May 2003
Volume 44, Issue 5
Free
Retinal Cell Biology  |   May 2003
Differential Temporal and Spatial Expression of Immediate Early Genes in Retinal Neurons after Ischemia–Reperfusion Injury
Author Affiliations
  • Nagahisa Yoshimura
    From the Department of Ophthalmology and the
  • Takanobu Kikuchi
    Research Center for Instrumental Analysis, Shinshu University School of Medicine, Matsumoto, Japan.
  • Sachiko Kuroiwa
    From the Department of Ophthalmology and the
  • Satoko Gaun
    From the Department of Ophthalmology and the
Investigative Ophthalmology & Visual Science May 2003, Vol.44, 2211-2220. doi:10.1167/iovs.02-0704
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Nagahisa Yoshimura, Takanobu Kikuchi, Sachiko Kuroiwa, Satoko Gaun; Differential Temporal and Spatial Expression of Immediate Early Genes in Retinal Neurons after Ischemia–Reperfusion Injury. Invest. Ophthalmol. Vis. Sci. 2003;44(5):2211-2220. doi: 10.1167/iovs.02-0704.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

purpose. To investigate genes that are up- and downregulated in rat retinal ischemia–reperfusion injury systematically by using an oligonucleotide microarray system and to determine temporal and spatial expression changes of some genes that showed upregulation in the analysis.

methods. Retinal ischemia was induced in rats by increasing intraocular pressure to 110 mm Hg for 1 hour. Gene expression at 12 hours after reperfusion was compared with that in the control retina by using oligonucleotide microarrays that display a total of 8800 genes and expressed sequence tags (ESTs). Temporal and spatial expression changes of immediate early genes and cell-cycle–related genes were studied by using real-time polymerase chain reaction (PCR) and immunohistochemical methods.

results. At 12 hours after reperfusion, 135 genes and ESTs were found to be up- or downregulated. The upregulated genes were classified into seven groups: (1) immediate early genes; (2) cell-cycle–related genes; (3) stress-responsive protein genes; (4) cell-signaling protein genes; (5) cell-adhesion and cell surface protein genes; (6) genes for translation and protein turnover; and (7) genes for metabolism. Real-time PCR analyses showed peaks of Fra-1 expression at 6 hours after reperfusion, whereas those for c-Jun, Jun B, and cyclin D1 were at 24 hours. Fra-1 and Jun B immunoreactivities were found in Müller cells, whereas c-Jun and cyclin D1 immunoreactivities were found in apoptotic retinal neurons.

conclusions. Gene expression changes after a retinal ischemia–reperfusion injury were profiled by using an oligonucleotide microarray system. Seven groups of genes were found to be upregulated by the injury. Among the immediate early genes, Fra-1 and Jun B immunoreactivities were found in Müller cells whereas c-Jun and cyclin D1 immunoreactivities were found in apoptotic retinal neurons.

Animal models of retinal ischemia–reperfusion mimic human retinal diseases such as central retinal arterial occlusion or branch retinal arterial occlusion. Convenient animal models of retinal ischemia–reperfusion have been devised, 1 2 and such models are used to study the pathobiology of human diseases. Also, in this model, a variety of phenomena occur, including synthesis of inflammatory mediators, oxygen-derived free radicals, and lipid mediators. 3 4 5 6 7 Furthermore, the retinal ischemia–reperfusion model is useful to study retinal neuronal cell death. In the model, after reperfusion, a large population of retinal neurons dies by apoptosis, although there are some neurons that die by necrosis. 8 9 10 11 12 In this retinal injury model, neurons in the retinal ganglion cell layer are first damaged and then those in the inner nuclear layer become apoptotic. Finally, a relatively small population of photoreceptor cells dies. 9  
Many hypotheses have been proposed to explain the molecular mechanisms of retinal neuronal apoptosis. 12 Among the possible mechanisms, glutamate toxicity, and generation of reactive oxygen species are thought to be important. 12 13 14 15 16 We have shown earlier that the aberrant expressions of c-Jun and cyclin D1 play a role in neuronal apoptosis in the inner nuclear layer after ischemia–reperfusion injury. 9  
Because apoptosis is a process in which upregulation of death messages plays a major role, studies of such upregulated genes may reveal the molecular mechanisms involved in retinal neuronal apoptosis and may thus give us a clue to aid in development of new therapeutic modalities. However, there must be many genes that are up- or downregulated in the process of retinal apoptosis after the ischemia–reperfusion injury. With the conventional candidate gene approach, systematic studies of so many important genes are time consuming and almost impossible. In addition, with this approach, we may overemphasize the roles of specific genes and overlook more important genes. 
With the recent development of DNA microarray analysis, 17 18 19 systematic and thorough studies on up- or downregulated genes have become possible. In the present study, we investigated systematically the changes in mRNA expression after ischemia–reperfusion injury. We also studied the temporal and spatial expression changes of some of the upregulated genes by using real-time polymerase chain reaction (PCR) analysis and by immunohistochemical methods. 
Materials and Methods
Animals
Sixty-three adult male Sprague-Dawley rats weighing 250 to 300 g were used. They were kept under standard laboratory conditions with a 12-hour light–dark cycle. All procedures on the animals were performed in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. This study was also approved by the Institutional Review Board of Shinshu University School of Medicine. 
Ischemia–Reperfusion Injury
Retinal ischemia was induced by transient elevation of the intraocular pressure, as described in detail elsewhere. 1 6 16 Briefly, the animals were anesthetized with an intraperitoneal injection of 60 mg/kg pentobarbital. The anterior chamber of the left eye was cannulated with a 27-gauge needle connected to a physiological saline reservoir. Intraocular pressure was raised to 110 mm Hg by elevating the reservoir, and retinal ischemia was confirmed by fundus examination. After 1 hour, the intraocular pressure was returned to normal by removing the infusion needle from the anterior chamber. A sham procedure was performed on the control right eye without increasing the intraocular pressure. 
High-Density Oligonucleotide Microarray Analysis
After 1 hour of ischemia and 12 hours of reperfusion, four rats were killed with an overdose of pentobarbital sodium. The eyes were enucleated, and the anterior segment containing the cornea, lens, and iris was dissected and discarded. The retinas from the four eyes were combined and immediately processed to prepare poly(A) mRNA. Experimental and control eyes were enucleated at the same time. Poly(A) mRNAs obtained from the experimental and control rat retinas were purified concurrently (MicroFast Track 2.0 mRNA Isolation Kit; Invitrogen, Groningen, The Netherlands). Double-stranded cDNA was synthesized from 3 μg poly(A) mRNA (SuperScript Choice System (Life Technologies, Grand Island, NY) and the T7-(dT)24 primer containing poly(dT) and a T7 RNA polymerase promoter sequence (Research Genetics, Huntsville, AL). In vitro transcription with the double-stranded cDNA used as the template was performed in the presence of biotinylated UTP and CTP (BioArray High Yield RNA Transcript Labeling Kit; Enzo Diagnostics, Farmingdale, NY). Biotin-labeled cRNA was then purified (RNeasy Mini Kit; Qiagen, Hilden, Germany), fragmented, and hybridized to the RATU34A oligonucleotide microarrays (Affymetrix, Santa Clara, CA). The arrays were washed and stained with streptavidin-phycoerythrin. On the microarray, 8800 genes, including expressed sequence tags (ESTs), are plotted and expression changes of 8800 genes and ESTs can be analyzed by a single assay. 
Fluorescence intensities were measured with a microarray scanner (GeneArray Scanner; Affymetrix) and were analyzed with accompanying software (Genechip Expression Analysis; Affymetrix). The labeled cRNA samples were individually hybridized twice onto two different arrays, and the differences observed consistently in the replicates were analyzed. Genes were considered to be up- or downregulated if the magnitude of change was at least 2.1-fold in one experiment, and the averaged change in two experiments was 3.0-fold or greater. 
Total RNA Preparation and Reverse Transcription
After 1 hour of ischemia, and 0, 6, 12, 24, and 48 hours of reperfusion, rats (four rats for each time point) were killed with an overdose of pentobarbital sodium. The eyes were enucleated and dissected as described earlier. The retina was peeled out of the eyecup and immediately homogenized in the extraction reagent (Trizol; Life Technologies). Total RNA was extracted from the homogenate according to the manufacturer’s guidelines. The experiments were repeated twice. 
First-strand cDNA was synthesized from 5 μg total RNA with a random hexamer primer (First-Strand cDNA Synthesis Kit; Amersham Pharmacia Biotech, Piscataway, NJ). The reaction was performed at 37°C for 1 hour, and then an equal volume of RNase-free distilled water was added. Reverse transcriptase was inactivated at 95°C for 10 minutes, and the sample was stored at −80°C until used. 
Real-Time PCR
Real-time PCR was performed with a commercial system (Light Cycler; Roche Molecular Biochemicals, Indianapolis, IN). To prevent nonspecific amplification, we used hot-start PCR with a kit containing anti-Taq antibodies (ExTaq RT-PCR Version Takara Shuzou Co., Ohtsu, Japan). The PCR solution contained dNTPs (0.3 mM each), 3 mM MgCl2, RT-PCR buffer (Takara), green fluorescent dye (SYBR Green I, diluted to 1:60,000; Molecular Probes, Eugene, OR), 5% DMSO, specific primer set (0.5 μM), and Taq polymerase (1.25 units). Table 1 summarizes the sequences and sources of primers used in this study. 
The PCR parameters were initial denaturation, 1 cycle at 95°C for 2 minutes; preamplification, 5 cycles at 95°C for 10 seconds and 68°C for 30 seconds; amplification, 35 cycles at 95°C for 10 seconds, 62°C for 10 seconds, and 72°C for 30 seconds; melting curve, one cycle at 72°C for 1 minute with the temperature gradually increased up to 95°C. Amplicons were purified by a spin column (Centri-Sep; Princeton Separations, Adelphia, NJ), and their nucleotide sequences were determined by a direct sequencing method using an autosequencer (Prism 310; Applied Biosystems, Foster City, CA). 
Relative quantification of gene expression with the real-time PCR data was performed by using the comparative threshold (Ct) cycle method. The Cts of the target genes were normalized to the levels of GAPDH as an endogenous control at each time point after reperfusion. The degree of change in each targeted gene was calculated and compared with the control sham-treated eye. The results are expressed as the mean ± SEM. The PCR experiments were repeated at least four times. 
Immunohistochemistry
At 0, 6, 12, 24, and 48 hours after reperfusion, rats were anesthetized by pentobarbital and were fixed by intracardiac perfusion of 4% paraformaldehyde in 0.1 M phosphate buffer. Three rats were used for each time point. The eyes were enucleated and immersed in the same fixative for 12 hours. After they were embedded in paraffin, 3-μm sections were prepared. The specimens were incubated with primary antibodies diluted in PBS containing 1% BSA and 0.05% Tween-20 for 24 hours at 4°C. The primary antibodies and concentrations used were mouse monoclonal anti-Jun B at 1:100 (Santa Cruz Biotechnology), rabbit polyclonal anti-Fra-1 at 1:100 (Santa Cruz Biotechnology), rabbit polyclonal anti-c-Jun at 1:100 (Santa Cruz Biotechnology), rabbit polyclonal anti-S-100 at 1:200 (Immunotech, Marseille, France). 
After reaction with the primary antibodies, the specimens were washed with PBS and incubated with secondary antibodies for 2 hours at room temperature. The antibodies and dilutions were fluorescein isothiocyanate (FITC)–conjugated goat anti-mouse immunoglobulin at 1:100 (Dako, Glostrup, Denmark) and rhodamine-conjugated goat anti-rabbit immunoglobulin at 1:100 (Dako). Sections were stained with 1 μg/mL propidium iodide (PI) to stain cell nuclei and viewed with a confocal laser scanning microscope (LSM 410; Zeiss, Oberkochen, Germany). 
Results
High-Density Oligonucleotide Microarray Analysis
The scattergrams of mRNA expression demonstrating the differences between the control retina and retinas subjected to ischemia–reperfusion injury at 12 hours after the injury are shown in Figure 1 . The changes in the expression of the majority of the genes were within threefold, but there were 135 (including ESTs) or 111 (excluding ESTs) genes that showed upregulation or downregulation greater than threefold. The results of two independent DNA microarray analyses are summarized in Table 2 . It is apparent that at least seven different gene groups were upregulated in the experimental retina. The gene groups were (1) transcription factors or immediate early genes, (2) cell-cycle–related genes, (3) stress response protein genes, (4) cell signaling protein genes, (5) cell adhesion and cell surface protein genes, (6) genes for translation and protein turnover, and (7) genes for cellular metabolism. 
Among the genes that showed upregulation of more than 10-fold of the control, genes for Fra-1, Jun B belonged to the immediate early genes. Cyclin D2 was classified as cell-cycle–related genes. Heme oxygenase 1, beta A3/A1 crystallin, and metallothionein-2 were stress-response protein genes. Several genes including glutathione S-transferase were downregulated (Table 2)
Real-Time Polymerase Chain Reaction Analyses of mRNA Expression
Among the transcription factor genes and cell-cycle–related genes, c-Fos, Fra-1, Fra-2, c-Myc, c-Jun, Jun B, cyclin D1, and cyclin D2 were selected to study the time course of mRNA expression in more detail. Ethidium bromide–stained agarose gel showed that the PCR products except for that of cyclin D1were single banded, and no by-products were found (Fig. 2A) . Faint bands other than the main products were found in cyclin D1 when the expression was highly upregulated. Using expression of the GAPDH gene as the internal standard, relative mRNA expression as determined by the microarray analysis and by the real-time PCR analyses were compared. As shown in Figure 2B , most of the gene expression at 12 hours after reperfusion, except for that of Jun B, showed very similar results, showing that our microarray analysis is reliable. Also, the time course of the expression as determined by the gel electrophoresis agreed well with the real-time PCR analyses (Figs. 2A 2B)
Real-time PCR analyses showed that the genes for Fra-1, c-Myc, Jun B, cyclin D1, and Fra-2 were upregulated during the reperfusion period for up to 48 hours. Genes for c-Fos, c-Jun, and cyclin D2 showed modest upregulation (Figs. 2C 2D) . Fra-1 expression peaked at 6 hours after reperfusion but that of Jun B and c-Jun was much delayed, showing peaks at 24 hours after reperfusion. Cyclin D1 expression peaked at 24 hours after reperfusion when cells in the inner nuclear layer show a peak of apoptosis. At the peak of expression, Fra-1 expression was more than 60 times that of the sham-treated retinas, and expression of c-Myc, Jun B, and cyclin D1 were increased by approximately 30-fold (Fig. 2C)
Immunohistochemical Detection of Upregulated Genes
To identify the cells that expressed specific transcription factors and cell-cycle–related genes, immunohistochemical studies were performed. In the control retina, no positive Fra-1 or Jun B immunoreactivities were observed (Figs. 3A 4A) . However, at 12 hours after reperfusion, Fra-1 immunoreactivities were found in cells located in the inner nuclear layer (Fig. 3B) . Under higher magnification and double staining with PI, such Fra-1–positive cells were not deeply stained with the PI dye (Figs. 3C 3D) . Double staining with anti-Fra-1 antibody and anti-S-100 antibody clearly demonstrated that Fra-1 was expressed in S-100–expressing Müller cells (Figs. 3E 3F)
Jun B immunoreactivity was also found in cells located in the inner nuclear layer at 12 hours after reperfusion (Fig. 4B) . Such cells were positive for S-100 as were Müller cells (Figs. 4C 4D) . Double staining with anti-Jun B antibody and anti-c-Jun antibody revealed that Jun B immunoreactivity was expressed in Müller cells whereas c-Jun immunoreactivity was expressed in dying cells that showed typical apoptotic morphology (Figs. 4E 4F) . At 24 hours after reperfusion, Fra-1 and Jun B immunoreactivities were found in Müller cells. Also, c-Jun immunoreactivities were found in dying neuronal cells (graphic data not shown). 
Discussion
We initially determined a profile of the mRNA expression changes in the rat sensory retina that underwent 1 hour of ischemia. At 12 hours after reperfusion, among 8800 genes and ESTs, 111 genes excluding ESTs were shown to be up- or downregulated. 
There were 98 genes that showed more than threefold upregulation compared with the control and 13 genes showed more than threefold downregulation compared with the control (Table 2) . Upregulated genes were classified into at least seven groups. Systematic studies such as this study have not been published and, to the best of our knowledge, this report is the first to investigate extensively the changes in retinal gene expression after ischemia–reperfusion injury. 
In the present study, retinas from four eyes were pooled and gene expression changes in the pooled sample were analyzed on two separate microarray analyses. It would be more appropriate to use two separate samples and to perform microarray analyses on three or more microarrays, but many of the genes listed in Table 2 have been studied previously, and the agreements indicate that our microarray procedures and analyses, at least in part, were valid. Moreover, real-time PCR data and the microarray data agreed well. Therefore, the data presented in the study are considered reliable. 
Although all the genes listed in Table 2 seemed interesting, it was not possible to study all of them. Thus, special attention was paid to the transcription factors or immediate early genes and cell-cycle–related genes. The reasons for this selection were that (1) expression of transcription factors can be a key and an initial event that determines the fate of cells in the retina because expression of many genes is controlled by transcription factors 20 21 22 and that (2) the importance of immediate early gene expression after the ischemia–reperfusion injury in the brain is well documented. 23 24  
After the ischemia–reperfusion injury, three waves of gene expression are known to take place. 25 The expression of immediate early genes is the first event to take place after reperfusion, and they are thought to play an important role in the initiation and development of the injury. 25 26 The importance of cell-cycle–related genes in retinal neuronal apoptosis has been reported in two publications from this laboratory, 9 27 and the expression of these cell-cycle–related genes is under the control of transcription factors. 
Real-time PCR analyses were used to determine the time course of gene expression, and the data agreed well with the DNA microarray analyses. We also performed immunohistochemical studies to determine the cells expressing specific transcription factor genes and cell-cycle–related gene products. The results clearly demonstrated that transcription factors and cell-cycle–related genes or gene products were upregulated after the ischemia–reperfusion injury of the rat retina. Cells that expressed Fra-1 and Jun B were Müller glial cells and not neurons (Figs. 3 4) . The neuronal cells that become apoptotic after the injury did not express Fra-1 or Jun B but did express c-Jun (Fig. 4) . Highly upregulated expression of Fra-1 or Jun B may be explained by the fact that living and not dying cells express such transcription factors and the rather moderate upregulation of c-Jun may be explained by the expression of the gene by dying neurons. 
The cyclin D1 gene was also highly upregulated, a response that could arise from both Müller cells and dying neurons in the retina. 9 Aberrant expression of cyclin D1 is known to induce neuronal apoptosis by the G1 arrest mechanism. 28 In the transient ischemia of rat forebrain, however, cyclin D1 is reported to be expressed in glial cells rather than neurons. 29 In the retina, both apoptotic neurons and Müller glial cells expressed cyclin D1, and these results show that cyclin D1 is important both in neuronal apoptosis and glial proliferation. From our previous studies, it became clear that at 6 hours after reperfusion, cells in the ganglion cell layer may become apoptotic, but no other neuronal cells in the sensory retina showed any signs of apoptosis. 9 At this time point, Fra-1 expression showed a peak in our real-time PCR analyses. Because Fra-1 is expressed in Müller cells, glial cells in the retina may have initiated some neuroprotective responses against the insult as early as 6 hours, and Fra-1 may play a role in the expression of such neuroprotective genes. On the one hand, Jun B, c-Jun, and cyclin D1 are expressed much later than Fra-1, with peaks at 24 hours when neurons in the inner nuclear layer show a peak of apoptosis. 9 Apparently, c-Jun plays an important role in the process of apoptosis. Jun B, on the other hand, is unlikely to play a role in neuronal apoptosis, because the protein was selectively expressed in Müller glial cells. Jun B may be important in the proliferation of glial cells, because at 24 hours after ischemia, glial proliferation takes place. 
Differentially regulated expression of immediate early genes has been reported in brain ischemia–reperfusion injury in many animal species. 30 31 32 33 34 35 36 37 However, the types of cells that express the immediate early genes and the possible roles played by such genes in the brain are still debatable. For example, some investigators argue that such immediate early genes play an important role in neuronal apoptosis, 30 38 39 40 whereas others believe that they are not directly involved in apoptosis but are important in postischemia changes. 41 42 Both glial and neuronal cells are known to express such immediate early genes, 40 41 and the brain regions expressing these genes do not necessarily correspond to the region that has ischemia–reperfusion injury. 32 33 34 Such discrepant results may have stemmed from the more complex neuronal and glial structure of the brain, and the retina may be a better system to study the roles of immediate early genes after the ischemia–reperfusion injury. 
However, much less information is available on the expression of such immediate early genes in retinal ischemia–reperfusion injury. One study is available that reported expression of c-Jun and c-Fos mRNA after injury, but information is not available on the possible roles of such genes. 43 Previous studies from this laboratory showed that c-Jun is expressed in retinal neurons that show apoptotic morphology. 9 27 The present results also clearly demonstrated that c-Jun expression is associated with neuronal cell death, whereas Fra-1 and Jun B are expressed in Müller glial cells. These data support the idea that differentially regulated expression of immediate early genes plays a role in the determination of cell fate. If such assumption is correct, it may be reasonable to plan a neuroprotective therapy upstream of the immediate early gene expression. 
The expression of c-Fos and Jun B in Müller cells after a penetrating retinal wound has been reported. 44 45 Also aberrant expression of c-Fos in degenerating photoreceptors in rd mice is known. 46 In optic nerve axotomy, c-Jun expression in retinal ganglion cells is considered to play a role in regeneration rather than degeneration. 47 48 It may well be that different injuries induce the expression of different immediate early genes in retinal neurons. 35 49 It is also possible that different species of neurons respond to an injury differently, depending on the severity of the injury. 49  
In this retinal ischemia–reperfusion injury, the precise time course of cell death, as well as the characterization of the dying neurons is well established. 9 Because the retina has a much simpler neuronal network than brain, the use of the retina as a model to study neuronal apoptosis has some merit, but further information regarding the effect of immediate early genes on neuronal and glial cell death after other types of retinal damage is necessary to determine the importance of differentially regulated expression of immediate early genes and cell-cycle–related genes in the process that occurs after an ischemia–reperfusion injury. 
 
Table 1.
 
Oligonucleotides Used for Real-Tme PCR
Table 1.
 
Oligonucleotides Used for Real-Tme PCR
Target Gene Sequence (5′–3′) Product Size (bp)
GAPDH Sense TGCCACTCAGAAGACTGTGGATG 374
Antisense AGTTGTCATTGAGAGCAATGCCAG
c-Fos Sense GTCTTCCTTTGTCTTCACCTACC 440
Antisense GCTCACATGCTACTAACTACCAG
Fra-1 Sense AAGCAGAAGGAACGCCTTGAGC 420
Antisense GCTGGATGAACAGGGAAAGGAG
Fra-2 Sense GAGACAGAGGAGCTGGAGGAG 387
Antisense GGTGAAGACAAGGTTTGAAGTGC
c-Myc Sense TGCCAAACTGGTCTCCGAGAAG 454
Antisense GCTGTGTGGAGGTTTGCTGTGG
c-Jun Sense TCCCCCATCGACATGGAGTCTC 400
Antisense CCAGTCCATCTTGTGTACCCTTG
JunB Sense CAAGGTGAAGACACTCAAGGCTG 352
Antisense AAACATACAAAATACGCTGGAAGG
Cyclin D1 Sense CCACAGATGTGAAGTTCATTTCC 358
Antisense GATGCCACTACTTGGTGACTCC
Cyclin D2 Sense GTGCTACCGACTTCAAGTTTGCC 347
Antisense TGACGAACACGCCTCTCTCTTG
Figure 1.
 
Scattergram of the mRNA expression changes between the control and reperfused retina. The abscissa shows mRNA expression in the retina 12 hours after 1 hour of ischemia and the ordinate shows mRNA expression in the control retina. Most of the genes showed expression changes of within ± threefold (between the two oblique lines).
Figure 1.
 
Scattergram of the mRNA expression changes between the control and reperfused retina. The abscissa shows mRNA expression in the retina 12 hours after 1 hour of ischemia and the ordinate shows mRNA expression in the control retina. Most of the genes showed expression changes of within ± threefold (between the two oblique lines).
Table 2.
 
Summary of Genes Differentially Regulated in Rat Retina after Ischemia–Reperfusion
Table 2.
 
Summary of Genes Differentially Regulated in Rat Retina after Ischemia–Reperfusion
Accession Number Gene Name Change Multiple
Exp. 1 Exp. 2 Avg.
Immediate early genes or transcription factors
 M19651 Fos-related antigen (Fra-1) 33.9 9.3 21.6
 X54686 Jun B 22.9 8.0 15.5
 Y00396 c-Myc 12.1 3.8 8.0
 X60769 CCAAT/enhancer binding protein (C/EBP), beta 11.2 3.0 7.1
 U02522 Mta1, metastasis associated 1 7.0 2.5 4.8
 M65149 CELF, CCAAT/enhancer binding protein (C/EBP), delta 5.1 4.5 4.8
 X62875 High mobility group protein I (HMGIY) 3.4 3.8 3.6
 AI175959 c-Jun 3.0 3.5 3.3
 M63282 Leucine zipper protein, ATF3 3.0 2.9 3.0
 M18416 Nerve growth factor-induced (NGFI-A) 2.6 3.3 3.0
 AF053100 Pax4a −3.4 −4.0 −3.7
Cell-cycle–related genes
 D16308 Cyclin D2 27.0 8.4 17.7
 X75207 Cyclin D1 8.6 3.1 5.9
 AF063447 Nuclear RNA helicase 4.8 2.5 3.7
 L23148 Inhibitor of DNA-binding, splice variant Id1.25 4.0 2.7 3.4
Stress responsive protein genes
 AF082125 Aryl hydrocarbon receptor (AHR) 52.1 13.0 32.6
 J02722 Heme oxygenase 1 34.8 9.4 22.1
 X15143 beta A3/A1 crystallin 20.8 5.7 13.3
 AI176456 Metallothionein-2 and metallothionein-1 13.0 8.9 11.0
 X60351 alpha B-crystallin 9.9 8.9 9.4
 J00717 gamma-C-crystallin (gamma 2-1) 13.0 4.7 8.9
 X83671 beta-B2 crystallin 6.8 6.2 6.5
 AF082160 GRIFIN, galectin-related inter-fiber protein 8.5 3.3 5.9
 S81917 34-kDa DnaJ-hsp40 heat shock-chaperone protein 7.5 2.9 5.2
 M15901 beta-B3-2-crystallin 4.9 3.3 4.1
 AA891286 NADPH-dependent thioredoxin reductase (TRR1) 4.1 4.0 4.1
 AA998683 Heat shock protein 27 (hsp 27) 5.4 2.5 4.0
 U63923 Thioredoxin reductase 3.6 4.3 4.0
 AA108277 Heat shock protein (hsp-E7I) 5.4 2.2 3.8
 S75280 Pre-mtHSP70 3.4 3.5 3.5
 U47921 alpha A (insert)-crystallin 3.0 2.9 3.0
 S72505 Glutathione S-transferase Yc1 subunit −12.2 −10.9 −11.6
Cell-signaling protein genes
 AF030089 Activity and neurotransmitter-induced early gene protein 4 (ania-4) 65.1 31.3 48.2
 AF065161 Cytokine-inducible SH2-containing protein 24.6 7.0 15.8
 X17053 Immediate-early serum-responsive JE protein, monocyte chemotactic protein 1 (MCP-1) 17.4 12.9 15.2
 AA859593 Estrogen-responsive finger protein 20.6 5.4 13.0
 S54008 Fibroblast growth factor receptor 1 beta-isoform 17.2 5.3 11.3
 AF051895 Lipocortin V, annexin V 16.3 5.6 11.0
 U42627 Dual-specificity protein tyrosine phosphatase (rVH6) 11.0 9.0 10.0
 J03627 S-100 related protein 10.5 7.9 9.2
 U59510 Endothelin-2 13.6 3.5 8.6
 M80367 Isoprenylated 67-kDa protein, similar to mouse interferon-induced guanylate binding protein GBP-2 8.6 4.5 6.6
 AA998446 Phosphatidylinositol transfer protein (beta isoform) 9.5 3.5 6.5
 AI113289 Protein-tyrosine-phosphatase (ptp) 6.6 6.3 6.5
 U91847 p38 mitogen activated protein kinase, p38 MAP kinase 8.1 2.7 5.4
 AI171962 Lipocortin I, annexin I 7.2 2.6 4.9
 AI232477 G protein gamma-5 subunit 3.9 5.8 4.9
 D28508 Protein-tyrosine kinase, JAK3 7.1 2.3 4.7
 U14950 Synapse-associated protein 97 (SAP97) 5.9 3.4 4.7
 AI014163 Interferon-related developmental regulator 1 (IFRD1, PC4) 4.5 4.7 4.6
 L21192 GAP-43 4.2 4.4 4.3
 X61381 Interferon induced protein, a family of IFN-induced transmembrane proteins 4.5 3.9 4.2
 M34253 Interferon regulatory factor 1 (IRF-1) 4.3 3.9 4.1
 U45965 Macrophage inflammatory protein-2, MIP-2 5.7 2.4 4.1
 M74223 VGF, nerve growth factor inducible 2.7 3.8 3.3
 AF013144 MAP-kinase phosphatase (cpg21) 2.7 3.6 3.2
 AF034899 Olfactory receptor-like protein (SCR D-9) −4.0 −2.3 −3.2
 U88324 G protein betal subunit (rGb1) −3.8 −4.7 −4.3
(continued)
Table 2A.
 
(Continued). Summary of Genes Differentially Regulated in Rat Retina after Ischemia–Reperfusion
Table 2A.
 
(Continued). Summary of Genes Differentially Regulated in Rat Retina after Ischemia–Reperfusion
Cell adhesion and cell surface protein genes
 U92081 Epithelial cell transmembrane protein antigen precursor (RTI40) 15.7 36.2 26.0
 M61875 Glycoprotein CD44 21.2 6.6 13.9
 M64986 Amphoterincin 19.3 6.3 12.8
 AI231213 Metastasis suppressor homologue (KAI1), similar to mouse CD82 12.0 5.9 9.0
 D00913 Intercellular adhesion molecule-1, ICAM-1 12.8 2.4 7.6
 J02962 IgE binding protein 8.9 2.9 5.9
 AF017437 Integrin-associated protein form 4 (IAP) 7.5 3.1 5.3
 AB008538 HB2, activated leukocyte cell-adhesion molecule (ALCAM) 6.4 2.6 4.5
 AI177366 Integrin beta subunit 4.4 4.5 4.5
 M32062 Fc-gamma receptor 4.7 2.7 3.7
 M14656 Osteopontin 3.6 3.3 3.5
 X61654 Ad1-antigen, similar to mouse CD63 3.0 3.9 3.5
 AI170268 beta-2-Microglobulin 3.5 2.8 3.2
 M24324 MHC class I RT1 (RTS) 2.9 3.2 3.1
 AF074608 MHC class I antigen (RT1.EC2) 2.6 3.4 3.0
 U27562 SC1 protein, SPARC-like 1 −3.3 −3.1 −3.2
 AI176461 Sialoglycoprotein MG-160 −6.1 −4.3 −5.2
Genes for translation and protein turnover
 AI169327 Tissue inhibitor of metalloproteinase (TIMP) 55.2 15.1 35.2
 AA946503 alpha-2u Globulin-related protein 36.7 10.8 23.8
 X02601 Transin, stromelysin-1, matrix metalloproteinase-3 14.9 14.2 14.6
 M23697 Tissue-type plasminogen activator (t-PA) 8.1 4.7 6.4
 L09120 Calpain II 80-kDa subunit 8.7 3.5 6.1
 J04943 Nucleolar protein B23.2 4.7 3.5 4.1
 AI178921 Insulin-degrading enzyme (EC 3.4.24.56) 4.2 2.9 3.6
 AI176595 Cathepsin L 3.1 3.1 3.1
 X59375 Ribosomal protein S27 3.2 2.8 3.0
Genes for cellular metabolism
 X12459 Argininosuccinate synthetase (EC 6.3.4.5) 23.7 7.4 15.6
 J04792 Ornithine decarboxylase (ODC) 12.8 10.1 11.5
 U24282 Iodothyronine deiodinase III (dioIII) 5.1 3.5 4.3
 D89514 5-Aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase 3.7 4.2 4.0
 U26033 Carnitine octanoyltransferase 3.6 3.6 3.6
 AA892775 Lysozyme 3.7 2.6 3.2
 X55298 Ribophorin II 3.1 3.1 3.1
 M91652 Glutamine synthetase (glnA) −3.3 −3.7 −3.5
 S56464 Hexokinase II (HKII) −4.3 −4.4 −4.4
 X58294 Carbonic anhydrase II −4.0 −5.8 −4.9
Others
 AA892333 alpha-Tubulin 61.9 16.7 39.3
 AF026554 Sodium-dependent multi-vitamin transporter (SMVT) 11.4 3.5 7.5
 U06230 Protein S 8.6 2.5 5.6
 U87983 Hyaluronan-mediated motility receptor 6.8 3.6 5.2
 X54617 Myosin regulatory light chain (RLC-A) 4.4 6.6 5.0
 AA945169 Transthyretin, thyroid hormone-binding protein 4.5 3.6 4.1
 MI1597 Calcitonin-related peptide, alpha 5.0 2.3 3.7
 AI178135 Complement component 1, q subcomponent–binding protein (gC1qBP) 4.2 3.0 3.6
 AA892318 Similar to mouse SRp25 nuclear protein 2.9 4.2 3.6
 AA859305 Tropomyosin 5 (TM-5) 4.9 2.9 3.9
 AF083269 p41-Arc, actin related protein 2/3 complex, subunit 1B 3.4 3.2 3.3
 AF008439 Natural resistance-associated macrophage protein 2 (Nramp2) 4.0 2.5 3.3
 U31866 Rattus norvegicus Nclone10 mRNA 3.2 2.8 3.0
 AI228669 GABA transporter protein −3.1 −3.0 −3.1
 S76779 Apolipoprotein E, rApoE −3.2 −3.2 −3.2
 D89730 T16, EGF-containing fibulin-like extracellular matrix protein 1 −4.8 −3.6 −4.2
 AJ224879 Collagen alpha 1 type II −8.8 −3.7 −6.3
Figure 2.
 
(A) Ethidium bromide–stained agarose gel of the PCR products. Each reaction product yielded a single band. The number of thermal cycles used in the amplification step were GAPDH, 25 cycles; Fra-1, Fra-2, c-Myc, c-Jun, cyclin D1, and cyclin D2, 30 cycles; and c-Fos and Jun B, 35 cycles. (B) Comparison of gene expression changes as determined by microarray and real-time PCR analyses at 12 hours after reperfusion. Gene expression for GAPDH was used as the internal control and each gene expression was normalized. Microarray analysis data are the average of results in two independent experiments and real-time PCR data are the mean ± SEM of results in four independent experiments. (C) Time course of gene expression changes as evaluated by real-time PCR analysis. Fra-1 mRNA expression peaked at 6 hours, whereas Jun B and cyclin D1 peaked at 24 hours. Data are presented as the mean ± SEM of results in four independent experiments. (D) Time course of gene expression changes, as evaluated by the real-time PCR analysis. Fra-2 mRNA expression showed upregulation approximately seven times the control level. Gene expression for c-Fos, c-Jun, and cyclin D2 was modestly upregulated. Data are presented as the mean ± SEM of results in four independent experiments.
Figure 2.
 
(A) Ethidium bromide–stained agarose gel of the PCR products. Each reaction product yielded a single band. The number of thermal cycles used in the amplification step were GAPDH, 25 cycles; Fra-1, Fra-2, c-Myc, c-Jun, cyclin D1, and cyclin D2, 30 cycles; and c-Fos and Jun B, 35 cycles. (B) Comparison of gene expression changes as determined by microarray and real-time PCR analyses at 12 hours after reperfusion. Gene expression for GAPDH was used as the internal control and each gene expression was normalized. Microarray analysis data are the average of results in two independent experiments and real-time PCR data are the mean ± SEM of results in four independent experiments. (C) Time course of gene expression changes as evaluated by real-time PCR analysis. Fra-1 mRNA expression peaked at 6 hours, whereas Jun B and cyclin D1 peaked at 24 hours. Data are presented as the mean ± SEM of results in four independent experiments. (D) Time course of gene expression changes, as evaluated by the real-time PCR analysis. Fra-2 mRNA expression showed upregulation approximately seven times the control level. Gene expression for c-Fos, c-Jun, and cyclin D2 was modestly upregulated. Data are presented as the mean ± SEM of results in four independent experiments.
Figure 3.
 
(A) Control retina stained with anti-Fra-1 antibody. No specific immunostaining was observed. The cellular nuclei were stained by PI (red). (B) Immunostaining with anti-Fra-1 antibody, at 12 hours after reperfusion. Positively stained cells (green) were found in the inner nuclear layer (INL). (C) Higher magnification of (B), showing positively stained cells in the INL (arrows). No positive anti-Fra-1 staining appeared in cells that showed condensed PI staining (arrowheads). (D) PI staining of the same section as (C). The image was obtained by using a red filter to identify PI-positive cells. (E) Double staining with anti-Fra-1 (green) and anti-S-100 (red) antibodies showed colocalization of Fra-1 and S-100 (arrowheads). (F) S-100 staining of the same section as in (E). Arrowheads: positive staining. Scale bar: (A, B, E, F) 25 μm; (C, D) 10 μm.
Figure 3.
 
(A) Control retina stained with anti-Fra-1 antibody. No specific immunostaining was observed. The cellular nuclei were stained by PI (red). (B) Immunostaining with anti-Fra-1 antibody, at 12 hours after reperfusion. Positively stained cells (green) were found in the inner nuclear layer (INL). (C) Higher magnification of (B), showing positively stained cells in the INL (arrows). No positive anti-Fra-1 staining appeared in cells that showed condensed PI staining (arrowheads). (D) PI staining of the same section as (C). The image was obtained by using a red filter to identify PI-positive cells. (E) Double staining with anti-Fra-1 (green) and anti-S-100 (red) antibodies showed colocalization of Fra-1 and S-100 (arrowheads). (F) S-100 staining of the same section as in (E). Arrowheads: positive staining. Scale bar: (A, B, E, F) 25 μm; (C, D) 10 μm.
Figure 4.
 
(A) Control retina stained with anti-Jun B antibody, showing no specific immunostaining. The cellular nuclei were stained by PI (red). (B) Immunostaining with anti-Jun B antibody, at 12 hours after reperfusion. Positively stained cells (green) are seen in the INL. (C) Double staining with anti-Jun B (green) and anti-S-100 (red) antibodies. Colocalization of Jun B and S-100 signals is evident. (D) Higher magnification of (C). Colocalization of the two signals are more clearly evident. (E) Double staining with anti-Jun B (green) and anti-c-Jun (red) antibodies, showing Jun B (arrows) and c-Jun (arrowheads) immunoreactivity. The two signals do not merge indicating that Jun B–positive cells and c-Jun–positive cells are different. (F) c-Jun immunostaining of the same section as in (E). Black and white image obtained by using a red filter, shows c-Jun immunostaining (arrowheads) more clearly. Arrow: Jun-B positivity. Scale bar: (A, B) 25 μm; (C, D, E, F) 10 μm.
Figure 4.
 
(A) Control retina stained with anti-Jun B antibody, showing no specific immunostaining. The cellular nuclei were stained by PI (red). (B) Immunostaining with anti-Jun B antibody, at 12 hours after reperfusion. Positively stained cells (green) are seen in the INL. (C) Double staining with anti-Jun B (green) and anti-S-100 (red) antibodies. Colocalization of Jun B and S-100 signals is evident. (D) Higher magnification of (C). Colocalization of the two signals are more clearly evident. (E) Double staining with anti-Jun B (green) and anti-c-Jun (red) antibodies, showing Jun B (arrows) and c-Jun (arrowheads) immunoreactivity. The two signals do not merge indicating that Jun B–positive cells and c-Jun–positive cells are different. (F) c-Jun immunostaining of the same section as in (E). Black and white image obtained by using a red filter, shows c-Jun immunostaining (arrowheads) more clearly. Arrow: Jun-B positivity. Scale bar: (A, B) 25 μm; (C, D, E, F) 10 μm.
Stefansson, E, Wilson, CA, Schoen, T, Kuwabara, T. (1988) Experimental ischemia induces cell mitosis in the adult rat retina Invest Ophthalmol Vis Sci 29,1050-1055 [PubMed]
Buchi, ER, Suivaizdis, I, Fu, J. (1991) Pressure-induced retinal ischemia in rats: an experimental model for quantitative study Ophthalmologica 203,138-147 [CrossRef] [PubMed]
Hangai, M, Yoshimura, N, Yoshida, M, Yabuuchi, K, Honda, Y. (1995) Interleukin-1 gene expression in transient retinal ischemia in the rat Invest Ophthalmol Vis Sci 36,571-578 [PubMed]
Zhang, H, Agardh, CD, Agardh, E. (1995) Increased catalase levels and hypoxanthine-enhanced nitro-blue tetrazolium staining in rat retina after ischemia followed by recirculation Curr Eye Res 14,47-54 [CrossRef] [PubMed]
Perlman, JI, Shuber, H, Selvaraj, RP, Cassidy, EM (1999) Free radical generation following pressure-induced retinal ischemia in the rat Retina 19,255-257 [CrossRef] [PubMed]
Shibuki, H, Katai, N, Yodoi, J, Uchida, K, Yoshimura, N. (2000) Lipid peroxidation and peroxynitrite in retinal ischemia-reperfusion injury Invest Ophthalmol Vis Sci 41,3607-3614 [PubMed]
Hangai, M, Miyamoto, K, Hiroi, K, et al (1999) Roles of constitutive nitric oxide synthase in post ischemic rat retina Invest Ophthalmol Vis Sci 40,450-458 [PubMed]
Rosenbaum, DM, Rosenbaum, PS, Gupta, A, Michaelson, MD, Hall, DH, Kessler, JA. (1997) Retinal ischemia leads to apoptosis which is ameliorated by aurintricarboxylic acid Vision Res 37,3445-3451 [CrossRef] [PubMed]
Kuroiwa, S, Katai, N, Shibuki, H, et al (1998) Expression of cell cycle-related genes in dying cells following retinal ischemic injury in the rat Invest Ophthalmol Vis Sci 39,610-617 [PubMed]
Kuroiwa, S, Katai, N, Yoshimura, N. (1999) A possible role for p16INK4 in neuronal cell death after retinal ischemia-reperfusion injury Invest Ophthalmol Vis Sci 40,528-533 [PubMed]
Joo, CK, Choi, JS, Ko, HW, et al (1999) Necrosis and apoptosis after retinal ischemia: involvement of NMDA-mediated excitotoxicity and p53 Invest Ophthalmol Vis Sci 40,713-720 [PubMed]
Osborne, NN, Ugarte, M, Chao, M, et al (1999) Neuroprotection in relation to retinal ischemia and relevance to glaucoma Surv Ophthalmol 43,S102-S128 [CrossRef] [PubMed]
Lucas, DR, Newhouse, JP. (1957) The toxic effect of sodium L-glutamate on the inner layer of the retina Arch Ophthalmol 58,193-201 [CrossRef]
Szabo, ME, Droy-Lefaix, MT, Doly, M, Carre, C, Braquet, P. (1991) Ischemia and reperfusion-induced histologic changes in the rat retina: demonstration of a free radical-mediated mechanism Invest Ophthalmol Vis Sci 32,1471-1478 [PubMed]
Sucher, NJ, Lipton, SA, Dreyer, EB. (1997) Molecular basis of glutamate toxicity in retinal ganglion cells Vision Res 37,3483-3493 [CrossRef] [PubMed]
Shibuki, H, Katai, N, Kuroiwa, S, Kurokawa, T, Yodoi, J, Yoshimura, N. (1998) Protective effect of adult T cell leukemia-derived factor on retinal ischemia-reperfusion injury in the rat Invest Ophthalmol Vis Sci 39,1470-1477 [PubMed]
DeRisi, JL, Iyer, VR, Brown, PO. (1997) Exploring the metabolic and genetic control of gene expression on a genomic scale Science 278,680-686 [CrossRef] [PubMed]
Duggan, DJ, Bittner, M, Chen, Y, Meltzer, P, Trent, JM. (1999) Expression profiling using cDNA microarrays Nat Genet 21,10-14 [CrossRef] [PubMed]
Lipshuts, RJ, Fodor, SP, Gingeras, TR, Lockhart, DJ. (1999) High density synthetic oligonucleotide arrays Nat Genet 21,20-24 [CrossRef] [PubMed]
Sheng, M, Greenberg, ME. (1990) The regulation and function of c-fos and other immediate early genes in the nervous system Neuron 4,477-485 [PubMed]
Morgan, JI, Curran, T. (1991) Stimulus-transcription coupling in the nervous system: involvement of the inducible proto-oncogenes fos and jun Annu Rev Neurosci 14,421-451 [CrossRef] [PubMed]
Herdegen, T., Leah, JD. (1998) Inducible and constitutive transcription factors in the mammalian nervous system: control of gene expression by Jun, Fos, and Krox, and CREB/ATF proteins Brain Res Rev 28,370-490 [CrossRef] [PubMed]
Herrera, DG., Robertson, HA. (1996) Activation of c-fos in the brain Prog Neurobiol 50,83-107 [CrossRef] [PubMed]
Dirnagl, U., Iadecola, C., Moskowitz, MA. (1999) Pathobiology of ischaemic stroke: an integrated view Trends Neurosci 22,391-397 [CrossRef] [PubMed]
Iadecola, C. (1997) Bright and dark sides of nitric oxide in ischemic brain injury Trends Neurosci 20,132-139 [CrossRef] [PubMed]
Papadopouls, MC., Fiffard, RG., Bell, BA. (2000) An introduction to the changes in gene expression that occur after cerebral ischaemia Br J Neurosurg 14,305-312 [CrossRef] [PubMed]
Kurokawa, T., Katai, N., Kurimoto, Y., Yoshimura, N. (1999) BDNF diminishes caspase-2 but not of c-Jun in retinal ganglion cells after ischemia–reperfusion injury Invest Ophthalmol Vis Sci 40,3006-3011 [PubMed]
Freeman, RS., Estus, S., Johnson, EM, Jr (1994) Analysis of cell cycle-related gene expression in postmitotic neurons: selective induction of cyclin D1 during programmed cell death Neuron 12,343-355 [CrossRef] [PubMed]
Wiessner, C., Brink, I., Lorenz, P., Neumann-Haefelin, T., Vogel, P., Yamashita, K. (1996) Cyclin D1 messenger RNA is induced in microglia rather than neurons following transient forebrain ischaemia Neuroscience 72,947-958 [CrossRef] [PubMed]
Welsh, FA., Moyer, DJ., Harris, VA. (1992) Regional expression of heat shock protein-70 mRNA and c-fos mRNA following focal ischemia in rat brain J Cereb Blood Metab 12,204-212 [CrossRef]
An, G., Lin, T-N., Liu, J-S., Xue, J-J., He, Y-Y., Hsu, CY. (1993) Expression of c-fos and c-jun family genes after focal cerebral ischemia Ann Neurol 33,457-464 [CrossRef] [PubMed]
Collaco-Moraes, Y., Aspey, BS., de Belleroche, JS., Harrison, MJ. (1994) Focal ischemia causes an extensive induction of immediate early genes that are sensitive to MK-801 Stroke 25,1855-1860 [CrossRef] [PubMed]
Kinouchi, H., Sharp, FR., Chan, PH., Koistinaho, J., Sagar, SM., Yoshimoto, T. (1994) Induction of c-fos, junB, c-jun, and hsp70 mRNA in cortex, thalamus, basal ganglia, and hippocampus following middle cerebral artery occlusion J Cereb Blood Flow Metab 14,808-817 [CrossRef] [PubMed]
Kinouchi, H., Sharp, FR., Chan, PH, et al (1994) MK-801 inhibits the induction of immediate early genes in cerebral cortex, thalamus, and hippocampus, but not in substantia nigra following middle cerebral artery occlusion Neurosci Lett 179,111-114 [CrossRef] [PubMed]
Johansson, IM., Wester, P., Hakova, M., Gu, W., Seckl, JR., Olsson, T. (2000) Early and delayed induction of immediate early gene expression in a novel focal cerebral ischemia model in the rat Eur J Neurosci 12,3615-3625 [CrossRef] [PubMed]
Sharp, FR., Lu, A., Tang, Y., Millhorn, DE. (2000) Multiple molecular penumbras after focal cerebral ischemia J Cereb Blood Metab 20,1011-1032
Keyvani, K., Witte, OW., Paulus, W. (2002) Gene expression profiling in perilesional and contralateral areas after ischemia in rat brain J Cereb Blood Metab 22,153-160
Dragunow, M., Beilharz, E., Sirimanne, E, et al (1994) Immediate-early gene protein expression in neurons undergoing delayed death, but not necrosis, following hypoxic-ischaemic injury to the young rat brain Mol Brain Res 25,19-33 [CrossRef] [PubMed]
Estus, S., Zaks, WJ., Freeman, RS., Gruda, M., Bravo, R., Johnson, EM, Jr (1994) Altered gene expression in neurons during programmed cell death: identification of c-jun as necessary for neuronal apoptosis J Cell Biol 127,1717-1727 [CrossRef] [PubMed]
Whitfield, PC., Williams, R., Pickard, JD. (1999) Delayed induction of junB precedes CA1 neuronal death after global ischemia in the gerbil Brain Res 818,450-458 [CrossRef] [PubMed]
Kato, H., Kogure, K., Araki, T., Itoyama, Y. (1995) Induction of Jun-like immunoreactivity in astrocytes in gerbil hippocampus with ischemia tolerance Neurosci Lett 189,13-16 [CrossRef] [PubMed]
Oorschot, DE., Black, MJ., Rangi, F., Scarr, E. (2000) Is Fos protein expressed by dying striatal neurons after immature hypoxic-ischemic brain injury? Exp Neurol 161,227-233 [CrossRef] [PubMed]
Otori, Y., Shimada, S., Morimura, H., Ishimoto, I., Tohyama, M., Tano, Y. (1997) Expression of c-fos, and c-jun mRNA following transient retinal ischemia: an approach using ligation of the retinal central artery in the rat Surv Ophthalmol 42,S96-S104 [CrossRef] [PubMed]
Ohki, K., Yoshida, K., Yamakawa, A., Harada, T., Matuda, H., Imaki, J. (1995) Jun B gene expression in rat retinal cells following focal retinal injury Curr Eye Res 14,1021-1024 [CrossRef] [PubMed]
Yoshida, K., Muraki, Y., Ohki, K, et al (1995) c-fos gene expression in rat retinal cells following focal retinal injury Invest Ophthalmol Vis Sci 36,251-254 [PubMed]
Rich, KA., Zhan, Y., Blanks, JC. (1997) Aberrant expression of c-Fos accompanies photoreceptor cell death in the rd mouse J Neurobiol 32,593-612 [CrossRef] [PubMed]
Hüll, M., Bähr, M. (1994) Regulation of immediate-early gene expression in rat retinal ganglion cells after axotomy and during regeneration through a peripheral nerve graft J Neurobiol 25,92-105 [CrossRef] [PubMed]
Robinson, GA. (1995) Axotomy-induced regulation of c-Jun expression in regenerating rat retinal ganglion cells Mol Brain Res 30,61-69 [CrossRef] [PubMed]
Akins, PT., Liu, PK., Hsu, CY. (1996) Immediate early gene expression in response to cerebral ischemia: friend or foe? Stroke 27,1682-1687 [CrossRef] [PubMed]
Figure 1.
 
Scattergram of the mRNA expression changes between the control and reperfused retina. The abscissa shows mRNA expression in the retina 12 hours after 1 hour of ischemia and the ordinate shows mRNA expression in the control retina. Most of the genes showed expression changes of within ± threefold (between the two oblique lines).
Figure 1.
 
Scattergram of the mRNA expression changes between the control and reperfused retina. The abscissa shows mRNA expression in the retina 12 hours after 1 hour of ischemia and the ordinate shows mRNA expression in the control retina. Most of the genes showed expression changes of within ± threefold (between the two oblique lines).
Figure 2.
 
(A) Ethidium bromide–stained agarose gel of the PCR products. Each reaction product yielded a single band. The number of thermal cycles used in the amplification step were GAPDH, 25 cycles; Fra-1, Fra-2, c-Myc, c-Jun, cyclin D1, and cyclin D2, 30 cycles; and c-Fos and Jun B, 35 cycles. (B) Comparison of gene expression changes as determined by microarray and real-time PCR analyses at 12 hours after reperfusion. Gene expression for GAPDH was used as the internal control and each gene expression was normalized. Microarray analysis data are the average of results in two independent experiments and real-time PCR data are the mean ± SEM of results in four independent experiments. (C) Time course of gene expression changes as evaluated by real-time PCR analysis. Fra-1 mRNA expression peaked at 6 hours, whereas Jun B and cyclin D1 peaked at 24 hours. Data are presented as the mean ± SEM of results in four independent experiments. (D) Time course of gene expression changes, as evaluated by the real-time PCR analysis. Fra-2 mRNA expression showed upregulation approximately seven times the control level. Gene expression for c-Fos, c-Jun, and cyclin D2 was modestly upregulated. Data are presented as the mean ± SEM of results in four independent experiments.
Figure 2.
 
(A) Ethidium bromide–stained agarose gel of the PCR products. Each reaction product yielded a single band. The number of thermal cycles used in the amplification step were GAPDH, 25 cycles; Fra-1, Fra-2, c-Myc, c-Jun, cyclin D1, and cyclin D2, 30 cycles; and c-Fos and Jun B, 35 cycles. (B) Comparison of gene expression changes as determined by microarray and real-time PCR analyses at 12 hours after reperfusion. Gene expression for GAPDH was used as the internal control and each gene expression was normalized. Microarray analysis data are the average of results in two independent experiments and real-time PCR data are the mean ± SEM of results in four independent experiments. (C) Time course of gene expression changes as evaluated by real-time PCR analysis. Fra-1 mRNA expression peaked at 6 hours, whereas Jun B and cyclin D1 peaked at 24 hours. Data are presented as the mean ± SEM of results in four independent experiments. (D) Time course of gene expression changes, as evaluated by the real-time PCR analysis. Fra-2 mRNA expression showed upregulation approximately seven times the control level. Gene expression for c-Fos, c-Jun, and cyclin D2 was modestly upregulated. Data are presented as the mean ± SEM of results in four independent experiments.
Figure 3.
 
(A) Control retina stained with anti-Fra-1 antibody. No specific immunostaining was observed. The cellular nuclei were stained by PI (red). (B) Immunostaining with anti-Fra-1 antibody, at 12 hours after reperfusion. Positively stained cells (green) were found in the inner nuclear layer (INL). (C) Higher magnification of (B), showing positively stained cells in the INL (arrows). No positive anti-Fra-1 staining appeared in cells that showed condensed PI staining (arrowheads). (D) PI staining of the same section as (C). The image was obtained by using a red filter to identify PI-positive cells. (E) Double staining with anti-Fra-1 (green) and anti-S-100 (red) antibodies showed colocalization of Fra-1 and S-100 (arrowheads). (F) S-100 staining of the same section as in (E). Arrowheads: positive staining. Scale bar: (A, B, E, F) 25 μm; (C, D) 10 μm.
Figure 3.
 
(A) Control retina stained with anti-Fra-1 antibody. No specific immunostaining was observed. The cellular nuclei were stained by PI (red). (B) Immunostaining with anti-Fra-1 antibody, at 12 hours after reperfusion. Positively stained cells (green) were found in the inner nuclear layer (INL). (C) Higher magnification of (B), showing positively stained cells in the INL (arrows). No positive anti-Fra-1 staining appeared in cells that showed condensed PI staining (arrowheads). (D) PI staining of the same section as (C). The image was obtained by using a red filter to identify PI-positive cells. (E) Double staining with anti-Fra-1 (green) and anti-S-100 (red) antibodies showed colocalization of Fra-1 and S-100 (arrowheads). (F) S-100 staining of the same section as in (E). Arrowheads: positive staining. Scale bar: (A, B, E, F) 25 μm; (C, D) 10 μm.
Figure 4.
 
(A) Control retina stained with anti-Jun B antibody, showing no specific immunostaining. The cellular nuclei were stained by PI (red). (B) Immunostaining with anti-Jun B antibody, at 12 hours after reperfusion. Positively stained cells (green) are seen in the INL. (C) Double staining with anti-Jun B (green) and anti-S-100 (red) antibodies. Colocalization of Jun B and S-100 signals is evident. (D) Higher magnification of (C). Colocalization of the two signals are more clearly evident. (E) Double staining with anti-Jun B (green) and anti-c-Jun (red) antibodies, showing Jun B (arrows) and c-Jun (arrowheads) immunoreactivity. The two signals do not merge indicating that Jun B–positive cells and c-Jun–positive cells are different. (F) c-Jun immunostaining of the same section as in (E). Black and white image obtained by using a red filter, shows c-Jun immunostaining (arrowheads) more clearly. Arrow: Jun-B positivity. Scale bar: (A, B) 25 μm; (C, D, E, F) 10 μm.
Figure 4.
 
(A) Control retina stained with anti-Jun B antibody, showing no specific immunostaining. The cellular nuclei were stained by PI (red). (B) Immunostaining with anti-Jun B antibody, at 12 hours after reperfusion. Positively stained cells (green) are seen in the INL. (C) Double staining with anti-Jun B (green) and anti-S-100 (red) antibodies. Colocalization of Jun B and S-100 signals is evident. (D) Higher magnification of (C). Colocalization of the two signals are more clearly evident. (E) Double staining with anti-Jun B (green) and anti-c-Jun (red) antibodies, showing Jun B (arrows) and c-Jun (arrowheads) immunoreactivity. The two signals do not merge indicating that Jun B–positive cells and c-Jun–positive cells are different. (F) c-Jun immunostaining of the same section as in (E). Black and white image obtained by using a red filter, shows c-Jun immunostaining (arrowheads) more clearly. Arrow: Jun-B positivity. Scale bar: (A, B) 25 μm; (C, D, E, F) 10 μm.
Table 1.
 
Oligonucleotides Used for Real-Tme PCR
Table 1.
 
Oligonucleotides Used for Real-Tme PCR
Target Gene Sequence (5′–3′) Product Size (bp)
GAPDH Sense TGCCACTCAGAAGACTGTGGATG 374
Antisense AGTTGTCATTGAGAGCAATGCCAG
c-Fos Sense GTCTTCCTTTGTCTTCACCTACC 440
Antisense GCTCACATGCTACTAACTACCAG
Fra-1 Sense AAGCAGAAGGAACGCCTTGAGC 420
Antisense GCTGGATGAACAGGGAAAGGAG
Fra-2 Sense GAGACAGAGGAGCTGGAGGAG 387
Antisense GGTGAAGACAAGGTTTGAAGTGC
c-Myc Sense TGCCAAACTGGTCTCCGAGAAG 454
Antisense GCTGTGTGGAGGTTTGCTGTGG
c-Jun Sense TCCCCCATCGACATGGAGTCTC 400
Antisense CCAGTCCATCTTGTGTACCCTTG
JunB Sense CAAGGTGAAGACACTCAAGGCTG 352
Antisense AAACATACAAAATACGCTGGAAGG
Cyclin D1 Sense CCACAGATGTGAAGTTCATTTCC 358
Antisense GATGCCACTACTTGGTGACTCC
Cyclin D2 Sense GTGCTACCGACTTCAAGTTTGCC 347
Antisense TGACGAACACGCCTCTCTCTTG
Table 2.
 
Summary of Genes Differentially Regulated in Rat Retina after Ischemia–Reperfusion
Table 2.
 
Summary of Genes Differentially Regulated in Rat Retina after Ischemia–Reperfusion
Accession Number Gene Name Change Multiple
Exp. 1 Exp. 2 Avg.
Immediate early genes or transcription factors
 M19651 Fos-related antigen (Fra-1) 33.9 9.3 21.6
 X54686 Jun B 22.9 8.0 15.5
 Y00396 c-Myc 12.1 3.8 8.0
 X60769 CCAAT/enhancer binding protein (C/EBP), beta 11.2 3.0 7.1
 U02522 Mta1, metastasis associated 1 7.0 2.5 4.8
 M65149 CELF, CCAAT/enhancer binding protein (C/EBP), delta 5.1 4.5 4.8
 X62875 High mobility group protein I (HMGIY) 3.4 3.8 3.6
 AI175959 c-Jun 3.0 3.5 3.3
 M63282 Leucine zipper protein, ATF3 3.0 2.9 3.0
 M18416 Nerve growth factor-induced (NGFI-A) 2.6 3.3 3.0
 AF053100 Pax4a −3.4 −4.0 −3.7
Cell-cycle–related genes
 D16308 Cyclin D2 27.0 8.4 17.7
 X75207 Cyclin D1 8.6 3.1 5.9
 AF063447 Nuclear RNA helicase 4.8 2.5 3.7
 L23148 Inhibitor of DNA-binding, splice variant Id1.25 4.0 2.7 3.4
Stress responsive protein genes
 AF082125 Aryl hydrocarbon receptor (AHR) 52.1 13.0 32.6
 J02722 Heme oxygenase 1 34.8 9.4 22.1
 X15143 beta A3/A1 crystallin 20.8 5.7 13.3
 AI176456 Metallothionein-2 and metallothionein-1 13.0 8.9 11.0
 X60351 alpha B-crystallin 9.9 8.9 9.4
 J00717 gamma-C-crystallin (gamma 2-1) 13.0 4.7 8.9
 X83671 beta-B2 crystallin 6.8 6.2 6.5
 AF082160 GRIFIN, galectin-related inter-fiber protein 8.5 3.3 5.9
 S81917 34-kDa DnaJ-hsp40 heat shock-chaperone protein 7.5 2.9 5.2
 M15901 beta-B3-2-crystallin 4.9 3.3 4.1
 AA891286 NADPH-dependent thioredoxin reductase (TRR1) 4.1 4.0 4.1
 AA998683 Heat shock protein 27 (hsp 27) 5.4 2.5 4.0
 U63923 Thioredoxin reductase 3.6 4.3 4.0
 AA108277 Heat shock protein (hsp-E7I) 5.4 2.2 3.8
 S75280 Pre-mtHSP70 3.4 3.5 3.5
 U47921 alpha A (insert)-crystallin 3.0 2.9 3.0
 S72505 Glutathione S-transferase Yc1 subunit −12.2 −10.9 −11.6
Cell-signaling protein genes
 AF030089 Activity and neurotransmitter-induced early gene protein 4 (ania-4) 65.1 31.3 48.2
 AF065161 Cytokine-inducible SH2-containing protein 24.6 7.0 15.8
 X17053 Immediate-early serum-responsive JE protein, monocyte chemotactic protein 1 (MCP-1) 17.4 12.9 15.2
 AA859593 Estrogen-responsive finger protein 20.6 5.4 13.0
 S54008 Fibroblast growth factor receptor 1 beta-isoform 17.2 5.3 11.3
 AF051895 Lipocortin V, annexin V 16.3 5.6 11.0
 U42627 Dual-specificity protein tyrosine phosphatase (rVH6) 11.0 9.0 10.0
 J03627 S-100 related protein 10.5 7.9 9.2
 U59510 Endothelin-2 13.6 3.5 8.6
 M80367 Isoprenylated 67-kDa protein, similar to mouse interferon-induced guanylate binding protein GBP-2 8.6 4.5 6.6
 AA998446 Phosphatidylinositol transfer protein (beta isoform) 9.5 3.5 6.5
 AI113289 Protein-tyrosine-phosphatase (ptp) 6.6 6.3 6.5
 U91847 p38 mitogen activated protein kinase, p38 MAP kinase 8.1 2.7 5.4
 AI171962 Lipocortin I, annexin I 7.2 2.6 4.9
 AI232477 G protein gamma-5 subunit 3.9 5.8 4.9
 D28508 Protein-tyrosine kinase, JAK3 7.1 2.3 4.7
 U14950 Synapse-associated protein 97 (SAP97) 5.9 3.4 4.7
 AI014163 Interferon-related developmental regulator 1 (IFRD1, PC4) 4.5 4.7 4.6
 L21192 GAP-43 4.2 4.4 4.3
 X61381 Interferon induced protein, a family of IFN-induced transmembrane proteins 4.5 3.9 4.2
 M34253 Interferon regulatory factor 1 (IRF-1) 4.3 3.9 4.1
 U45965 Macrophage inflammatory protein-2, MIP-2 5.7 2.4 4.1
 M74223 VGF, nerve growth factor inducible 2.7 3.8 3.3
 AF013144 MAP-kinase phosphatase (cpg21) 2.7 3.6 3.2
 AF034899 Olfactory receptor-like protein (SCR D-9) −4.0 −2.3 −3.2
 U88324 G protein betal subunit (rGb1) −3.8 −4.7 −4.3
(continued)
Table 2A.
 
(Continued). Summary of Genes Differentially Regulated in Rat Retina after Ischemia–Reperfusion
Table 2A.
 
(Continued). Summary of Genes Differentially Regulated in Rat Retina after Ischemia–Reperfusion
Cell adhesion and cell surface protein genes
 U92081 Epithelial cell transmembrane protein antigen precursor (RTI40) 15.7 36.2 26.0
 M61875 Glycoprotein CD44 21.2 6.6 13.9
 M64986 Amphoterincin 19.3 6.3 12.8
 AI231213 Metastasis suppressor homologue (KAI1), similar to mouse CD82 12.0 5.9 9.0
 D00913 Intercellular adhesion molecule-1, ICAM-1 12.8 2.4 7.6
 J02962 IgE binding protein 8.9 2.9 5.9
 AF017437 Integrin-associated protein form 4 (IAP) 7.5 3.1 5.3
 AB008538 HB2, activated leukocyte cell-adhesion molecule (ALCAM) 6.4 2.6 4.5
 AI177366 Integrin beta subunit 4.4 4.5 4.5
 M32062 Fc-gamma receptor 4.7 2.7 3.7
 M14656 Osteopontin 3.6 3.3 3.5
 X61654 Ad1-antigen, similar to mouse CD63 3.0 3.9 3.5
 AI170268 beta-2-Microglobulin 3.5 2.8 3.2
 M24324 MHC class I RT1 (RTS) 2.9 3.2 3.1
 AF074608 MHC class I antigen (RT1.EC2) 2.6 3.4 3.0
 U27562 SC1 protein, SPARC-like 1 −3.3 −3.1 −3.2
 AI176461 Sialoglycoprotein MG-160 −6.1 −4.3 −5.2
Genes for translation and protein turnover
 AI169327 Tissue inhibitor of metalloproteinase (TIMP) 55.2 15.1 35.2
 AA946503 alpha-2u Globulin-related protein 36.7 10.8 23.8
 X02601 Transin, stromelysin-1, matrix metalloproteinase-3 14.9 14.2 14.6
 M23697 Tissue-type plasminogen activator (t-PA) 8.1 4.7 6.4
 L09120 Calpain II 80-kDa subunit 8.7 3.5 6.1
 J04943 Nucleolar protein B23.2 4.7 3.5 4.1
 AI178921 Insulin-degrading enzyme (EC 3.4.24.56) 4.2 2.9 3.6
 AI176595 Cathepsin L 3.1 3.1 3.1
 X59375 Ribosomal protein S27 3.2 2.8 3.0
Genes for cellular metabolism
 X12459 Argininosuccinate synthetase (EC 6.3.4.5) 23.7 7.4 15.6
 J04792 Ornithine decarboxylase (ODC) 12.8 10.1 11.5
 U24282 Iodothyronine deiodinase III (dioIII) 5.1 3.5 4.3
 D89514 5-Aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase 3.7 4.2 4.0
 U26033 Carnitine octanoyltransferase 3.6 3.6 3.6
 AA892775 Lysozyme 3.7 2.6 3.2
 X55298 Ribophorin II 3.1 3.1 3.1
 M91652 Glutamine synthetase (glnA) −3.3 −3.7 −3.5
 S56464 Hexokinase II (HKII) −4.3 −4.4 −4.4
 X58294 Carbonic anhydrase II −4.0 −5.8 −4.9
Others
 AA892333 alpha-Tubulin 61.9 16.7 39.3
 AF026554 Sodium-dependent multi-vitamin transporter (SMVT) 11.4 3.5 7.5
 U06230 Protein S 8.6 2.5 5.6
 U87983 Hyaluronan-mediated motility receptor 6.8 3.6 5.2
 X54617 Myosin regulatory light chain (RLC-A) 4.4 6.6 5.0
 AA945169 Transthyretin, thyroid hormone-binding protein 4.5 3.6 4.1
 MI1597 Calcitonin-related peptide, alpha 5.0 2.3 3.7
 AI178135 Complement component 1, q subcomponent–binding protein (gC1qBP) 4.2 3.0 3.6
 AA892318 Similar to mouse SRp25 nuclear protein 2.9 4.2 3.6
 AA859305 Tropomyosin 5 (TM-5) 4.9 2.9 3.9
 AF083269 p41-Arc, actin related protein 2/3 complex, subunit 1B 3.4 3.2 3.3
 AF008439 Natural resistance-associated macrophage protein 2 (Nramp2) 4.0 2.5 3.3
 U31866 Rattus norvegicus Nclone10 mRNA 3.2 2.8 3.0
 AI228669 GABA transporter protein −3.1 −3.0 −3.1
 S76779 Apolipoprotein E, rApoE −3.2 −3.2 −3.2
 D89730 T16, EGF-containing fibulin-like extracellular matrix protein 1 −4.8 −3.6 −4.2
 AJ224879 Collagen alpha 1 type II −8.8 −3.7 −6.3
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×