December 2004
Volume 45, Issue 12
Free
Cornea  |   December 2004
Stimulation of Matrix Metalloproteinases by Hyperosmolarity via a JNK Pathway in Human Corneal Epithelial Cells
Author Affiliations
  • De-Quan Li
    From the Ocular Surface Center, Cullen Eye Institute, Department of Ophthalmology, Baylor College of Medicine, Houston, Texas; and the
  • Zhuo Chen
    From the Ocular Surface Center, Cullen Eye Institute, Department of Ophthalmology, Baylor College of Medicine, Houston, Texas; and the
  • Xiu Jun Song
    From the Ocular Surface Center, Cullen Eye Institute, Department of Ophthalmology, Baylor College of Medicine, Houston, Texas; and the
    Third Hospital of Hebei Medical University, Shijiazhuang, China.
  • Lihui Luo
    From the Ocular Surface Center, Cullen Eye Institute, Department of Ophthalmology, Baylor College of Medicine, Houston, Texas; and the
  • Stephen C. Pflugfelder
    From the Ocular Surface Center, Cullen Eye Institute, Department of Ophthalmology, Baylor College of Medicine, Houston, Texas; and the
Investigative Ophthalmology & Visual Science December 2004, Vol.45, 4302-4311. doi:10.1167/iovs.04-0299
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to Subscribers Only
      Sign In or Create an Account ×
    • Get Citation

      De-Quan Li, Zhuo Chen, Xiu Jun Song, Lihui Luo, Stephen C. Pflugfelder; Stimulation of Matrix Metalloproteinases by Hyperosmolarity via a JNK Pathway in Human Corneal Epithelial Cells. Invest. Ophthalmol. Vis. Sci. 2004;45(12):4302-4311. doi: 10.1167/iovs.04-0299.

      Download citation file:


      © 2016 Association for Research in Vision and Ophthalmology.

      ×
  • Supplements
Abstract

purpose. To investigate whether exposure of human corneal epithelial cells to hyperosmotic stress activates the c-Jun NH2-terminal kinase (JNK) stress-activated protein kinase (SAPK) pathway, and stimulates production of the matrix metalloproteinases (MMPs): gelatinase (MMP-9), collagenases (MMP-1 and -13), and stromelysin (MMP-3).

methods. Primary human corneal epithelial cells cultured in normal osmolar medium (312 mOsM) were exposed to media with higher osmolarity (350–500 mOsM) achieved by adding NaCl, with or without SB202190, an inhibitor of the JNK pathway; dexamethasone; or doxycycline for different lengths of time. The conditioned media were collected after 24 hours of exposure for zymography and ELISA. Total RNA was extracted from cultures treated for 6 hours and subjected to semiquantitative RT-PCR. Cells treated for 5 to 60 minutes were lysed in RIPA buffer and subjected to Western blot with phospho (p)-specific antibodies against p-JNK and p-c-Jun. JNK1 activation was also detected with an immunoassay system.

results. The concentrations of MMP-9, -1, and -3 proteins in 24-hour conditioned media of corneal epithelial cells progressively increased as the media’s osmolarity was increased from 312 to 500 mOsM by the addition of NaCl. The concentration of MMP-13 progressively increased to a peak at 450 mOsM. Active p-JNK-1, p-JNK-2, and p-c-Jun were detected by Western blot as early as 5 minutes and peaked at 60 minutes in cells exposed to hyperosmolar media. The levels of p-JNK-1, p-JNK-2, and p-c-Jun correlated positively with the osmolarity of the culture media. The p-JNK inhibitor SB202190 and doxycycline markedly inhibited the stimulation of p-JNK-1, p-JNK-2, and p-c-Jun, as well as MMP-9, -1, -13, and -3 at both the mRNA and protein levels in the cells exposed to hyperosmolar media.

conclusions. Expression and production of MMP-9, -1, -13, and -3 by human corneal epithelial cells correlated positively with increasing media osmolarity. This increase was mediated at least in part through activation of the JNK SAPK pathway. Doxycycline, an agent used to treat MMP-mediated ocular surface disease, inhibited the hyperosmolarity-induced MMP production and JNK activation. The relevance of these findings to stimulated production of MMPs by the elevated tear osmolarity in dry eye remains to be determined.

Investigation of osmotic stress in mammalian tissues has been focused primarily on the kidney, but increasing evidence suggests that osmotic stress, caused by altered extracellular osmolarity, is a highly relevant challenge to normal cell function in a variety of other tissues, including human bronchial epithelial cells, 1 2 peripheral blood mononuclear cells, 3 and the corneal epithelium. 4 Hyperosmolarity has been reported to increase significantly the production of inflammatory cytokines such as interleukin (IL)-1 and chemokines such as IL-8 in human peripheral blood leukocytes 3 and bronchial epithelial cells. 1 On the ocular surface, the tear fluid serves as the major source of hydration, and it plays a protective role against bacterial infection and physicochemical insults. 5 Dry eye, a common disease that affects approximately 7 million Americans, develops from decreased tear secretion or excessive tear evaporation that results in a hyperosmolar tear film. 6 Chronic dry eye has been demonstrated to cause inflammation, evidenced by an increase in proinflammatory cytokines and chemokines in the tear fluid, increased expression of immune activation and adhesion molecules (HLA-DR and intercellular adhesion molecule [ICAM-1]) by the conjunctival epithelium, and an increased number of T lymphocytes in the conjunctiva. 7 8 9 10 The importance of inflammation in the pathogenesis of the ocular surface disease of dry eye, termed keratoconjunctivitis sicca (KCS), is underscored by the clinical improvement obtained with anti-inflammatory agents such as cyclosporine A, corticosteroids, and doxycycline. 11  
Von Bahr 12 was the first to suggest (in 1941) that tear film osmolarity is dependent on tear secretion and evaporation and that decreased secretion would lead to increased osmolarity. Balik 13 appears to have been the first to suggest (in 1952) that the corneal and conjunctival changes in KCS could be explained on the basis of an increased “concentration of sodium chloride” in the tear film, but he was unable to demonstrate this increase. Approximately 2 decades later, Tumbar et al. 14 evaluated tear osmolarity in six eyes with KCS and found an elevation of approximately 25 mOsM/L. 14 Subsequent studies also reported significantly increased tear fluid osmolarity in patients with KCS, with peak osmolarities of approximately 450 mOsM. 15 16 Based on its sensitivity and specificity, tear osmolarity was proposed as a gold standard diagnostic test for dry eye by Farris 17 at the 1st International Conference on the Lacrimal Gland, Tear Film and Dry Eye in 1992. Elevated tear film osmolarity, associated with decreased corneal glycogen and reduced conjunctival goblet cell density, was found in short- and long-term rabbit models of dry eye. 18 19 The use of sodium hyaluronate eye drops with pronounced hypotonicity had greater therapeutic effects on the severity of Sjögren’s-syndrome–associated KCS than did isotonic solutions. 20 However, the pathogenic effects of increased osmolarity on the ocular surface have not been consistently demonstrated. Bathing the corneal epithelium with solutions with osmolarities of up to 425 mOsM/L, similar to levels that are encountered in dry eye, was not sufficient in itself to increase the cell-shedding rate. 21 Hypo-osmolar artificial tears were reported to be less comfortable than iso-osmolar tears in patients with KCS. 22 Studies showing lack of strong correlation between objective measures of ocular surface disease and eye irritation symptoms suggest that a gold standard for diagnosis for dry eye has yet to be identified. 23 Thus, although the elevated tear osmolarity in dry eye has been recognized for decades, there is still a mystery regarding the role of tear hyperosmolarity in the pathogenesis of the ocular surface disease of dry eye, and whether it may cause inflammation, epithelial disease, and irritation symptoms. 
Matrix metalloproteinases (MMPs) are a family of zinc-dependent extracellular endoproteinases. To date, at least 23 MMP genes have been identified in humans. They can be classified into six groups on the basis of their substrate specificity: gelatinases, collagenases, stromelysins, matrilysins, membrane-type MMPs, and others. MMPs play a central role in tissue remodeling, wound healing, angiogenesis, and many diseases, including ocular surface diseases such as dry eye (for reviews, see Refs. 24 25 26 ). MMPs participate in tissue remodeling during inflammation, 27 28 29 30 31 and also promote inflammation by cleavage of the precursors of pro-inflammatory factors—for example, IL-1, and tumor necrosis factor (TNF)-α 32 33 and latent pro-MMPs 34 35 36 —into their active forms. In addition, cytokines and growth factors, such as IL-1, IL-6, TNF-α, platelet-derived growth factor (PDGF), and transforming growth factor (TGF)-β, stimulate the production of a variety of MMPs, including gelatinases (MMP-2 and -9), collagenases (MMP-1 and -13), and stromelysins (MMP-3 and -10). 37 38 39 40 41 Increased levels of IL-1, MMP-3, and MMP-9 in the tear fluid have been observed in patients with KCS. 42 43 44 45 The highest levels of MMP-9 were detected in the tear fluid of patients with severe KCS and sterile corneal ulceration. 9 The mechanism by which MMP production is stimulated by the ocular surface stress of dry eye has not been determined; however, activation of cell-signaling pathways that regulate production of these proinflammatory factors by hyperosmolar stress must be considered. 
The mitogen-activated protein kinases (MAPKs) are well-conserved signaling pathways that include extracellular-signal–regulated kinases (ERK), c-Jun N-terminal kinases (JNKs), and p38 MAPK. JNKs are also known as stress-activated protein kinases (SAPKs) for their response to a variety of stressors. 46 47 48 JNK is the major enzyme that phosphorylates the transcription factor c-Jun, which serves as an essential regulatory step for the control of transcriptionally active c-Fos/c-Jun heterodimers. 46 Thus, activated MAPKs initiate a cascade of protein phosphorylation involving multiple other kinases and activate nuclear transcription factors such as AP-1 and ATF, 49 50 51 which stimulate expression of inflammatory cytokines such as IL-1, TNF-α, and IL-8 2 3 and MMPs such as MMP-1, -9, and -13. 52 53 JNK activation has been reported in osmotically shocked cells. 47 However, the linkage between induction of MMP production and activation of JNK that follows hyperosmotic stress has not been established. 
We hypothesize that hyperosmotic stress may cause inflammation in corneal epithelial cells by activating MAPK signaling pathways in human corneal epithelial cells. The present study was undertaken to test this hypothesis by evaluating the expression and regulation of MMPs and activation of JNK-signaling pathway by hyperosmotic stress in primary cultured human corneal epithelial cells. The purpose of this study was to determine whether there is a link between hyperosmolar stress and the production of the proinflammatory factors by the corneal epithelium that have been detected on the ocular surface of dry eyes. 
Materials and Methods
Cell culture dishes, plates, centrifuge tubes, and other plastic ware were purchased from BD Biosciences (Lincoln Park, NJ), polyvinylidene difluoride (PVDF) membranes were from Millipore (Bedford, MA), and polyacrylamide gels and sodium dodecyl sulfate (SDS) were from Bio-Rad (Hercules, CA). Dulbecco’s modified Eagle’s medium (DMEM), Ham’s F-12, amphotericin B, gentamicin, and DNA size markers were from Invitrogen-Gibco (Grand Island, NY). Fetal bovine serum (FBS) was from Hyclone (Logan, UT). SB202190 was from Calbiochem-EMD Biosciences, Inc. (San Diego, CA). Protease inhibitor cocktail tablets were from Roche Applied Science (Indianapolis, IN). A protein assay kit (Micro BCA) was from Pierce Chemical (Rockford, IL). Enhanced chemiluminescence (ECL) reagents were from Amersham (Piscataway, NJ). Rabbit polyclonal antibody against JNK and horseradish-peroxidase–conjugated goat anti-rabbit IgG were from Cell Signaling Technology (Beverly, MA), rabbit antibody against phosphorylated JNK (p-JNK) was from Santa Cruz Biotechnology (Santa Cruz, CA), and rabbit antibody against phosphorylated c-jun (p-c-jun) and a cell-signaling assay kit (Beadlyte) were from Upstate Biotechnology (Lake Placid, NY). Sorbitol-treated PC12 cell extracts used as a positive control for p-JNK were from Promega (Madison, WI). Enzyme-linked immunosorbent assay (ELISA) kits for human MMP-9, -1, -13, and -3 were from R&D Systems (Minneapolis, MN). The RNA-PCR kit (GeneAmp) was from Applied Biosystems (Foster City, CA). Doxycycline, dexamethasone, and all other chemicals and reagents were from Sigma-Aldrich (St. Louis, MO). 
Primary Cultures of Human Corneal Epithelial Cells
Human corneoscleral tissues, which did not meet the criteria for clinical use, from donors aged 16 to 59 years were obtained from the Lions Eye Bank of Texas (Houston, TX). Corneal epithelial cells were grown from limbal explants by using a previously described method 40 43 with modifications. In brief, after carefully removal of the central cornea, excess sclera, iris, corneal endothelium, conjunctiva and Tenon’s capsule, the remaining limbal rim was cut into 12 equal pieces (approximately 2 × 2 mm each). Two pieces with epithelium side up were directly placed into each well of six-well culture plates, and each explant was covered with a drop of FBS overnight. The explants were then cultured in supplemented hormonal epithelial medium (SHEM) medium, which was an 1:1 mixture of DMEM and Ham’s F12, containing 5 ng/mL EGF, 5 μg/mL insulin, 5 μg/mL transferrin, 5 ng/mL sodium selenite, 0.5 μg/mL hydrocortisone, 30 ng/mL cholera toxin A, 0.5% dimethyl sulfoxide (DMSO), 50 μg/mL gentamicin, 1.25 μg/mL amphotericin B, and 5% FBS, at 37°C under 5% CO2 and 95% humidity. The medium was renewed every 2 to 3 days. The epithelial phenotype of these cultures was confirmed by characteristic morphology and immunofluorescent staining with cytokeratin antibodies (AE-1/AE-3). 
Cell Treatment
Subconfluent corneal epithelial cultures (grown for 12–14 days, approximately 4–5 × 105 cells/well) were washed three times with PBS and switched to a serum-free medium (SHEM without FBS) for 24 hours before treatment. For gelatin zymography and MMP ELISA, the corneal epithelial cells were cultured for an additional 24 hours in an equal volume (1.4 mL/well) of serum-free media with a different osmolarity, ranging from 312 to 500 mOsM which was achieved by adding 0, 30, 50, 70, or 90 mM sodium chloride (NaCl), with or without SB202190 (20 μM), an inhibitor of the JNK pathway; dexamethasone (1 μM); or doxycycline (10 μg/mL), which was added 40 minutes before adding NaCl. The conditioned media were then collected and centrifuged, and the supernatants were stored at −80°C before use. For Western blot, the cultures were treated with the same conditions as just described, but for a shorter time, ranging from 5 to 60 minutes. The adherent cells were lysed in RIPA buffer containing 50 mM Tris-HCl, 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 2 mM sodium fluoride, 2 mM EDTA, 0.1% SDS, and protease inhibitor cocktail. The cell extracts were centrifuged at 12,000g for 15 minutes at 4°C, and the supernatants were store at −80°C before use. The total protein concentrations of the conditioned media and cell extracts were determined by bicinchoninic (BCA) protein assay (Micro BCA; Pierce Biotechnology). For gene expression, cultures that received the same treatments for 6 hours were lysed in 4 M guanidium solution and subjected to total RNA extraction. These experiments were performed at least three times on each of three separate sets of cultures that were initiated from different donor corneas. 
Gelatin Zymography
To measure the production and activity of gelatinases in the conditioned media from corneal epithelial cultures receiving various treatments, gelatin zymography was performed using a previously reported method. 40 43 Briefly, 8 to 10 μL of each supernatant of the conditioned medium was used, and the volume was adjusted to contain the same quantity of protein (5 μg). The media supernatants were mixed with an equal volume of 2× SDS-PAGE sample buffer without boiling or reduction. Samples were fractionated in an 8% polyacrylamide gel containing gelatin (0.5 mg/mL) by electrophoresis at 100 V for 90 minutes at 4°C. The gels were soaked in 0.25% Triton X-100 for 30 minutes at room temperature (RT) to remove the SDS and incubated in a digestion buffer (50 mM Tris-HCl [pH 7.4], 150 mM NaCl, 10 mM CaCl2, 2 μM ZnSO4, and 0.001% Brij-35) containing 5 mM phenylmethylsulfonyl fluoride (PMSF), a serine protease inhibitor, at 37°C overnight, to allow proteinase digestion of the substrate. The gels were stained with 0.25% Coomassie brilliant blue R-250 in 40% isopropanol for 2 hours and destained with 7% acetic acid. Gelatinolytic activities appeared as clear bands of digested gelatin against a dark blue background of stained gelatin. 
Matrix Metalloproteinase ELISA
Double sandwich ELISAs for human MMP-9, -1, -13, and MMP-3 were performed using kits from R&D Systems, as previous reported. 40 41 In brief, 100 μL of assay buffer and 100 μL of standard dilutions of recombinant human MMP-9, -1, -13, or -3 or culture-conditioned media were dispensed into wells of a 96-well plate coated with anti-MMP-9, -1, -13, or -3 monoclonal antibody, respectively. After incubation at RT for 2 hours and four washes, 200 μL of rabbit anti-MMP-9, -1, -13, or -3 conjugate with horseradish peroxidase was added to each well and incubated at RT for 2 hours. Aliquots of 200 μL of the color reagent 3,3′,5,5′-tetramethylbenzidine (TMB) were then applied for 20 to 30 minutes to develop a blue color, and the reaction was stopped by adding 50 μL of 1 M H2SO4. Absorbance was read at 450 nm by a microplate reader (Versamax; Molecular Devices, Sunnyvale, CA) with a reference wavelength of 570 nm. 
Western Blot Analysis
Western blot was performed with a previously described method 54 55 with modification. The cell extract samples (50 μg/lane) were mixed with 6× SDS reducing sample buffer and boiled for 5 minutes before loading. Proteins were separated by SDS polyacrylamide gel electrophoresis and transferred electronically to PVDF membranes. The membranes were blocked with 5% nonfat milk in TTBS (50 mM Tris [pH 7.5], 0.9% NaCl2, and 0.1% Tween-20) for 1 hour at RT, and then incubated 2 hours at RT with a rabbit antibody against JNK (1:1000), p-JNK (1:100), or p-c-Jun (1:1000). The membranes were washed with TTBS and then incubated for 1 hour at RT with horseradish-peroxidase–conjugated goat anti-rabbit IgG (1:2000 dilution). After the membranes were washed four times, the signals were detected with an enhanced chemiluminescence reagent and imaged (model 2000R; Eastman Kodak, New Haven, CT). 
Cell- Signaling Assay
The levels of phosphorylated (p-JNK1) and total JNK1 were also measured with a cell-signaling assay (Beadlyte Cell Signaling Assay; Upstate Biotechnology). This sensitive assay is a fluorescent bead-based sandwich immunoassay. In brief, cells cultured in normal (312 mOsM) and hyperosmolar (350–500 mOsM) media by adding 20 to 90 mM NaCl for 60 minutes were lysed in cell-signaling buffer B from the kit. Total protein concentrations of these cell lysates were measured by a BCA protein assay. Each sample (10 μg/25 μL) was pipetted into a well of a 96-well plate and incubated with 25 μL of beads coupled to JNK1- or p-JNK1–specific capture antibodies overnight. The beads were washed and mixed with biotinylated specific reporter antibodies for total JNK1 or p-JNK1, followed by streptavidin-phycoerythrin. The amount of total or p-JNK1 was then quantified (model 100 system; Luminex Corp., Austin, TX). Fifty events per bead were read, and the data output obtained from the software (Bio-Plex Manager; Luminex Corp.) were exported to statistical analysis software (Excel; Microsoft, Redmond, WA) for further analysis. The results are presented as the percentage of p-JNK1 to total JNK1. 
RNA Isolation and Semiquantitative RT-PCR
Total RNA was isolated from corneal epithelial cultures with different treatment by acid guanidium thiocyanate-phenol-chloroform extraction, with a previously described method. 56 The PCR primers for gelatinase (MMP-9), collagenases (MMP-1 and -13), stromelysins (MMP-3), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were designed from published human gene sequences (Table 1) . Semiquantitative RT-PCR was performed to evaluate the expression of these MMP genes by corneal epithelial cells using the house-keeping gene GAPDH as an internal control. 40 56 In brief, the first-strand cDNAs were synthesized from 1 μg of total RNA at 42°C for 30 minutes. PCR amplification was performed (GeneAmp PCR System 9700; Applied Biosystems) using the following program: denaturation for 2 minutes at 95°C followed by 20 to 40 cycles of denaturation for 1 minute at 95°C, annealing for 1 minute at 60°C, and extension for 1 minute at 72°C and a last extension for 7 minutes at 72°C. Semiquantitative RT-PCR was established by terminating reactions at intervals of 20, 24, 28, 32, 36, and 40 cycles for each primer pair to ensure that the PCR products formed were within the linear portion of the amplification curve. The fidelity of the RT-PCR product was verified by comparing the size of the amplified products with the expected cDNA bands and by sequencing the PCR products. 
Statistical Analysis
Based on the normality of the data distribution, the Student’s t-test or Mann-Whitney test were used for statistical comparison of assay results between groups. 
Results
Effect of Hyperosmolarity on Expression and Production of MMPs
Gelatin zymography (Fig. 1) clearly showed that the production and activity of the 92-kDa MMP-9 protein was stimulated in a concentration-dependent fashion in conditioned media from human corneal epithelial cells cultured in media of increasing osmolarity (∼370–500 mOsM) by adding 30, 50, 70, or 90 mM NaCl to normally osmotic media (312 mOsM) for 24 hours. In contrast, production of 72-kDa MMP-2 was increased only slightly by hyperosmolar media. Although zymography showed clearly the protein’s molecular size, enzymatic activity, and relative intensity of the MMP bands, ELISA was performed to determine quantitatively the concentration of the MMP proteins produced by these cells. The concentration of MMP-9 in conditioned media, measured by ELISA, confirmed this progressive stimulation, with MMP-9 levels significantly increasing from 6.28 ± 1.82 (mean ± SD) ng/mL in cells exposed to normal osmolarity (312 mOsM) to 12.06 ± 2.49, 20.35 ± 1.72, and 23.23 ± 1.71 ng/mL (all P < 0.001, n = 4) in cells exposed to media with increasing osmolarities of 400, 450, and 500 mOsM, respectively (Fig. 2A)
Because casein gel zymography was not sensitive enough to detect MMP-3 and other stromelysin and collagenase zymography is not available, only ELISAs were performed to detect MMP-1, -13, and -3. The results showed that the concentrations of collagenase MMP-1 (Fig. 2B) increased in a concentration-dependent manner from 12.02 ± 1.02 ng/mL in control media (312 mOsM) to 21.53 ± 1.28 (P > 0.05, n = 4), 53.30 ± 4.66 and 88.46 ± 3.47 ng/mL (all P < 0.001, n = 4), respectively, in conditioned media treated for 24 hours with hyperosmolar media of 400, 450, and 500 mOsM created by adding 50, 70, or 90 mM NaCl to control media. The levels of collagenase MMP-13 (Fig. 2C) dramatically increased from 105.55 ± 7.63 pg/mL in control media to 393.12 ± 42.73, 984.31 ± 55.36, and 521.51 ± 77.7 pg/mL (all P < 0.001, n = 4) in media of increasing osmolarity. The peak level of MMP-13 was reached in 450-mOsM media. The stromelysin MMP-3 concentration (Fig. 2D) increased from 13.72 ± 2.64 ng/mL in the control group to 26.50 ± 3.60, 50.21 ± 11.85, and 74.30± 6.94 ng/mL (all P < 0.001, n = 4) in hyperosmolar media of 400, 450, and 500 mOsM, respectively. 
Effect of Hyperosmolarity on JNK Signaling Pathway
With phospho-specific antibodies, Western blot analysis revealed that phosphorylated JNK-1 (p-JNK-1) and JNK-2 (p-JNK-2) increased in corneal epithelial cells as early as 5 minutes, and reached peak levels 60 minutes after exposure to media of approximately 500 mOsM (Fig. 3A) . Levels of p-JNK-1 and -2 were stimulated in a concentration-dependent fashion when the cells were exposed to media of increasing osmolarity (400–500 mOsM) by adding 50 to 90 mM NaCl for 60 minutes (Fig. 3C) . Specifically, the intensity of 54 kDa p-JNK-2 bands was greater than the 46 kDa p-JNK-1 bands in human corneal epithelial cells stimulated by hyperosmolar media. Phosphorylated 38-kDa c-Jun (p-c-Jun), a direct downstream transcription factor activated by p-JNK, was also increased in a concentration-dependent manner in the cells exposed to hyperosmolar medium (Fig. 3D) . In contrast, there was no change in the intensity of the total JNK bands in these samples when a JNK antibody was used that detects total JNK, including both the unphosphorylated and phosphorylated forms (Fig. 3B) . The cell-signaling assay further confirmed that the percentages of activated p-JNK1 to total JNK1 were increased by hyperosmolar media in a concentration-dependent manner from 370 to 500 mOsM by adding 30 to 90 mM NaCl to the normal medium (Fig. 3E) , although the increase by 370 mOsM was not significant (P > 0.05). 
Effect of SB202190 and Doxycycline on JNK Activation and MMP Expression Induced by Hyperosmolarity
To confirm the hypothesis that hyperosmotic stress stimulates the production of MMPs by the corneal epithelial cells through the JNK pathway, a JNK pathway inhibitor, SB202190, and two clinical anti-inflammatory compounds, doxycycline and dexamethasone, were added individually to the culture media 40 minutes before NaCl was added. As shown in Figure 4B , Western blot displayed clearly that p-JNK-1, p-JNK-2, and p-c-Jun were markedly activated in the cells exposed to hyperosmolar media of 450 and 500 mOsM. The addition of 20 to 40 μM of SB202190 almost abolished the stimulation of p-JNK-1 and -2 by hyperosmolarity (Figs. 4A 4B) . The stimulated increase in p-c-Jun was also markedly inhibited by 20 μM of SB202190 (Fig. 4B) . Compared with 20 μM SB202130, 10 μg/mL doxycycline showed similar inhibitory effects, whereas 1 μM dexamethasone showed much less inhibition of p-JNK and p-c-Jun activation in corneal epithelial cells stimulated with hyperosmolar media with 90 mM NaCl added (Fig. 4B) . In contrast, a similar intensity of total JNK-1 and JNK-2 was detected in these samples by Western blot, using a JNK antibody that detects both unphosphorylated and phosphorylated JNK (Fig. 4B)
Gelatin zymography showed that SB202190 and doxycycline, but not dexamethasone, blocked the stimulatory effects of hyperosmolarity on MMP-9 production by cultured corneal epithelial cells (Fig. 5) . Inhibitory effects on MMP-9 production were observed by ELISA (Fig. 6A) . MMP-9 concentration in the conditioned media was significantly increased from 7.43 ± 1.54 ng/mL (mean ± SD) in normal media at 312 mOsM to 22.85 ± 4.64 ng/mL (P < 0.001, n = 5) in hyperosmolar media. The stimulated MMP-9 concentrations were significantly decreased to 9.8 ± 2.07 ng/mL (P < 0.001, n = 5) by SB202190 and to 8.35 ± 3.59 ng/mL (P < 0.001, n = 5) by doxycycline; however, no inhibition was observed by dexamethasone (19.51 ± 5.74 ng/mL, P = 0.341, n = 5). 
The concentrations of MMP-1 in the 24-hour conditioned media (Fig. 6B) were markedly increased from 21.40 ± 5.41 ng/mL in normal media to 61.56 ± 17.35 ng/mL (P < 0.001, n = 5) in hyperosmolar media. These were significantly decreased to 32.79 ± 18.50, 34,11 ± 10.58, and 36.74 ± 14.61 (all P < 0.05, n = 5) ng/mL by SB202190, doxycycline, and dexamethasone, respectively. The concentrations of MMP-13 (Fig. 6C) were dramatically increased from 179.82 ± 75.54 pg/mL in normal media to 966.52 ± 151.57 pg/mL (P < 0.001, n = 5) in hyperosmolar media. A significant decrease to 255.20 ± 72.17 (P < 0.001, n = 5), 534.15 ± 171.81 (P < 0.05, n = 5), and 487.45 ± 198.19 (P < 0.05, n = 5) pg/mL was observed with SB202190, doxycycline, and dexamethasone treatment, respectively. The concentrations of MMP-3 (Fig. 6D) were also markedly increased from 24.13 ± 15.04 ng/mL in normal media to 77.61 ± 21.86 ng/mL (P < 0.05, n = 5) in hyperosmolar media. Significant inhibition to 47.47 ± 11.76, 32.14 ± 17.96, and 40.76 ± 27.33 ng/mL (all P < 0.05, n = 5) was observed with SB202190, doxycycline, and dexamethasone treatment, respectively. 
Semiquantitative RT-PCR (Fig. 7) showed that the expression of MMP-9, -1, -13, and -3 mRNA was stimulated in corneal epithelial cells exposed to hyperosmolar media with 90 mM NaCl added, and this stimulation was inhibited by SB202190 and doxycycline. Of note, dexamethasone had little inhibitory effect on MMP-9 expression, whereas it inhibited the expression of MMP-1, -13, and -3 mRNA stimulated by hyperosmolarity. 
Discussion
Stimulation of Gelatinase MMP-9, Collagenases MMP-1 and -13, and Stromelysin MMP-3 by Hyperosmolarity
MMPs have been implicated in the pathogenesis of a number of ocular surface diseases, including wound healing, dry eye, sterile corneal ulceration, recurrent epithelial erosion, corneal neovascularization, pterygium, and conjunctivochalasis. 28 55 57 58 59 60 The regulation of MMP production in these diseases is not well understood. Increased levels of proinflammatory cytokines (IL-1 and TNF-α) and MMPs (MMP-3 and -9) have been observed in tear fluid of patients with dry eye. 8 43 44 61 62 Stimulated production of gelatinase MMP-9, collagenases MMP-1 and -13, and stromelysins MMP-3 and -10 by IL-1β and TNF-α has been observed in cultured human corneal epithelial cells 40 41 43 and conjunctival fibroblasts. 63 64 Elevated tear fluid osmolarity has been recognized as a common feature of dry eye for decades 65 ; however, the stimulatory effects of hyperosmolarity on MMP production by the corneal epithelium has not been evaluated. The present study demonstrates for the first time that hyperosmotic stress stimulates expression and production of gelatinase (MMP-9), collagenases (MMP-1 and -13), and stromelysin (MMP-3) by primary cultured human corneal epithelial cells. As the zymography and ELISA assays show in Figures 1 and 2 , the concentrations of MMP-9, -1, -13, and -3 increased significantly in a concentration-dependent manner in the conditioned media from corneal epithelial cells exposed to hyperosmolar media compared with control cells in normal osmolar media. This hyperosmolar stimulation of MMP production was also observed at the transcriptional level by semiquantitative RT-PCR (Fig. 7)
Activation of JNK Signaling Pathway by Hyperosmolarity
MAPKs are important cell-signaling mediators that play vital roles in the cellular response to stress. The different MAPKs can be activated in response to specific stimuli and they also regulate specific substrates. The JNK and p38 MAPK cascades are strongly activated by cellular stresses, as well as by proinflammatory agents, such as endotoxin, IL-1, and TNF-α. 66 67 68 In contrast, ERK MAPK is strongly activated by growth factors such as PDGF, hepatocyte growth factor (HGF), epidermal growth factor (EGF), transforming growth factor (TGF)-β, and other stimuli that mediate cell proliferation, differentiation, and survival. 53 69 70 Each MAPK pathway is activated by phosphorylation of threonine and tyrosine residues by upstream dual-specificity MAPK kinases (MKKs): ERK is activated by MKK1 and -2, p38 by MKK3 and -6, and JNK by MKK4 and -7. The mechanism of activation and the functional role of each MAPK cascade is dependent on cell types and the stimuli used. 71 It is well established that the phosphorylation of the transcription factor c-Jun by JNK is a key event in the cellular response to stress. 46 72 The role of the JNK cascade pathway in response to hyperosmolarity is not well understood, although a few studies have reported activation of JNK by hyperosmotic stress in mammalian cells. 47 In this study, Western blot analysis was performed using antibodies specific for the phosphorylated active forms of JNK and c-Jun. The results (Fig. 3) showed that p-JNK-1 and p-JNK-2 were activated in human corneal epithelial cells exposed to hyperosmolar media (400–500 mOsM). The cell-signaling assay (Beadlyte; Upstate Biotechnology) further confirmed that the percentages of activated p-JNK1 to total JNK1 were increased by hyperosmolar media in a concentration-dependent manner, from 370 to 500 mOsM. Of note, the 54-kDa p-JNK-2 is the major isoform activated by these conditions with weaker activation of 46-kDa p-JNK-1. Further studies are necessary to evaluate whether p-JNK-2 is the primary activated isoform in corneal epithelial cells exposed to hyperosmotic stress. A direct downstream substrate of activated JNK, p-c-Jun, was also activated by hyperosmolarity. Evaluation of total JNK levels showed that hyperosmolar stress activated cellular JNK, but did not stimulate overall levels of JNK. This was confirmed by treatment with SB202190, a JNK pathway inhibitor that dramatically inhibited the hyperosmolarity-activated phosphorylation of JNK-1, JNK-2, and c-Jun (Fig. 4)
Stimulation of MMPs by Hyperosmolarity through Activation of JNK Signaling Pathway
MAPK cascade signaling pathways are known to regulate production and activity of MMPs through activation of transcription factors such as NFκB, AP-1, and ATF in different target cells. 52 53 73 74 The JNK pathway was reported to be activated by inflammatory cytokines, such as IL-1β and TNF-α, 52 73 74 which are also known to stimulate expression and activity of MMPs in a variety of cell types 37 52 73 ; but the link between hyperosmolar stress activation of JNK and stimulated production of MMPs has not been established, although JNK activation by hyperosmotic stress in mammalian cells was observed 10 years ago. 47 To establish this connection, the effects of the JNK pathway inhibitor SB202190 and the anti-inflammatory agents doxycycline and dexamethasone were evaluated on JNK activation and MMP production by corneal epithelial cells exposed to hyperosmolar media. 
SB202190, a chemical originally used as p38 MAPK pathway inhibitor, has also been recognized as an inhibitor of JNK activation. 75 76 77 We observed that phosphorylation of JNK was dose-dependently inhibited by SB202190 in a concentration range of 20 to 40 μM in corneal epithelial cultures exposed to 500 mOsM media (Fig. 4A) . Thus, 20 μM of SB202190 was used for all subsequent inhibition experiments in this study. SB202190 almost abolished the hyperosmolarity-activated p-JNK and p-c-Jun (Fig. 4) , and it also dramatically inhibited the expression and production of MMP-9, -1, -13, and -3 by the cells exposed to hyperosmolar media as shown by semiquantitative RT-PCR (Fig. 7) , gelatin zymography (Fig. 5) , and ELISA (Fig. 6)
Doxycycline, an anti-inflammatory medication used to treat ocular surface diseases, has been reported to inhibit expression and production of MMP-9, -1, -13, -3, and -10 induced by IL-1β and TNF-α in human corneal epithelial cells. 40 41 43 In the current study, doxycycline exhibited inhibitory effects similar to SB202190 on hyperosmolarity-activated p-JNK and p-c-Jun. Doxycycline also significantly inhibited expression and production of MMP-9, -1, -13, and -3 by corneal epithelial cells exposed to hyperosmolar media (Figs. 4 5 6 7) . This finding suggests that the mechanism of MMP inhibition by doxycycline is the blocking of the activation of the JNK signaling pathway. 
Unlike doxycycline, dexamethasone showed little effect on activation of p-JNK and p-c-Jun (Fig. 4) , as well as on stimulation of gelatinase MMP-9 expression and production induced by hyperosmolarity in these corneal epithelial cells (Figs. 5 6 7) . Dexamethasone inhibited the stimulated expression and production of collagenases (MMP-1 and -13) and stromelysin (MMP-3) by the cells treated with hyperosmolar media (Figs. 6 7) . This suggests that dexamethasone, a steroid hormone, may regulate collagenases and stromelysins through different signaling pathways than JNK. 
In the present study, most of the experiments were conducted at 400 to 500 mOsM, because lower osmolar media (340–370 mOsM) did not significantly stimulate MMP production by cultured corneal epithelial cells. This could be due to the sensitivity of zymography and ELISA we used or to the greater resistance of cultured corneal epithelial cells to hyperosmolar stress than in vivo. Using a highly sensitive immunoassay (Beadlyte; Upstate Biotechnology), we were able to detect activation of JNK1 by a media with osmolarity of 370 mOsM. We have observed that human corneal epithelial cells grow very well in a wide range of medium osmolarity, ranging from 312 mOsM SHEM without HEPES to 340 mOsM SHEM with HEPES. Gilbard et al. 16 have reported that normal subjects have a tear osmolarity of 302 ± 6 (mean ± SD) mOsM, whereas dry eye patients have an osmolarity of 343 ± 32 mOsM (range, 306–441) mOsM. Our findings in this study were obtained at osmolarities of at least 370 to 400 mOsM, which is at the high end of the range of tear osmolarity in patients and far above the average tear osmolarity in KCS. Although the phenomenon of hyperosmolarity-induced MMPs and -activated intracellular stress pathways is true, further studies are necessary to establish a direct linkage between elevated osmolarity of tear fluid and ocular surface inflammation in patients with dry eye with KCS. 
In conclusion, our findings provide direct evidence for the first time that hyperosmolarity stimulates expression and production of gelatinase (MMP-9), collagenases (MMP-1 and -13), and stromelysin (MMP-3) through activation of the JNK signaling pathway in human corneal epithelial cells. The efficacy of doxycycline in treating ocular surface diseases may be due to its ability to suppress JNK activation and MMP production by the corneal epithelium. 
 
Table 1.
 
Human Primer Sequences Used for RT-PCR
Table 1.
 
Human Primer Sequences Used for RT-PCR
Gene Accession No. Sense Primer Antisense Primer PCR Product (bp)
MMP-9 NM_004994 ATCCAGTTTGGTGTCGCGGAGC GAAGGGGAAGACGCACAGCT 552
MMP-1 M13509 GGAGGGGATGCTCATTTTGATG TAGGGAAGCCAAAGGAGCTGT 541
MMP-13 NM_002427 TTGTTGCTGCGCATGAGTTCG GGGTGCTCATATGCAGCATCA 370
MMP-3 J03209 CCTGCTTTGTCCTTTGATGC TGAGTCAATCCCTGGAAAGTC 432
GAPDH M33197 GCCAAGGTCATCCATGACAAC GTCCACCACCCTGTTGCTGTA 498
Figure 1.
 
A representative zymogram shows the stimulation of MMP-9 by media of increasing osmolarity (370–500 mOsM). Subconfluent primary human corneal epithelial cultures were switched to serum-free media and then treated for 24 hours with media of increasing osmolarity (370–500 mOsM) achieved by adding 30, 50, 70, or 90 mM NaCl to control media. The conditioned media were collected for gelatin zymography, which showed two major clear bands of 92 and 72 kDa, representing MMP-9 and -2, respectively.
Figure 1.
 
A representative zymogram shows the stimulation of MMP-9 by media of increasing osmolarity (370–500 mOsM). Subconfluent primary human corneal epithelial cultures were switched to serum-free media and then treated for 24 hours with media of increasing osmolarity (370–500 mOsM) achieved by adding 30, 50, 70, or 90 mM NaCl to control media. The conditioned media were collected for gelatin zymography, which showed two major clear bands of 92 and 72 kDa, representing MMP-9 and -2, respectively.
Figure 2.
 
Results of ELISAs for gelatinase MMP-9 (A), collagenase MMP-1 (B), collagenase MMP-13 (C), and stromelysin MMP-3 (D) in the conditioned media from cells exposed to hyperosmolar media (400–500 mOsM) for 24 hours. Subconfluent primary human corneal epithelial cultures were switched to serum-free media and then treated for 24 hours with normal (312 mOsM) and hyperosmolar (400, 450, and 500 mOsM) media by adding increasing concentrations of NaCl (50, 70, or 90 mM). The supernatants of the conditioned media were collected for MMP ELISAs according to the manufacturer’s protocols. *P < 0.001, n = 4, compared with the control in normal-osmolarity media.
Figure 2.
 
Results of ELISAs for gelatinase MMP-9 (A), collagenase MMP-1 (B), collagenase MMP-13 (C), and stromelysin MMP-3 (D) in the conditioned media from cells exposed to hyperosmolar media (400–500 mOsM) for 24 hours. Subconfluent primary human corneal epithelial cultures were switched to serum-free media and then treated for 24 hours with normal (312 mOsM) and hyperosmolar (400, 450, and 500 mOsM) media by adding increasing concentrations of NaCl (50, 70, or 90 mM). The supernatants of the conditioned media were collected for MMP ELISAs according to the manufacturer’s protocols. *P < 0.001, n = 4, compared with the control in normal-osmolarity media.
Figure 3.
 
Representative Western blot analysis showing the time course (A) and response of increasing osmolarity on levels of total JNK (B), activated p-JNK-1, p-JNK-2 (C), and p-c-Jun (D) in corneal epithelial cells. Sorbitol-treated PC12 cell extracts were used as positive controls for JNK-1 and -2. Subconfluent primary human corneal epithelial cultures were switched to serum-free media and then treated for 5 to 60 minutes with 500-mOsM media for the time course or treated for 60 minutes with hyperosmolar media approximately 400, 450, and 500 mOsM created by adding increasing concentrations of NaCl (50, 70, or 90 mM). The cells were then lysed in RIPA buffer, and the supernatants (50 μg total protein per lane for each sample) of cellular extracts were used for immunoblot analysis with rabbit polyclonal antibodies against JNK, p-JNK, or p-c-Jun. (E) Data show increased percentages of p-JNK to total JNK in corneal epithelial cells exposed to hyperosmolar media ranging from 350 to 500 mOsM by adding 20 to 90 mM NaCl, respectively. *P < 0.05, **P < 0.01.
Figure 3.
 
Representative Western blot analysis showing the time course (A) and response of increasing osmolarity on levels of total JNK (B), activated p-JNK-1, p-JNK-2 (C), and p-c-Jun (D) in corneal epithelial cells. Sorbitol-treated PC12 cell extracts were used as positive controls for JNK-1 and -2. Subconfluent primary human corneal epithelial cultures were switched to serum-free media and then treated for 5 to 60 minutes with 500-mOsM media for the time course or treated for 60 minutes with hyperosmolar media approximately 400, 450, and 500 mOsM created by adding increasing concentrations of NaCl (50, 70, or 90 mM). The cells were then lysed in RIPA buffer, and the supernatants (50 μg total protein per lane for each sample) of cellular extracts were used for immunoblot analysis with rabbit polyclonal antibodies against JNK, p-JNK, or p-c-Jun. (E) Data show increased percentages of p-JNK to total JNK in corneal epithelial cells exposed to hyperosmolar media ranging from 350 to 500 mOsM by adding 20 to 90 mM NaCl, respectively. *P < 0.05, **P < 0.01.
Figure 4.
 
Representative Western blot analysis showing the effects of SB202190, doxycycline, and dexamethasone on levels of total JNK-1, JNK-2, p-JNK-1, p-JNK-2, and p-c-Jun. Subconfluent primary human corneal epithelial cultures were switched to serum-free media and then treated for 60 minutes with (A) hyperosmolar media (500 mOsM) by adding 90 mM NaCl, with or without 20 or 40 μM SB202190; and (B) hyperosmolar media of approximately 450 to 500 mOsM by adding 70 or 90 mM NaCl, with or without 20 μM SB202190 (SB), 1 μM dexamethasone (Dex), or 10 μg/mL doxycycline (Doxy). The cells were lysed in RIPA buffer, and the supernatants (50 μg total protein per lane for each sample) of cellular extracts were used for immunoblot analysis with rabbit polyclonal antibodies against JNK, p-JNK, or p-c-Jun.
Figure 4.
 
Representative Western blot analysis showing the effects of SB202190, doxycycline, and dexamethasone on levels of total JNK-1, JNK-2, p-JNK-1, p-JNK-2, and p-c-Jun. Subconfluent primary human corneal epithelial cultures were switched to serum-free media and then treated for 60 minutes with (A) hyperosmolar media (500 mOsM) by adding 90 mM NaCl, with or without 20 or 40 μM SB202190; and (B) hyperosmolar media of approximately 450 to 500 mOsM by adding 70 or 90 mM NaCl, with or without 20 μM SB202190 (SB), 1 μM dexamethasone (Dex), or 10 μg/mL doxycycline (Doxy). The cells were lysed in RIPA buffer, and the supernatants (50 μg total protein per lane for each sample) of cellular extracts were used for immunoblot analysis with rabbit polyclonal antibodies against JNK, p-JNK, or p-c-Jun.
Figure 5.
 
A representative zymogram showing the inhibitory effect on hyperosmolarity-stimulated MMP-9 production by SB202190 and doxycycline, but not dexamethasone. Subconfluent primary human corneal epithelial cultures were switched to serum-free media and then treated for 24 hours with hyperosmolar media (500 mOsM) by adding 90 mM NaCl with or without 20 μM SB202190 (SB), 1 μM dexamethasone (Dex), or 10 μg/mL doxycycline (Doxy). The conditioned media were collected for gelatin zymography, which showed two major clear bands of 92-kDa MMP-9 and 72-kDa MMP-2.
Figure 5.
 
A representative zymogram showing the inhibitory effect on hyperosmolarity-stimulated MMP-9 production by SB202190 and doxycycline, but not dexamethasone. Subconfluent primary human corneal epithelial cultures were switched to serum-free media and then treated for 24 hours with hyperosmolar media (500 mOsM) by adding 90 mM NaCl with or without 20 μM SB202190 (SB), 1 μM dexamethasone (Dex), or 10 μg/mL doxycycline (Doxy). The conditioned media were collected for gelatin zymography, which showed two major clear bands of 92-kDa MMP-9 and 72-kDa MMP-2.
Figure 6.
 
ELISAs showed the inhibitory effects on hyperosmolarity-stimulated production of gelatinase MMP-9 (A), collagenases MMP-1 (B), MMP-13 (C), and stromelysin MMP-3 (D) by SB202190, dexamethasone, and doxycycline. Subconfluent primary human corneal epithelial cultures were switched to serum-free media and then treated for 24 hours with hyperosmolar media (500 mOsM) by adding 90 mM NaCl, with or without 20 μM SB202190 (SB), 1 μM dexamethasone (Dex), or 10 μg/mL doxycycline (Doxy). The supernatants of the conditioned media were collected for MMP ELISAs according to the manufacturer’s protocol. When compared with hyperosmolar media with 90 mM NaCl added, *P < 0.05, **P < 0.001, n = 5.
Figure 6.
 
ELISAs showed the inhibitory effects on hyperosmolarity-stimulated production of gelatinase MMP-9 (A), collagenases MMP-1 (B), MMP-13 (C), and stromelysin MMP-3 (D) by SB202190, dexamethasone, and doxycycline. Subconfluent primary human corneal epithelial cultures were switched to serum-free media and then treated for 24 hours with hyperosmolar media (500 mOsM) by adding 90 mM NaCl, with or without 20 μM SB202190 (SB), 1 μM dexamethasone (Dex), or 10 μg/mL doxycycline (Doxy). The supernatants of the conditioned media were collected for MMP ELISAs according to the manufacturer’s protocol. When compared with hyperosmolar media with 90 mM NaCl added, *P < 0.05, **P < 0.001, n = 5.
Figure 7.
 
Representative semiquantitative RT-PCR showing the mRNA expressions of gelatinase MMP-9, collagenases MMP-1 and -13, stromelysin MMP-3, and internal control GAPDH by human corneal epithelial cells treated for 6 hours in normal and hyperosmolar media (500 mOsM) by adding 90 mM NaCl, with or without 20 μM SB202190 (SB), 1 μM dexamethasone (Dex), or 10 μg/mL doxycycline (Doxy). Total RNA was extracted from each group of cells, RT-PCR was performed using an equal amount (1 μg) of total RNA, and analysis was performed at 4-cycle intervals from 20 to 40 PCR cycles to ensure that the PCR products with expected sizes for each MMP were formed within the linear portion of the amplification curve. The PCR cycles performed for MMP-9, -1, -13, and -3 and GAPDH were 32, 32, 40, 36, and 28, respectively. A 100-bp DNA ladder was run in parallel.
Figure 7.
 
Representative semiquantitative RT-PCR showing the mRNA expressions of gelatinase MMP-9, collagenases MMP-1 and -13, stromelysin MMP-3, and internal control GAPDH by human corneal epithelial cells treated for 6 hours in normal and hyperosmolar media (500 mOsM) by adding 90 mM NaCl, with or without 20 μM SB202190 (SB), 1 μM dexamethasone (Dex), or 10 μg/mL doxycycline (Doxy). Total RNA was extracted from each group of cells, RT-PCR was performed using an equal amount (1 μg) of total RNA, and analysis was performed at 4-cycle intervals from 20 to 40 PCR cycles to ensure that the PCR products with expected sizes for each MMP were formed within the linear portion of the amplification curve. The PCR cycles performed for MMP-9, -1, -13, and -3 and GAPDH were 32, 32, 40, 36, and 28, respectively. A 100-bp DNA ladder was run in parallel.
The authors thank the Lions Eye Bank of Texas for their great support in providing human corneoscleral tissues. 
Hashimoto S, Matsumoto K, Gon Y, Nakayama T, Takeshita I, Horie T. Hyperosmolarity-induced interleukin-8 expression in human bronchial epithelial cells through p38 mitogen-activated protein kinase. Am J Respir Crit Care Med. 1999;159:634–640. [CrossRef] [PubMed]
Loitsch SM, von Mallinckrodt C, Kippenberger S, Steinhilber D, Wagner TO, Bargon J. Reactive oxygen intermediates are involved in IL-8 production induced by hyperosmotic stress in human bronchial epithelial cells. Biochem Biophys Res Commun. 2000;276:571–578. [CrossRef] [PubMed]
Shapiro L, Dinarello CA. Hyperosmotic stress as a stimulant for proinflammatory cytokine production. Exp Cell Res. 1997;231:354–362. [CrossRef] [PubMed]
Katsuyama I, Arakawa T. A convenient rabbit model of ocular epithelium damage induced by osmotic dehydration. J Ocul Pharmacol Ther. 2003;19:281–289. [CrossRef] [PubMed]
Rolando M, Zierhut M. The ocular surface and tear film and their dysfunction in dry eye disease. Surv Ophthalmol. 2001;45(suppl 2)S203–S210. [CrossRef] [PubMed]
Pflugfelder SC, Stern ME, Beuerman R. The problem. Pflugfelder SC Stern ME Beuerman R eds. Dry Eye and the Ocular Surface. 2004;1–10. Marcel Dekker New York.
Jones DT, Monroy D, Ji Z, Atherton SS, Pflugfelder SC. Sjögren’s syndrome: cytokine and Epstein-Barr viral gene expression within the conjunctival epithelium. Invest Ophthalmol Vis Sci. 1994;35:3493–3504. [PubMed]
Pflugfelder SC, Jones D, Ji Z, Afonso A, Monroy D. Altered cytokine balance in the tear fluid and conjunctiva of patients with Sjögren’s syndrome keratoconjunctivitis sicca. Curr Eye Res. 1999;19:201–211. [CrossRef] [PubMed]
Solomon A, Dursun D, Liu Z, Xie Y, Macri A, Pflugfelder SC. Pro- and anti-inflammatory forms of interleukin-1 in the tear fluid and conjunctiva of patients with dry-eye disease. Invest Ophthalmol Vis Sci. 2001;42:2283–2292. [PubMed]
Calonge M. The treatment of dry eye. Surv Ophthalmol. 2001;45(suppl 2)S227–S239. [CrossRef] [PubMed]
Pflugfelder SC. Anti-inflammatory therapies of dry eye. Am J Ophthalmol. 2004.
Von Bahr G. Konnte der flussigkeitsabgang durch die cornea von physiologischer bedeutung sein?. Acta Ophthalmol. 1941;19:125–134.
Balik J. The lacrimal fluid in keratoconjunctivitis sicca; a quantitative and qualitative investigation. Am J Ophthalmol. 1952;35:1773–1782. [PubMed]
Tumbar T, Guasch G, Greco V, et al. Defining the epithelial stem cell niche in skin. Science. 2004;303:359–363. [CrossRef] [PubMed]
Mathers WD, Lane JA, Sutphin JE, Zimmerman MB. Model for ocular tear film function. Cornea. 1996;15:110–119. [CrossRef] [PubMed]
Gilbard JP, Farris RL, Santamaria J. Osmolarity of tear microvolumes in keratoconjunctivitis sicca. Arch Ophthalmol. 1978;96:677–681. [CrossRef] [PubMed]
Farris RL. Tear osmolarity-a new gold standard?. Adv Exp Med Biol. 1994;350:495–503. [PubMed]
Gilbard JP, Rossi SR, Gray KL, Hanninen LA, Kenyon KR. Tear film osmolarity and ocular surface disease in two rabbit models for keratoconjunctivitis sicca. Invest Ophthalmol Vis Sci. 1988;29:374–378. [PubMed]
Gilbard JP, Rossi SR, Gray KL, Hanninen LA. Natural history of disease in a rabbit model for keratoconjunctivitis sicca. Acta Ophthalmol Suppl. 1989;192:95–101. [PubMed]
Aragona P, Di Stefano G, Ferreri F, Spinella R, Stilo A. Sodium hyaluronate eye drops of different osmolarity for the treatment of dry eye in Sjogren’s syndrome patients. Br J Ophthalmol. 2002;86:879–884. [CrossRef] [PubMed]
Wilson G. The effect of osmolality on the shedding rate of the corneal epithelium. Cornea. 1996;15:240–244. [CrossRef] [PubMed]
Wright P, Cooper M, Gilvarry AM. Effect of osmolarity of artificial tear drops on relief of dry eye symptoms: BJ6 and beyond. Br J Ophthalmol. 1987;71:161–164. [CrossRef] [PubMed]
Begley CG, Chalmers RL, Abetz L, et al. The relationship between habitual patient-reported symptoms and clinical signs among patients with dry eye of varying severity. Invest Ophthalmol Vis Sci. 2003;44:4753–4761. [CrossRef] [PubMed]
Woessner JF, Jr. Matrix metalloproteinases and their inhibitors in connective tissue remodeling. FASEB J. 1991;5:2145–2154. [PubMed]
Murphy G, Docherty AJP. The matrix metalloproteinases and their inhibitors. Am J Respir Cell Mol Biol. 1992;7:120–125. [CrossRef] [PubMed]
Visse R, Nagase H. Matrix metalloproteinases and tissue inhibitors of metalloproteinases: structure, function, and biochemistry. Circ Res. 2003;92:827–839. [CrossRef] [PubMed]
Fini ME, Girard MT, Matsubara M. Collagenolytic/gelatinolytic enzymes in corneal wound healing. Acta Ophthalmol Suppl. 1992;202:26–33. [PubMed]
Kvanta A, Sarman S, Fagerholm P, Seregard S, Steen B. Expression of matrix metalloproteinase-2 (MMP-2) and vascular endothelial growth factor (VEGF) in inflammation-associated corneal neovascularization. Exp Eye Res. 2000;70:419–428. [CrossRef] [PubMed]
Vaalamo M, Karjalainen-Lindsberg ML, Puolakkainen P, Kere J, Saarialho-Kere U. Distinct expression profiles of stromelysin-2 (MMP-10), collagenase-3 (MMP-13), macrophage metalloelastase (MMP-12), and tissue inhibitor of metalloproteinases-3 (TIMP-3) in intestinal ulcerations. Am J Pathol. 1998;152:1005–1014. [PubMed]
Mohan R, Chintala SK, Jung JC, et al. Matrix metalloproteinase gelatinase B (MMP-9) coordinates and effects epithelial regeneration. J Biol Chem. 2002;277:2065–2072. [CrossRef] [PubMed]
Leonardi A, Brun P, Abatangelo G, Plebani M, Secchi AG. Tear levels and activity of matrix metalloproteinase (MMP)-1 and MMP-9 in vernal keratoconjunctivitis. Invest Ophthalmol Vis Sci. 2003;44:3052–3058. [CrossRef] [PubMed]
Ito A, Mukaiyama A, Itoh Y, et al. Degradation of interleukin 1beta by matrix metalloproteinases. J Biol Chem. 1996;271:14657–14660. [CrossRef] [PubMed]
Gearing AJ, Beckett P, Christodoulou M, et al. Matrix metalloproteinases and processing of pro-TNF-alpha. J Leukoc Biol. 1995;57:774–777. [PubMed]
Knauper V, Smith B, Lopez-Otin C, Murphy G. Activation of progelatinase B (proMMP-9) by active collagenase-3 (MMP- 13). Eur J Biochem. 1997;248:369–373. [CrossRef] [PubMed]
Ogata Y, Enghild JJ, Nagase H. Matrix metalloproteinase 3 (stromelysin) activates the precursor for the human matrix metalloproteinase 9. J Biol Chem. 1992;267:3581–3584. [PubMed]
Nakamura H, Fujii Y, Ohuchi E, Yamamoto E, Okada Y. Activation of the precursor of human stromelysin 2 and its interactions with other matrix metalloproteinases. Eur J Biochem. 1998;253:67–75. [CrossRef] [PubMed]
Kusano K, Miyaura C, Inada M, et al. Regulation of matrix metalloproteinases (MMP-2, -3, -9, and -13) by interleukin-1 and interleukin-6 in mouse calvaria: association of MMP induction with bone resorption. Endocrinology. 1998;139:1338–1345. [PubMed]
Sasaki M, Kashima M, Ito T, et al. Differential regulation of metalloproteinase production, proliferation and chemotaxis of human lung fibroblasts by PDGF, interleukin-1beta and TNF-alpha. Mediators Inflamm. 2000;9:155–160. [CrossRef] [PubMed]
Bond M, Fabunmi RP, Baker AH, Newby AC. Synergistic upregulation of metalloproteinase-9 by growth factors and inflammatory cytokines: an absolute requirement for transcription factor NF-kappa B. FEBS Lett. 1998;435:29–34. [CrossRef] [PubMed]
Li DQ, Lokeshwar BL, Solomon A, Monroy D, Ji Z, Pflugfelder SC. Regulation of MMP-9 production by human corneal epithelial cells. Exp Eye Res. 2001;73:449–459. [CrossRef] [PubMed]
Li D-Q, Shang TY, Kim HS, Solomon A, Lokeshwar BL, Pflugfelder SC. Regulated expression of collagenases MMP-1, -8, and -13 and stromelysins MMP-3, -10, and -11 by human corneal epithelial cells. Invest Ophthalmol Vis Sci. 2003;44:2928–2936. [CrossRef] [PubMed]
Afonso AA, Sobrin L, Monroy DC, Selzer M, Lokeshwar B, Pflugfelder SC. Tear fluid gelatinase B activity correlates with IL-1alpha concentration and fluorescein clearance in ocular rosacea. Invest Ophthalmol Vis Sci. 1999;40:2506–2512. [PubMed]
Sobrin L, Liu Z, Monroy DC, et al. Regulation of MMP-9 activity in human tear fluid and corneal epithelial culture supernatant. Invest Ophthalmol Vis Sci. 2000;41:1703–1709. [PubMed]
Pflugfelder SC, Solomon A, Stern ME. The diagnosis and management of dry eye: a twenty-five-year review. Cornea. 2000;19:644–649. [CrossRef] [PubMed]
Smith VA, Rishmawi H, Hussein H, Easty DL. Tear film MMP accumulation and corneal disease. Br J Ophthalmol. 2001;85:147–153. [CrossRef] [PubMed]
Kyriakis JM, Banerjee P, Nikolakaki E, et al. The stress-activated protein kinase subfamily of c-Jun kinases. Nature. 1994;369:156–160. [CrossRef] [PubMed]
Galcheva-Gargova Z, Derijard B, Wu IH, Davis RJ. An osmosensing signal transduction pathway in mammalian cells. Science. 1994;265:806–808. [CrossRef] [PubMed]
Rosette C, Karin M. Ultraviolet light and osmotic stress: activation of the JNK cascade through multiple growth factor and cytokine receptors. Science. 1996;274:1194–1197. [CrossRef] [PubMed]
Gupta S, Barrett T, Whitmarsh AJ, et al. Selective interaction of JNK protein kinase isoforms with transcription factors. EMBO J. 1996;15:2760–2770. [PubMed]
Li X, Commane M, Jiang Z, Stark GR. IL-1-induced NFkappa B and c-Jun N-terminal kinase (JNK) activation diverge at IL-1 receptor-associated kinase (IRAK). Proc Natl Acad Sci USA. 2001;98:4461–4465. [CrossRef] [PubMed]
Barr RK, Bogoyevitch MA. The c-Jun N-terminal protein kinase family of mitogen-activated protein kinases (JNK MAPKs). Int J Biochem Cell Biol. 2001;33:1047–1063. [CrossRef] [PubMed]
Mengshol JA, Vincenti MP, Brinckerhoff CE. IL-1 induces collagenase-3 (MMP-13) promoter activity in stably transfected chondrocytic cells: requirement for Runx-2 and activation by p38 MAPK and JNK pathways. Nucleic Acids Res. 2001;29:4361–4372. [CrossRef] [PubMed]
Zeigler ME, Chi Y, Schmidt T, Varani J. Role of ERK and JNK pathways in regulating cell motility and matrix metalloproteinase 9 production in growth factor-stimulated human epidermal keratinocytes. J Cell Physiol. 1999;180:271–284. [CrossRef] [PubMed]
Solomon A, Rosenblatt M, Li DQ, et al. Doxycycline inhibition of interleukin-1 in the corneal epithelium. Invest Ophthalmol Vis Sci. 2000;41:2544–2557. [PubMed]
Li DQ, Lee SB, Gunja-Smith Z, et al. Overexpression of collagenase (MMP-1) and stromelysin (MMP-3) by pterygium head fibroblasts. Arch Ophthalmol. 2001;119:71–80. [PubMed]
Li DQ, Tseng SC. Three patterns of cytokine expression potentially involved in epithelial-fibroblast interactions of human ocular surface. J Cell Physiol. 1995;163:61–79. [CrossRef] [PubMed]
Fini ME, Cook JR, Mohan R. Proteolytic mechanisms in corneal ulceration and repair. Arch Dermatol Res. 1998;290(suppl)S12–S23. [CrossRef] [PubMed]
Dursun D, Kim MC, Solomon A, Pflugfelder SC. Treatment of recalcitrant recurrent corneal erosions with inhibitors of matrix metalloproteinase-9, doxycycline and corticosteroids. Am J Ophthalmol. 2001;132:8–13. [CrossRef] [PubMed]
Di Girolamo N, Wakefield D, Coroneo MT. Differential expression of matrix metalloproteinases and their tissue inhibitors at the advancing pterygium head. Invest Ophthalmol Vis Sci. 2000;41:4142–4149. [PubMed]
Li DQ, Meller D, Liu Y, Tseng SC. Overexpression of MMP-1 and MMP-3 by cultured conjunctivochalasis fibroblasts. Invest Ophthalmol Vis Sci. 2000;41:404–410. [PubMed]
Barton K, Monroy DC, Nava A, Pflugfelder SC. Inflammatory cytokines in the tears of patients with ocular rosacea. Ophthalmology. 1997;104:1868–1874. [CrossRef] [PubMed]
Jones DT, Monroy D, Ji Z, Pflugfelder SC. Alterations of ocular surface gene expression in Sjögren’s syndrome. Adv Exp Med Biol. 1998;438:533–536. [PubMed]
Solomon A, Li DQ, Lee SB, Tseng SC. Regulation of collagenase, stromelysin, and urokinase-type plasminogen activator in primary pterygium body fibroblasts by inflammatory cytokines. Invest Ophthalmol Vis Sci. 2000;41:2154–2163. [PubMed]
Meller D, Li DQ, Tseng SC. Regulation of collagenase, stromelysin, and gelatinase B in human conjunctival and conjunctivochalasis fibroblasts by interleukin-1beta and tumor necrosis factor-alpha. Invest Ophthalmol Vis Sci. 2000;41:2922–2929. [PubMed]
Farris RL. Contact lenses and the dry eye. Int Ophthalmol Clin. 1994;34:129–136. [CrossRef] [PubMed]
Roberts ML, Cowsert LM. Interleukin-1 beta and reactive oxygen species mediate activation of c-Jun NH2-terminal kinases, in human epithelial cells, by two independent pathways. Biochem Biophys Res Commun. 1998;251:166–172. [CrossRef] [PubMed]
Finch A, Davis W, Carter WG, Saklatvala J. Analysis of mitogen-activated protein kinase pathways used by interleukin 1 in tissues in vivo: activation of hepatic c-Jun N-terminal kinases 1 and 2, and mitogen-activated protein kinase kinases 4 and 7. Biochem J. 2001;353:275–281. [CrossRef] [PubMed]
Raingeaud J, Gupta S, Rogers JS, et al. Pro-inflammatory cytokines and environmental stress cause p38 mitogen-activated protein kinase activation by dual phosphorylation on tyrosine and threonine. J Biol Chem. 1995;270:7420–7426. [CrossRef] [PubMed]
Cho A, Graves J, Reidy MA. Mitogen-activated protein kinases mediate matrix metalloproteinase-9 expression in vascular smooth muscle cells. Arterioscler Thromb Vasc Biol. 2000;20:2527–2532. [CrossRef] [PubMed]
Hayashida T, Decaestecker M, Schnaper HW. Cross-talk between ERK MAP kinase and Smad signaling pathways enhances TGF-beta-dependent responses in human mesangial cells. FASEB J. 2003;17:1576–1578. [PubMed]
Suzuki K, Hino M, Kutsuna H, et al. Selective activation of p38 mitogen-activated protein kinase cascade in human neutrophils stimulated by IL-1beta. J Immunol. 2001;167:5940–5947. [CrossRef] [PubMed]
Derijard B, Hibi M, Wu IH, et al. JNK1: a protein kinase stimulated by UV light and Ha-Ras that binds and phosphorylates the c-Jun activation domain. Cell. 1994;76:1025–1037. [CrossRef] [PubMed]
Reunanen N, Li SP, Ahonen M, Foschi M, Han J, Kahari VM. Activation of p38a mitogen-activated protein kinase enhances collagenase-1 (MMP-1) and stromelysin-1 (MMP-3) expression by mRNA stabilization. J Biol Chem. 2002;277:32360–32368. [CrossRef] [PubMed]
Liacini A, Sylvester J, Li WQ, Zafarullah M. Inhibition of interleukin-1-stimulated MAP kinases, activating protein- 1 (AP-1) and nuclear factor kappa B (NF-kappaB) transcription factors down-regulates matrix metalloproteinase gene expression in articular chondrocytes. Matrix Biol. 2002;21:251–262. [CrossRef] [PubMed]
Chen CY, Gatto-Konczak F, Wu Z, Karin M. Stabilization of interleukin-2 mRNA by the c-Jun NH2-terminal kinase pathway. Science. 1998;280:1945–1949. [CrossRef] [PubMed]
Ming XF, Kaiser M, Moroni C. c-jun N-terminal kinase is involved in AUUUA-mediated interleukin-3 mRNA turnover in mast cells. EMBO J. 1998;17:6039–6048. [CrossRef] [PubMed]
Pages G, Berra E, Milanini J, Levy AP, Pouyssegur J. Stress-activated protein kinases (JNK and p38/HOG) are essential for vascular endothelial growth factor mRNA stability. J Biol Chem. 2000;275:26484–26491. [CrossRef] [PubMed]
Figure 1.
 
A representative zymogram shows the stimulation of MMP-9 by media of increasing osmolarity (370–500 mOsM). Subconfluent primary human corneal epithelial cultures were switched to serum-free media and then treated for 24 hours with media of increasing osmolarity (370–500 mOsM) achieved by adding 30, 50, 70, or 90 mM NaCl to control media. The conditioned media were collected for gelatin zymography, which showed two major clear bands of 92 and 72 kDa, representing MMP-9 and -2, respectively.
Figure 1.
 
A representative zymogram shows the stimulation of MMP-9 by media of increasing osmolarity (370–500 mOsM). Subconfluent primary human corneal epithelial cultures were switched to serum-free media and then treated for 24 hours with media of increasing osmolarity (370–500 mOsM) achieved by adding 30, 50, 70, or 90 mM NaCl to control media. The conditioned media were collected for gelatin zymography, which showed two major clear bands of 92 and 72 kDa, representing MMP-9 and -2, respectively.
Figure 2.
 
Results of ELISAs for gelatinase MMP-9 (A), collagenase MMP-1 (B), collagenase MMP-13 (C), and stromelysin MMP-3 (D) in the conditioned media from cells exposed to hyperosmolar media (400–500 mOsM) for 24 hours. Subconfluent primary human corneal epithelial cultures were switched to serum-free media and then treated for 24 hours with normal (312 mOsM) and hyperosmolar (400, 450, and 500 mOsM) media by adding increasing concentrations of NaCl (50, 70, or 90 mM). The supernatants of the conditioned media were collected for MMP ELISAs according to the manufacturer’s protocols. *P < 0.001, n = 4, compared with the control in normal-osmolarity media.
Figure 2.
 
Results of ELISAs for gelatinase MMP-9 (A), collagenase MMP-1 (B), collagenase MMP-13 (C), and stromelysin MMP-3 (D) in the conditioned media from cells exposed to hyperosmolar media (400–500 mOsM) for 24 hours. Subconfluent primary human corneal epithelial cultures were switched to serum-free media and then treated for 24 hours with normal (312 mOsM) and hyperosmolar (400, 450, and 500 mOsM) media by adding increasing concentrations of NaCl (50, 70, or 90 mM). The supernatants of the conditioned media were collected for MMP ELISAs according to the manufacturer’s protocols. *P < 0.001, n = 4, compared with the control in normal-osmolarity media.
Figure 3.
 
Representative Western blot analysis showing the time course (A) and response of increasing osmolarity on levels of total JNK (B), activated p-JNK-1, p-JNK-2 (C), and p-c-Jun (D) in corneal epithelial cells. Sorbitol-treated PC12 cell extracts were used as positive controls for JNK-1 and -2. Subconfluent primary human corneal epithelial cultures were switched to serum-free media and then treated for 5 to 60 minutes with 500-mOsM media for the time course or treated for 60 minutes with hyperosmolar media approximately 400, 450, and 500 mOsM created by adding increasing concentrations of NaCl (50, 70, or 90 mM). The cells were then lysed in RIPA buffer, and the supernatants (50 μg total protein per lane for each sample) of cellular extracts were used for immunoblot analysis with rabbit polyclonal antibodies against JNK, p-JNK, or p-c-Jun. (E) Data show increased percentages of p-JNK to total JNK in corneal epithelial cells exposed to hyperosmolar media ranging from 350 to 500 mOsM by adding 20 to 90 mM NaCl, respectively. *P < 0.05, **P < 0.01.
Figure 3.
 
Representative Western blot analysis showing the time course (A) and response of increasing osmolarity on levels of total JNK (B), activated p-JNK-1, p-JNK-2 (C), and p-c-Jun (D) in corneal epithelial cells. Sorbitol-treated PC12 cell extracts were used as positive controls for JNK-1 and -2. Subconfluent primary human corneal epithelial cultures were switched to serum-free media and then treated for 5 to 60 minutes with 500-mOsM media for the time course or treated for 60 minutes with hyperosmolar media approximately 400, 450, and 500 mOsM created by adding increasing concentrations of NaCl (50, 70, or 90 mM). The cells were then lysed in RIPA buffer, and the supernatants (50 μg total protein per lane for each sample) of cellular extracts were used for immunoblot analysis with rabbit polyclonal antibodies against JNK, p-JNK, or p-c-Jun. (E) Data show increased percentages of p-JNK to total JNK in corneal epithelial cells exposed to hyperosmolar media ranging from 350 to 500 mOsM by adding 20 to 90 mM NaCl, respectively. *P < 0.05, **P < 0.01.
Figure 4.
 
Representative Western blot analysis showing the effects of SB202190, doxycycline, and dexamethasone on levels of total JNK-1, JNK-2, p-JNK-1, p-JNK-2, and p-c-Jun. Subconfluent primary human corneal epithelial cultures were switched to serum-free media and then treated for 60 minutes with (A) hyperosmolar media (500 mOsM) by adding 90 mM NaCl, with or without 20 or 40 μM SB202190; and (B) hyperosmolar media of approximately 450 to 500 mOsM by adding 70 or 90 mM NaCl, with or without 20 μM SB202190 (SB), 1 μM dexamethasone (Dex), or 10 μg/mL doxycycline (Doxy). The cells were lysed in RIPA buffer, and the supernatants (50 μg total protein per lane for each sample) of cellular extracts were used for immunoblot analysis with rabbit polyclonal antibodies against JNK, p-JNK, or p-c-Jun.
Figure 4.
 
Representative Western blot analysis showing the effects of SB202190, doxycycline, and dexamethasone on levels of total JNK-1, JNK-2, p-JNK-1, p-JNK-2, and p-c-Jun. Subconfluent primary human corneal epithelial cultures were switched to serum-free media and then treated for 60 minutes with (A) hyperosmolar media (500 mOsM) by adding 90 mM NaCl, with or without 20 or 40 μM SB202190; and (B) hyperosmolar media of approximately 450 to 500 mOsM by adding 70 or 90 mM NaCl, with or without 20 μM SB202190 (SB), 1 μM dexamethasone (Dex), or 10 μg/mL doxycycline (Doxy). The cells were lysed in RIPA buffer, and the supernatants (50 μg total protein per lane for each sample) of cellular extracts were used for immunoblot analysis with rabbit polyclonal antibodies against JNK, p-JNK, or p-c-Jun.
Figure 5.
 
A representative zymogram showing the inhibitory effect on hyperosmolarity-stimulated MMP-9 production by SB202190 and doxycycline, but not dexamethasone. Subconfluent primary human corneal epithelial cultures were switched to serum-free media and then treated for 24 hours with hyperosmolar media (500 mOsM) by adding 90 mM NaCl with or without 20 μM SB202190 (SB), 1 μM dexamethasone (Dex), or 10 μg/mL doxycycline (Doxy). The conditioned media were collected for gelatin zymography, which showed two major clear bands of 92-kDa MMP-9 and 72-kDa MMP-2.
Figure 5.
 
A representative zymogram showing the inhibitory effect on hyperosmolarity-stimulated MMP-9 production by SB202190 and doxycycline, but not dexamethasone. Subconfluent primary human corneal epithelial cultures were switched to serum-free media and then treated for 24 hours with hyperosmolar media (500 mOsM) by adding 90 mM NaCl with or without 20 μM SB202190 (SB), 1 μM dexamethasone (Dex), or 10 μg/mL doxycycline (Doxy). The conditioned media were collected for gelatin zymography, which showed two major clear bands of 92-kDa MMP-9 and 72-kDa MMP-2.
Figure 6.
 
ELISAs showed the inhibitory effects on hyperosmolarity-stimulated production of gelatinase MMP-9 (A), collagenases MMP-1 (B), MMP-13 (C), and stromelysin MMP-3 (D) by SB202190, dexamethasone, and doxycycline. Subconfluent primary human corneal epithelial cultures were switched to serum-free media and then treated for 24 hours with hyperosmolar media (500 mOsM) by adding 90 mM NaCl, with or without 20 μM SB202190 (SB), 1 μM dexamethasone (Dex), or 10 μg/mL doxycycline (Doxy). The supernatants of the conditioned media were collected for MMP ELISAs according to the manufacturer’s protocol. When compared with hyperosmolar media with 90 mM NaCl added, *P < 0.05, **P < 0.001, n = 5.
Figure 6.
 
ELISAs showed the inhibitory effects on hyperosmolarity-stimulated production of gelatinase MMP-9 (A), collagenases MMP-1 (B), MMP-13 (C), and stromelysin MMP-3 (D) by SB202190, dexamethasone, and doxycycline. Subconfluent primary human corneal epithelial cultures were switched to serum-free media and then treated for 24 hours with hyperosmolar media (500 mOsM) by adding 90 mM NaCl, with or without 20 μM SB202190 (SB), 1 μM dexamethasone (Dex), or 10 μg/mL doxycycline (Doxy). The supernatants of the conditioned media were collected for MMP ELISAs according to the manufacturer’s protocol. When compared with hyperosmolar media with 90 mM NaCl added, *P < 0.05, **P < 0.001, n = 5.
Figure 7.
 
Representative semiquantitative RT-PCR showing the mRNA expressions of gelatinase MMP-9, collagenases MMP-1 and -13, stromelysin MMP-3, and internal control GAPDH by human corneal epithelial cells treated for 6 hours in normal and hyperosmolar media (500 mOsM) by adding 90 mM NaCl, with or without 20 μM SB202190 (SB), 1 μM dexamethasone (Dex), or 10 μg/mL doxycycline (Doxy). Total RNA was extracted from each group of cells, RT-PCR was performed using an equal amount (1 μg) of total RNA, and analysis was performed at 4-cycle intervals from 20 to 40 PCR cycles to ensure that the PCR products with expected sizes for each MMP were formed within the linear portion of the amplification curve. The PCR cycles performed for MMP-9, -1, -13, and -3 and GAPDH were 32, 32, 40, 36, and 28, respectively. A 100-bp DNA ladder was run in parallel.
Figure 7.
 
Representative semiquantitative RT-PCR showing the mRNA expressions of gelatinase MMP-9, collagenases MMP-1 and -13, stromelysin MMP-3, and internal control GAPDH by human corneal epithelial cells treated for 6 hours in normal and hyperosmolar media (500 mOsM) by adding 90 mM NaCl, with or without 20 μM SB202190 (SB), 1 μM dexamethasone (Dex), or 10 μg/mL doxycycline (Doxy). Total RNA was extracted from each group of cells, RT-PCR was performed using an equal amount (1 μg) of total RNA, and analysis was performed at 4-cycle intervals from 20 to 40 PCR cycles to ensure that the PCR products with expected sizes for each MMP were formed within the linear portion of the amplification curve. The PCR cycles performed for MMP-9, -1, -13, and -3 and GAPDH were 32, 32, 40, 36, and 28, respectively. A 100-bp DNA ladder was run in parallel.
Table 1.
 
Human Primer Sequences Used for RT-PCR
Table 1.
 
Human Primer Sequences Used for RT-PCR
Gene Accession No. Sense Primer Antisense Primer PCR Product (bp)
MMP-9 NM_004994 ATCCAGTTTGGTGTCGCGGAGC GAAGGGGAAGACGCACAGCT 552
MMP-1 M13509 GGAGGGGATGCTCATTTTGATG TAGGGAAGCCAAAGGAGCTGT 541
MMP-13 NM_002427 TTGTTGCTGCGCATGAGTTCG GGGTGCTCATATGCAGCATCA 370
MMP-3 J03209 CCTGCTTTGTCCTTTGATGC TGAGTCAATCCCTGGAAAGTC 432
GAPDH M33197 GCCAAGGTCATCCATGACAAC GTCCACCACCCTGTTGCTGTA 498
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×