is predominantly expressed in ciliated cells, which are abundant in respiratory tract and renal tubules as well as retina, but the ORF15-containing isoform(s), is most abundant in nonmotile cilia, which are present in a restricted set of tissues, including photoreceptors and cochlear cells. 21,29,30 The proximal promoter that we have identified is likely to regulate basal expression of both ORF15 and non-ORF15–containing isoforms. 
Another interesting finding is that the RPGR promoter-driven lacZ reporter shows a gradient of expression from dorsal to ventral in the retina (Fig. 5). In mice, M opsin has a similar gradient of expression from dorsal to ventral but S opsin has a gradient of expression from ventral to dorsal. 45 RPGR KO mice show mislocalization of both M (green) and S (blue) cone opsins, 20 suggesting that the dorsal-to-ventral gradient of RPGR expression is unlikely to be functionally related to its proposed role in the transport of cone opsins. 20  
Supplementary Materials
References
Wright AF Chakarova CF Abd El-Aziz M Bhattacharya SS . Photoreceptor degeneration—genetic and mechanistic dissection of a complex trait. Nat Rev Genet . 2010;11:273–284. [CrossRef] [PubMed]
Bramall A Wright AF Jacobson SG McInnes RR . The genomic, biochemical and cellular responses of the retina in inherited photoreceptor degenerations, and prospects for the treatment of these disorders. Annu Rev Neurosci . 2010;33:441–472. [CrossRef] [PubMed]
Kajiwara K Berson EL Dryja TP . Digenic retinitis pigmentosa due to mutations at the unlinked peripherin/RDS and ROM1 loci. Science . 1994;264:1604–1608. [CrossRef] [PubMed]
Hussels-Maumenee I Pierce ER Bias WB Schleutermann DA . Linkage studies of typical retinitis pigmentosa and common markers. Am J Hum Genet . 1975;27:505–508. [PubMed]
Breuer DK Yashar BM Filippova E A comprehensive mutation analysis of RP2 and RPGR in a North American cohort of families with X-linked retinitis pigmentosa. Am J Hum Genet . 2002;70:1545–1554. [CrossRef] [PubMed]
Meindl A Dry K Herrmann K A gene (RPGR) with homology to the RCC1 guanine nucleotide exchange factor is mutated in X-linked retinitis pigmentosa (RP3). Nat Genet . 1996;13:35–42. [CrossRef] [PubMed]
Roepman R van Duijnhoven G Rosenberg T Positional cloning of the gene for X-linked retinitis pigmentosa 3: homology with the guanine-nucleotide exchange factor RCC1. Hum Mol Genet . 1996;5:1035–1041. [CrossRef] [PubMed]
Vervoort R Lennon A Bird AC Mutational hot spot within a new RPGR exon in X-linked retinitis pigmentosa. Nat Genet . 2000;25:462–466. [CrossRef] [PubMed]
Renault L Nassar N Vetter I The 1.7 A crystal structure of the regulator of chromosome condensation (RCC1) reveals a seven-bladed propeller. Nature . 1998;392:97–101. [CrossRef] [PubMed]
Wright AF Shu X . Focus on molecules: RPGR. Exp Eye Res . 2007;85:1–2. [CrossRef] [PubMed]
Shu X Black GC Rice JM RPGR mutation analysis and disease: an update. Hum Mutat . 2007;28:322–328. [CrossRef] [PubMed]
Shu X McDowall E Brown AF Wright AF . The human retinitis pigmentosa GTPase regulator gene variant database. Hum Mutat . 2008;29:605–608. [CrossRef] [PubMed]
Linari M Ueffing M Manson F Wright A Meitinger T Becker J . The retinitis pigmentosa GTPase regulator, RPGR, interacts with the delta subunit of rod cyclic GMP phosphodiesterase. Proc Natl Acad Sci U S A . 1999;96:1315–1320. [CrossRef] [PubMed]
Boylan JP Wright AF . Identification of a novel protein interacting with RPGR. Hum Mol Genet . 2000;9:2085–2093. [CrossRef] [PubMed]
Roepman R Bernoud-Hubac N Schick DE The retinitis pigmentosa GTPase regulator (RPGR) interacts with novel transport-like proteins in the outer segments of rod photoreceptors. Hum Mol Genet . 2000;9:2095–2105. [CrossRef] [PubMed]
Hong DH Yue G Adamian M Li T . Retinitis pigmentosa GTPase regulator (RPGRr)-interacting protein is stably associated with the photoreceptor ciliary axoneme and anchors RPGR to the connecting cilium. J Biol Chem . 2001;276:12091–12099. [CrossRef] [PubMed]
Dryja TP Adams SM Grimsby JL Null RPGRIP1 alleles in patients with Leber congenital amaurosis. Am J Hum Genet . 2001;68:1295–1298. [CrossRef] [PubMed]
Gerber S Perrault I Hanein S Complete exon-intron structure of the RPGR-interacting protein (RPGRIP1) gene allows the identification of mutations underlying Leber congenital amaurosis. Eur J Hum Genet . 2001;9:561–571. [CrossRef] [PubMed]
Zhao Y Hong DH Pawlyk B The retinitis pigmentosa GTPase regulator (RPGR)-interacting protein: subserving RPGR function and participating in disk morphogenesis. Proc Natl Acad Sci U S A . 2003;100:3965–3970. [CrossRef] [PubMed]
Hong DH Pawlyk BS Shang J Sandberg MA Berson EL Li T . A retinitis pigmentosa GTPase regulator (RPGR)-deficient mouse model for X-linked retinitis pigmentosa (RP3). Proc Natl Acad Sci U S A . 2000;97:3649–3654. [CrossRef] [PubMed]
Shu X Fry AM Tulloch B RPGR ORF15 isoform co-localizes with RPGRIP1 at centrioles and basal bodies and interacts with nucleophosmin. Hum Mol Genet . 2005;14:1183–1197. [CrossRef] [PubMed]
Khanna H Hurd TW Lillo C RPGR-ORF15, which is mutated in retinitis pigmentosa, associates with SMC1, SMC3, and microtubule transport proteins. J Biol Chem . 2005;280:33580–33587. [CrossRef] [PubMed]
Chang B Khanna H Hawes N In-frame deletion in a novel centrosomal/ciliary protein CEP290/NPHP6 perturbs its interaction with RPGR and results in early-onset retinal degeneration in the rd16 mouse. Hum Mol Genet . 2006;15:1847–1857. [CrossRef] [PubMed]
Khanna H Davis EE Murga-Zamalloa CA A common allele in RPGRIP1L is a modifier of retinal degeneration in ciliopathies. Nat Genet . 2009;41:739–745. [CrossRef] [PubMed]
Kirschner R Rosenberg T Schultz-Heienbrok R RPGR transcription studies in mouse and human tissues reveal a retina-specific isoform that is disrupted in a patient with X-linked retinitis pigmentosa. Hum Mol Genet . 1999;8:1571–1578. [CrossRef] [PubMed]
Shu X Zeng Z Eckmiller MS Developmental and tissue expression of Xenopus laevis RPGR. Invest Ophthalmol Vis Sci . 2006;47:348–356. [CrossRef] [PubMed]
Shu X Zeng Z Gautier P Zebrafish RPGR is required for normal retinal development and plays a role in dynein-based retrograde transport processes. Hum Mol Genet . 2010;19:657–670. [CrossRef] [PubMed]
Zhang Q Acland GM Wu WX Different RPGR exon ORF15 mutations in Canids provide insights into photoreceptor cell degeneration. Hum Mol Genet . 2002;11:993–1003. [CrossRef] [PubMed]
Hong DH Pawlyk B Sokolov M RPGR isoforms in photoreceptor connecting cilia and the transitional zone of motile cilia. Invest Ophthalmol Vis Sci . 2003;44:2413–2421. [CrossRef] [PubMed]
Mavlyutov TA Zhao H Ferreira PA . Species-specific subcellular localization of RPGR and RPGRIP isoforms: implications for the phenotypic variability of congenital retinopathies among species. Hum Mol Genet . 2002;11:1899–1907. [CrossRef] [PubMed]
Iannaccone A Breuer DK Wang XF Clinical and immunohistochemical evidence for an X linked retinitis pigmentosa syndrome with recurrent infections and hearing loss in association with an RPGR mutation. J Med Genet . 2003;40:e118. [CrossRef] [PubMed]
Brunner S Colman D Travis AJ Overexpression of RPGR leads to male infertility in mice due to defects in flagellar assembly. Biol Reprod . 2008;79:608–617. [CrossRef] [PubMed]
Sandelin A Carninci P Lenhard B Ponjavic J Hayashizaki Y Hume DA . Mammalian RNA polymerase II core promoters: insights from genome-wide studies. Nat Rev Genet . 2007;8:424–436. [CrossRef] [PubMed]
Wray GA Hahn MW Abouheif E The evolution of transcriptional regulation in eukaryotes. Mol Biol Evol . 2003;20:1377–1419. [CrossRef] [PubMed]
Frith MC Valen E Krogh A Hayashizaki Y Carninci P Sandelin A . A code for transcription initiation in mammalian genomes. Genome Res . 2008;18:1–12. [CrossRef] [PubMed]
Gardiner-Garden M Frommer M . CpG islands in vertebrate genomes. J Mol Biol . 1987;196:261–282. [CrossRef] [PubMed]
Antequera F Bird A . Number of CpG islands and genes in human and mouse. Proc Natl Acad Sci U S A . 1993;90:11995–11999. [CrossRef] [PubMed]
Tan NY Khachigian LM . Sp1 phosphorylation and its regulation of gene transcription. Mol Cell Biol . 2009;29:2482–2488. [CrossRef]
Hagen G Muller S Beato M Suske G . Cloning by recognition site screening of two novel GT box binding proteins: a family of Sp1 related genes. Nucleic Acids Res . 1992;20:5519–5525. [CrossRef] [PubMed]
Lerner LE Gribanova YE Ji M Knox BE Farber DB . Nrl and Sp nuclear proteins mediate transcription of rod-specific cGMP-phosphodiesterase β-subunit gene. J Biol Chem . 2001;276:34999–35007. [CrossRef] [PubMed]
Lerner LE Peng G Gribanova YE Chen S Farber D . Sp4 is expressed in retinal neurons, activates transcription of photoreceptor-specific genes, and synergizes with Crx. J Biol Chem . 2005;280:20642–20650. [CrossRef] [PubMed]
Hennig AK Peng GH Chen S . Regulation of photoreceptor gene expression by Crx-associated transcription factor network. Brain Res . 2008;1192:114–133. [CrossRef] [PubMed]
Rivolta C Berson EL Dryja TP . Dominant Leber congenital amaurosis, cone-rod degeneration, and retinitis pigmentosa caused by mutant versions of the transcription factor CRX. Hum Mutat . 2001;18:488–498. [CrossRef] [PubMed]
Trifunovic D Karali M Camposampiero D Ponzin D Banfi S Marigo V . A high-resolution RNA expression atlas of retinitis pigmentosa genes in human and mouse retinas. Invest Ophthalmol Vis Sci . 2008;49:2330–2336. [CrossRef] [PubMed]
Applebury ML Antoch MP Baxter LC The murine cone photoreceptor: a single cone type expresses both S and M opsins with retinal spatial patterning. Neuron . 2000;27:513–523. [CrossRef] [PubMed]
Footnotes
 Supported by RP Fighting Blindness and the Medical Research Council (UK) (AFW), the Royal Society of London, TENOVUS Scotland, National Eye Research Centre, Visual Research Trust, the W.H. Ross Foundation, the Rosetrees Trust, the Carnegie Trust for the Universities Scotland, and the Nuffield Foundation (XS).
Footnotes
 Disclosure: X. Shu, None; J.R. Simpson, None; A.W. Hart, None; Z. Zeng, None; S.R. Patnaik, None; P. Gautier, None; E. Murdoch, None; B. Tulloch, None; A.F. Wright, None
Figure 1. 
 
(A) Schematic representation of the 5′ region of the human RPGR gene investigated using reporter constructs generated in the pGL-3 vector. (B) The corresponding activities of the luciferase reporter gene in RPE1 and HEK 293T cell lines. The promoter-less plasmid pGL3-Basic was used as a negative control and the pGL3-Control plasmid containing an SV40 promoter and enhancer was used as a positive control. The Renilla luciferase plasmid was used as an internal control for the normalization of transfection efficiency. The activities of the reporter gene are expressed as -fold change relative to the activity of pGL3-Basic (an activity value of 1.0).
Figure 1. 
 
(A) Schematic representation of the 5′ region of the human RPGR gene investigated using reporter constructs generated in the pGL-3 vector. (B) The corresponding activities of the luciferase reporter gene in RPE1 and HEK 293T cell lines. The promoter-less plasmid pGL3-Basic was used as a negative control and the pGL3-Control plasmid containing an SV40 promoter and enhancer was used as a positive control. The Renilla luciferase plasmid was used as an internal control for the normalization of transfection efficiency. The activities of the reporter gene are expressed as -fold change relative to the activity of pGL3-Basic (an activity value of 1.0).
Figure 2. 
 
Effect of mutating predicted Sp1 sites on RPGR promoter activity in RPE1 and 293T cell lines. (A) The sequence conservation of the two most conserved Sp1 sites (SP1A, SP1B) 5′ of the human RPGR gene in 5 mammalian species. (B) Schematic representation of SP1A and SP1B mutation constructs. (C) The promoter activities of wild-type and SP1A or SP1B mutant reporter constructs. The promoter-less plasmid pGL3-Basic was used as a negative control, the pGL3-control plasmid containing an SV40 promoter was used as a positive control. The Renilla luciferase plasmid was used as an internal control for the normalization of transfection efficiency. The activities of the reporter gene are expressed as -fold change relative to the activity of pGL3-basic (an activity value of 1.0). Compared with wild type, SP1A, SP1B and SP1AB showed significantly reduced activities in both RPE1 and 293T cell lines (** P < 0.0001, t-test).
Figure 2. 
 
Effect of mutating predicted Sp1 sites on RPGR promoter activity in RPE1 and 293T cell lines. (A) The sequence conservation of the two most conserved Sp1 sites (SP1A, SP1B) 5′ of the human RPGR gene in 5 mammalian species. (B) Schematic representation of SP1A and SP1B mutation constructs. (C) The promoter activities of wild-type and SP1A or SP1B mutant reporter constructs. The promoter-less plasmid pGL3-Basic was used as a negative control, the pGL3-control plasmid containing an SV40 promoter was used as a positive control. The Renilla luciferase plasmid was used as an internal control for the normalization of transfection efficiency. The activities of the reporter gene are expressed as -fold change relative to the activity of pGL3-basic (an activity value of 1.0). Compared with wild type, SP1A, SP1B and SP1AB showed significantly reduced activities in both RPE1 and 293T cell lines (** P < 0.0001, t-test).
Figure 3. 
 
EMSA showing Sp1 binding to its two predicted sites in the RPGR promoter. The gel shift assay was performed with the nuclear extract isolated from HeLa cells and with radiolabeled probes derived from the RPGR promoter region containing putative Sp1 binding sites. The Sp1/DNA complex occurred with wild-type oligonucleotides (WT-probe, Sp1A: lane 2; Sp1B: lane 8), no complex was formed with mutant oligonucleotides (Mut-probe, Sp1Amut: lane 5; Sp1Bmut: lane 11). The anti-Sp1 antibody depletion assay showed ablation of the Sp1/DNA complex (Lanes 3 and 9). In the control (no nuclear extract added), no complex was seen (lanes 1, 4, 7, 10). NB, nonspecific binding.
Figure 3. 
 
EMSA showing Sp1 binding to its two predicted sites in the RPGR promoter. The gel shift assay was performed with the nuclear extract isolated from HeLa cells and with radiolabeled probes derived from the RPGR promoter region containing putative Sp1 binding sites. The Sp1/DNA complex occurred with wild-type oligonucleotides (WT-probe, Sp1A: lane 2; Sp1B: lane 8), no complex was formed with mutant oligonucleotides (Mut-probe, Sp1Amut: lane 5; Sp1Bmut: lane 11). The anti-Sp1 antibody depletion assay showed ablation of the Sp1/DNA complex (Lanes 3 and 9). In the control (no nuclear extract added), no complex was seen (lanes 1, 4, 7, 10). NB, nonspecific binding.
Figure 4. 
 
Human RPGR gene 3098-bp upstream promoter-driven lacZ activities in different tissues from transgenic mice. No lacZ staining with X-gal was present in nontransgenic mice.
Figure 4. 
 
Human RPGR gene 3098-bp upstream promoter-driven lacZ activities in different tissues from transgenic mice. No lacZ staining with X-gal was present in nontransgenic mice.
Figure 5. 
 
Dorsal-ventral expression of human RPGR promoter-driven lacZ activity detected by X-gal staining in retinal sections from transgenic mice is shown in (A). Stronger lacZ activity was present in the outer nuclear layer in the dorsal retina (B) than in the ventral retina (C). No dorsal-ventral gradient distribution of lacZ staining was seen in the inner nuclear or ganglion cell layers.
Figure 5. 
 
Dorsal-ventral expression of human RPGR promoter-driven lacZ activity detected by X-gal staining in retinal sections from transgenic mice is shown in (A). Stronger lacZ activity was present in the outer nuclear layer in the dorsal retina (B) than in the ventral retina (C). No dorsal-ventral gradient distribution of lacZ staining was seen in the inner nuclear or ganglion cell layers.
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×