Free
Physiology and Pharmacology  |   July 2013
Enzyme-Induced Vitreolysis Can Alleviate the Progression of Diabetic Retinopathy Through the HIF-1α Pathway
Author Affiliations & Notes
  • Chuanyin Li
    Department of Ophthalmology, Ninth People's Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China
  • Ping Chen
    Department of Ophthalmology, Ninth People's Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China
  • Jingfa Zhang
    Department of Ophthalmology, Tongji University School of Medicine, Shanghai, China
  • Limei Zhang
    Department of Ophthalmology, Tongji University School of Medicine, Shanghai, China
  • Xiaolin Huang
    Department of Ophthalmology, Ninth People's Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China
  • Yuting Yao
    Department of Ophthalmology, Ninth People's Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China
  • Xin Che
    Department of Ophthalmology, Ninth People's Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China
  • Xianqun Fan
    Department of Ophthalmology, Ninth People's Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China
  • Shengfang Ge
    Department of Ophthalmology, Ninth People's Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China
  • Zhiliang Wang
    Department of Ophthalmology, Ninth People's Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China
  • Correspondence: Zhiliang Wang, Department of Ophthalmology, Shanghai Ninth People's Hospital, Shanghai JiaoTong University School of Medicine, Shanghai, China; ophwzl@163.com
  • Shengfang Ge, Department of Ophthalmology, Shanghai Ninth People's Hospital, Shanghai JiaoTong University School of Medicine, Shanghai, China; geshengfang@sjtu.edu.cn
  • Xianqun Fan, Department of Ophthalmology, Shanghai Ninth People's Hospital, Shanghai JiaoTong University School of Medicine, Shanghai, China; fanxq@sh163.net
Investigative Ophthalmology & Visual Science July 2013, Vol.54, 4964-4970. doi:10.1167/iovs.12-11443
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to Subscribers Only
      Sign In or Create an Account ×
    • Get Citation

      Chuanyin Li, Ping Chen, Jingfa Zhang, Limei Zhang, Xiaolin Huang, Yuting Yao, Xin Che, Xianqun Fan, Shengfang Ge, Zhiliang Wang; Enzyme-Induced Vitreolysis Can Alleviate the Progression of Diabetic Retinopathy Through the HIF-1α Pathway. Invest. Ophthalmol. Vis. Sci. 2013;54(7):4964-4970. doi: 10.1167/iovs.12-11443.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

Purpose.: Westudied the mechanism by which complete posterior vitreous detachment by enzyme-induced vitreolysis alleviates the progression of diabetic retinopathy.

Methods.: We enrolled 50 diabetic rats and 20 normal control rats in this study. The right eyes of these diabetic rats were treated with a hyaluronidase (5 U) plus plasmin (0.25 U) by intravitreous injection (ET group), while the left eyes of diabetic rats (DR group) and eyes of the normal rats (NC group) were injected with balanced saline. Eight months after intravitreous injection, the oxygen concentration in the vitreous was measured, and the expression levels of hypoxia inducible factor-1α (HIF-1α), vascular endothelial growth factor (VEGF), pigment epithelium-derived factor (PEDF), and basic fibroblast growth factor (bFGF) in retinas were determined by real-time PCR and Western blot. Clinical observation, visual electrophysiology tests, and scanning electron microscopy (SEM) also were performed on the rats.

Results.: SEM results showed that the surface of retinas in the ET group had little vitreous cortex and the inner limiting membrane could be observed. The oxygen concentration of the midvitreous was higher in the ET group than other groups. A significantly high expression of HIF-1α, VEGF, and bFGF was detected in the retinas of the DR group compared to the ET and NC groups. In visual electrophysiology tests, amplitude decline and peak time latency were found in diabetic rats, and changes in the DR group were more obvious than in the ET group.

Conclusions.: Enzyme-induced vitreolysis can increase oxygen concentration in the vitreous, with reduced expression of HIF-1α, VEGF, and bFGF, and increased expression of PEDF in the retinas, thus alleviating the progression of diabetic retinopathy.

Introduction
Diabetic retinopathy (DR) is one of the most serious eye diseases that cause blindness. A variety of treatment methods are available for DR, such as vascular endothelial growth factor (VEGF) inhibitor, anti-inflammatory molecules, 1 and protein kinase C inhibitor C, 2 and so forth. After the appearance of retinal vascular disease, all of these interventions have shown limited efficacy. 3 Retinal laser and vitreous surgery are available, but are expensive. It has been shown that complete posterior vitreous detachment (PVD) can inhibit the development of diabetic retinopathy and diabetic patients with complete PVD are not vulnerable to proliferative diabetic retinopathy (PDR). 4 Pharmacologic vitreolysis is a therapy that induces PVD using drugs rather than surgery to treat vitreoretinal disease. 5 We reported previously that the combination of hyaluronidase and plasmin could induce complete PVD in diabetic rats. 3  
Hypoxia inducible factor-1α (HIF-1α) is the oxygen-regulated α-subunit of hypoxia-inducible transcription factor-1 (HIF-1), which is the upstream molecule of VEGF. Increased expression of HIF-1α and VEGF is found in rat diabetic retinas, and the HIF-1 pathway is activated in the retina in early diabetes. 6,7 Basic fibroblast growth factor (bFGF) is related to pathologic changes of the retinal vascular system in the early phase of DR. 8 Pigment epithelium-derived factor (PEDF), a member of the serine protease inhibitor family, has been shown to be a highly effective inhibitor of angiogenesis in animal and cell culture models. 9 VEGF and PEDF have counterbalancing proangiogenic and antiangiogenic activities in the conditions, such as retinal ischemia, proliferative diabetic retinopathy, and neovascular age-related macular degeneration (AMD). 10 The mean oxygen tension in the midvitreous in diabetic retinopathy has been shown to be lower than that in control subjects. 11 Vitrectomy or advanced vitreous degeneration can increase the oxygen concentration in the vitreous, but promote the progression of nuclear cataracts. 12  
The molecular mechanism of complete PVD that can alleviate the progression of diabetic retinopathy has not been reported to our knowledge. In our study, the vitreous was liquefied using plasmin plus hyaluronidase in diabetic rats to induce complete PVD according to our previous studies. 3 We then tested the oxygen concentration in the vitreous, and analyzed the expression of HIF-1α, VEGF, PEDF, and bFGF in the retinas. Clinical observation and visual electrophysiology tests were applied to monitor the changes in retinal function. 
Methods
Rat Diabetic Model
All animal experiments were performed in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research, the institutional guidelines for animal care at Shanghai Jiao Tong University, and were approved by the Animal Care and Use Committee of Shanghai Jiao Tong University. We purchased 70, 8-week-old male Sprague-Dawley rats (173 ± 22 g) from the Shanghai Slac Laboratory Animal Center (Shanghai, China) and housed and maintained them in specified pathogen–free (SPF)-graded animal rooms in the experimental animal center of Tongji University.Of the rats, 50 were intraperitoneally injected with a single dose of 60 mg/kg of streptozotocin (STZ; Sigma-Aldrich, St. Louis, MO) and the other 20 rats were injected with balanced saline as a control group. Plasma glucose levels were examined at 1, 3, 7, and 15 days after STZ injection with an automatic blood glucose meter. After 15 days, diabetic rats with plasma glucose values of 16.7 mmol/L (approximately 300 mg/dL) or higher were enrolled in the study. 
Complete PVD Induced by Intravitreous Injection of Hyaluronidase Plus Plasmin
At 16 days after STZ intraperitoneal injection, 49 diabetic rats (plasma glucose values ≥16.7 mmol/L) were enrolled as a diabetic model. The right eyes of these diabetic rats were treated with 5 μL hyaluronidase (5 U) plus plasmin (0.25 U) by intravitreous injection to induce complete posterior vitreous detachment (ET group), the left eyes were injected with 5 μL balanced saline (DR group), and the normal rats also were treated with 5 μL balanced saline (NC group). Of all the 49 diabetic rats, 4 rats died during 3 to 6 months after intravitreous injection, 12 diabetic rats died during 6 to 8 months after intravitreous injection, and the other 33 diabetic rats survived and were involved in this study. 
Clinical Observations
Slit-lamp examination and indirect ophthalmoscopic examination of all rats showed normal before the intravitreous injection. The same examinations were repeated at 1, 3, 7, and 15 days after STZ injection, and at 1, 3, 7, 30, 90, 180, and 240 days after intravitreous injection. 
Retinal Histopathology
At 8 months (240 days) after intravitreous injection, the eyeballs of 4 diabetic rats and 4 normal rats (4 DR, 4 ET and 4 NC) were removed under anesthesia, and the retinas subsequently were collected. After 24 hours fixation with 4% paraformaldehyde, the retinas were incubated with 3% trypsin buffer (Sigma-Aldrich) at 37°C for 2 to 3 hours, and then were washed, dried, and stained with hematoxylin and eosin (H&E). Retinal vascular structures were observed, images pictured, and the ratio of endothelial cells to pericytes calculated. 
Scanning Electron Microscopic (SEM) Examination
At 8 months after intravitreous injection, a scanning electron microscope (Hitachi S-450; Hitachi Ltd., Tokyo, Japan) examination was performed on the retinas of 4 diabetic rats and 4 normal control rats (4 NC, 4 DR, and 4 ET). The rats were anesthetized and eyes were enucleated as described above. The enucleated eyes were put immediately into 2% glutaraldehyde. After 24 hours fixation, the anterior segment was separated carefully from the posterior segment of the globe. Each retina was divided into two sample parts; the specimens were prepared for SEM as described previously. 3  
Visual Electrophysiology Tests
To detect the function of retinas in the three groups (NC, DR, and ET), flash electroretinogram (FERG) and oscillatory potentials (Ops) tests (TOMEY EP-1000; Tomey Corp., Nagoya, Japan) were performed on 25 diabetic rats and 10 normal rats (25 DR, 25 ET, and 20 NC) at 8 months after intravitreous injection. All rats received dark adaptation 12 hours before these tests. Ops and FERG parameters were measured using standard procedures with a light intensity of 3.556e−3 candela·s/m2
Measurement of Oxygen Concentrations in the Vitreous
The oxygen concentration in the vitreous was measured using an oxygen microsensor electrode with a tip diameter of 10 μm (Unisense, Aarhus, Denmark). Before measuring the concentration in the vitreous, the device was calibrated using water with different oxygen concentrations (0–162.5 μmol/L) at room temperature (RT). See Figure 3A for the microsensor entering the midvitreous of the eye. The values and depth of sensor entering the eyes were monitored by a Microprofiling system (Unisense). 
RNA Extraction, cDNA Synthesis, and Real-Time Quantitative PCR
At 8 months after intravitreous injection, 10 diabetic rats and 5 normal rats (10 DR, 10 ET, and 10 NC) were sacrificed, the eyes were enucleated immediately, and the retinas excised in ice-cold PBS under a dissecting microscope. For total RNA isolation, 0.5 mL of Trizol reagent (Invitrogen, Carlsbad, CA) was added to each retina sample. A hand-held homogenizer (Pro200; PRO Scientific, Oxford, CT) was used to break the retinal tissue into pieces, and 2.5 μg of total RNA was reverse-transcribed using a PrimeScript RT reagent Kit (TaKaRa, Dalian, China). Real-time quantitative PCR was performed to determine the messenger RNA (mRNA) levels of HIF-1α, VEGF, PEDF, and bFGF in the retinas of the three groups; β-actin was used as the internal control (primers are shown in Table 1). The PCR reactions consisted of 30 seconds at 95°C followed by 40 cycles at 95°C for 5 seconds, 60°C for 30 seconds, and 72°C for 30 seconds. Relative mRNA expression was calculated with the 2−ddCt method as described previously, 7 and one of the target gene expression level at the NC group was taken as 1. 
Table 1
 
Sequence of Real-Time PCR Primers
Table 1
 
Sequence of Real-Time PCR Primers
Gene Forward Primer Reverse Primer
β-actin CCTCTATGCCAACACAGTGC CATCGTACTCCTGCTTGCTG
VEGF AGGAGGCAAACCGATCGGAGCT TGGAGCACTGTCTGCGCACAC
bFGF AACGGCGGCTTCTTCCTGCG CCGTCCATCTTCCTTCATAGCCAGG
PEDF GTGGGCAACCAAGTTTGACT AGGGGCAGGAAGAAGATGAT
HIF-1α ACCGCAACTGCCACCACTGA TGGTGAGGCTGTCCGACTGTGA
Protein Isolation and Western Blot Analysis
To determine the protein levels of HIF-1α, VEGF, PEDF, and bFGF in three groups, retinas of 10 diabetic rats and 5 normal rats were obtained as described above, two retinas as a specimen. A total of 180 μL of protein lysis buffer RIPA (Beyotime, Shanghai, China) was added to each sample. A hand-held homogenizer (Pro200; PRO Scientific) was used to break the retinal tissue into pieces. Equivalent amounts of protein were subjected to SDS-polyacrylamide gel electrophoresis and transferred to 0.22 μm polyvinylidene fluoride (PVDF) membranes. They were blocked in 5% nonfat milk for 1 hour, and then the membrane was incubated with primary antibodies of HIF-1α (Abcam, Cambridge, MA), VEGF (Abcam), bFGF (Abcam), PEDF (Millipore, Billerica, MA), or β-actin (Sigma-Aldrich) overnight at 4°C. Secondary antibodies were labeled with IRDyes. Signals were visualized using an Odyssey Infra-red Imaging System (LI-COR Biosciences, Lincoln, NE). β-Actin was used as the internal control to normalize the loading materials. We read the gray value of every band with Odyssey and then calculated the ratio of the target protein/β-actin, and one of the NC group target protein expression/β-actin levels was taken as 1. 
Statistical Analysis
The results were presented as mean values ± SD. The difference between the two groups was analyzed using the two-tailed Student's t-test, and the difference of three groups was subjected to the post hoc test used for the ANOVA. A confidence level of P < 0.05 was considered statistically significant. 
Results
Body Weight and Plasma Glucose Level
After STZ intraperitoneal injection, the diabetic rats maintained higher levels of plasma glucose and grew more slowly than the control group. The changes of plasma glucose levels and body weight are summarized in Tables 2 and 3
Table 2
 
Body Weight of Rats at Different Time Points
Table 2
 
Body Weight of Rats at Different Time Points
Body Weight, g
Before STZ Injection 15 Days After STZ Injection 3 Mo After Intravitreous Injection 8 Mo After Intravitreous Injection
Normal 173 ± 22 234 ± 27* 467 ± 32† 613 ± 47†
Diabetic 227 ± 19 302 ± 21 345 ± 36
Table 3
 
Plasma Glucose Values of Rats at Different Time Points
Table 3
 
Plasma Glucose Values of Rats at Different Time Points
Plasma Glucose Values, mmol/L
Before STZ Injection 1 D After STZ Injection 15 D After STZ Injection 8 Mo After Intravitreous Injection
Normal 5.7 ± 2.3 6.2 ± 2.4 6.5 ± 2.1 7.2 ± 2.3
Diabetic 24.4 ± 5.6* 22.9 ± 6.5* 26.1 ± 4.6*
Clinical Observations
Before intravitreous injection, the ocular fundus could be seen, and no obvious exudates or bleeding was observed in diabetic rats and normal rats. One day after intravitreous injection, slight vitreous hemorrhage was seen in all three groups (NC, DR, and ET), but disappeared in 3 days. Three months after intravitreous injection, moderate edema was observed in the retinas of diabetic rats (DR and ET), while no edema was found in the normal rats (NC). Three months after intravitreous injection, obvious cataracts began to appear in some diabetic rats and we could not observe the fundus clearly. We graded cataracts into three types: type 1, slight opacification in the lens and the retinas could be seen clearly; type 2, moderate opacification in the lens and the retinas could be seen faintly; and type 3, severe opacification in the lens and the retinas could not be seen. As summarized in Table 4, the ET group was more likely to have cataracts and progressed faster than the DR group. 
Table 4
 
Cataract Classification and Statistic
Table 4
 
Cataract Classification and Statistic
3 Mo After Intravitreous Injection 6 Mo After Intravitreous Injection 8 Mo After Intravitreous Injection
NC, n = 20 DR, n = 49 ET, n = 49 NC, n = 20 DR, n = 45 ET, n = 45 NC, n = 20 DR, n = 33 ET, n = 33
Type 1 0 7 8 1 9 13 1 8 10
Type 2 0 1 2 0 5  7 1 9 14
Type 3 0 0 0 0 1  3 0 5  9
Total 0 8 10 1 15 23 2 22 32
The Different Ratios of Endothelial Cells to Pericytes
At 8 months after intravitreous injection, the ratio of endothelial cells to pericytes was significantly higher in the DR group compared to other two groups; although the ratio of endothelial cells to pericytes in the ET group was statistically higher than those in the NC group, it was much lower than those in the DR group (Fig. 1D). Representative images of retinal histopathology were shown in Figures 1A through 1C. 
Figure 1
 
Retinal histopathology and the ratio of endothelial cells to pericytes. Retinal vascular structures in the (A) NC group, (B) DR group, and (C) ET group. Black arrows denoted pericytes and gray arrows denoted endothelial cells. (D) The different ratios of endothelial cells to pericytes in the three groups (NC, DR, and ET groups, n = 4 per group).
Figure 1
 
Retinal histopathology and the ratio of endothelial cells to pericytes. Retinal vascular structures in the (A) NC group, (B) DR group, and (C) ET group. Black arrows denoted pericytes and gray arrows denoted endothelial cells. (D) The different ratios of endothelial cells to pericytes in the three groups (NC, DR, and ET groups, n = 4 per group).
SEM Examination
As shown in Figure 2, the surface of the retinas in the ET group was smooth with little vitreous cortex, the inner limiting membrane (ILM) could be observed, and completed PVD was confirmed. However, the retinal surfaces of the DR and NC groups were covered with vitreous cortex, and no ILM could be observed. Completed PVD was confirmed in all four eyes of the ET group. 
Figure 2
 
SEM examination of complete posterior vitreous detachment. (A) ×400 and (a) ×1000. The surface of retinas in the NC group (normal rats) was covered with vitreous cortex and the ILM could not be observed (B) ×400 and (b) ×1000. The surface of the retinas in the DR group (left eyes of the diabetic rats) was shown and the ILM could not be observed. (C) ×400 and (c) ×1000. The surface of the retinas in the ET group (the right eyes of the diabetic rats), had a little vitreous cortex and the ILM could be observed. Complete posterior vitreous detachment was confirmed (n = 4 per group).
Figure 2
 
SEM examination of complete posterior vitreous detachment. (A) ×400 and (a) ×1000. The surface of retinas in the NC group (normal rats) was covered with vitreous cortex and the ILM could not be observed (B) ×400 and (b) ×1000. The surface of the retinas in the DR group (left eyes of the diabetic rats) was shown and the ILM could not be observed. (C) ×400 and (c) ×1000. The surface of the retinas in the ET group (the right eyes of the diabetic rats), had a little vitreous cortex and the ILM could be observed. Complete posterior vitreous detachment was confirmed (n = 4 per group).
Figure 3
 
Oxygen concentration in the vitreous. (A) The oxygen concentration was measured at the midvitreous with an oxygen microsensor electrode with a tip diameter of 10 μm. (B) The oxygen concentrations in three groups (NC, DR, and ET) are indicated, and the left eyes and right eyes of one diabetic rat are connected by dotted lines (**P < 0.01, n = 10 per group).
Figure 3
 
Oxygen concentration in the vitreous. (A) The oxygen concentration was measured at the midvitreous with an oxygen microsensor electrode with a tip diameter of 10 μm. (B) The oxygen concentrations in three groups (NC, DR, and ET) are indicated, and the left eyes and right eyes of one diabetic rat are connected by dotted lines (**P < 0.01, n = 10 per group).
Visual Electrophysiology Tests
In FERG and Ops tests, diabetic rats (DR and ET groups) showed significantly declined amplitude and the latency of the peak times, compared to normal rats (NC group). Changes in the ET group were mild compared to the DR group (Table 5, 6). 
Table 5
 
The Changes of FERG Amplitude and Peak Time
Table 5
 
The Changes of FERG Amplitude and Peak Time
NC, n = 20 DR, n = 25 ET, n = 25 P1 P2 P3
a-Wave Amplitude, μV 21.5 ± 7.3 12.7 ± 6.7 14.4 ± 8.3 * *
peak time, ms 7.8 ± 2.5 15.5 ± 2.9 14.7 ± 3.4 * *
b-Wave Amplitude, μV 623.9 ± 153.4 183.7 ± 47.5 213.7 ± 47.1 *
peak time, ms 49.5 ± 3.2 63.2 ± 4.9 57.7 ± 5.8 * *
Table 6
 
The Changes of Ops Amplitude and Op2 Peak Time
Table 6
 
The Changes of Ops Amplitude and Op2 Peak Time
NC, n = 20 DR, n = 25 ET, n = 25 P1 P2 P3
Ops amplitude, μV 275.4 ± 67.5 173.9 ± 39.4 194.4 ± 47.2 * *
Peak time of OP2, ms 162.1 ± 39.6 182.9 ± 46.9 164.5 ± 52.7
Oxygen Concentration in the Vitreous
The oxygen concentration in the vitreous was measured as shown in Figure 3A. The oxygen concentration of the vitreous was much lower in the DR group (18.6 ± 7.6 μmol/mL) than those in the NC (36.7 ± 10.5 μmol/mL) and ET (44.3 ± 9.3 μmol/mL) groups (Fig. 3B). 
mRNA Levels of HIF-1α, VEGF, PEDF, and bFGF in Rat Retinas
The results of differential expression of angiogenesis-related factors are shown in Figure 4. Significantly high level of HIF-1α expression was detected in the DR group compared to the other two groups. Meanwhile, the downstream molecule of the HIF-1α pathway VEGF and angiogenesis-related factor bFGF were significantly high in the DR group. In contrast, PEDF, a natural antagonist for VEGF, was low in the DR group. Although VEGF and bFGF in the ET group were higher than those in the NC group, they were much lower than those in the DR group. PEDF was higher than those in the DR group. 
Figure 4
 
mRNA levels of HIF-1α, VEGF, PEDF, and bFGF in three groups (NC, DR, and ET, *P < 0.05, **P < 0.01, n = 10 per group).
Figure 4
 
mRNA levels of HIF-1α, VEGF, PEDF, and bFGF in three groups (NC, DR, and ET, *P < 0.05, **P < 0.01, n = 10 per group).
Differential Protein Expression of HIF-1α, VEGF, PEDF, and bFGF in Retinas
To confirm the expression of these molecules at protein level, we performed Western blot assay. As shown in Figure 5A, the protein expression was consistent with mRNA expression. Although HIF-1α, and two angiogenesis-related factors, VEGF and bFGF, in the ET group were higher than those in the NC group, they were much lower than those in the DR group. An increased PEDF expression also was detected in the ET group compared to the DR group (Fig. 5B). 
Figure 5
 
Differential protein expression in the three groups. (A) The bands of Western blot analysis. (B) Ratio of protein expression levels (*P < 0.05, **P < 0.01, n = 10 per group).
Figure 5
 
Differential protein expression in the three groups. (A) The bands of Western blot analysis. (B) Ratio of protein expression levels (*P < 0.05, **P < 0.01, n = 10 per group).
Discussion
The occurrence of PVD is due to a separation between the posterior vitreous type II collagen and the retinal ILM type IV collagen. These two types of collagen are connected mainly by molecular glue, such as laminin, fibronectin, and chondroitin sulfate proteins. 1315 Our previous study demonstrated that the combination of hyaluronidase (5 U) and plasmin (0.25 U) could induce complete PVD in diabetic rats. 3 Eight months after intravitreous injection, an SEM examination indicated that the surface of the retina after pharmacologic vitreolysis (ET group) was smooth with little vitreous cortex, so that the ILM could be observed. 
Ops is very sensitive to decreased blood supply in the retina and hypoxia; therefore, it is regarded as an important index of diabetic retinopathy. 16 In our study, we found increased Ops amplitudes and decreased peak times of Op2 in the ET group compared to the DR group. Measurement of oxygen tension in the vitreous, which is believed to reflect global oxygenation of the retina, demonstrated lower levels of oxygen in the vitreous of diabetic individuals than those in nondiabetic individuals. 11,17,18 Our study indicated that oxygen concentration in the midvitreous was higher in the ET group than the DR group. Lange et al. noted that oxygen tension in the midvitreous in proliferative diabetic retinopathy was lower than in normal humans, but higher in the retina, identifying significant intraocular oxygen gradients in proliferative diabetic retinopathy patients. 11 Their studies confirmed that the gelatinous vitreous limited oxygen transport, whereas the liquefied vitreous by enzymatic-assisted PVD would help the transport of oxygen from the retina into the vitreous cavity, and promote the flow of the aqueous humor easily into the vitreous cavity, which might lead to an increase in oxygen concentration in the vitreous cavity. Our diabetic rats only had induced DR but not PDR. More ideal animal models are required for studying vasculature of DR, since STZ-induced DR does not cause new vessel formation in the retina, although VEGF and bFGF are increased. 
Vitrectomy can prevent retinal hypoxia in branch retinal vein occlusion. 19 HIF-1 is a transcription factor induced by a reduction in molecular oxygen levels, 20 and can upregulate the expression of angiogenesis-related factors, VEGF and bFGF. 6 Our study indicated that the retinas of the ET group had lower expression of HIF-1α, VEGF, and bFGF than in the DR group, which may be caused by the facts that the liquefied vitreous increased vitreal O2 levels and exchange rate of O2 within the retina. This is beneficial in improving retinal hypoxia caused by DR. PEDF is a natural antagonist for VEGF. 2123 The retinas of normal rats had higher expression of PEDF than diabetic rats, and pharmacologic vitreolysis-induced complete PVD could increase the expression of PEDF. The ratio of endothelial cells to pericytes can reflect angiogenesis of the retina. Our previous study showed that the ratio was significantly increased at 12 weeks after STZ injection 3 ; the ratio was highest in the DR group at eighth month after intravitreous injection; however, PVD could reduce the ratio. This phenomenon coincides with increased expression of VEGF and bFGF in the DR group. However, PEDF increases following pharmacologic vitreolysis require further elaboration. 
The eyes with pharmacologic vitreolysis were more likely to suffer cataracts. Our study showed that eyes in the ET group had a higher incidence of cataract than in the DR group. Measurements in human and rabbit eyes have shown that oxygen is low in the central vitreous and near the lens. 2426 Vitrectomy or advanced vitreous degeneration increases the oxygen levels in the vitreous, thus promoting the progression of nuclear cataracts. Maintenance of a low oxygen concentration around the lens might prevent the formation of nuclear cataracts. 12,27,28 So, the enzymatic-assisted PVD increases vitreal O2 levels, which is beneficial in improving retinal hypoxia caused by DR, but on the other hand will lead to the formation of cataracts. 
DR has a negative effect on retinal function, leading to changes in the amplitude and peak time (a-wave and b-wave) in FERG tests. 29 Complete PVD induced by the combination of hyaluronidase and plasmin could improve retinal functions in DR rats. 
In conclusion, enzyme-induced vitreolysis increased oxygen concentration in the vitreous; reduced the expression of HIF-1α, VEGF, and bFGF; and increased PEDF expression, all of which could reduce the severity of some clinical signs of DR, but could not eradicate completely pathogenesis caused by DR. Further clinical trials are needed to confirm the therapeutic effects of the combination of hyaluronidase and plasmin in diabetic patients with retinopathy. 
Supplementary Materials
Acknowledgments
Supported by the Shanghai Leading Academic Discipline Project Grant S30205, the National Key Program for Basic Research of China Grant 2010CB529902, the National Natural Science Foundation of China Grants 81070757 and 31000443, the Science and Technology Commission of Shanghai (10JC1409100), and the Shanghai Health Bureau Project (2009075). The authors alone are responsible for the content and writing of the paper. 
Disclosure: C. Li, None; P. Chen, None; J. Zhang, None; L. Zhang, None; X. Huang, None; Y. Yao, None; X. Che, None; X. Fan, None; S. Ge, None; Z. Wang, None 
References
Campochiaro PA Brown DM Pearson A Long-term benefit of sustained-delivery fluocinolone acetonide vitreous inserts for diabetic macular edema. Ophthalmology . 2011; 118: 626–635. [CrossRef] [PubMed]
PKC-DRS Study Group. The effect of ruboxistaurin on visual loss in patients with moderately severe to very severe nonproliferative diabetic retinopathy: initial results of the Protein Kinase C beta Inhibitor Diabetic Retinopathy Study (PKC-DRS) multicenter randomized clinical trial. Diabetes . 2005; 54: 2188–2197. [CrossRef] [PubMed]
Zhi-Liang W Wo-Dong S Min L Xiao-Ping B Jin J. Pharmacologic vitreolysis with plasmin and hyaluronidase in diabetic rats. Retina . 2009; 29: 269–274. [CrossRef] [PubMed]
Ono R Kakehashi A Yamagami H Prospective assessment of proliferative diabetic retinopathy with observations of posterior vitreous detachment. Int Ophthalmol . 2005; 26: 15–19. [CrossRef] [PubMed]
Sebag J. Pharmacologic vitreolysis. Retina . 1998; 18: 1–3. [CrossRef] [PubMed]
Zhang J Hu LM Xu G Anti-VEGF effects of intravitreal erythropoietin in early diabetic retinopathy. Front Biosci (Elite Ed) . 2010; 2: 912–927. [CrossRef] [PubMed]
Li C Wu Q Liu B Detection and validation of circulating endothelial cells, a blood-based diagnostic marker of acute myocardial infarction. PLoS One . 2013; 8: e58478. [CrossRef] [PubMed]
Song E Dong Y Han LN Diabetic retinopathy: VEGF, bFGF and retinal vascular pathology. Chin Med J (Engl) . 2004; 117: 247–251. [PubMed]
Dawson DW Volpert OV Gillis P Pigment epithelium-derived factor: a potent inhibitor of angiogenesis. Science . 1999; 285: 245–248. [CrossRef] [PubMed]
Gao G Li Y Zhang D Gee S Crosson C Ma J. Unbalanced expression of VEGF and PEDF in ischemia-induced retinal neovascularization. FEBS Lett . 2001; 489: 270–276. [CrossRef] [PubMed]
Lange CA Stavrakas P Luhmann UF Intraocular oxygen distribution in advanced proliferative diabetic retinopathy. Am J Ophthalmol . 2011; 152: 406–412. [PubMed]
Shui YB Holekamp NM Kramer BC The gel state of the vitreous and ascorbate-dependent oxygen consumption: relationship to the etiology of nuclear cataracts. Arch Ophthalmol . 2009; 127: 475–482. [CrossRef] [PubMed]
Kakehashi A Ueno N Chakrabarti B. Molecular mechanisms of photochemically induced posterior vitreous detachment. Ophthalmic Res . 1994; 26: 51–59. [CrossRef] [PubMed]
Akiba J Ueno N Chakrabarti B. Molecular mechanisms of posterior vitreous detachment. Graefes Arch Clin Exp Ophthalmol . 1993; 231: 408–412. [CrossRef] [PubMed]
Sebag J Balazs EA. Morphology and ultrastructure of human vitreous fibers. Invest Ophthalmol Vis Sci . 1989; 30: 1867–1871. [PubMed]
Hancock HA Kraft TW. Oscillatory potential analysis and ERGs of normal and diabetic rats. Invest Ophthalmol Vis Sci . 2004; 45: 1002–1008. [CrossRef] [PubMed]
Holekamp NM Shui YB Beebe D. Lower intraocular oxygen tension in diabetic patients: possible contribution to decreased incidence of nuclear sclerotic cataract. Am J Ophthalmol . 2006; 141: 1027–1032. [CrossRef] [PubMed]
Maeda N Tano Y Ikeda T Imai T Hamano H Manabe R. Vitreous oxygen tension of proliferative diabetic retinopathy [in Japanese]. Nihon Ganka Gakkai Zasshi . 1992; 96: 511–515. [PubMed]
Stefansson E Novack RL Hatchell DL. Vitrectomy prevents retinal hypoxia in branch retinal vein occlusion. Invest Ophthalmol Vis Sci . 1990; 31: 284–289. [PubMed]
Fujita Y Kuchimaru T Kadonosono T In vivo imaging of brain ischemia using an oxygen-dependent degradative fusion protein probe. PLoS One . 2012; 7: e48051. [CrossRef] [PubMed]
Tombran-Tink J Barnstable CJ. Therapeutic prospects for PEDF: more than a promising angiogenesis inhibitor. Trends Mol Med . 2003; 9: 244–250. [CrossRef] [PubMed]
Bouck N. PEDF: anti-angiogenic guardian of ocular function. Trends Mol Med . 2002; 8: 330–334. [CrossRef] [PubMed]
Pons M Marin-Castaño ME. Nicotine increases VEGF/PEDF ratio in retinal pigment epithelium: a possible mechanism for CNV in passive smokers with AMD. Invest Ophthalmol Vis Sci . 2011; 52: 3842–3853. [CrossRef] [PubMed]
Holekamp NM Shui YB Beebe DC. Vitrectomy surgery increases oxygen exposure to the lens: a possible mechanism for nuclear cataract formation. Am J Ophthalmol . 2005; 139: 302–310. [CrossRef] [PubMed]
Barbazetto IA Liang J Chang S Zheng L Spector A Dillon JP. Oxygen tension in the rabbit lens and vitreous before and after vitrectomy. Exp Eye Res . 2004; 78: 917–924. [CrossRef] [PubMed]
Shui YB Fu JJ Garcia C Oxygen distribution in the rabbit eye and oxygen consumption by the lens. Invest Ophthalmol Vis Sci . 2006; 47: 1571–1580. [CrossRef] [PubMed]
Beebe DC Holekamp NM Siegfried C Shui YB. Vitreoretinal influences on lens function and cataract. Philos Trans R Soc Lond B Biol Sci . 2011; 366: 1293–1300. [CrossRef] [PubMed]
Stefansson E. Physiology of vitreous surgery. Graefes Arch Clin Exp Ophthalmol . 2009; 247: 147–163. [CrossRef] [PubMed]
Lin BQ Zhou JY Ma Y Deng YJ Zheng CJ Lin JL. Preventive effect of danhong huayu koufuye on diabetic retinopathy in rats. Int J Ophthalmol . 2011; 4: 599–604. [PubMed]
Footnotes
 CL and PC contributed equally to the work presented here and should therefore be regarded as equivalent authors.
Figure 1
 
Retinal histopathology and the ratio of endothelial cells to pericytes. Retinal vascular structures in the (A) NC group, (B) DR group, and (C) ET group. Black arrows denoted pericytes and gray arrows denoted endothelial cells. (D) The different ratios of endothelial cells to pericytes in the three groups (NC, DR, and ET groups, n = 4 per group).
Figure 1
 
Retinal histopathology and the ratio of endothelial cells to pericytes. Retinal vascular structures in the (A) NC group, (B) DR group, and (C) ET group. Black arrows denoted pericytes and gray arrows denoted endothelial cells. (D) The different ratios of endothelial cells to pericytes in the three groups (NC, DR, and ET groups, n = 4 per group).
Figure 2
 
SEM examination of complete posterior vitreous detachment. (A) ×400 and (a) ×1000. The surface of retinas in the NC group (normal rats) was covered with vitreous cortex and the ILM could not be observed (B) ×400 and (b) ×1000. The surface of the retinas in the DR group (left eyes of the diabetic rats) was shown and the ILM could not be observed. (C) ×400 and (c) ×1000. The surface of the retinas in the ET group (the right eyes of the diabetic rats), had a little vitreous cortex and the ILM could be observed. Complete posterior vitreous detachment was confirmed (n = 4 per group).
Figure 2
 
SEM examination of complete posterior vitreous detachment. (A) ×400 and (a) ×1000. The surface of retinas in the NC group (normal rats) was covered with vitreous cortex and the ILM could not be observed (B) ×400 and (b) ×1000. The surface of the retinas in the DR group (left eyes of the diabetic rats) was shown and the ILM could not be observed. (C) ×400 and (c) ×1000. The surface of the retinas in the ET group (the right eyes of the diabetic rats), had a little vitreous cortex and the ILM could be observed. Complete posterior vitreous detachment was confirmed (n = 4 per group).
Figure 3
 
Oxygen concentration in the vitreous. (A) The oxygen concentration was measured at the midvitreous with an oxygen microsensor electrode with a tip diameter of 10 μm. (B) The oxygen concentrations in three groups (NC, DR, and ET) are indicated, and the left eyes and right eyes of one diabetic rat are connected by dotted lines (**P < 0.01, n = 10 per group).
Figure 3
 
Oxygen concentration in the vitreous. (A) The oxygen concentration was measured at the midvitreous with an oxygen microsensor electrode with a tip diameter of 10 μm. (B) The oxygen concentrations in three groups (NC, DR, and ET) are indicated, and the left eyes and right eyes of one diabetic rat are connected by dotted lines (**P < 0.01, n = 10 per group).
Figure 4
 
mRNA levels of HIF-1α, VEGF, PEDF, and bFGF in three groups (NC, DR, and ET, *P < 0.05, **P < 0.01, n = 10 per group).
Figure 4
 
mRNA levels of HIF-1α, VEGF, PEDF, and bFGF in three groups (NC, DR, and ET, *P < 0.05, **P < 0.01, n = 10 per group).
Figure 5
 
Differential protein expression in the three groups. (A) The bands of Western blot analysis. (B) Ratio of protein expression levels (*P < 0.05, **P < 0.01, n = 10 per group).
Figure 5
 
Differential protein expression in the three groups. (A) The bands of Western blot analysis. (B) Ratio of protein expression levels (*P < 0.05, **P < 0.01, n = 10 per group).
Table 1
 
Sequence of Real-Time PCR Primers
Table 1
 
Sequence of Real-Time PCR Primers
Gene Forward Primer Reverse Primer
β-actin CCTCTATGCCAACACAGTGC CATCGTACTCCTGCTTGCTG
VEGF AGGAGGCAAACCGATCGGAGCT TGGAGCACTGTCTGCGCACAC
bFGF AACGGCGGCTTCTTCCTGCG CCGTCCATCTTCCTTCATAGCCAGG
PEDF GTGGGCAACCAAGTTTGACT AGGGGCAGGAAGAAGATGAT
HIF-1α ACCGCAACTGCCACCACTGA TGGTGAGGCTGTCCGACTGTGA
Table 2
 
Body Weight of Rats at Different Time Points
Table 2
 
Body Weight of Rats at Different Time Points
Body Weight, g
Before STZ Injection 15 Days After STZ Injection 3 Mo After Intravitreous Injection 8 Mo After Intravitreous Injection
Normal 173 ± 22 234 ± 27* 467 ± 32† 613 ± 47†
Diabetic 227 ± 19 302 ± 21 345 ± 36
Table 3
 
Plasma Glucose Values of Rats at Different Time Points
Table 3
 
Plasma Glucose Values of Rats at Different Time Points
Plasma Glucose Values, mmol/L
Before STZ Injection 1 D After STZ Injection 15 D After STZ Injection 8 Mo After Intravitreous Injection
Normal 5.7 ± 2.3 6.2 ± 2.4 6.5 ± 2.1 7.2 ± 2.3
Diabetic 24.4 ± 5.6* 22.9 ± 6.5* 26.1 ± 4.6*
Table 4
 
Cataract Classification and Statistic
Table 4
 
Cataract Classification and Statistic
3 Mo After Intravitreous Injection 6 Mo After Intravitreous Injection 8 Mo After Intravitreous Injection
NC, n = 20 DR, n = 49 ET, n = 49 NC, n = 20 DR, n = 45 ET, n = 45 NC, n = 20 DR, n = 33 ET, n = 33
Type 1 0 7 8 1 9 13 1 8 10
Type 2 0 1 2 0 5  7 1 9 14
Type 3 0 0 0 0 1  3 0 5  9
Total 0 8 10 1 15 23 2 22 32
Table 5
 
The Changes of FERG Amplitude and Peak Time
Table 5
 
The Changes of FERG Amplitude and Peak Time
NC, n = 20 DR, n = 25 ET, n = 25 P1 P2 P3
a-Wave Amplitude, μV 21.5 ± 7.3 12.7 ± 6.7 14.4 ± 8.3 * *
peak time, ms 7.8 ± 2.5 15.5 ± 2.9 14.7 ± 3.4 * *
b-Wave Amplitude, μV 623.9 ± 153.4 183.7 ± 47.5 213.7 ± 47.1 *
peak time, ms 49.5 ± 3.2 63.2 ± 4.9 57.7 ± 5.8 * *
Table 6
 
The Changes of Ops Amplitude and Op2 Peak Time
Table 6
 
The Changes of Ops Amplitude and Op2 Peak Time
NC, n = 20 DR, n = 25 ET, n = 25 P1 P2 P3
Ops amplitude, μV 275.4 ± 67.5 173.9 ± 39.4 194.4 ± 47.2 * *
Peak time of OP2, ms 162.1 ± 39.6 182.9 ± 46.9 164.5 ± 52.7
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×