January 2005
Volume 46, Issue 1
Free
Retina  |   January 2005
Pigmented Paravenous Chorioretinal Atrophy Is Associated with a Mutation within the Crumbs Homolog 1 (CRB1) Gene
Author Affiliations
  • Gareth J. McKay
    From the Ophthalmic Research Centre, Institute of Clinical Science, Queen’s University of Belfast, Belfast, Northern Ireland, United Kingdom; and the
  • Stephen Clarke
    From the Ophthalmic Research Centre, Institute of Clinical Science, Queen’s University of Belfast, Belfast, Northern Ireland, United Kingdom; and the
  • Jason A. Davis
    Department of Biochemistry, University of Oxford, Oxford, United Kingdom.
  • David A. C. Simpson
    From the Ophthalmic Research Centre, Institute of Clinical Science, Queen’s University of Belfast, Belfast, Northern Ireland, United Kingdom; and the
  • Giuliana Silvestri
    From the Ophthalmic Research Centre, Institute of Clinical Science, Queen’s University of Belfast, Belfast, Northern Ireland, United Kingdom; and the
Investigative Ophthalmology & Visual Science January 2005, Vol.46, 322-328. doi:10.1167/iovs.04-0734
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to Subscribers Only
      Sign In or Create an Account ×
    • Get Citation

      Gareth J. McKay, Stephen Clarke, Jason A. Davis, David A. C. Simpson, Giuliana Silvestri; Pigmented Paravenous Chorioretinal Atrophy Is Associated with a Mutation within the Crumbs Homolog 1 (CRB1) Gene. Invest. Ophthalmol. Vis. Sci. 2005;46(1):322-328. doi: 10.1167/iovs.04-0734.

      Download citation file:


      © 2016 Association for Research in Vision and Ophthalmology.

      ×
  • Supplements
Abstract

purpose. Pigmented paravenous chorioretinal atrophy (PPCRA) is an unusual retinal degeneration characterized by accumulation of pigmentation along retinal veins. The purpose of this study was to describe the phenotype of a family with PPCRA, determine the mode of inheritance, and identify the causal mutation.

methods. Ophthalmic examination was performed on seven family members and serially detailed in the proband over a 3-year period. Blood samples were collected and DNA extracted. All 12 coding exons and the 5′ promoter region of the crumbs homologue 1 (CRB1) gene were PCR amplified and DNA sequenced. In silico homology modeling was performed on the mutated protein domain.

results. Subtle symmetrical chorioretinal atrophy in the inferior quadrant was the earliest clinical sign detectable within this family. Paravenous pigmentation occurred initially in the far periphery, progressing centrally, with atrophy later becoming more widespread, involving the nasal, then the temporal, and finally the upper quadrant. A novel, dominant Val162Met mutation within the fourth EGF-like domain of CRB1 cosegregates with the PPCRA phenotype. It is thought to affect domain structure, because codon 162 is involved in hydrogen bonding between the antiparallel β-strands of the major β-sheet, causing sufficient perturbation of the backbone that the domain-stabilizing hydrogen bond does not form or is weakened.

conclusions. PPCRA was dominantly inherited in this family, but exhibited variable expressivity. Males are more likely to exhibit a severe phenotype, whereas females may remain virtually asymptomatic even in later years. The PPCRA phenotype is associated with a Val162Met mutation in CRB1 which is likely to affect the structure of the CRB1 protein.

PPCRA is a rare retinal disorder characterized by the presence of bilaterally symmetrical chorioretinal atrophy, with accumulation of bone corpuscle pigmentation along the retinal veins. 1 Patients are often asymptomatic, and the diagnosis is based on a characteristic fundus appearance, usually during routine ophthalmic examination. PPCRA was first reported in a 47-year-old man in whom alopecia areata developed and in whom there was the incidental finding of a bilateral and peculiar fundus appearance, the characteristics of which have since been considered typical of the disease. 2 Considerable variability in the extent and degree to which the retina is affected has been reported, 3 4 5 with the course of retinal degeneration unpredictable. It has been suggested 6 that PPCRA differs from RP in the absence of night blindness, minimal ERG abnormalities and its distinctive fundal appearance. However, other investigations have reported night blindness in association with PPCRA. 7 We provide a detailed clinical report of the PPCRA phenotype within an affected family. 
The cause of PPCRA is unknown, with some suggesting that PPCRA is a primary retinal degenerative disease, 8 and others reporting a congenital origin. 3 5 9 10 Of the 90 previously reported cases, 80 have been in male patients and have mostly been determined to be sporadic. 11 Previously, a mildly affected, asymptomatic 54-year-old mother received a diagnosis of PPCRA, along with her mildly affected daughter and severely affected 28-year-old son (proband). 5 Dominant or X-linked recessive modes of inheritance were postulated. Unfortunately, the investigators were unable to ascertain fully the mode of inheritance because of the restricted number of family members that they were able to examine. Descriptions of other families, however, suggested a dominant mode of inheritance. 9 10 Doubt, therefore, surrounds the nature of the inheritance pattern of this disorder. 
After a screening involving several genes known to be associated with retinal degeneration, we identified a single nucleotide variation within the CRB1 gene in the proband. In the present study, the CRB1 genotype was investigated in the whole family. Mutations in the CRB1 gene (OMIM 604210; Online Mendalian Inheritance in Man, http://www.ncbi.nlm.nih.gov/Omim/ provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD) have been described previously in a severe, autosomal recessive form of RP, designated RP12 (OMIM 600105). 12 13 14 RP12 is usually characterized by preserved para-arteriolar retinal pigment epithelium (PPRPE) in the early-to-middle stages of the disease, although this is not always the case. 15 Patients experience night-blindness and development of a progressive loss of their visual field at <10 years of age with severe visual impairment before the age of 20, due to early macular involvement. 13 RP12 with PPRPE can be heterogenous in its phenotype and is seen most consistently in the equatorial and peripheral regions of the eye. CRB1 mutations have been associated with the development of Coats’-like exudative vasculopathy in patients with RP. 13  
Previous studies have also described mutations in the CRB1 gene associated with Leber congenital amaurosis (LCA). 13 15 16 17 18 19 LCA is considered the earliest and most severe form of retinal dystrophy, causing blindness or severe visual impairment at birth or during the early months of life. Onset of human genetic retinal disease usually results in retinal thinning due to progressive photoreceptor degeneration. However, a recent investigation using optical coherence tomography reported coarsely laminated retinal thickening, 18 lacking the distinct layers of normal adult retina, in association with CRB1 mutations in patients with LCA. In these cases the CRB1 mutant retinal phenotype may present an immature lamination pattern resulting from interrupted naturally occurring developmental apoptosis. This is the first report of a mutation associated with PPCRA, and we suggest possible structural effects on the CRB1 protein. 
Methods
Patients
Full ophthalmic examination and fundus photography were performed on seven family members and one spouse, the proband’s father (Fig. 1) . The family and 150 control individuals were white. All patients gave informed consent to participate in this study, which adhered to the tenets of the Declaration of Helsinki and was approved by internal institutional review (QUB 74/03). Electrophysiology was performed in three of the second-generation individuals and optical coherence scanning tomography (OCT) was performed on a subset of the family. 
Molecular Analyses
DNA was extracted from a blood sample provided under consent. Sixteen amplicons spanning specific exons of several candidate genes associated with retinal degeneration were analyzed (Table 1) . In addition, 14 primer pairs (Table 2 ; Invitrogen Life Technologies, Paisley, UK) were used to amplify all 12 exons of the CRB1 gene and their flanking donor and acceptor splice sites, the 5′ noncoding promoter region and part of the 3′ untranslated region. In 150 control individuals only exon 2 of the CRB1 gene was amplified. Each amplicon was generated by polymerase chain reaction (PCR; Platinum PCR SuperMix; Invitrogen-Life Technologies) after initial denaturation at 94°C for 1 minute and 30 cycles of 94°C, 10 seconds; 50°C, 10 seconds; and 72°C, 20 seconds; and one cycle of 72°C, 7 minutes. PCR amplicons were column purified (Promega, Madison, WI) and subjected to DNA sequence analysis by dye termination chemistry (Big Dye Sequencing; Applied Biosystems, Warrington, UK). Homology modeling of the fourth EGF-like calcium-binding domain of CRB1 was performed (Swiss-Model, ver. 36.0003; http://www.expasy.org/spdbv/ provided in the public domain by the Swiss Institute of Bioinformatics, Geneva, Switzerland). 20 21  
Results
Clinical Assessment
A 28-year-old man (proband) was referred for evaluation of a pigmentary retinopathy (Fig. 2) . A diagnosis of PPCRA with optic disc drusen was made. The patient reported no symptoms on presentation; however, he subsequently suffered a serious decline in visual function over the next 3 years. 
Clinical examination revealed that the proband’s father was unaffected, but although his mother and two siblings were asymptomatic, they showed clinical signs of early PPCRA. The proband’s mother (II:2) was aged 62 at the time of examination. She showed moderate chorioretinal atrophy in the inferior quadrant associated with paravenous pigmentary changes in the far periphery. The woman, who was ill, was examined at home and is now deceased. It was therefore difficult to capture the pigmentary changes in the far periphery with the handheld camera. However, moderate chorioretinal atrophic changes in the inferior quadrant were recorded (Figs. 3 A 3B) . Individual II:5, a woman, was severely affected with very poor visual acuity. Although the changes in this 59-year-old individual were panfundoscopic, the more severe chorioretinal atrophy and pigmentation were again located in the inferior quadrant (Figs. 3C 3D) . Individual II:6, aged 56, was found to have no evidence of any atrophy or pigmentation and was deemed unaffected. Individual III:2, a 36-year-old woman, showed very early chorioretinal atrophy in the inferior quadrant but, as yet no pigmentary changes, and had normal electrophysiology. Individual III:4 (a 27-year-old man) showed more obvious chorioretinal atrophy inferiorly, with some very early pigmentary changes (Fig. 4)and had subnormal rod ERGs in both eyes. 
OCT scanning in this family indicated that retinal thickness and lamination were within normal limits (Fig. 5A) . An OCT scan taken through an area of bony spicule pigmentation indicated that the pigment lies in the superficial neuroretina (Figs. 5B 5C)
Mutation Analysis
A heterozygous c.619G→A single nucleotide variation in CRB1 (GenBank accession number AY043325) resulting in an amino acid change from valine to methionine was detected at codon 162 within the fourth EGF-like domain. Of the seven family members examined, the Val162Met variation was found to cosegregate with six affected family members and was not found in one unaffected family member (Fig. 1) , giving a lod score of 1.8. This nucleotide variation was not detected in 150 control individuals analyzed. 
Molecular Modeling
Homology modeling of the fourth EGF-like domain was performed (Swiss-Model, ver. 36.0003; http://www.expasy.org/spdbv/), 20 21 based on structural data for the calcium binding EGF-like domains of coagulation factor VII, which has a high degree of primary sequence identity (Fig. 6A) . The Val162Met variation is adjacent to the fourth highly conserved cysteine and is a semiconservative substitution, with valine being replaced with the larger, nonaliphatic methionine residue. Deduction of any structural effect is challenging because Val162 is not conserved, but that amino acid residue is involved in hydrogen bonding between the antiparallel β-strands of the major β-sheet; in CRB1 the backbone amide/carbonyl of Val162 hydrogen bonds with those of Phe173 (Fig. 6B) . A possibility is that changing the side-chain would result in sufficient perturbation of the backbone that the domain-stabilizing hydrogen bond does not form or is weakened. 
Discussion
Subtle symmetrical chorioretinal atrophy in the inferior quadrant is the earliest clinical sign of PPCRA detectable within this family. This geographic pattern correlates with the clinical spotting of the inferior nasal quadrant of the fundus of rd8 mice, which have a point mutation in the Crb1 gene. 22 Paravenous pigmentation occurs initially in the far periphery but, as the disease progresses, moves more centrally with the chorioretinal atrophy becoming more widespread, with involvement of the nasal, then the temporal and finally the upper quadrant. Both males and females have variable expressivity. Males are more likely to exhibit a severe phenotype, whereas females may remain virtually asymptomatic, even in later years. The reason for the differential expression of the disease process remains unexplained; however, it is consistent with a mutation in CRB1, 5 9 10 23 in which mutations have been reported to cause a wide spectrum of phenotypes. 12 13 14 24 The specific CRB1 mutation reported affects the phenotype observed, with loss of function more likely to result in LCA and residual function associated with RP. 24 In addition, the same mutations can lead to different phenotypes, with inconsistent characteristics such as PPRPE and Coats’-like exudative vasculopathy. 13 14 24 Therefore other genetic modifiers and environmental factors may influence the effect of CRB1 mutations. 
The earliest reported cases of PPCRA suggested an inflammatory cause because one affected individual was diagnosed with tuberculous spondylitis, 2 a child with congenital syphilis, 25 another with rubeola retinopathy, 26 and another with ocular inflammation with cystoid macular edema. 7 In accordance with the previous reports relating to the hereditary etiology of this disease, 3 5 9 23 27 we found no evidence of an inflammatory or infectious origin within this family. The autosomal dominant mode of inheritance observed in this family is consistent with most of the information available from previous reports of PPCRA. 9 10 Our experience supports suggestions that sporadic cases may in fact be revealed to be familial, if asymptomatic relatives are examined. 3 6  
The CRB1 gene is composed of 12 exons and encodes a transmembrane protein with 19 epidermal growth factor (EGF)-like domains, three laminin A globular-like domains, and a 37-amino-acid cytoplasmic tail. It is expressed in human retina and brain, with evidence of alternative splicing at its 3′ end and is thought to encode four different isoforms, two of which are found in human retina. 28 Crumbs, the Drosophila orthologue of CRB1, forms part of one of the many protein complexes along the plasma membrane that participate in cell-to-cell contact and has been shown to be a key regulator of epithelial apical–basal polarity. 29 The function of the intracellular domain of Crumbs and CRB1 in localizing the phototransduction complex to the apical membranes of photoreceptors appears to be conserved from Drosophila to humans. 28 30 31 The extracellular domain of Crumbs is essential to suppress light-induced photoreceptor degeneration. 32 In mice, Crb1, the murine orthologue of CRB1 is located apical to the zonula adherens in photoreceptors and is necessary for the integrity of the external limiting membrane. 22 33 A report of abnormal lamination and increased retinal thickness in patients with certain CRB1 mutations 18 suggests a role in laminar development. This function does not appear to be affected by the Val162Met mutation, because retinal thicknesses measured by OCT were within the normal range. 
All the CRB1 mutations previously reported to be associated with retinal degeneration in humans have also been localized to the extracellular portion of the protein, leading to amino acid substitutions, frame shifts, or premature stop codons (with the exception of one documented mutation at codon 1354 within the transmembrane domain, reported in an individual with RP with Coats’-like exudative vasculopathy, in conjunction with two additional mutations found within the extracellular domain). 12 13 14 15 16 Among these mutations, Cys948Tyr is the most common, having been associated with LCA, RP, RP with Coats’-like exudative vasculopathy and RP with PPRPE. A family has been reported in which affected individuals homozygous for the Cys948Tyr mutation experience a severe LCA phenotype. 14 This observation is in contrast to a compound heterozygous family member with the Cys948Tyr mutation and a nonsynonymous Ile1100Thr mutation, also within the CRB1 gene, resulting in an early onset RP phenotype without PPRPE. It was concluded that the homozygous mutation results in a complete loss of function of the CRB1 gene, whereas heterozygosity is still likely to result in partial function. den Hollander et al. 12 concurred with these findings, reporting homozygous Cys948Tyr to be a severe mutation likely to lead to LCA. When found heterozygously in combination with a splice-site mutation that was unlikely to completely inactivate the protein, the less severe RP with PPRPE resulted. Cys948Tyr occurs in what appears to be a truncated EGF-like domain (the 14th EGF-like domain). Although no high-resolution structural data are available, the amino acid sequence up to the fourth cysteine conforms to the EGF consensus sequence. In the typical EGF structure, this cysteine forms a disulfide bond with the second highly conserved cysteine (Cys933), and a nonsynonymous substitution would therefore be expected to disrupt the native fold of the domain. 
The Val162Met mutation within CRB1 occurs in the fourth EGF-like domain. EGF-like domains are widely distributed in nature and are independently folding modules found in many transmembrane and extracellular proteins. 34 Sequence similarity among EGF-like domains is low at approximately 30%, they are defined largely on the basis of the spacing between the cysteines, 35 and they typically consist of six cysteine residues that form disulfide bonds in a 1-3, 2-4, 5-6 arrangement. A subset of EGF-like domains contains a consensus associated with calcium binding. The residues that define this consensus comprise those that directly bind the calcium atom (through both side chain and backbone carbonyl H-bonding), those involved in interdomain packing interactions, and those for which clear functions have not yet been determined. 36 The main structural feature of all EGF-like domains (both calcium-binding and non–calcium-binding) is a central two-stranded β-sheet that is located in the region of the sequence containing the 1-3 and 2-4 disulfide bonds. The region separated by the 5-6 disulfide bond forms a β-strand with hairpin turns at either end. The 19 EGF domains comprise ∼50% of CRB1 but contain ∼70% of the nontruncating mutations, half of which directly substitute one of the six signature cysteine amino acid residues that disulfide bond to stabilize the global fold of the domain. Other mutations introduce cysteine residues that could incorrectly form disulfide bonds. The remaining mutations have no clear structural effect, and could mediate their disease-causing phenotype through disruption of intradomain, interdomain, or protein–protein interactions. 
Human fibrillin-1 is a gene composed of similar calcium-binding EGF domains and demonstrates similar mutation frequency ratios within the EGF-like domains, emphasizing the functional importance of these domains. 37 38 A relatively conservative Val1128Ile mutation similar to CRB1 Val162Met occurs at the corresponding domain location within a calcium-binding EGF-like domain of fibrillin 1 and is associated with Marfan syndrome. 39 A variant of Marfan syndrome is also caused by a conservative mutation at G1127S, 40 corresponding to codon 161 within CRB1, a site previously reported to be associated with RP through a conservative alanine-to-valine substitution. 12 Both mutations within each gene have been associated with disease, and all mutations are nominally conservative, although each substituted residue is larger than its native counterpart. Smallridge et al. 37 reports that the G1127S is likely to impair folding of the calcium-binding EGF-like domain, possibly because of the exchange of the glycine for a less flexible residue at the start of the major β-hairpin. 
The mechanisms whereby mutations in CRB1 cause retinal degeneration are unclear. Crb1 is required for maintenance of the adherens junctions between photoreceptor and Müller glia cells. 33 Complete loss of Crb1 results in retinal disorganization and dystrophy in mice, and null mutations in CRB1 result in LCA in humans. 14 EGF-like domains mediate protein interactions, and the severity of the phenotype associated with mutations within them presumably reflects the importance of the specific interactions affected. Although previously reported mutations within CRB1 are recessive, dominant mutations within EGF-like domains of other proteins have been reported to cause retinal disease, for example EFEMP1 Arg345Trp (dominant drusen) 41 and HEMICENTIN-1 Gln5345Arg (ARMD1 phenotype). 42 It has been proposed that mutations within the calcium-binding EGF-like domains of fibrillin-1 exert a dominant negative effect by disrupting the function of the multicomponent 10- to 12-nm microfibrils of which fibrillin-1 is a major constituent. 43 It is possible that the fourth CRB1 EGF-like calcium-binding domain is involved in the assembly of an extracellular scaffold structure and that the Val162Met mutation disrupts the organization of this network. Further investigation is necessary to confirm whether the mutational effect is local to the domain or is implicated in a potential site of protein–protein interaction. However, the extensive variation in phenotypic presentation within this family suggests that multiple interactions are likely to be involved. 
 
Figure 1.
 
Cosegregation analysis of a CRB1 mutation in a family with PPCRA. The letters below each pedigree number refer to the CRB1 sequence at position 619 of the cDNA. All six affected members of the family have the A allele, whereas the one unaffected member (II:6) is homozygous for G. The detailed phenotypes of the proband (indicated with an arrow) and other affected individuals are given in the text. The proband’s father (II:1) was also examined to confirm that he had no retinal degeneration. Current ages of individuals involved in the study are shown above and to the right of the symbols.
Figure 1.
 
Cosegregation analysis of a CRB1 mutation in a family with PPCRA. The letters below each pedigree number refer to the CRB1 sequence at position 619 of the cDNA. All six affected members of the family have the A allele, whereas the one unaffected member (II:6) is homozygous for G. The detailed phenotypes of the proband (indicated with an arrow) and other affected individuals are given in the text. The proband’s father (II:1) was also examined to confirm that he had no retinal degeneration. Current ages of individuals involved in the study are shown above and to the right of the symbols.
Table 1.
 
Genes Partially DNA Sequenced in Addition to CRB1 in an Initial Screening for the Detection of Mutations Associated with PPCRA
Table 1.
 
Genes Partially DNA Sequenced in Addition to CRB1 in an Initial Screening for the Detection of Mutations Associated with PPCRA
Amplicon Gene Exon Chromosomal Location
1 LRAT Exon 1 4q32.1
2 LRAT Exon 2 4q32.1
3 MERTK Exon 15 2q13
4 PDE6A Exon 11/12 5q33.1
5 RP1 Exon 3 8q12.1
6 RP7 Exon 1 6p21.2
7 RP7 Exon 2 6p21.2
8 RP7 Exon 3 6p21.2
9 RP2 Exon 1 Xp11.23
10 RP3 Exon 6 Xp11.4
11 RP3 Exon 7 Xp11.4
12 RP3 Exon 8 Xp11.4
13 RP3 Exon 11 Xp11.4
14 RP10 Exon 7 7q32.1
15 RP9 Exon 6 7p14.3
16 RP20 Exon 4/5 1p31.2
Table 2.
 
Primer Sequences and Product Size for Each Amplicon
Table 2.
 
Primer Sequences and Product Size for Each Amplicon
Amplicon Sense Primer Antisense Primer Product Size (bp)
5′ UTR gtaaaaatcagctatagaaattgc gggaatataatttatgaacagaaaa 456
Exon 1 cttctgtcttggcccaacttac accctttgtagtagtgagctgg 877
Exon 2 gcagcacaaaggtcacaaag aagtggcagaagcagaggtg 732
Exon 3 tctttgtaacagctgctctgcc tagagctctcacgttctcgg 490
Exon 4 catggtttgcatgaccctgtac gtctgaagtaggttaccaagctgc 564
Exon 5 cttgtttccactaagcctcctc agcaggaagagctgtactgtg 450
Exon 6 cgtgaaacttctatttttgatgtga gtgctatggctaggagtgcc 1054
Exon 7 ttcgtcttccatcccttctg agatgatgttactgacccacca 743
Exon 8 ggagttggtaatggcagtagtc ggttgtttcccctatgcgagt 479
Exon 9a aatgatcattactattaataacgg* aattcagtggtcactggctg 650
Exon 9b tgtgggagacagagctattg gcatcactgttcttgtcaaattg 575
Exon 10 tagccatgcttgtcacag cagtttaggtcaaagggg 520
Exon 11 ttcccatttcacaaccaatg agcactatgggaggctgaag 794
Exon 12 attcgcatcccaatgatttc atgcagttgttctcctttctgag 841
Figure 2.
 
Fundus photograph of the proband demonstrating the typical distribution of chorioretinal atrophy in the inferior quadrant (A) associated with paravenous pigmentation (B).
Figure 2.
 
Fundus photograph of the proband demonstrating the typical distribution of chorioretinal atrophy in the inferior quadrant (A) associated with paravenous pigmentation (B).
Figure 3.
 
Fundus photography of patients with PPCRA. (A) Left eye of individual II:2, age 62, showing moderate chorioretinal atrophy in the inferior quadrant associated with paravenous pigmentary changes in the far periphery (not shown). (B) Extensive chorioretinal atrophy in the left eye of individual II:2 in the inferior periphery. (C) Right posterior pole of individual II:5, showing advanced changes. (D) Right nasal quadrant of individual II:5, showing advanced chorioretinal atrophy and pigmentary changes.
Figure 3.
 
Fundus photography of patients with PPCRA. (A) Left eye of individual II:2, age 62, showing moderate chorioretinal atrophy in the inferior quadrant associated with paravenous pigmentary changes in the far periphery (not shown). (B) Extensive chorioretinal atrophy in the left eye of individual II:2 in the inferior periphery. (C) Right posterior pole of individual II:5, showing advanced changes. (D) Right nasal quadrant of individual II:5, showing advanced chorioretinal atrophy and pigmentary changes.
Figure 4.
 
Fundus photographs of individual III:4. (A) Right fundus showing normal posterior pole. (B) Right inferior quadrant showing early chorioretinal atrophy. (C) Right inferior quadrant: midperiphery showing moderate chorioretinal atrophy. (D) Right nasal quadrant showing moderate chorioretinal atrophy.
Figure 4.
 
Fundus photographs of individual III:4. (A) Right fundus showing normal posterior pole. (B) Right inferior quadrant showing early chorioretinal atrophy. (C) Right inferior quadrant: midperiphery showing moderate chorioretinal atrophy. (D) Right nasal quadrant showing moderate chorioretinal atrophy.
Figure 5.
 
OCT of PPCRA retina. (A) OCT scan of right macular area, fixation slightly eccentric showing normal thickness and lamination of the retina. (B) OCT image of the left eye showing a section through an area of pigment in the neurosensory retina ( Image not available ). (C) An area of blocked transmission at the location of pigment that is in the intranasal quadrant ( Image not available ).
Figure 5.
 
OCT of PPCRA retina. (A) OCT scan of right macular area, fixation slightly eccentric showing normal thickness and lamination of the retina. (B) OCT image of the left eye showing a section through an area of pigment in the neurosensory retina ( Image not available ). (C) An area of blocked transmission at the location of pigment that is in the intranasal quadrant ( Image not available ).
Figure 6.
 
(A) Homology modeling of the fourth EGF-like calcium-binding domain of CRB1 (Swiss-Model, Version 36.0003; http://www.expasy.org/spdbv/). The methionine residue in the mutant protein at codon 162 is highlighted in space-filling mode. The cysteine pairs that form disulfide bonds are indicated. A primary amino acid sequence alignment with factor VII EGF-like domain illustrates the degree of similarity with CRB1:EGF4. This model is based on the coordinates of PDB entries for the following calcium-binding EGF-like domains: 1fak.pdb, 1dva.pdb, 1dan.pdb, and 1qfk.pdb. (B) The fourth EGF-like domain from CRB1 (Swiss PDB viewer, ver. 3.7) showing the calcium ion (red) and the residues directly involved in calcium binding. Green dotted lines: the calculated hydrogen bonding between the backbone amide/carbonyl of Val162 (cyan) with those of Phe173 (purple) within the antiparallel β-strands of the major β-sheet. Yellow: disulfide bonds. For clarity, all other side chains and hydrogen bonds have been omitted.
Figure 6.
 
(A) Homology modeling of the fourth EGF-like calcium-binding domain of CRB1 (Swiss-Model, Version 36.0003; http://www.expasy.org/spdbv/). The methionine residue in the mutant protein at codon 162 is highlighted in space-filling mode. The cysteine pairs that form disulfide bonds are indicated. A primary amino acid sequence alignment with factor VII EGF-like domain illustrates the degree of similarity with CRB1:EGF4. This model is based on the coordinates of PDB entries for the following calcium-binding EGF-like domains: 1fak.pdb, 1dva.pdb, 1dan.pdb, and 1qfk.pdb. (B) The fourth EGF-like domain from CRB1 (Swiss PDB viewer, ver. 3.7) showing the calcium ion (red) and the residues directly involved in calcium binding. Green dotted lines: the calculated hydrogen bonding between the backbone amide/carbonyl of Val162 (cyan) with those of Phe173 (purple) within the antiparallel β-strands of the major β-sheet. Yellow: disulfide bonds. For clarity, all other side chains and hydrogen bonds have been omitted.
The authors thank the family involved in this investigation for their patience and cooperation and Gerry Mahon, Justin O’Neill, Vittorio Silvestri, Anne Hughes, and Ronald Hunter for assistance with the research. 
FranceschettiA. A curious affection of the fundus oculi: helicoids peripapillar chorioretinal degeneration: its relation to pigmentary paravenous chorioretinal degeneration. Doc Ophthalmol. 1962;63:81–110.
BrownTH. Retinochoroiditis radiata. Br J Ophthalmol. 1937;21:645–648. [CrossRef] [PubMed]
NobleKG. Hereditary pigmented paravenous chorioretinal atrophy. Am J Ophthalmol. 1989;105:365–369.
NucciP, ManittoMP, PiantanidaA, BrancatoR. Macular dysplasia and pigmented paravenous retino-choroidal atrophy. Ophthalmic Genet. 1994;15:161–164. [CrossRef] [PubMed]
BozkurtN, BavbekT, KazokogluH. Hereditary pigmented paravenous chorioretinal atrophy. Ophthalmic Genet. 1998;19:99–104. [CrossRef] [PubMed]
Al-HusainyS, SarodiaU, DeaneJS. Pigmented paravenous retinochoroidal atrophy: evidence of progression to macular involvement in a family with a 42-year history. Eye. 2001;15:329–360. [CrossRef] [PubMed]
BatioglouF, AtmacaLS, AtillaH, ArslanpenceA. Inflammatory pigmented paravenous chorioretinal atrophy. Eye. 2002;16:81–84. [CrossRef] [PubMed]
LesselMR, ThalerA., HeiligP. ERG and EOG in progressive paravenous retinochoroidal atrophy. Doc Ophthalmol. 1986;62:25–29. [CrossRef] [PubMed]
SkalkaHW. Hereditary pigmented paravenous retinochoroidal atrophy. Am J Ophthalmol. 1979;87:286–291. [CrossRef] [PubMed]
TraversiC, TosiGM, CaporossiA. Unilateral retinitis pigmentosa in a woman and pigmented paravenous chorioretinal atrophy in her daughter and son. Eye. 2000;14:395–397. [CrossRef] [PubMed]
KuknerAS, YilmazT, CelebiS, AydemirO, UlasF. Pigmented paravenous chorioretinal atrophy. Ophthalmologica. 2003;217:436–440. [CrossRef] [PubMed]
den HollanderAI, ten BrinkJB, de KokYJ, et al. Mutations in a human homologue of Drosophila crumbs cause retinitis pigmentosa (RP12). Nat Genet. 1999;23:217–221. [CrossRef] [PubMed]
den HollanderAI, HeckenlivelyJR, van den BornLI, et al. Leber congenital amaurosis and retinitis pigmentosa with Coats-like exudative vasculopathy are associated with mutations in the Crumbs homologue 1 (CRB1) gene. Am J Hum Genet. 2001;69:198–203. [CrossRef] [PubMed]
BernalS, CalafM, Garcia-HoyosM, et al. Study of the involvement of the RGR, CRBP1 and CRB1 genes in the pathogenesis of autosomal recessive retinitis pigmentosa. J Med Genet. 2003;40:E89. [CrossRef] [PubMed]
LoteryAJ, MalikA, ShamiSA, et al. CRB1 mutations may result in retinitis pigmentosa without para-arteriolar RPE preservation. Ophthalmic Genet. 2001;22:163–169. [CrossRef] [PubMed]
LoteryAJ, JacobsonSG, FishmanGA, et al. Mutations in the CRB1 gene cause Leber congenital amaurosis. Arch Ophthalmol. 2001;119:415–420. [CrossRef] [PubMed]
GerberS, PerraultI, HaneinS, et al. A novel mutation disrupting the cytoplasmic domain of CRB1 in a large consanguineous family of Palestinian origin affected with Leber congenital amaurosis. Ophthalmic Genet. 2002;23:225–235. [CrossRef] [PubMed]
JacobsonSG, CideciyanAV, AlemanTS, et al. Crumbs homolog 1 (CRB1) mutations result in a thick human retina with abnormal lamination. Hum Mol Genet. 2003;12:1073–1078. [CrossRef] [PubMed]
KhaliqS, AbidA, HameedA, et al. Mutation screening of Pakistani families with congenital eye disorders. Exp Eye Res. 2003;76:343–348. [CrossRef] [PubMed]
GuexN, PeitschMC. SWISS-MODEL and the Swiss-PdbViewer: an environment for comparative protein modelling. Electrophoresis. 1997;18:2714–2723. [CrossRef] [PubMed]
SchwedeT, KoppJ, GuexN, PeitschMC. SWISS-MODEL: an automated protein homology-modeling server. Nucleic Acids Res. 2003;31:3381–3385. [CrossRef] [PubMed]
MehalowAK, KameyaS, SmithRS, et al. CRB1 is essential for external limiting membrane integrity and photoreceptor morphogenesis in the mammalian retina. Hum Mol Genet. 2003;12:2179–2189. [CrossRef] [PubMed]
TraboulsiEI, MaumeneeHI. Hereditary pigmented paravenous chorioretinal atrophy. Arch Ophthalmol. 1986;104:1636–1640. [CrossRef] [PubMed]
CremersFP, MaugeriA, den HollanderAI, HoyngCB. The expanding roles of ABCA4 and CRB1 in inherited blindness. Novartis Found Symp. 2004;255:68–79. [PubMed]
Hsing-HsiangC. Retino-choroiditis radiata. Am J Ophthalmol. 1948;41:1485–1487.
FoxmanSG, HeckenlivelyJR, SinclairSH. Rubeola retinopathy and pigmented paravenous retinochoroidal atrophy. Am J Ophthalmol. 1985;99:605–606. [CrossRef] [PubMed]
MurrayAT, KirkbyGR. Pigmented paravenous retinochoroidal atrophy: a literature review supported by a unique case and insight. Eye. 2000;14:711–716. [CrossRef] [PubMed]
den HollanderAI, JohnsonK, de KokYJ, et al. CRB1 has a cytoplasmic domain that is functionally conserved between human and Drosophila. Hum Mol Genet. 2001;10:2767–2773. [CrossRef] [PubMed]
TepassU, TheresC, KnustE. Crumbs encodes an EGF-like protein expressed on apical membranes of Drosophila epithelial cells and required for organization of epithelia. Cell. 1990;61:787–799. [CrossRef] [PubMed]
IzaddoostS, NamSC, BhatMA, BellenHJ, ChoiKW. Drosophila Crumbs is a positional cue in photoreceptor adherens junctions and rhabdomeres. Nature. 2002;416:178–183. [CrossRef] [PubMed]
PellikkaM, TanentzapfG, PintoM, et al. Crumbs, the Drosophila homologue of human CRB1/RP12, is essential for photoreceptor morphogenesis. Nature. 2002;416:143–149. [CrossRef] [PubMed]
JohnsonK, GraweF, GrzeschikN, KnustE. Drosophila crumbs is required to inhibit light-induced photoreceptor degeneration. Curr Biol. 2002;12:1675–1680. [CrossRef] [PubMed]
Van De PavertSA, KantardzhievaA, MalyshevaA, et al. Crumbs homologue 1 is required for maintenance of photoreceptor cell polarization and adhesion during light exposure. J Cell Sci. 2004;117:4169–4177. [CrossRef] [PubMed]
CampbellID, BorkP. Epidermal growth factor-like modules. Curr Opin Struct Biol. 1993;3:385–392. [CrossRef]
Sampoli BenitezBA, KomivesEA. Disulfide bond plasticity in epidermal growth factor. Proteins. 2000;40:168–174. [CrossRef] [PubMed]
DowningAK, KnottV, WernerJM, CardyCM, CampbellID, HandfordPA. Solution structure of a pair of calcium-binding epidermal growth factor-like-domains: implications for the Marfan syndrome and other genetic disorders. Cell. 1996;85:597–605. [CrossRef] [PubMed]
SmallridgeRS, WhitemanP, WernerJM, CampbellID, HandfordPA, DowningAK. Solution structure and dynamics of a calcium binding epidermal growth factor-like domain pair from the neonatal region of human fibrillin-1. J Biol Chem. 2003;278:12199–12206. [CrossRef] [PubMed]
WhitemanP, HandfordPA. Defective secretion of recombinant fragments of fibrillin-1: implications of protein misfolding for the pathogenesis of Marfan syndrome and related disorders. Hum Mol Genet. 2003;12:727–737. [CrossRef] [PubMed]
LoeysB, NuytinckL, DelvauxI, De BieS, De PaepeA. Genotype and phenotype analysis of 171 patients referred for molecular study of the fibrillin-1 gene FBN1 because of suspected Marfan syndrome. Arch Intern Med. 2001;161:2447–2454. [CrossRef] [PubMed]
FranckeU, BergMA, TynanK, et al. A Gly1127Ser mutation in an EGF-like domain of the fibrillin-1 gene is a risk factor for ascending aortic aneurysm and dissection. Am J Hum Gene. 1995;56:1287–1296.
StoneEM, LoteryAJ, MunierFL, et al. A single EFEMP1 mutation associated with both Malattia Leventinese and Doyne honeycomb retinal dystrophy. Nat Genet. 1999;22:199–202. [CrossRef] [PubMed]
SchultzDW, KleinML, HumpertAJ, et al. Analysis of the ARMD1 locus: evidence that a mutation in HEMICENTIN-1 is associated with age-related macular degeneration in a large family. Hum Mol Genet. 2003;12:3315–3323. [CrossRef] [PubMed]
DietzHC, McIntoshI, SakaiLY, et al. Four novel FBN1 mutations: significance for mutant transcript level and EGF-like domain calcium binding in the pathogenesis of Marfan syndrome. Genomics. 1993;17:468–475. [CrossRef] [PubMed]
Figure 1.
 
Cosegregation analysis of a CRB1 mutation in a family with PPCRA. The letters below each pedigree number refer to the CRB1 sequence at position 619 of the cDNA. All six affected members of the family have the A allele, whereas the one unaffected member (II:6) is homozygous for G. The detailed phenotypes of the proband (indicated with an arrow) and other affected individuals are given in the text. The proband’s father (II:1) was also examined to confirm that he had no retinal degeneration. Current ages of individuals involved in the study are shown above and to the right of the symbols.
Figure 1.
 
Cosegregation analysis of a CRB1 mutation in a family with PPCRA. The letters below each pedigree number refer to the CRB1 sequence at position 619 of the cDNA. All six affected members of the family have the A allele, whereas the one unaffected member (II:6) is homozygous for G. The detailed phenotypes of the proband (indicated with an arrow) and other affected individuals are given in the text. The proband’s father (II:1) was also examined to confirm that he had no retinal degeneration. Current ages of individuals involved in the study are shown above and to the right of the symbols.
Figure 2.
 
Fundus photograph of the proband demonstrating the typical distribution of chorioretinal atrophy in the inferior quadrant (A) associated with paravenous pigmentation (B).
Figure 2.
 
Fundus photograph of the proband demonstrating the typical distribution of chorioretinal atrophy in the inferior quadrant (A) associated with paravenous pigmentation (B).
Figure 3.
 
Fundus photography of patients with PPCRA. (A) Left eye of individual II:2, age 62, showing moderate chorioretinal atrophy in the inferior quadrant associated with paravenous pigmentary changes in the far periphery (not shown). (B) Extensive chorioretinal atrophy in the left eye of individual II:2 in the inferior periphery. (C) Right posterior pole of individual II:5, showing advanced changes. (D) Right nasal quadrant of individual II:5, showing advanced chorioretinal atrophy and pigmentary changes.
Figure 3.
 
Fundus photography of patients with PPCRA. (A) Left eye of individual II:2, age 62, showing moderate chorioretinal atrophy in the inferior quadrant associated with paravenous pigmentary changes in the far periphery (not shown). (B) Extensive chorioretinal atrophy in the left eye of individual II:2 in the inferior periphery. (C) Right posterior pole of individual II:5, showing advanced changes. (D) Right nasal quadrant of individual II:5, showing advanced chorioretinal atrophy and pigmentary changes.
Figure 4.
 
Fundus photographs of individual III:4. (A) Right fundus showing normal posterior pole. (B) Right inferior quadrant showing early chorioretinal atrophy. (C) Right inferior quadrant: midperiphery showing moderate chorioretinal atrophy. (D) Right nasal quadrant showing moderate chorioretinal atrophy.
Figure 4.
 
Fundus photographs of individual III:4. (A) Right fundus showing normal posterior pole. (B) Right inferior quadrant showing early chorioretinal atrophy. (C) Right inferior quadrant: midperiphery showing moderate chorioretinal atrophy. (D) Right nasal quadrant showing moderate chorioretinal atrophy.
Figure 5.
 
OCT of PPCRA retina. (A) OCT scan of right macular area, fixation slightly eccentric showing normal thickness and lamination of the retina. (B) OCT image of the left eye showing a section through an area of pigment in the neurosensory retina ( Image not available ). (C) An area of blocked transmission at the location of pigment that is in the intranasal quadrant ( Image not available ).
Figure 5.
 
OCT of PPCRA retina. (A) OCT scan of right macular area, fixation slightly eccentric showing normal thickness and lamination of the retina. (B) OCT image of the left eye showing a section through an area of pigment in the neurosensory retina ( Image not available ). (C) An area of blocked transmission at the location of pigment that is in the intranasal quadrant ( Image not available ).
Figure 6.
 
(A) Homology modeling of the fourth EGF-like calcium-binding domain of CRB1 (Swiss-Model, Version 36.0003; http://www.expasy.org/spdbv/). The methionine residue in the mutant protein at codon 162 is highlighted in space-filling mode. The cysteine pairs that form disulfide bonds are indicated. A primary amino acid sequence alignment with factor VII EGF-like domain illustrates the degree of similarity with CRB1:EGF4. This model is based on the coordinates of PDB entries for the following calcium-binding EGF-like domains: 1fak.pdb, 1dva.pdb, 1dan.pdb, and 1qfk.pdb. (B) The fourth EGF-like domain from CRB1 (Swiss PDB viewer, ver. 3.7) showing the calcium ion (red) and the residues directly involved in calcium binding. Green dotted lines: the calculated hydrogen bonding between the backbone amide/carbonyl of Val162 (cyan) with those of Phe173 (purple) within the antiparallel β-strands of the major β-sheet. Yellow: disulfide bonds. For clarity, all other side chains and hydrogen bonds have been omitted.
Figure 6.
 
(A) Homology modeling of the fourth EGF-like calcium-binding domain of CRB1 (Swiss-Model, Version 36.0003; http://www.expasy.org/spdbv/). The methionine residue in the mutant protein at codon 162 is highlighted in space-filling mode. The cysteine pairs that form disulfide bonds are indicated. A primary amino acid sequence alignment with factor VII EGF-like domain illustrates the degree of similarity with CRB1:EGF4. This model is based on the coordinates of PDB entries for the following calcium-binding EGF-like domains: 1fak.pdb, 1dva.pdb, 1dan.pdb, and 1qfk.pdb. (B) The fourth EGF-like domain from CRB1 (Swiss PDB viewer, ver. 3.7) showing the calcium ion (red) and the residues directly involved in calcium binding. Green dotted lines: the calculated hydrogen bonding between the backbone amide/carbonyl of Val162 (cyan) with those of Phe173 (purple) within the antiparallel β-strands of the major β-sheet. Yellow: disulfide bonds. For clarity, all other side chains and hydrogen bonds have been omitted.
Table 1.
 
Genes Partially DNA Sequenced in Addition to CRB1 in an Initial Screening for the Detection of Mutations Associated with PPCRA
Table 1.
 
Genes Partially DNA Sequenced in Addition to CRB1 in an Initial Screening for the Detection of Mutations Associated with PPCRA
Amplicon Gene Exon Chromosomal Location
1 LRAT Exon 1 4q32.1
2 LRAT Exon 2 4q32.1
3 MERTK Exon 15 2q13
4 PDE6A Exon 11/12 5q33.1
5 RP1 Exon 3 8q12.1
6 RP7 Exon 1 6p21.2
7 RP7 Exon 2 6p21.2
8 RP7 Exon 3 6p21.2
9 RP2 Exon 1 Xp11.23
10 RP3 Exon 6 Xp11.4
11 RP3 Exon 7 Xp11.4
12 RP3 Exon 8 Xp11.4
13 RP3 Exon 11 Xp11.4
14 RP10 Exon 7 7q32.1
15 RP9 Exon 6 7p14.3
16 RP20 Exon 4/5 1p31.2
Table 2.
 
Primer Sequences and Product Size for Each Amplicon
Table 2.
 
Primer Sequences and Product Size for Each Amplicon
Amplicon Sense Primer Antisense Primer Product Size (bp)
5′ UTR gtaaaaatcagctatagaaattgc gggaatataatttatgaacagaaaa 456
Exon 1 cttctgtcttggcccaacttac accctttgtagtagtgagctgg 877
Exon 2 gcagcacaaaggtcacaaag aagtggcagaagcagaggtg 732
Exon 3 tctttgtaacagctgctctgcc tagagctctcacgttctcgg 490
Exon 4 catggtttgcatgaccctgtac gtctgaagtaggttaccaagctgc 564
Exon 5 cttgtttccactaagcctcctc agcaggaagagctgtactgtg 450
Exon 6 cgtgaaacttctatttttgatgtga gtgctatggctaggagtgcc 1054
Exon 7 ttcgtcttccatcccttctg agatgatgttactgacccacca 743
Exon 8 ggagttggtaatggcagtagtc ggttgtttcccctatgcgagt 479
Exon 9a aatgatcattactattaataacgg* aattcagtggtcactggctg 650
Exon 9b tgtgggagacagagctattg gcatcactgttcttgtcaaattg 575
Exon 10 tagccatgcttgtcacag cagtttaggtcaaagggg 520
Exon 11 ttcccatttcacaaccaatg agcactatgggaggctgaag 794
Exon 12 attcgcatcccaatgatttc atgcagttgttctcctttctgag 841
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×