December 2004
Volume 45, Issue 12
Free
Cornea  |   December 2004
Experimental Dry Eye Stimulates Production of Inflammatory Cytokines and MMP-9 and Activates MAPK Signaling Pathways on the Ocular Surface
Author Affiliations
  • Lihui Luo
    From the Ocular Surface Center, Cullen Eye Institute, Department of Ophthalmology, Baylor College of Medicine, Houston, Texas.
  • De-Quan Li
    From the Ocular Surface Center, Cullen Eye Institute, Department of Ophthalmology, Baylor College of Medicine, Houston, Texas.
  • Amish Doshi
    From the Ocular Surface Center, Cullen Eye Institute, Department of Ophthalmology, Baylor College of Medicine, Houston, Texas.
  • William Farley
    From the Ocular Surface Center, Cullen Eye Institute, Department of Ophthalmology, Baylor College of Medicine, Houston, Texas.
  • Rosa M. Corrales
    From the Ocular Surface Center, Cullen Eye Institute, Department of Ophthalmology, Baylor College of Medicine, Houston, Texas.
  • Stephen C. Pflugfelder
    From the Ocular Surface Center, Cullen Eye Institute, Department of Ophthalmology, Baylor College of Medicine, Houston, Texas.
Investigative Ophthalmology & Visual Science December 2004, Vol.45, 4293-4301. doi:10.1167/iovs.03-1145
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Lihui Luo, De-Quan Li, Amish Doshi, William Farley, Rosa M. Corrales, Stephen C. Pflugfelder; Experimental Dry Eye Stimulates Production of Inflammatory Cytokines and MMP-9 and Activates MAPK Signaling Pathways on the Ocular Surface. Invest. Ophthalmol. Vis. Sci. 2004;45(12):4293-4301. doi: 10.1167/iovs.03-1145.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

purpose. To evaluate whether experimentally induced dry eye in mice activates mitogen-activated protein kinase (MAPK) signaling pathways, c-Jun N-terminal kinases (JNK), extracellular-regulated kinases (ERK), and p38 and stimulates ocular surface inflammation.

methods. 129SvEv/CD-1 mixed mice aged 6 to 8 weeks were treated with systemic scopolamine and exposure to an air draft for different lengths of time, from 4 hours to 10 days. Untreated mice were used as the control. The concentrations of IL-1β and TNF-α in tear fluid washings and in corneal and conjunctival epithelia were measured by ELISA. MMP-9 in tear washings was evaluated by zymography, and gelatinase activity in the cornea and conjunctiva was determined by in situ zymography. Corneal and conjunctival epithelia were lysed in RIPA buffer for Western blot with MAPK antibodies, or they were lysed in 4 M guanidium thiocyanate solution for extraction of total RNA, which was used to determine gene expression by semiquantitative RT-PCR, real-time PCR, and gene array.

results. Compared with those in age-matched control subjects, the concentrations of IL-1β and MMP-9 in tear fluid washings and the concentrations of IL-1β and TNF-α and gelatinolytic activity in the corneal and conjunctival epithelia were significantly increased in mice receiving treatments to induce dry eye after 5 or 10 days. The expression of IL-1β, TNF-α, and MMP-9 mRNA by the corneal and conjunctival epithelia was also stimulated in mice treated for 5 or 10 days. The levels of phosphorylated JNK1/2, ERK1/2, and p38 MAPKs in the corneal and conjunctival epithelia were markedly increased as early as 4 hours after treatment, and they remained elevated up to 5 days.

conclusions. Experimental dry eye stimulates expression and production of IL-1β, TNF-α, and MMP-9 and activates MAPK signaling pathways on the ocular surface. MAPKs are known to stimulate the production of inflammatory cytokines and MMPs, and they could play an important role in the induction of these factors that have been implicated in the pathogenesis of dry eye disease.

There is increasing evidence that dry eye induces inflammation on the ocular surface that is responsible in part for the ocular surface epithelial diseases and irritation symptoms that develop. Increased levels of inflammatory mediators, including proinflammatory cytokines and chemokines, have been detected in the tear fluid and/or conjunctival epithelia of patients with keratoconjunctivitis sicca (KCS). 1 2 3 These inflammatory mediators appear to initiate an inflammatory cascade on the ocular surface, evidenced by increased expression of immune activation and adhesion molecules (HLA-DR and intracellular adhesion molecule [ICAM]-1) by the conjunctival epithelia. These molecules function to attract and retain inflammatory cells in the conjunctiva. Increased HLA-DR antigen expression by the conjunctival epithelium detected by flow cytometry has been observed as a consistent feature of dry eye. 4 Another pathologic change is an increased concentration and activity of matrix metalloproteinases (MMPs) in the tear fluid of patients with dry eye. 3 5 These enzymes, such as MMP-9, lyse a variety of different substrates including components of the corneal epithelial basement membrane and tight junction proteins (such as ZO-1 and occludin) that maintain corneal epithelial barrier function. 6 7 8 MMP-9 appears to play a physiological role in regulating corneal epithelial desquamation. In systemic vitamin A deficiency, there is reduced expression of MMP-9 and increased stratification of the corneal epithelium. 9 In contrast, the increased MMP-9 activity in KCS may be responsible in part for the deranged corneal epithelial barrier function (increased fluorescein permeability), increased corneal epithelial desquamation (punctuate epithelial erosions), and corneal surface irregularity 10 (Pflugfelder SC, et al. IOVS 2002;43:ARVO E-Abstract 3124). Another important pathologic finding in dry eye is increased apoptosis or programmed cell death of the ocular surface epithelia. 11 12 Clinical evidence indicates that these inflammatory mediators are relevant in the pathogenesis of KCS because anti-inflammatory therapies that target components of the inflammatory response to dry eye have been reported to have efficacy in treating the signs and symptoms of KCS. 13 The temporal sequence and mechanisms by which ocular surface dryness stimulates inflammation on the ocular surface have not been determined. We hypothesize that the ocular surface stress of dry eye, such as the hyperosmolar tear film that is recognized as a universal feature of dry eye, 14 stimulates the production and release of proinflammatory cytokines by the ocular surface epithelia and that this process is mediated by a group of key signaling molecules called mitogen-activated protein kinases (MAPKs). The MAPK cascades are well-conserved signaling pathways that include three subtypes: c-jun N-terminal kinases (JNK), extracellular signal-regulated kinases (ERK), and p38 MAPK. It has been reported that cellular stress (e.g., hyperosmotic saline) and inflammatory factors such as IL-1β and TNF-α activate JNK, ERK, and p38 MAPK signaling pathways in a variety of cell types, including epithelial cells, 15 vascular endothelial cells, 16 and fibroblasts. 17 18 The activated kinases initiate a cascade of protein phosphorylation involving multiple other kinases and activate nuclear transcription factors such as NFκB, AP-1, and ATF, 19 20 which stimulate expression of inflammatory cytokines, chemokines such as IL-8, 21 and MMPs such as MMP-1, -9, and -13. 22 23 The purpose of this study was to use a previously reported murine model of KCS to evaluate whether experimental dryness stimulates the expression and production of inflammatory molecules that have been identified in human KCS and activates MAPK signaling pathways. 
Animals and Methods
Mouse Model of Dry Eye
129SvEv/CD-1 mixed white mice aged 6 to 8 weeks were used for the study. All studies were performed in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. The mouse model of dry eye was created by a previously reported method 24 modified by placement of the mice in a blower hood at <40% humidity for 18 hours per day with subcutaneous injections of 0.5 mg/0.2 mL scopolamine hydrobromide (Sigma-Aldrich, St. Louis, MO) in alternating mouse hindquarters, administered four times a day at 9 AM, 12 PM, 3 PM, and 6 PM. The mice were treated for variable lengths of time, ranging from 4 hours to 1 day and 3, 5, and 10 days, depending on the parameter that was evaluated. Untreated age-matched mice were used as normal controls. To determine whether the scopolamine or dry atmosphere activates MAPKs, we treated mice (eight eyes per group) with a 1-μL drop of 10−3 M scopolamine, 25 with or without exposure to an air draft in a blower hood for 4 hours; or with exposure to an air draft in a blower hood alone for 4 hours; or with subcutaneous injections of 0.5 mg/0.2 mL scopolamine, with or without exposure to an air draft in a blower for 4 hours. Untreated age-matched mice were used as normal control subjects. 
Tear Fluid Washings
Tear fluid washings were collected by a previously reported method. 26 Briefly, 1.5 μL of PBS containing 0.1% bovine serum albumin (BSA) was instilled into the conjunctival sac. The tear fluid and buffer were collected with a 1-μL volume glass capillary tube (Drummond Scientific Co., Broomhall, PA) by capillary action from the tear meniscus in the lateral canthus. The 2-μL sample of tear washings was pooled from both eyes of each mouse and was stored at −80°C until zymography and ELISA were performed. 
ELISA and Gelatin Zymography
The corneal and conjunctival epithelia from five groups of mice (12 eyes per group), including untreated control mice and mice treated with subcutaneous injections of scopolamine and placement in a blower hood for 1 day or 3, 5, or 10 days, were collected, lysed and subjected to total protein assay with a bicinchoninic protein assay kit (Micro BCA; Pierce, Rockford, IL). The concentrations of IL-1β and TNF-α in the cell lysates and in the tear fluid washings were determined by ELISA kits for mouse IL-1β and TNF-α (Quantikine M Murine; R&D Systems, Minneapolis, MN), according to the manufacturer’s protocol. The level of gelatinolytic enzymes in tear fluid washings was measured by SDS-PAGE gelatin zymography, according to a previously reported method. 27 A 2-μL tear-washings sample (pooled from both eyes of each mouse) was added to SDS sample buffer and fractionated on an 8% polyacrylamide gel containing gelatin (0.5 mg/mL) by electrophoresis. The gels were soaked in 0.25% Triton X-100 for 30 minutes at RT to remove the SDS, then incubated in a digestion buffer containing 50 mM Tris-HCl, 150 mM NaCl, 10 mM CaCl2, 2 μM ZnSO4, 0.01% Brij-35, and 5 mM phenylmethylsulfonyl fluoride (PMSF), a serine protease inhibitor, at 37°C overnight to allow proteinase digestion of its substrate. The gels were rinsed in distilled water and stained with 0.25% Coomassie brilliant blue R-250 in 40% isopropanol for 2 hours and destained with 10% acetic acid. 
In Situ Zymography
In situ zymography was performed to localize the gelatinase activity in the cornea and conjunctiva by a modification of a previous method. 28 The fresh whole eyes with their eyelids and conjunctiva were embedded in a mixture of 75% (vol) OCT compound (Sakura Finetek USA. Inc., Torrance, CA) and 25% (vol) Immu-Mount (Thermo-Shandon, Pittsburgh, PA), then frozen in liquid nitrogen. Sections (10 μm) were cut on a cryostat (Leica, Wetzlar, Germany) and stored at −80°C until use. They were then thawed and incubated overnight with reaction buffer (0.05 M Tris-HCl [pH 7.6], 0.15 M NaCl, 5 mM CaCl2, and 0.2 mM NaN3), containing 40 μg/mL FITC-labeled DQ gelatin, which is available in a gelatinase-collagenase assay kit (EnzChek; Molecular Probes, Eugene, OR). As a negative control, 50 μM 1,10-phenanthroline, a inhibitor of metalloproteinases, was added to the reaction buffer before the FITC-labeled DQ gelatin was applied to frozen sections. Proteolysis of the FITC-labeled DQ gelatin substrate yields cleaved gelatin-FITC peptides that are fluorescent. The localization of fluorescence indicates the sites of net gelatinolytic activity. After incubation, the sections were washed three times with PBS for 5 minutes, counterstained with 1 μg/mL Hoechst 33342 dye (Sigma-Aldrich) in an anti-fade medium (Gel/Mount; Fisher, Atlanta, GA), and covered with 22 × 50 mm coverslip. The gelatinolytic activity of MMPs was localized and photographed by a fluorescence microscope (Eclipse E400; Nikon, Garden City, NY). Images were acquired by a digital camera (DMX 1200; Nikon). 
Western Blot Analysis
The corneal and conjunctival epithelia collected and pooled from each group were lysed in RIPA lysis buffer containing 50 mM Tris-HCl, 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 2 mM sodium fluoride, 2 mM EDTA, 0.1% SDS, and an EDTA-free protease inhibitor cocktail tablet (Roche Applied Science, Indianapolis, IN). The cell extracts were centrifuged at 14,000g for 15 minutes at 4°C, and the supernatants were used for experiments. The total protein concentrations of the cell extracts were determined with a protein assay kit (Micro BCA; Pierce). The protein samples (50 μg per lane) were mixed with 6× SDS reducing sample buffer and boiled for 5 minutes before loading. Proteins were separated by SDS polyacrylamide gel electrophoresis (4%–15% Tris-HCl; gradient gels from Bio-Rad, Hercules, CA) and transferred electronically to polyvinylidene difluoride (PVDF) membranes (Millipore, Bedford, MA). The membranes were blocked with 5% nonfat milk in TTBS (50 mM Tris [pH 7.5], 0.9% NaCl, and 0.1% Tween-20) for 1 hour at room temperature (RT) and then incubated 2 hours at RT with a 1:1000 dilution of rabbit antibody against phospho-p38 MAPK (Cell Signaling, Beverly, MA), 1:100 dilution of rabbit antibody against phospho-JNK, or 1:500 dilution of monoclonal antibody against phospho-p44/42 ERK (Santa Cruz Biotechnology, Santa Cruz, CA). After three washings with TTBS, the membranes were incubated for 1 hour at RT with the horseradish-peroxidase–conjugated secondary antibody goat anti-rabbit IgG (1:2000 dilution; Cell Signaling) or with goat anti-mouse IgG (1:5000 dilution; Pierce). After the membranes were washed four times, the signals were detected with an enhanced chemiluminescence reagent (ECL; Amersham, Piscataway, NJ) and the images were acquired (model 2000R; Eastman Kodak, New Haven, CT). The membranes were stripped in 62.5 mM Tris-HCl (pH 6.8), containing 2% SDS and 100 mM β-mercaptoethanol at 60°C for 30 minutes and then were reprobed with 1:100 dilution of rabbit antibody against JNK (Santa Cruz Biotechnology) or 1:1000 dilution of rabbit antibodies against ERK or p38 MAPK (Cell Signaling). These three antibodies detect both the phosphorylated and unphosphorylated forms that represent the total levels of the MAPKs. The signals were detected and captured as described earlier. 
RNA Isolation and Semiquantitative RT-PCR
Total RNA from the corneal and conjunctival epithelia collected and pooled from each group (10 eyes per group for each experiment) was isolated by an acid guanidium thiocyanate-phenol-chloroform extraction method, 29 and stored at −80°C until use. Gene expression was analyzed by reverse transcription–polymerase chain reaction (RT-PCR) 29 30 using a housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), as the internal control. In brief, first-strand cDNA was synthesized from 0.5 μg of total RNA with MuLV reverse transcriptase. PCR amplification of the first-strand cDNAs was performed with specific primer pairs for murine IL-1β, TNF-α, MMP-9, and GAPDH mRNA (Table 1) . Semiquantitative RT-PCR was established by terminating reactions at intervals of 24, 28, 32, 36, and 40 cycles for each primer pair to ensure that the PCR products formed were within the linear portion of the amplification curve. 
Real-Time PCR
The first-strand cDNA was synthesized from 1 μg of total RNA with random hexamer using M-MuLV reverse transcriptase (Ready-To-Go You-Prime First-Strand Beads; Amersham Pharmacia Biotech, Inc., Piscataway, NJ), as previously described. 31 Real-time PCR was performed with fluorogenic primers (LUX, Light Upon Extension; Invitrogen, Carlsbad, CA) 32 33 and a PCR master mix (Platinum Quantitative PCR Supermix-UDG; Invitrogen) in a thermocycler (Smart Cycler System; Cepheid, Sunnyvale, CA) according to the manufacturer’s recommendations. Assays were performed in duplicate. A nontemplate control was included in all the experiments to evaluate DNA contamination of the reagent used. The fluorogenic primers designed from published sequences using software provided by the manufacturer (LUX; Invitrogen) are listed in Table 2 . The results of quantitative real-time PCR were analyzed by the comparative threshold cycle (CT) method 32 33 and normalized by GAPDH as an internal control. 
Gene Array
The gene array analysis was performed with a kit (nonrad-GEArray Q Series for Mouse inflammatory cytokines and receptors; SuperArray Bioscience Corp., Frederick, MD) according to the manufacturer’s instructions. This array is designed to profile the expression of 96 cytokine and receptor genes associated with inflammatory response, as well as control sequences (PUC18 and blank as negative controls; β-actin and GAPDH as loading controls). In brief, first-strand cDNA was synthesized from 3 μg of total RNA of the corneal epithelia by reverse transcriptase, amplified, and labeled with biotin-16-dUTP by linear polymerase reaction (LPR) with DNA polymerase. The membranes (GEArray; SuperArray) were incubated with prehybridization solution at 60°C for 2 hours and then hybridized with the biotin-labeled cDNA probes overnight at 60°C in a hybridization oven with continuous agitation. After the membranes were washed and blocked, the biotin-labeled signals on the array membranes were bound to alkaline-phosphatase–conjugated streptavidin (AP) and detected by chemiluminescent substrate (CDP-Star; Amersham Pharmacia Biotech). The array images were acquired by a charge-coupled device (CCD) camera and imaging workstation (model 2000R; Eastman Kodak). Gene expression was quantitated by the microarray software (GEArray Analyzer; SuperArray) and normalized by the housekeeping genes β-actin and GAPDH. 
Statistical Analysis
Based on the normality of the data distribution, the t-test or Mann-Whitney test was used for statistical comparison of assay results between groups. 
Results
IL-1β ELISA and Gelatin Zymography in Tear Fluid Washings
Tear fluid washings (pooled from both eyes of each mouse) were collected from 12 mice before (day 0) and after treatment with subcutaneous injections of scopolamine and placement in a blower hood for 5 (day 5) or 10 (day 10) days. The concentrations of the proinflammatory cytokine IL-1β and MMP-9 were measured in these washings by ELISA and gelatin zymography, respectively. The IL-1β concentration significantly increased from 27.14 ± 11.20 pg/mL before treatment to 65.25 ± 23.75 pg/mL after treatment for 5 days (n = 12, P < 0.0005) and to 81.91 ± 45.67 pg/mL after treatment for 10 days (n = 12, P < 0.0005, compared with pretreatment values, Fig. 1 ). The IL-1β concentration in tear washings was slightly, but not significantly, higher at 10 days than it was at 5 days. Zymography showed that gelatinolytic bands of 105 kDa consistent with murine MMP-9 were present in the tear fluid washings of mice treated for 10 days. No gelatinolytic activity was detected in the tear fluid washings before treatment (Fig. 2)
IL-1β and TNF-α in the Corneal and Conjunctival Epithelia by ELISA
Determined by ELISA, the IL-1β concentration in the corneal and conjunctival epithelia was not significantly higher after treatment for 1 to 3 days (P > 0.05). The levels of IL-1β were significantly increased from 51.74 ± 26.08 pg/mg total protein in untreated corneal epithelia to 99.41 ± 31.66 pg/mg (P < 0.05) at day 5 and 116.18 ± 38.82 pg/mg (P < 0.01) at day 10 in the treated group. IL-1β in the conjunctival epithelia was also significantly stimulated from 51.50 ± 18.57 pg/mg in the untreated eyes to 87.24 ± 18.20 pg/mg at day 5 and 89.17± 21.69 pg/mg at day 10 (P < 0.01) in the treated group (Fig. 3A) . The concentration of TNF-α in the corneal and conjunctival epithelia was not significantly higher after treatment for 1 to 5 days (P > 0.05); however, by 10 days the concentration in the corneal and conjunctival epithelia was significantly increased to 30.55 ± 2.71 pg/mg (P < 0.01) and 20.59 ± 11.40 pg/mg (P < 0.05), respectively, compared with 11.12 ± 6.89 and 5.90 ± 3.24 pg/mg in untreated eyes, respectively (Fig. 3B)
In Situ Zymography on Ocular Surface Epithelia
In situ zymography showed that mice treated with systemic scopolamine and placement in a blower hood for 5 and 10 days had higher gelatinolytic activity in both the corneal (Fig. 4 [1]) and the conjunctival epithelia (Fig. 4 [2]) compared with untreated mice. 
Semiquantitative RT-PCR of IL-1β, TNF- α, and MMP-9 mRNA by Ocular Surface Epithelia
The levels of RNA transcripts encoding the inflammatory cytokines IL-1β, TNF-α, and MMP-9, as well as a housekeeping gene GAPDH, were evaluated by conventional semiquantitative RT-PCR with pooled total RNA samples of corneal or conjunctival epithelia obtained from four groups (10 eyes per group) of untreated mice and the mice treated with systemic scopolamine and placement in a blower hood for 1, 5, or 10 days (20 mice in each experiment). The levels of transcripts of IL-1β, TNF-α, and MMP-9 in the corneal and conjunctival epithelia of mice treated for 1 day were no different from untreated control eyes, but these were noted to increase at 5 and 10 days (Fig. 5)
Real-Time PCR of IL-1β, TNF- α, and MMP-9 mRNA by Ocular Surface Epithelia
The levels of IL-1β, TNF-α, and MMP-9 mRNA, as well as the housekeeping gene GAPDH, were evaluated by real-time PCR, using pooled total RNA samples of corneal or conjunctival epithelia (10 eyes per group) from untreated mice and mice treated for 1, 5, or 10 days (20 mice in each experiment). The use of real-time PCR confirmed the findings of conventional RT-PCR and provided a measure of the relative increase in mRNA levels of these factors after dry eye treatment. Quantitation of gene expression could be performed because the slope of the standard curve for each gene showed a similar efficiency of amplification (Fig. 6A) , and the real-time PCR produced a single specific product for each of the primer sets used (LUX; Invitrogen), proved by melting temperature analysis for each gene (Fig. 6B) . Nontemplate control experiments showed absence of DNA contamination. The comparative C T (threshold cycle) method was used to determine the difference (ΔC T) between the C T of each time point of the treatment and the C T of the untreated control. Before subtraction, the C T was normalized by the C T of an endogenous reference gene, GAPDH. The experiment was performed three times to ensure reproducibility of results. Because of a limited amount of RNA available from each experiment, not all sets of total RNA samples used for real-time PCR assays were from the same eyes that were used for the conventional RT-PCR shown in Figure 5 . Similar to the conventional RT-PCR, higher levels of IL-1β, TNF-α, and MMP-9 mRNAs were observed in the corneal (Fig. 7 , CE) and conjunctival (Fig. 7 , JE) epithelia after treatment for 5 or 10 days. 
Gene array for Expression of Inflammatory Cytokines and Receptors by the Corneal Epithelia
The findings of gene array analysis for mouse inflammatory cytokines and receptors further confirmed that dry eye increases the expression of inflammatory cytokines, especially IL-1β and TNF-α. Because IL-1β, TNF-α, and MMP-9 mRNA were observed to increase after 5 days of treatment by conventional RT-PCR and real-time PCR (Figs. 5 7) , we performed the gene array analysis using total RNAs from the untreated and the 5-day–treated corneal epithelia. Several transcripts of inflammatory cytokines and receptors were found to be stimulated in the corneal epithelia by day 5 of treatment, including IL-1β, IL-1 receptor 1 (IL-1R1), IL-1 receptor 2 (IL-1R2), TNF-α, and TNF receptor 1 (TNFR1), as shown in Figure 8
Activated JNK, ERK, and p38 MAP Kinases in the Ocular Surface Epithelia
The activation of JNK, ERK, and p38 MAPK pathways was evaluated by immunoblot analysis with phospho-antibodies against the activated forms of these kinases, by using pooled extracts of corneal or conjunctival epithelia from five groups (eight eyes per group) of untreated mice and the mice treated for 4 hours or 1 day or 3 or 5 days (20 mice in each experiment). As shown in Figure 9 , phosphorylated (p)-JNK1, p-JNK2, p-ERK1, p-ERK2, and p-p38 were markedly increased in the corneal and conjunctival epithelia of the mice treated from 4 hours up to 5 days. In contrast, levels of total JNK1/2, ERK1/2, and p38 were not changed. A different pattern of JNK1 and JNK2 activation was observed between corneal and conjunctival epithelia using the same antibody against p-JNK. Levels of 54-kDa p-JNK2 in response to dry eye showed greater increase in the corneal epithelia than in the conjunctival epithelia (Fig. 9B) . The effect of the scopolamine drop and/or blower fan on MAPK activation was evaluated in the corneal and conjunctival epithelia 4 hours after instillation of a 1-μL drop of 10−3 M scopolamine and/or placement in an air draft in a blower hood. There was no change in the level of activated MAPK with either of those treatments compared with untreated eyes. In contrast, MAPK activation was observed in mice treated with scopolamine injection and a blower for 4 hours, but it was not in mice treated with scopolamine injection alone. Figure 10 is a representative Western blot showing the effects of these treatments on ERK1 and -2 activation. These findings reveal that multiple MAPK signaling pathways are activated by the stress of dry eye and that this activation occurs rapidly, as early as 4 hours after induction of dry eye. 
Discussion
We previously reported a mouse model of dry eye created by systemic administration of the anticholinergic agent scopolamine and exposure to a low-humidity environment and air draft. 24 This experimentally induced dry eye results in reduced tear production and tear fluorescein clearance, altered corneal epithelial barrier function, reduced conjunctival goblet cell density, and increased conjunctival epithelial proliferation. These ocular surface epithelial changes mimic human KCS. In this subsequent study, we present evidence that experimental dry eye stimulates production of inflammatory factors (IL-1β, TNF-α, and MMP-9) and activates MAPK signaling pathways on the ocular surface epithelia. 
Ocular Surface Inflammation in Experimental Dry Eye
Increased levels of proinflammatory cytokines and MMPs have been observed on the ocular surface of patients with KCS. 2 34 35 36 Furthermore, inflammation has been observed to develop in neurturin-deficient mice that have naturally occurring and permanent dry eye. These mice have been observed to have increased concentrations of IL-1β and MMP-9 in tear fluid washings and stimulated expression of IL-1β, TNF-α, macrophage inflammatory protein 2 (MIP-2), cytokine-induced neutrophil chemoattractant (KC), and MMP-9 mRNA by the corneal epithelia as the dry eye develops with age. 26 The present study provides convincing evidence that ocular surface inflammation develops in response to experimentally induced dry eye in mice. The concentrations of IL-1β and MMP-9 in the tear fluid washings and gelatinolytic activity on the ocular surface epithelia were observed to increase significantly in mice treated with subcutaneous injections of scopolamine and placement in a blower hood for 5 or 10 days (Figs. 1 2 4) . The increased IL-1β concentration in the tear fluid washings could be due in part to a concentration effect caused by decreased tear volume. However, experimental evidence suggests that this is not the only cause. IL-1β was measured in tear fluid washings, rather than in pure collected tear fluid. IL-1β in the tear fluid was collected by placing a 1.5-μL drop of PBS on the ocular surface and collecting 1 μL. Therefore, all these samples were diluted tear washings, and the dilution factor was greater in the dry eyes. Using a fluorescein dilution method, we calculated the tear volume to be approximately 0.1 μL in normal eyes and 0.01 μL in dry eyes. Using these tear volumes, an approximate real tear concentration of IL-1β was calculated. In normal eyes, the tear fluid is diluted approximately 16 times (0.1 μL tears + 1.5 μL PBS). In contrast, the tear fluid in dry eyes was diluted approximately 151 times (0.01 μL tears + 1.5 μL PBS). The measured IL-1β concentrations of 20 and 80 pg/mL in the tear fluid washings of untreated mice and mice treated for 10 days, respectively (Fig. 1) , multiplied by these dilution factors, yields an estimated true tear fluid concentration of 320 pg/mL in normal eyes and 12,080 pg/mL in dry eyes. This estimated 38-fold difference is much higher than the 10-fold difference that would be expected from the difference in tear volume. Therefore, it is likely that the increased IL-1β concentration in the tear washings of mice with dry eye is produced by the lacrimal glands and/or the stressed ocular surface epithelia. We also found the concentrations of IL-1β and TNF-α significantly increased in the corneal and conjunctival epithelia of the mice treated for 5 or 10 days (Fig. 3) . In addition, both conventional RT-PCR and real-time PCR showed that the levels of IL-1β, TNF-α, and MMP-9 mRNA in the corneal and conjunctival epithelia noticeably increased in mice treated for 5 or 10 days, compared with untreated mice (Figs. 5 7) . The gene array data further supported that dry eye induces inflammation at the transcriptional level by showing increased expression of inflammatory cytokines (IL-1β, TNF-α) and their receptors (IL-1R1, IL-1R2, and TNFR1) in the corneal epithelia of the mice treated for 5 days (Fig. 8) . It is likely that elevated levels of these cytokines in the corneal epithelium were due to stimulated production by the corneal epithelial cells, because we did not detect any infiltration of inflammatory cells into the corneal epithelium over a 2-week dry eye treatment period. In contrast, slight infiltration of the conjunctival epithelium and stroma with inflammatory cells has been observed in this murine dry eye model, and these cells could be responsible for some of the increased levels of inflammatory cytokines. IL-1 is a potent inducer of other inflammatory cytokines such as IL-6 and TNF-α, and chemokines such as IL-8. 37 In mice, IL-1 and TNF-α stimulate the production of the key chemoattractants KC and MIP-2. 38 39 IL-1 and TNF-α also stimulate the production of MMPs by epithelial and inflammatory cells. 30 40 The gelatinase MMP-9 is one of the most important MMPs on the ocular surface. Overexpression of MMP-9 by the corneal epithelia has been reported to impede re-epithelialization of the cornea after experimental thermal injury in animal models and has been associated with sterile corneal ulceration in humans. 41 The concentration and activity of MMP-9 have been found to be significantly higher in the tear fluid of patients with KCS, with the highest levels observed in patients with sterile ulceration. 5 MMP-9 is also an efficient activator of latent precursor cytokines, including TGF-β1 and IL-1β. 42 We used multiple methods to demonstrate conclusively that ocular surface dryness induces the production of these key inflammatory factors and provides a model for studying their roles in the pathogenesis of KCS. 
Effect of Dry Eye on MAPK Signaling Pathways
MAPKs are major cell-signaling mediators that play vital roles in the cellular response to stress. The JNK and p38 MAPK cascades are strongly activated by cellular stresses, as well as by proinflammatory agents such as endotoxin, IL-1, and TNF-α. 43 44 45 In contrast, ERK MAPK is strongly activated by growth factors such as platelet-derived growth factor, as well as many other stimuli that mediate cell proliferation, differentiation, and survival. 46 Each MAPK pathway is activated by phosphorylation of threonine and tyrosine residues by upstream dual-specificity MAPK kinases (MKKs): ERK is activated by MKK1 and -2, p38 by MKK3 and -6, and JNK by MKK4 and -7. The mechanism of activation and the functional role of each MAPK cascade is dependent on the particular cell type and the type of stimuli used. 47 In this study, immunoblot analysis was performed with antibodies specific for the activated or phosphorylated forms of these MAPKs (p-JNK, p-ERK, and p-p38). Our findings showed that compared with untreated mice, the phosphorylated forms of JNK1/2, ERK1/2, and p38 were markedly increased in the corneal and conjunctival epithelia of the mice treated for 4 hours or 1 day or 3 or 5 days (Fig. 9) . Scopolamine drops and/or the blower in a dry atmosphere or scopolamine injection alone did not activate MAPKs after 4 hours of treatment. In contrast, scopolamine injection combined with exposure to a blower for 4 hours was found to activate MAPKs (Fig. 10) . It is possible that scopolamine or dry atmosphere has some effect on activation of MAPKs with long-term treatment. However, the dry eye stress on the ocular surface appeared to be primarily responsible for MAPKs activation in our dry eye model. We found that the levels of phospho-JNK2 in response to dry eye were higher in the corneal epithelia than in the conjunctival epithelia (Fig. 9B) . This may indicate that the cornea and conjunctiva differ in their reactivity to dry eye stress. In mice, this could be because only the cornea, but not the conjunctiva, is exposed in the palpebral aperture. 
MAPK intracellular signaling pathways have been demonstrated to play a central role in regulating a wide range of inflammatory responses in many different cell types. Activation of JNK/c-Jun and ERK1/2 MAPK signal transduction pathways leads to activation of murine peritoneal macrophages. 48 p38 MAPK activity mediates TNF-α and MIP-2 release, and migration of neutrophils and macrophages toward the chemokines MIP-2 and KC after lipopolysaccharide (LPS)-stimulation. 49 Cross-talk between ERK and p38 MAPK mediates selective suppression of proinflammatory cytokine production by TGF-β. 50 p38 kinase appears to be involved in the stimulated release of IL-1β and the sustained neutrophilic response in rat airway inflammation. 51 In addition, MAPK cascades regulate the expression and activity of some MMPs (MMP-9, -1, -3, and -13), through activation of transcription factors such as NFκB, AP-1, and ATF in different target cells. 22 52 53 54 These findings suggest that these three activated MAPK pathways could mediate the production of proinflammatory cytokines and MMP-9 by stressed ocular surface epithelia in our murine dry eye model. 
The mechanism of activation of MAPKs in this dry eye model is still unknown. The JNK, ERK, or p38 MAPK signaling pathways have been reported to be activated by inflammatory cytokines such as IL-1β and TNF-α, 43 45 47 which are also known to stimulate expression and activity of MMPs in a variety of cell types. 22 23 30 In this study, the production of IL-1β and TNF-α proteins in the corneal and conjunctival epithelia was not increased until treatment for 5 days (Fig. 3) , and the expression of their mRNA was not increased in 1-day treated mice (Figs. 5 7) . However, the levels of activated JNK, ERK, and p38 were observed to increase markedly within 4 hours of treatment (Fig. 9) . It suggests that the earlier activated MAPK signaling pathways in our dry eye model may play a role in the induction of inflammatory cytokines IL-1β and TNF-α, which could further trigger MAPK activation in turn and stimulate the expression of MMP-9. Further studies are needed to define the relationship between MAPK activation and stimulated production of IL-1β and TNF-α on the ocular surface. How are MAPKs activated in this model of dry eye? One of the original stimuli may come from the hyperosmotic stress of dry eye on the ocular surface. Hyperosmolarity of the tear film has been recognized as a key factor in the pathogenesis of dry eye and has been proposed as a gold standard for diagnosis of dry eye. 14 In a preliminary study, we found that hyperosmotic stress can activate the JNK pathway and stimulate the expression of the inflammatory cytokines (IL-1β and TNF-α) and MMP-9 by cultured human corneal epithelial cells (Li, et al. IOVS 2002;43:ARVO E-Abstract 1981). The effect of the tear film’s hyperosmolarity on the activation of MAPKs on the ocular surface epithelia of mice remains to be determined. 
In conclusion, our findings demonstrate that experimentally induced dry eye in mice stimulates ocular surface inflammation mimicking human KCS and activates three MAPK intracellular signaling pathways: JNKs, ERKs, and p38. These MAPKs may be relevant therapeutic targets in human KCS. 
 
Table 1.
 
Mouse Primer Sequences Used for RT-PCR
Table 1.
 
Mouse Primer Sequences Used for RT-PCR
Gene GeneBank Accession No. Sense Primer Antisense Primer PCR Product (bp)
IL-1β M15131 TGAGCTGAAAGCTCTCCACC CTGATGTACCAGTTGGGGAA 297
TNF-α M11731 TCAGCCTCTTCTCATTCCTG TGAAGAGAACCTGGGAGTAG 333
MMP-9 NM_013599 CGACGACGACGAGTTGTG CTGTGGTGCAGGCCGAATAG 128
GAPDH M32599 GCCAAGGTCATCCATGACAAC GTCCACCACCCTGTTGCTGTA 498
Table 2.
 
Primer Sequences Used for Real-Time PCR*
Table 2.
 
Primer Sequences Used for Real-Time PCR*
Gene GeneBank Accession No. Labeled Forward Primer, † Unlabeled Reverse Primer
IL-1β M15131 cacaggAGCAACGACAAAATACCTGtG TCTTCTTTGGGTATTGCTTGG
TNF-α M11731 caagcaCAGCCTCTTCTCATTCCTGCtTG GGGTCTGGGCCATAGAACTGA
MMP-9 NM_013599 cacaacCGACGACGACGAGTTGtG CTGTGGTGCAGGCCGAATAG
GAPDH M32599 catgcGGGAAGCTCACTGGCAtG GGTCCTCAGTGTAGCCCAAGA
Figure 1.
 
IL-1β concentration in tear fluid washings of mice before (day 0) and after treatment with systemic scopolamine and placement in a blower hood for 5 (day 5) or 10 (day 10) days by ELISA (n = 12 for each group). Data are mean ± SD (error bars) of results in three separate experiments, with four mice per experiment. *P < 0.0005, Mann–Whitney test.
Figure 1.
 
IL-1β concentration in tear fluid washings of mice before (day 0) and after treatment with systemic scopolamine and placement in a blower hood for 5 (day 5) or 10 (day 10) days by ELISA (n = 12 for each group). Data are mean ± SD (error bars) of results in three separate experiments, with four mice per experiment. *P < 0.0005, Mann–Whitney test.
Figure 2.
 
A representative zymogram showing 105-kDa MMP-9 bands in tear fluid washings samples from four mice after treatment with systemic scopolamine and placement in a blower hood for 10 days.
Figure 2.
 
A representative zymogram showing 105-kDa MMP-9 bands in tear fluid washings samples from four mice after treatment with systemic scopolamine and placement in a blower hood for 10 days.
Figure 3.
 
IL-1β (A) and TNF-α concentrations (B) in the corneal (CE) and conjunctival (JE) epithelia of untreated mice (Untreated) and mice treated with systemic scopolamine and placement in a blower hood for 1 day (day 1) or 3 (day 3), 5 (day 5), or 10 (day 10) days, measured by ELISA. Data show mean ± SD (error bars) of results in three separate experiments of four eyes per group for each experiment. *P < 0.05, **P < 0.01, n = 12, t-test.
Figure 3.
 
IL-1β (A) and TNF-α concentrations (B) in the corneal (CE) and conjunctival (JE) epithelia of untreated mice (Untreated) and mice treated with systemic scopolamine and placement in a blower hood for 1 day (day 1) or 3 (day 3), 5 (day 5), or 10 (day 10) days, measured by ELISA. Data show mean ± SD (error bars) of results in three separate experiments of four eyes per group for each experiment. *P < 0.05, **P < 0.01, n = 12, t-test.
Figure 4.
 
Representative in situ zymograms showing gelatinolytic activity in the corneal epithelia (1) and conjunctival epithelia (2) of untreated mice (A) and mice treated with systemic scopolamine and placed in a blower hood for 5 (C) or 10 (E) days, with counterstaining by Hoechst 33342 dye (B, D, F). Arrows: corneal epithelium. BCj, bulbar conjunctiva; TCj, tarsal conjunctiva.
Figure 4.
 
Representative in situ zymograms showing gelatinolytic activity in the corneal epithelia (1) and conjunctival epithelia (2) of untreated mice (A) and mice treated with systemic scopolamine and placed in a blower hood for 5 (C) or 10 (E) days, with counterstaining by Hoechst 33342 dye (B, D, F). Arrows: corneal epithelium. BCj, bulbar conjunctiva; TCj, tarsal conjunctiva.
Figure 5.
 
Representative semiquantitative RT-PCR showing the expression of IL-1β, TNF-α, and MMP-9 mRNA by corneal (CE) and conjunctival epithelia (JE) in age-matched untreated mice (UT) and mice treated with systemic scopolamine and placed in a blower hood for 1 day (D1) or 5 (D5) or 10 (D10) days, with GAPDH mRNA as an internal control.
Figure 5.
 
Representative semiquantitative RT-PCR showing the expression of IL-1β, TNF-α, and MMP-9 mRNA by corneal (CE) and conjunctival epithelia (JE) in age-matched untreated mice (UT) and mice treated with systemic scopolamine and placed in a blower hood for 1 day (D1) or 5 (D5) or 10 (D10) days, with GAPDH mRNA as an internal control.
Figure 6.
 
(A) A representative standard curve showing the starting template amount versus CT obtained by real-time PCR. (B) A representative melting curve analysis of real-time PCR products.
Figure 6.
 
(A) A representative standard curve showing the starting template amount versus CT obtained by real-time PCR. (B) A representative melting curve analysis of real-time PCR products.
Figure 7.
 
Real-time PCR analysis showing the relative changes of IL-1β, TNF-α, and MMP-9 mRNA by corneal (CE) and conjunctival epithelia (JE). The comparative CT method was used to determine the difference (ΔCT) between the CT of each sample from untreated mice (UT) and mice treated for 1 day (D1) or 5 (D5) or 10 days (D10), normalized to the CT of GAPDH. Data are the mean ± SD of results in three separate experiments.
Figure 7.
 
Real-time PCR analysis showing the relative changes of IL-1β, TNF-α, and MMP-9 mRNA by corneal (CE) and conjunctival epithelia (JE). The comparative CT method was used to determine the difference (ΔCT) between the CT of each sample from untreated mice (UT) and mice treated for 1 day (D1) or 5 (D5) or 10 days (D10), normalized to the CT of GAPDH. Data are the mean ± SD of results in three separate experiments.
Figure 8.
 
(A) A part of a representative gene array for mouse inflammatory cytokines and receptors, showing increased expression of IL-1β, IL-1R1, IL-1R2, TNF-α, and TNFR1 mRNA by the corneal epithelia in the mice treated with systemic scopolamine and placed in a blower hood for 5 days (D5), compared with age-matched untreated mice (UT). GAPDH and β-actin mRNA were used as an internal control. (B) Relative changes in IL-1β, IL-1R1, IL-1R2, TNF-α, and TNFR1 mRNA expression in mice treated for 5 days compared with untreated mice (mean ± SD of results in three separate experiments).
Figure 8.
 
(A) A part of a representative gene array for mouse inflammatory cytokines and receptors, showing increased expression of IL-1β, IL-1R1, IL-1R2, TNF-α, and TNFR1 mRNA by the corneal epithelia in the mice treated with systemic scopolamine and placed in a blower hood for 5 days (D5), compared with age-matched untreated mice (UT). GAPDH and β-actin mRNA were used as an internal control. (B) Relative changes in IL-1β, IL-1R1, IL-1R2, TNF-α, and TNFR1 mRNA expression in mice treated for 5 days compared with untreated mice (mean ± SD of results in three separate experiments).
Figure 9.
 
(A) Representative Western blot analysis showing the levels of phospho-JNKs (p-JNK1, p-JNK2), total JNKs (JNK1, JNK2), phospho-ERKs (p-ERK1, p-ERK2), total ERKs (ERK1, ERK2), phospho-p38 (p-p38), and total p38 (p-38) in the corneal (CE) and conjunctival epithelia (JE) of untreated mice (UT) and mice treated with systemic scopolamine and placed in a blower hood for 4 hours (4h), 1 day (D1), or 3 (D3) or 5 (D5) days. (B) The ratio of the intensity of p-MAPK to total MAPK (mean ± SD of results in three experiments) in corneal (CE) and conjunctival epithelia (JE) from untreated mice and mice treated for 4 hours or 1 day, 3 days, or 5 days.
Figure 9.
 
(A) Representative Western blot analysis showing the levels of phospho-JNKs (p-JNK1, p-JNK2), total JNKs (JNK1, JNK2), phospho-ERKs (p-ERK1, p-ERK2), total ERKs (ERK1, ERK2), phospho-p38 (p-p38), and total p38 (p-38) in the corneal (CE) and conjunctival epithelia (JE) of untreated mice (UT) and mice treated with systemic scopolamine and placed in a blower hood for 4 hours (4h), 1 day (D1), or 3 (D3) or 5 (D5) days. (B) The ratio of the intensity of p-MAPK to total MAPK (mean ± SD of results in three experiments) in corneal (CE) and conjunctival epithelia (JE) from untreated mice and mice treated for 4 hours or 1 day, 3 days, or 5 days.
Figure 10.
 
Representative Western blot analysis showing the levels of phospho-ERKs (p-ERK1, p-ERK2) and total ERKs (ERK1, ERK2) in the corneal (CE) and conjunctival (JE) epithelia of untreated mice (UT) and five groups of treated mice. One group of mice (eight eyes/four mice) received a 1-μL drop of 10−3 M scopolamine in each eye and remained in a normal atmosphere for 4 hours (SD). A second group of mice were exposed to an air draft in a blower hood alone for 4 hours (B). A third group of mice received a 1-μL drop of 10−3 M scopolamine and were placed in a blower hood for 4 hours (SD+B). A fourth group of mice received subcutaneous injections of 0.5 mg/0.2 mL scopolamine and remained in a normal atmosphere for 4 hours (SI). The fifth group of mice received subcutaneous injections of 0.5 mg/0.2 mL scopolamine and were placed in a blower hood for 4 hours (SI+B).
Figure 10.
 
Representative Western blot analysis showing the levels of phospho-ERKs (p-ERK1, p-ERK2) and total ERKs (ERK1, ERK2) in the corneal (CE) and conjunctival (JE) epithelia of untreated mice (UT) and five groups of treated mice. One group of mice (eight eyes/four mice) received a 1-μL drop of 10−3 M scopolamine in each eye and remained in a normal atmosphere for 4 hours (SD). A second group of mice were exposed to an air draft in a blower hood alone for 4 hours (B). A third group of mice received a 1-μL drop of 10−3 M scopolamine and were placed in a blower hood for 4 hours (SD+B). A fourth group of mice received subcutaneous injections of 0.5 mg/0.2 mL scopolamine and remained in a normal atmosphere for 4 hours (SI). The fifth group of mice received subcutaneous injections of 0.5 mg/0.2 mL scopolamine and were placed in a blower hood for 4 hours (SI+B).
Jones DT, Monroy D, Ji Z, Atherton SS, Pflugfelder SC. Sjögren’s syndrome: cytokine and Epstein-Barr viral gene expression within the conjunctival epithelium. Invest Ophthalmol Vis Sci. 1994;35:3493–3504. [PubMed]
Pflugfelder SC, Jones D, Ji Z, Afonso A, Monroy D. Altered cytokine balance in the tear fluid and conjunctiva of patients with Sjögren’s syndrome keratoconjunctivitis sicca. Curr Eye Res. 1999;19:201–211. [CrossRef] [PubMed]
Solomon A, Dursun D, Liu Z, Xie Y, Macri A, Pflugfelder SC. Pro- and anti-inflammatory forms of interleukin-1 in the tear fluid and conjunctiva of patients with dry-eye disease. Invest Ophthalmol Vis Sci. 2001;42:2283–2292. [PubMed]
Brignole F, Pisella PJ, Goldschild M, De Saint JM, Goguel A, Baudouin C. Flow cytometric analysis of inflammatory markers in conjunctival epithelial cells of patients with dry eyes. Invest Ophthalmol Vis Sci. 2000;41:1356–1363. [PubMed]
Afonso AA, Sobrin L, Monroy DC, Selzer M, Lokeshwar B, Pflugfelder SC. Tear fluid gelatinase B activity correlates with IL-1alpha concentration and fluorescein clearance in ocular rosacea. Invest Ophthalmol Vis Sci. 1999;40:2506–2512. [PubMed]
Sternlicht MD, Werb Z. How matrix metalloproteinases regulate cell behavior. Annu Rev Cell Dev Biol. 2001;17:463–516. [CrossRef] [PubMed]
Behzadian MA, Wang XL, Windsor LJ, Ghaly N, Caldwell RB. TGF-beta increases retinal endothelial cell permeability by increasing MMP-9: possible role of glial cells in endothelial barrier function. Invest Ophthalmol Vis Sci. 2001;42:853–859. [PubMed]
Asahi M, Wang X, Mori T, et al. Effects of matrix metalloproteinase-9 gene knock-out on the proteolysis of blood-brain barrier and white matter components after cerebral ischemia. J Neurosci. 2001;21:7724–7732. [PubMed]
Twining SS, Schulte DP, Zhou X, Wilson PM, Fish BL, Moulder JE. Changes in rat corneal matrix metalloproteinases and serine proteinases under vitamin A deficiency. Curr Eye Res. 1997;16:158–165. [CrossRef] [PubMed]
de Paiva S, Lindsey JL, Pflugfelder SC. Assessing the severity of keratitis sicca with videokeratoscopic indices. Ophthalmology. 2003;110:1102–1109. [CrossRef] [PubMed]
Gao J, Schwalb TA, Addeo JV, Ghosn CR, Stern ME. The role of apoptosis in the pathogenesis of canine keratoconjunctivitis sicca: the effect of topical cyclosporin A therapy. Cornea. 1998;17:654–663. [CrossRef] [PubMed]
Yeh S, Song XJ, Farley W, Li DQ, Stern ME, Pflugfelder SC. Apoptosis of ocular surface cells in experimentally induced dry eye. Invest Ophthalmol Vis Sci. 2003;44:124–129. [CrossRef] [PubMed]
Pflugfelder SC. Anti-inflammatory therapy of dry eye. The Ocular Surface. 2003;1:31–36. [CrossRef] [PubMed]
Farris RL. Tear osmolarity: a new gold standard?. Adv Exp Med Biol. 1994;350:495–503. [PubMed]
McDermott AM, Redfern RL, Zhang B, Pei Y, Huang L, Proske RJ. Defensin expression by the cornea: multiple signalling pathways mediate IL-1beta stimulation of hBD-2 expression by human corneal epithelial cells. Invest Ophthalmol Vis Sci. 2003;44:1859–1865. [CrossRef] [PubMed]
Huot J, Houle F, Marceau F, Landry J. Oxidative stress-induced actin reorganization mediated by the p38 mitogen-activated protein kinase/heat shock protein 27 pathway in vascular endothelial cells. Circ Res. 1997;80:383–392. [CrossRef] [PubMed]
Ridley SH, Sarsfield SJ, Lee JC, et al. Actions of IL-1 are selectively controlled by p38 mitogen-activated protein kinase: regulation of prostaglandin H synthase-2, metalloproteinases, and IL-6 at different levels. J Immunol. 1997;158:3165–3173. [PubMed]
MacGillivray M, Herrera-Abreu MT, Chow CW, et al. The protein tyrosine phosphatase SHP-2 regulates interleukin-1-induced ERK activation in fibroblasts. J Biol Chem. 2003;278:27190–27198. [CrossRef] [PubMed]
Li X, Commane M, Jiang Z, Stark GR. IL-1-induced NFkappa B and c-Jun N-terminal kinase (JNK) activation diverge at IL-1 receptor-associated kinase (IRAK). Proc Natl Acad Sci USA. 2001;98:4461–4465. [CrossRef] [PubMed]
Gupta S, Barrett T, Whitmarsh AJ, et al. Selective interaction of JNK protein kinase isoforms with transcription factors. EMBO J. 1996;15:2760–2770. [PubMed]
Loitsch SM, von Mallinckrodt C, Kippenberger S, Steinhilber D, Wagner TO, Bargon J. Reactive oxygen intermediates are involved in IL-8 production induced by hyperosmotic stress in human bronchial epithelial cells. Biochem Biophys Res Commun. 2000;276:571–578. [CrossRef] [PubMed]
Zeigler ME, Chi Y, Schmidt T, Varani J. Role of ERK and JNK pathways in regulating cell motility and matrix metalloproteinase 9 production in growth factor-stimulated human epidermal keratinocytes. J Cell Physiol. 1999;180:271–284. [CrossRef] [PubMed]
Johansson N, Ala-aho R, Uitto V, et al. Expression of collagenase-3 (MMP-13) and collagenase-1 (MMP-1) by transformed keratinocytes is dependent on the activity of p38 mitogen-activated protein kinase. J Cell Sci. 2000;113:227–235. [PubMed]
Dursun D, Wang M, Monroy D, et al. A mouse model of keratoconjunctivitis sicca. Invest Ophthalmol Vis Sci. 2002;43:632–638. [PubMed]
Yoshino K, Monroy D, Pflugfelder SC. Cholinergic stimulation of lactoferrin and epidermal growth factor secretion by the human lacrimal gland. Cornea. 1996;15:617–621. [PubMed]
Song XJ, Li DQ, Farley W, et al. Neurturin-deficient mice develop dry eye and keratoconjunctivitis sicca. Invest Ophthalmol Vis Sci. 2003;44:4223–4229. [CrossRef] [PubMed]
Sobrin L, Liu Z, Monroy DC, et al. Regulation of MMP-9 activity in human tear fluid and corneal epithelial culture supernatant. Invest Ophthalmol Vis Sci. 2000;41:1703–1709. [PubMed]
Duchossoy Y, Arnaud S, Feldblum S. Matrix metalloproteinases: potential therapeutic target in spinal cord injury. Clin Chem Lab Med. 2001;39:362–367. [PubMed]
Li DQ, Tseng SC. Three patterns of cytokine expression potentially involved in epithelial-fibroblast interactions of human ocular surface. J Cell Physiol. 1995;163:61–79. [CrossRef] [PubMed]
Li DQ, Lokeshwar BL, Solomon A, Monroy D, Ji Z, Pflugfelder SC. Regulation of MMP-9 production by human corneal epithelial cells. Exp Eye Res. 2001;73:449–459. [CrossRef] [PubMed]
Corrales RM, Galarreta DJ, Herreras JM, Calonge M, Chaves FJ. Normal human conjunctival epithelium expresses MUC13, MUC15, MUC16 and MUC17 mucin genes (in Spanish). Arch Soc Esp Oftalmol. 2003;78:375–381. [PubMed]
Nazarenko I, Pires R, Lowe B, Obaidy M, Rashtchian A. Effect of primary and secondary structure of oligodeoxyribonucleotides on the fluorescent properties of conjugated dyes. Nucleic Acids Res. 2002;30:2089–2195. [CrossRef] [PubMed]
Lowe B, Avila HA, Bloom FR, Gleeson M, Kusser W. Quantitation of gene expression in neural precursors by reverse-transcription polymerase chain reaction using self-quenched, fluorogenic primers. Anal Biochem. 2003;315:95–105. [CrossRef] [PubMed]
Barton K, Monroy DC, Nava A, Pflugfelder SC. Inflammatory cytokines in the tears of patients with ocular rosacea. Ophthalmology. 1997;104:1868–1874. [CrossRef] [PubMed]
Jones DT, Monroy D, Ji Z, Pflugfelder SC. Alterations of ocular surface gene expression in Sjögren’s syndrome. Adv Exp Med Biol. 1998;438:533–536. [PubMed]
Pflugfelder SC, Solomon A, Stern ME. The diagnosis and management of dry eye: a twenty-five-year review. Cornea. 2000;19:644–649. [CrossRef] [PubMed]
Selvan RS, Kapadia HB, Platt JL. Complement-induced expression of chemokine genes in endothelium: regulation by IL-1-dependent and -independent mechanisms. J Immunol. 1998;161:4388–4395. [PubMed]
Calkins CM, Bensard DD, Shames BD, et al. IL-1 regulates in vivo C-X-C chemokine induction and neutrophil sequestration following endotoxemia. J Endotoxin Res. 2002;8:59–67. [PubMed]
Tessier PA, Naccache PH, Clark-Lewis I, Gladue RP, Neote KS, McColl SR. Chemokine networks in vivo: involvement of C-X-C and C-C chemokines in neutrophil extravasation in vivo in response to TNF-alpha. J Immunol. 1997;159:3595–3602. [PubMed]
Woessner JF, Jr. Matrix metalloproteinases and their inhibitors in connective tissue remodeling. FASEB J. 1991;5:2145–2154. [PubMed]
Fini ME, Parks WC, Rinehart WB, et al. Role of matrix metalloproteinases in failure to re-epithelialize after corneal injury. Am J Pathol. 1996;149:1287–1302. [PubMed]
Schonbeck U, Mach F, Libby P. Generation of biologically active IL-1 beta by matrix metalloproteinases: a novel caspase-1-independent pathway of IL-1 beta processing. J Immunol. 1998;161:3340–3346. [PubMed]
Roberts ML, Cowsert LM. Interleukin-1 beta and reactive oxygen species mediate activation of c-Jun NH2-terminal kinases, in human epithelial cells, by two independent pathways. Biochem Biophys Res Commun. 1998;251:166–172. [CrossRef] [PubMed]
Finch A, Davis W, Carter WG, Saklatvala J. Analysis of mitogen-activated protein kinase pathways used by interleukin 1 in tissues in vivo: activation of hepatic c-Jun N-terminal kinases 1 and 2, and mitogen-activated protein kinase kinases 4 and 7. Biochem J. 2001;353:275–281. [CrossRef] [PubMed]
Raingeaud J, Gupta S, Rogers JS, et al. Pro-inflammatory cytokines and environmental stress cause p38 mitogen-activated protein kinase activation by dual phosphorylation on tyrosine and threonine. J Biol Chem. 1995;270:7420–7426. [CrossRef] [PubMed]
Dent P, Yacoub A, Fisher PB, Hagan MP, Grant S. MAPK pathways in radiation responses. Oncogene. 2003;22:5885–5896. [CrossRef] [PubMed]
Suzuki K, Hino M, Kutsuna H, et al. Selective activation of p38 mitogen-activated protein kinase cascade in human neutrophils stimulated by IL-1beta. J Immunol. 2001;167:5940–5947. [CrossRef] [PubMed]
Sodhi A, Biswas SK. Monocyte chemoattractant protein-1-induced activation of p42/44 MAPK and c-Jun in murine peritoneal macrophages: a potential pathway for macrophage activation. J Interferon Cytokine Res. 2002;22:517–526. [CrossRef] [PubMed]
Nick JA, Young SK, Brown KK, et al. Role of p38 mitogen-activated protein kinase in a murine model of pulmonary inflammation. J Immunol. 2000;164:2151–2159. [CrossRef] [PubMed]
Xiao YQ, Malcolm K, Worthen GS, et al. Cross-talk between ERK and p38 MAPK mediates selective suppression of pro-inflammatory cytokines by transforming growth factor-beta. J Biol Chem. 2002;277:14884–14893. [CrossRef] [PubMed]
Haddad EB, Birrell M, McCluskie K, et al. Role of p38 MAP kinase in LPS-induced airway inflammation in the rat. Br J Pharmacol. 2001;132:1715–1724. [CrossRef] [PubMed]
Reunanen N, Li SP, Ahonen M, Foschi M, Han J, Kahari VM. Activation of p38a mitogen-activated protein kinase enhances collagenase-1 (MMP-1) and stromelysin-1 (MMP-3) expression by mRNA stabilization. J Biol Chem. 2002;277:32360–32368. [CrossRef] [PubMed]
Liacini A, Sylvester J, Li WQ, Zafarullah M. Inhibition of interleukin-1-stimulated MAP kinases, activating protein- 1 (AP-1) and nuclear factor kappa B (NF-kappaB) transcription factors down-regulates matrix metalloproteinase gene expression in articular chondrocytes. Matrix Biol. 2002;21:251–262. [CrossRef] [PubMed]
Mengshol JA, Vincenti MP, Brinckerhoff CE. IL-1 induces collagenase-3 (MMP-13) promoter activity in stably transfected chondrocytic cells: requirement for Runx-2 and activation by p38 MAPK and JNK pathways. Nucleic Acids Res. 2001;29:4361–4372. [CrossRef] [PubMed]
Figure 1.
 
IL-1β concentration in tear fluid washings of mice before (day 0) and after treatment with systemic scopolamine and placement in a blower hood for 5 (day 5) or 10 (day 10) days by ELISA (n = 12 for each group). Data are mean ± SD (error bars) of results in three separate experiments, with four mice per experiment. *P < 0.0005, Mann–Whitney test.
Figure 1.
 
IL-1β concentration in tear fluid washings of mice before (day 0) and after treatment with systemic scopolamine and placement in a blower hood for 5 (day 5) or 10 (day 10) days by ELISA (n = 12 for each group). Data are mean ± SD (error bars) of results in three separate experiments, with four mice per experiment. *P < 0.0005, Mann–Whitney test.
Figure 2.
 
A representative zymogram showing 105-kDa MMP-9 bands in tear fluid washings samples from four mice after treatment with systemic scopolamine and placement in a blower hood for 10 days.
Figure 2.
 
A representative zymogram showing 105-kDa MMP-9 bands in tear fluid washings samples from four mice after treatment with systemic scopolamine and placement in a blower hood for 10 days.
Figure 3.
 
IL-1β (A) and TNF-α concentrations (B) in the corneal (CE) and conjunctival (JE) epithelia of untreated mice (Untreated) and mice treated with systemic scopolamine and placement in a blower hood for 1 day (day 1) or 3 (day 3), 5 (day 5), or 10 (day 10) days, measured by ELISA. Data show mean ± SD (error bars) of results in three separate experiments of four eyes per group for each experiment. *P < 0.05, **P < 0.01, n = 12, t-test.
Figure 3.
 
IL-1β (A) and TNF-α concentrations (B) in the corneal (CE) and conjunctival (JE) epithelia of untreated mice (Untreated) and mice treated with systemic scopolamine and placement in a blower hood for 1 day (day 1) or 3 (day 3), 5 (day 5), or 10 (day 10) days, measured by ELISA. Data show mean ± SD (error bars) of results in three separate experiments of four eyes per group for each experiment. *P < 0.05, **P < 0.01, n = 12, t-test.
Figure 4.
 
Representative in situ zymograms showing gelatinolytic activity in the corneal epithelia (1) and conjunctival epithelia (2) of untreated mice (A) and mice treated with systemic scopolamine and placed in a blower hood for 5 (C) or 10 (E) days, with counterstaining by Hoechst 33342 dye (B, D, F). Arrows: corneal epithelium. BCj, bulbar conjunctiva; TCj, tarsal conjunctiva.
Figure 4.
 
Representative in situ zymograms showing gelatinolytic activity in the corneal epithelia (1) and conjunctival epithelia (2) of untreated mice (A) and mice treated with systemic scopolamine and placed in a blower hood for 5 (C) or 10 (E) days, with counterstaining by Hoechst 33342 dye (B, D, F). Arrows: corneal epithelium. BCj, bulbar conjunctiva; TCj, tarsal conjunctiva.
Figure 5.
 
Representative semiquantitative RT-PCR showing the expression of IL-1β, TNF-α, and MMP-9 mRNA by corneal (CE) and conjunctival epithelia (JE) in age-matched untreated mice (UT) and mice treated with systemic scopolamine and placed in a blower hood for 1 day (D1) or 5 (D5) or 10 (D10) days, with GAPDH mRNA as an internal control.
Figure 5.
 
Representative semiquantitative RT-PCR showing the expression of IL-1β, TNF-α, and MMP-9 mRNA by corneal (CE) and conjunctival epithelia (JE) in age-matched untreated mice (UT) and mice treated with systemic scopolamine and placed in a blower hood for 1 day (D1) or 5 (D5) or 10 (D10) days, with GAPDH mRNA as an internal control.
Figure 6.
 
(A) A representative standard curve showing the starting template amount versus CT obtained by real-time PCR. (B) A representative melting curve analysis of real-time PCR products.
Figure 6.
 
(A) A representative standard curve showing the starting template amount versus CT obtained by real-time PCR. (B) A representative melting curve analysis of real-time PCR products.
Figure 7.
 
Real-time PCR analysis showing the relative changes of IL-1β, TNF-α, and MMP-9 mRNA by corneal (CE) and conjunctival epithelia (JE). The comparative CT method was used to determine the difference (ΔCT) between the CT of each sample from untreated mice (UT) and mice treated for 1 day (D1) or 5 (D5) or 10 days (D10), normalized to the CT of GAPDH. Data are the mean ± SD of results in three separate experiments.
Figure 7.
 
Real-time PCR analysis showing the relative changes of IL-1β, TNF-α, and MMP-9 mRNA by corneal (CE) and conjunctival epithelia (JE). The comparative CT method was used to determine the difference (ΔCT) between the CT of each sample from untreated mice (UT) and mice treated for 1 day (D1) or 5 (D5) or 10 days (D10), normalized to the CT of GAPDH. Data are the mean ± SD of results in three separate experiments.
Figure 8.
 
(A) A part of a representative gene array for mouse inflammatory cytokines and receptors, showing increased expression of IL-1β, IL-1R1, IL-1R2, TNF-α, and TNFR1 mRNA by the corneal epithelia in the mice treated with systemic scopolamine and placed in a blower hood for 5 days (D5), compared with age-matched untreated mice (UT). GAPDH and β-actin mRNA were used as an internal control. (B) Relative changes in IL-1β, IL-1R1, IL-1R2, TNF-α, and TNFR1 mRNA expression in mice treated for 5 days compared with untreated mice (mean ± SD of results in three separate experiments).
Figure 8.
 
(A) A part of a representative gene array for mouse inflammatory cytokines and receptors, showing increased expression of IL-1β, IL-1R1, IL-1R2, TNF-α, and TNFR1 mRNA by the corneal epithelia in the mice treated with systemic scopolamine and placed in a blower hood for 5 days (D5), compared with age-matched untreated mice (UT). GAPDH and β-actin mRNA were used as an internal control. (B) Relative changes in IL-1β, IL-1R1, IL-1R2, TNF-α, and TNFR1 mRNA expression in mice treated for 5 days compared with untreated mice (mean ± SD of results in three separate experiments).
Figure 9.
 
(A) Representative Western blot analysis showing the levels of phospho-JNKs (p-JNK1, p-JNK2), total JNKs (JNK1, JNK2), phospho-ERKs (p-ERK1, p-ERK2), total ERKs (ERK1, ERK2), phospho-p38 (p-p38), and total p38 (p-38) in the corneal (CE) and conjunctival epithelia (JE) of untreated mice (UT) and mice treated with systemic scopolamine and placed in a blower hood for 4 hours (4h), 1 day (D1), or 3 (D3) or 5 (D5) days. (B) The ratio of the intensity of p-MAPK to total MAPK (mean ± SD of results in three experiments) in corneal (CE) and conjunctival epithelia (JE) from untreated mice and mice treated for 4 hours or 1 day, 3 days, or 5 days.
Figure 9.
 
(A) Representative Western blot analysis showing the levels of phospho-JNKs (p-JNK1, p-JNK2), total JNKs (JNK1, JNK2), phospho-ERKs (p-ERK1, p-ERK2), total ERKs (ERK1, ERK2), phospho-p38 (p-p38), and total p38 (p-38) in the corneal (CE) and conjunctival epithelia (JE) of untreated mice (UT) and mice treated with systemic scopolamine and placed in a blower hood for 4 hours (4h), 1 day (D1), or 3 (D3) or 5 (D5) days. (B) The ratio of the intensity of p-MAPK to total MAPK (mean ± SD of results in three experiments) in corneal (CE) and conjunctival epithelia (JE) from untreated mice and mice treated for 4 hours or 1 day, 3 days, or 5 days.
Figure 10.
 
Representative Western blot analysis showing the levels of phospho-ERKs (p-ERK1, p-ERK2) and total ERKs (ERK1, ERK2) in the corneal (CE) and conjunctival (JE) epithelia of untreated mice (UT) and five groups of treated mice. One group of mice (eight eyes/four mice) received a 1-μL drop of 10−3 M scopolamine in each eye and remained in a normal atmosphere for 4 hours (SD). A second group of mice were exposed to an air draft in a blower hood alone for 4 hours (B). A third group of mice received a 1-μL drop of 10−3 M scopolamine and were placed in a blower hood for 4 hours (SD+B). A fourth group of mice received subcutaneous injections of 0.5 mg/0.2 mL scopolamine and remained in a normal atmosphere for 4 hours (SI). The fifth group of mice received subcutaneous injections of 0.5 mg/0.2 mL scopolamine and were placed in a blower hood for 4 hours (SI+B).
Figure 10.
 
Representative Western blot analysis showing the levels of phospho-ERKs (p-ERK1, p-ERK2) and total ERKs (ERK1, ERK2) in the corneal (CE) and conjunctival (JE) epithelia of untreated mice (UT) and five groups of treated mice. One group of mice (eight eyes/four mice) received a 1-μL drop of 10−3 M scopolamine in each eye and remained in a normal atmosphere for 4 hours (SD). A second group of mice were exposed to an air draft in a blower hood alone for 4 hours (B). A third group of mice received a 1-μL drop of 10−3 M scopolamine and were placed in a blower hood for 4 hours (SD+B). A fourth group of mice received subcutaneous injections of 0.5 mg/0.2 mL scopolamine and remained in a normal atmosphere for 4 hours (SI). The fifth group of mice received subcutaneous injections of 0.5 mg/0.2 mL scopolamine and were placed in a blower hood for 4 hours (SI+B).
Table 1.
 
Mouse Primer Sequences Used for RT-PCR
Table 1.
 
Mouse Primer Sequences Used for RT-PCR
Gene GeneBank Accession No. Sense Primer Antisense Primer PCR Product (bp)
IL-1β M15131 TGAGCTGAAAGCTCTCCACC CTGATGTACCAGTTGGGGAA 297
TNF-α M11731 TCAGCCTCTTCTCATTCCTG TGAAGAGAACCTGGGAGTAG 333
MMP-9 NM_013599 CGACGACGACGAGTTGTG CTGTGGTGCAGGCCGAATAG 128
GAPDH M32599 GCCAAGGTCATCCATGACAAC GTCCACCACCCTGTTGCTGTA 498
Table 2.
 
Primer Sequences Used for Real-Time PCR*
Table 2.
 
Primer Sequences Used for Real-Time PCR*
Gene GeneBank Accession No. Labeled Forward Primer, † Unlabeled Reverse Primer
IL-1β M15131 cacaggAGCAACGACAAAATACCTGtG TCTTCTTTGGGTATTGCTTGG
TNF-α M11731 caagcaCAGCCTCTTCTCATTCCTGCtTG GGGTCTGGGCCATAGAACTGA
MMP-9 NM_013599 cacaacCGACGACGACGAGTTGtG CTGTGGTGCAGGCCGAATAG
GAPDH M32599 catgcGGGAAGCTCACTGGCAtG GGTCCTCAGTGTAGCCCAAGA
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×