May 2005
Volume 46, Issue 5
Free
Cornea  |   May 2005
Serum-Free Spheroid Culture of Mouse Corneal Keratocytes
Author Affiliations
  • Satoru Yoshida
    From the Cornea Center and the
    SEED Co., Ltd, Tokyo, Japan; and the
  • Shigeto Shimmura
    From the Cornea Center and the
    Department of Ophthalmology, Tokyo Dental College, Chiba, Japan;
  • Jun Shimazaki
    Department of Ophthalmology, Tokyo Dental College, Chiba, Japan;
  • Naoshi Shinozaki
    From the Cornea Center and the
  • Kazuo Tsubota
    From the Cornea Center and the
    Department of Ophthalmology, Tokyo Dental College, Chiba, Japan;
    Department of Ophthalmology, Keio University School of Medicine, Tokyo, Japan.
Investigative Ophthalmology & Visual Science May 2005, Vol.46, 1653-1658. doi:10.1167/iovs.04-1405
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Satoru Yoshida, Shigeto Shimmura, Jun Shimazaki, Naoshi Shinozaki, Kazuo Tsubota; Serum-Free Spheroid Culture of Mouse Corneal Keratocytes. Invest. Ophthalmol. Vis. Sci. 2005;46(5):1653-1658. doi: 10.1167/iovs.04-1405.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

purpose. To develop a serum-free mass culture system for mouse keratocytes.

methods. Corneas of C57BL6/J mice were enzyme digested after the epithelium and endothelium were removed. Stromal cells were cultured in serum-free DMEM/F12 (1:1) containing epidermal growth factor (EGF), fibroblast growth factor 2 (FGF2), and B27 supplement. Primary spheres were dissociated by trypsin and subcultured as suspended secondary spheres. Cells from postnatal day (P)6 to P10 spheres were subcultured onto plastic dishes or type I collagen gels for phenotype analysis. The expression of the keratocyte markers keratocan, aldehyde dehydrogenase (Aldh), and CD34, were analyzed by RT-PCR, and vimentin and α-smooth muscle actin (α-SMA) were examined by immunocytochemistry.

results. Primary keratocytes formed spheres, which were cultured for over 12 passages. Suspended sphere cells expressed vimentin, keratocan, CD34, and lumican, but were negative for cytokeratin K12 (K12) and Pax6. Sphere cells subcultured on plastic exhibited a dendritic morphology characteristic of keratocytes, and maintained keratocan, Aldh, and CD34 expression in serum-free medium. Sphere cells subcultured with 10% serum became fibroblastic, and expressed α-SMA when stimulated by transforming growth factor (TGF)-β. α-SMA-positive cells demonstrated contractile properties on collagen gels, compatible with the myofibroblast phenotype.

conclusions. The phenotype of mouse keratocytes can be maintained in vitro for more than 12 passages by the serum-free sphere culturing technique.

The corneal stroma is characterized by a well-organized extracellular matrix consisting of a dense network of collagen fibrils and proteoglycans that are produced by keratocytes, the principal stromal mesenchymal cell of cranial neural crest origin. 1 2 In adult tissue, keratocytes are mitotically quiescent cells with a flat, dendritic morphology. Keratocytes form a three-dimensional network of cells through their extensive dendritic processes, linked via gap junctions, 3 4 5 6 7 8 9 10 and secrete collagens and keratan sulfate proteoglycans such as lumican, mimecan, and keratocan. 11 12 13 14 15 The corneal stroma is rich in total keratan sulfate proteoglycan content, 16 but contain relatively small amounts of dermatan sulfate proteoglycans. 17  
During corneal wound healing, the quiescent keratocytes are activated and transform into fibroblasts and/or myofibroblasts, losing their characteristic dendritic morphology. Keratan sulfate proteoglycans are downregulated, 11 18 whereas keratocytes proliferate and migrate to the site of injury, causing scar formation. 19 20 21 22 The conversion to myofibroblasts, characterized by intense expression of the contractile protein α-smooth muscle actin (α-SMA), 21 23 24 is induced by endogenous and exogenous transforming growth factor (TGF)-β. 25 26 27  
Ex vivo expansion of keratocytes is often performed to investigate keratocytes in vitro, and various culture techniques have been reported involving the use of plastic substrates. However, when cultured in serum-containing medium, collagenase-isolated keratocytes from bovine 28 and rabbit 27 29 corneas readily lose their in vivo quiescent phenotype and acquire a fibroblastic phenotype with altered physiological properties. 28 30 31 In the presence of 2% to 10% serum, keratan sulfate proteoglycan production is greatly reduced or absent in keratocyte-derived fibroblasts, 28 32 33 whereas production of dermatan sulfate proteoglycans is upregulated. Furthermore, TGF-β stimulation or culture at low densities 30 causes corneal fibroblasts to differentiate further into myofibroblasts with a more spread-out morphology. 26 29 32 34 Serum-free cultures have been reported to be effective in the maintenance of the dendritic morphology of keratocytes and the production of keratan sulfate proteoglycans. 27 28 30 31 32 33 35 36 However, the cultivation of a large quantity of cells by subculturing has been difficult. 
In this report, we introduce our method for subculturing mouse corneal keratocytes in large quantities, using a modified version of a suspension culture method originally described for neural stem cells. 37 38 39 In our study, the sphere culture of keratocytes did not require serum, and the dendritic keratocyte phenotype was restored when subcultured on plastic substrate in serum-free medium. 
Materials and Methods
Cell Culture
All animals were handled in full accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. Stromal cells were dissociated from adult C57BL6/J mice (7–8 weeks old) and then cultured as described previously 40 with modifications. In brief, cornea tissue was excised in Hanks’ balanced salt solution (HBSS) supplemented with 10% fetal bovine serum (FBS) by circular incision outside the limbus. The iris, ciliary body, and Descemet’s membrane including the endothelium were bluntly dissected from the cornea. The remaining stroma with epithelium was incubated in 5 mg/mL of Dispase II (Roche Diagnostics, Indianapolis, IN) at 4°C overnight. Loose epithelial sheets were then removed, and corneal stromal discs were cut into small segments and digested in 0.05% trypsin (Sigma-Aldrich, St. Louis, MO) for 30 minutes at 37°C, followed by 78 U/mL collagenase (Sigma-Aldrich) and 38 U/mL hyaluronidase (Sigma-Aldrich) for 30 minutes at 37°C. 
Stromal cells were mechanically dissociated into single cells, and cultured in DMEM/F12 (1:1) supplemented with 20 ng/mL epidermal growth factor (EGF; Sigma-Aldrich), 10 ng/mL of fibroblast growth factor 2 (FGF2, Sigma-Aldrich), B27 supplement (Invitrogen, Carlsbad, CA), and 103 U/mL leukemia inhibitory factor (LIF; Chemicon International Inc., Temecula, CA) at a density of 5 × 105 cells/mL in a 37°C 5% CO2 incubator. Initial culture was performed in 24-well plates or 35-mm dishes and then subcultured to 25-cm2 culture flasks. The spheres were then further subcultured in 75 cm2 culture flasks after 7 to 14 days, which was repeated every 7 to 14 days. Medium was changed every 5 to 7 days. All dishes and flasks used for sphere culture were polystyrene, noncoated vessels obtained from Asahi Techno Glass (Tokyo, Japan). Stromal sphere cells were examined by immunocytochemistry and RT-PCR. To allow cells to differentiate, cells dissociated from corneal spheres were cultured in serum-free or DMEM/F12 medium (10% FBS) supplemented with or without 2 ng/mL TGF-β (Sigma-Aldrich) for 4 days. Subcultured cells were stained by calcein-AM (Dojindo Laboratories, Tokyo, Japan), as described, 41 to visualize cell morphology. Primary stromal discs of mouse cornea were cultured in keratinocyte-serum free medium (K-SFM; Invitrogen) or DMEM/F12 with 10% FBS for 10 days (37°C, 5% CO2), to identify any contamination by epithelial cells. 
Immunocytochemistry
Immunocytochemistry was performed as described previously. 42 In brief, mouse corneal sphere cells and cells freshly isolated from mouse cornea were attached to glass slides by cytospin preparation (Auto Smear CF-120; Sakura, Tokyo, Japan) and then fixed in 4% paraformaldehyde for 15 minutes at 4°C. Cells were incubated in blocking serum for 30 minutes and then incubated with primary antibodies for 60 minutes. Primary antibodies used were anti-cytokeratin K12 (1:100, Santa Cruz Biotechnology, Santa Cruz, CA), anti-Pax6 (1:500, Chemicon International, Inc.), anti-vimentin (1:100, Santa Cruz Biotechnology), and anti-αSMA (1:200, Laboratory Vision, Fremont, CA). Immunoreactivity of primary antibodies was visualized with secondary antibodies conjugated with Cy3 or FITC (Jackson ImmunoResearch Laboratories, West Grove, PA). 
Reverse Transcription–Polymerase Chain Reaction
Sphere cells and freshly dissociated corneal cells were collected and immediately frozen in liquid N2. cDNAs were synthesized with a cDNA synthesis kit (Life Sciences, Inc., St. Petersburg, FL) from total RNA also prepared with a kit (RNeasy; Qiagen, Hilden, Germany). Gene-specific primers used for cytokeratin K12 (K12), Pax6, vimentin, keratocan, lumican, CD34, aldehyde dehydrogenase (Aldh), and Gapd are shown in Table 1 . PCR was then performed (GeneAmp 9700; Applied Biosystems, Foster City, CA). The PCR products were analyzed by agarose gel electrophoresis. 
Collagen Gel Contraction Assay
Collagen gel contraction assay was performed as described previously, 43 44 45 46 47 with some modifications. Collagen gels were prepared according to instructions provided by the manufacturer (Cellmaterix Type I-A; Nitta Gelatin, Osaka, Japan). In brief, collagen was mixed with 10-fold concentrated DMEM/F12 medium and 50 mM NaOH containing 260 mM NaHCO3 and 200 mM HEPES at a proportion of 8:1:1 (vol/vol/vol) at 4°C. Then a 0.2-mL aliquot of the solution was placed in the center of each well of a six-well cell culture cluster (Corning Inc., Corning, NY) and allowed to polymerize at 37°C for 30 minutes in a cloning ring 10 mm in diameter (Asahi Techno Glass). Cells cultured in medium containing 10% FBS were harvested and suspended at 2 × 105 cells/mL. Eighty-five micrometers of the cell suspension was applied to a polymerized collagen gel and incubated overnight in a 37°C 5% CO2 incubator. On day 1, the cloning ring was removed, and 2.5 mL of 10% FBS-containing medium was added to each well to submerge the cells. To examine TGF-β-dependent collagen gel contraction, TGF-β was added at a 0.1- or 1-ng/mL final concentration. As an inhibitor, an anti-TGF-β antibody (0.1 ng/mL) was also added in the medium for selected dishes. FBS-containing media with or without TGF-β and/or TGF-β antibody were changed on day 3. Gel thickness was measured on day 5 with an inverted phase-contrast microscope, by adjusting the plane of focus from the bottom to the top of the gel and recording the distance that the stage had been moved. 
Data are expressed as the mean ± SD. Post hoc comparisons between groups was performed with the Tukey procedure. Differences were considered significant at P < 0.01. 
Results
Sphere Formation from Stromal Cells
More than five mice were used to prepare corneal stromal cells in each experiment. From 10 corneas, 1.32 ± 0.16 × 104 cells (n = 3) were isolated, and subcultured cells proliferated into spheres, to yield an average of 7.97 ± 0.35 × 107 cells per 75 cm2 flask (n = 6) after four passages (P4). Sphere cells were propagated for >12 passages through 5 months without loss of viability. To avoid contamination of epithelial and endothelial cells, stromal discs were carefully prepared as described in the Materials and Methods sections. Dissociated cells from mouse stromal discs formed spheres when cultured in serum-free medium containing EGF and FGF2 (Fig. 1A , left). To exclude the possibility that spheres may have originated from contaminating epithelial cells, we first performed primary cultures of mouse corneal discs, with or without dispase treatment, followed by epithelium separation. K-SFM with low Ca2+ was used to examine epithelial expansion. 48 49 When untreated discs were cultured, migration of epithelial and stromal cells was observed in K-SFM and in DMEM/F12 containing 10% FBS, respectively (Fig. 1B , left). There were no epithelial cells migrating from dispase-treated discs in both media, whereas fibroblasts migrated from the discs in DMEM/F12 with serum (Fig. 1B , right). We further cultured dissociated epithelial cells under conditions that allowed stromal spheres to form by 14 days. As a result, no spheres were observed in the epithelial cell culture (Fig. 1A , right). To demonstrate whether the spheres were hollow or solid, confocal microscopy of 4′,6′-diamino-2-phenylindole (DAPI)-stained spheres was performed. Imaging in different focal planes showed that the inside of spheres was filled with cells, not hollow (Fig. 1C)
We then examined the expression of epithelial and stromal markers in primary and subcultured spheres (P10) by RT-PCR. Stromal markers examined were the proteoglycans, keratocan, and lumican, 13 14 50 51 as well as CD34, which was recently reported to be expressed in keratocytes. 52 53 54 As shown in Figures 2A and 2B , in addition to the mesenchymal intermediate filament vimentin, the expression of the genes described earlier were detected in the stromal spheres. On the contrary, K12 and Pax6, both of which are expressed in corneal epithelium, 40 42 55 56 57 58 were not detected in sphere cells (Fig. 2A)
Immunocytochemical analysis of spheres did not detect K12 and Pax6 expression (not shown), whereas vimentin staining was positive (Fig. 2C) . These results show that sphere cells were of stromal, not epithelial, origin. 
Characteristics of Sphere Cells
Sphere cells plated on collagen I-coated dishes in serum-free medium exhibited a dendritic morphology consistent with keratocytes (Fig. 3A) . 3 4 5 6 7 8 9 10 RT-PCR showed that expression of keratocan and Aldh were retained under these conditions (Fig. 4) . In contrast, the morphology of sphere cells subcultured in 10% serum were fibroblastic, and the expression of these genes was not detected (Fig. 4) . Corneal sphere cells further differentiated to express α-SMA after exposure to TGF-β, which is consistent with the myofibroblast phenotype (Figs. 3C 3D) . Furthermore, when cells were subcultured on collagen gels in the presence of TGF-β, fibroblast-mediated gel contraction was observed (Fig. 5) . Without TGF-β, contraction to 68.5% ± 1.75% of the original gel thickness was observed, whereas contraction was enhanced to 50.2% ± 3.96% or 29.4% ± 1.96% of the original thickness in the presence of 0.1 ng/mL or 1 ng of TGF-β, respectively (P < 0.01). TGF-β-dependent contraction was reduced to control levels when anti-TGF-β antibody was added to the medium. 
Discussion
We successfully isolated and subcultured sphere-forming cells from the mouse corneal stroma, yielding a multifold increase in available cells for further experiments. Zhao et al. 40 have reported that cells present in limbus-derived spheres are derived from the limbal epithelium but not the stroma. However, the corneal sphere cells that we isolated did not express the epithelial markers K12 or Pax6 throughout the study, and furthermore, exhibited properties of corneal keratocytes when subcultured in serum-free medium. The morphology of the subcultured cells as shown in Figure 3was similar to that of keratocytes in situ, and together with the expression of keratocan, lumican, Aldh, and CD34 in the subcultured cells, the collective evidence shows that these cells were of keratocyte origin. Although most genes were expressed during sphere cultures and maintained after adhesion to plastic dishes, keratocan, and Aldh were exclusively expressed in the keratocyte phenotype in serum-free medium (Fig. 4) . Although the biological role of Aldh is not known, abundant expression of the water-soluble enzyme was shown to be expressed in the keratocyte phenotype, but not by the fibroblasts or myofibroblasts. 32 59  
Plated sphere cells can further be induced to differentiate into the fibroblast and myofibroblast phenotypes. Sphere cells seeded onto plastic in the presence of 10% serum exhibited the morphology and properties of stromal fibroblasts. 28 The transition to α-SMA-positive myofibroblasts by exposure to TGF-β, causing collagen gel contraction (Fig. 5) , is also a functional property of stromal fibroblast primary cultures. 29 43 60 Therefore, subcultured sphere cells can be conditioned to express all three known phenotypes of keratocytes after expansion by sphere culture. Berryhill et al. 36 reported that the fibroblast phenotype can be partially restored to the keratocyte phenotype in terms of extracellular matrix production and morphology. However, biological functions, including Aldh activity, were not restored, suggesting that reversal to keratocyte phenotype after mass culture in serum-containing medium is not practical. Espana et al. 41 have reported the use of amniotic membrane (AM) as a substrate for keratocyte cultures in the presence of serum. They have shown that even with the use of serum, primary keratocytes maintained dendritic morphology on AM. The expression of keratocan and lumican was also present for up to five passages, which is a significant improvement over previous reports using artificial substrates. Still, the scarcity of keratocytes in tissue usually necessitates the use of human tissue or cells from larger animals, such as cows, 28 36 rabbits, 30 and rhesus monkeys. 61 Biochemical and molecular analysis of such cells are difficult due to the lack of available antibodies and genomic information. 
During subcultures of spheres, cells that failed to form spheres were found attached to the dish as nondividing, fibroblast-like cells (data not shown). Although these cells may have had low viability, there may be a selection process that allows only cells with high growth potential to propagate as spheres. Once secondary spheres are successfully initiated, subsequent passages continue to produce spheres for at least 12 passages, the longest that we observed. To our surprise, cells from later passages continued to show the keratocyte phenotype when subcultured on plastic, suggesting the possible presence of committed progenitor cells during the sphere culture stage. Many aspects of the keratocyte are still not understood, and the availability of cells from the mouse cornea should be a powerful tool in studying the biology of these cells. 
 
Table 1.
 
PCR Primers
Table 1.
 
PCR Primers
Gene Primer Sequence (5′–3′) Product Size (bp) GenBank Accession ID
Cytokeratin K12 Forward: TCCTCCTGCAGATTGACAACG 511 NM_010661
Reverse: TTCCAGGGACGACTTCATGG
Pax6 Forward: AGTTCTTCGCAACCTGGCTA 500 NM_013627
Reverse: TGAAGCTGCTGCTGATAGGA
Keratocan Forward: AGGATGCCTTCATTCACGGAC 491 NM_008438
Reverse: GCTCATTGTGGTGCTTATGGGG
Lumican Forward: TGCTGTCTCGGCTTCTCTGAAAG 567 NM_008524
Reverse: AACATCCCCCACATTCCCAACC
CD34 Forward: CCTTATTACACGGAGAATGGTGGAG 477 NM_133654
Reverse: AAGAGGCGAGAGAGGAGAAATGGG
Vimentin Forward: GAACGGAAAGTGGAATCCTTGC 591 NM_011701
Reverse: GGTTGGCAGAGGCAGAGAAATC
Aldh Forward: CTTCCAGCGGGTCATAAATCTG 528 NM_007436
Reverse: AGCCAGCAAAACAAGTGTCAGG
Gapd Forward: GACCACAGTCCATGCCATCAC 453 NM_008084
Reverse: TCCACCACCCTGTTGCTGTAG
Figure 1.
 
Sphere cells derived from the mouse corneal stroma. (A) Mouse corneal stroma and epithelium were separated by dispase treatment. Cells were cultured in DMEM/F12 supplemented with EGF and FGF2. After 7days’ culture, spheres formed from stromal cells, but not from epithelial cells. (B) Mouse corneal discs were cultured in K-SFM or DMEM/F12 with 10% FBS. Epithelial cells migrated from intact corneal discs in K-SFM (top left) but not from dispase-treated (denuded) discs (top right). Expanding fibroblastic cells were still observed after dispase treatment. (C) Confocal images of the sphere in two different focal planes, a and b, as shown schematically (left). Blue: DAPI-stained nuclei. Scale bar: (A) 50 μm; (B) 100 μm; (C) 10 μm.
Figure 1.
 
Sphere cells derived from the mouse corneal stroma. (A) Mouse corneal stroma and epithelium were separated by dispase treatment. Cells were cultured in DMEM/F12 supplemented with EGF and FGF2. After 7days’ culture, spheres formed from stromal cells, but not from epithelial cells. (B) Mouse corneal discs were cultured in K-SFM or DMEM/F12 with 10% FBS. Epithelial cells migrated from intact corneal discs in K-SFM (top left) but not from dispase-treated (denuded) discs (top right). Expanding fibroblastic cells were still observed after dispase treatment. (C) Confocal images of the sphere in two different focal planes, a and b, as shown schematically (left). Blue: DAPI-stained nuclei. Scale bar: (A) 50 μm; (B) 100 μm; (C) 10 μm.
Figure 2.
 
Sphere cells express keratocyte markers. (A, B) Total RNA was prepared from epithelial, stromal, and sphere cells. RT-PCR was performed with gene-specific primers. The epithelial markers K12 and Pax6 were not detected in the spheres (A). In contrast, the keratocyte markers keratocan, lumican, and CD34 were detected (B). Immunocytochemical analysis showed expression of the mesenchymal marker, vimentin, in spheres (C). Blue: nuclei of cells counterstained with DAPI. Scale bar, 50 μm.
Figure 2.
 
Sphere cells express keratocyte markers. (A, B) Total RNA was prepared from epithelial, stromal, and sphere cells. RT-PCR was performed with gene-specific primers. The epithelial markers K12 and Pax6 were not detected in the spheres (A). In contrast, the keratocyte markers keratocan, lumican, and CD34 were detected (B). Immunocytochemical analysis showed expression of the mesenchymal marker, vimentin, in spheres (C). Blue: nuclei of cells counterstained with DAPI. Scale bar, 50 μm.
Figure 3.
 
Phenotype of corneal stromal sphere cells stained by calcein-AM. Dissociated sphere cells were dendritic in SFM (A) and fibroblastic in adherent culture with medium containing 10% FBS (B). In the presence of TGF-β, morphology of adherent cells became myofibroblastic (C), and the cells expressed α-SMA, detected by immunocytochemistry (D, green). Blue: nuclei of cells counterstained with DAPI. Scale bar, 50 μm.
Figure 3.
 
Phenotype of corneal stromal sphere cells stained by calcein-AM. Dissociated sphere cells were dendritic in SFM (A) and fibroblastic in adherent culture with medium containing 10% FBS (B). In the presence of TGF-β, morphology of adherent cells became myofibroblastic (C), and the cells expressed α-SMA, detected by immunocytochemistry (D, green). Blue: nuclei of cells counterstained with DAPI. Scale bar, 50 μm.
Figure 4.
 
RT-PCR analysis of keratocyte markers expressed in sphere cells subcultured on plastic. Keratocan and Aldh were expressed only in cells in SFM, whereas lumican, CD34, and vimentin were also detected in cells cultured in the presence of 10% FBS.
Figure 4.
 
RT-PCR analysis of keratocyte markers expressed in sphere cells subcultured on plastic. Keratocan and Aldh were expressed only in cells in SFM, whereas lumican, CD34, and vimentin were also detected in cells cultured in the presence of 10% FBS.
Figure 5.
 
Collagen gel contraction assay of fibroblasts. Mouse corneal spheres were allowed to differentiate in 10% serum-containing medium. Dose-dependent TGF-β-induced collagen gel contraction was observed, which was inhibited by an anti-TGF-β antibody (*P < 0.01).
Figure 5.
 
Collagen gel contraction assay of fibroblasts. Mouse corneal spheres were allowed to differentiate in 10% serum-containing medium. Dose-dependent TGF-β-induced collagen gel contraction was observed, which was inhibited by an anti-TGF-β antibody (*P < 0.01).
The authors thank Kimie Katoh for technical assistance and all members of the Cornea Center Laboratory for helpful suggestions. 
BardJB, HayED. The behavior of fibroblasts from the developing avian cornea: morphology and movement in situ and in vitro. J Cell Biol. 1975;67:400–418. [CrossRef] [PubMed]
LwigalePY, ConradGW, Bronner-FraserM. Graded potential of neural crest to form cornea, sensory neurons and cartilage along the rostrocaudal axis. Development. 2004;131:1979–1991. [CrossRef] [PubMed]
PooleCA, BrookesNH, CloverGM. Confocal imaging of the human keratocyte network using the vital dye 5-chloromethylfluorescein diacetate. Clin Exp Ophthalmol. 2003;31:147–154. [CrossRef]
PooleCA, BrookesNH, CloverGM. Keratocyte networks visualised in the living cornea using vital dyes. J Cell Sci. 1993;106:685–691. [PubMed]
PooleCA, BrookesNH, CloverGM. Confocal imaging of the keratocyte network in porcine cornea using the fixable vital dye 5-chloromethylfluorescein diacetate. Curr Eye Res. 1996;15:165–174. [CrossRef] [PubMed]
JesterJV, BarryPA, LindGJ, PetrollWM, GaranaR, CavanaghHD. Corneal keratocytes: in situ and in vitro organization of cytoskeletal contractile proteins. Invest Ophthalmol Vis Sci. 1994;35:730–743. [PubMed]
ZieskeJD, GuimaraesSR, HutcheonAE. Kinetics of keratocyte proliferation in response to epithelial debridement. Exp Eye Res. 2001;72:33–39. [CrossRef] [PubMed]
HahnelC, SomodiS, SlowikC, WeissDG, GuthoffRF. Fluorescence microscopy and three-dimensional imaging of the porcine corneal keratocyte network. Graefes Arch Clin Exp Ophthalmol. 1997;235:773–779. [CrossRef] [PubMed]
WatskyMA. Keratocyte gap junctional communication in normal and wounded rabbit corneas and human corneas. Invest Ophthalmol Vis Sci. 1995;36:2568–2576. [PubMed]
UedaA, NishidaT, OtoriT, FujitaH. Electron-microscopic studies on the presence of gap junctions between corneal fibroblasts in rabbits. Cell Tissue Res. 1987;249:473–475. [PubMed]
CarlsonEC, WangIJ, LiuCY, BrannanP, KaoCW, KaoWW. Altered KSPG expression by keratocytes following corneal injury. Mol Vis. 2003;9:615–623. [PubMed]
MichelacciYM. Collagens and proteoglycans of the corneal extracellular matrix. Braz J Med Biol Res. 2003;36:1037–1046. [CrossRef] [PubMed]
KaoWW, LiuCY. Roles of lumican and keratocan on corneal transparency. Glycoconj J. 2002;19:275–285. [CrossRef] [PubMed]
LiuCY, BirkDE, HassellJR, KaneB, KaoWW. Keratocan-deficient mice display alterations in corneal structure. J Biol Chem. 2003;278:21672–21677. [CrossRef] [PubMed]
DunlevyJR, BealesMP, BerryhillBL, CornuetPK, HassellJR. Expression of the keratan sulfate proteoglycans lumican, keratocan and osteoglycin/mimecan during chick corneal development. Exp Eye Res. 2000;70:349–362. [CrossRef] [PubMed]
FunderburghJL, CatersonB, ConradGW. Distribution of proteoglycans antigenically related to corneal keratan sulfate proteoglycan. J Biol Chem. 1987;262:11634–11640. [PubMed]
HassellJR, CintronC, KublinC, NewsomeDA. Proteoglycan changes during restoration of transparency in corneal scars. Arch Biochem Biophys. 1983;222:362–369. [CrossRef] [PubMed]
SundarrajN, FiteD, BelakR, et al. Proteoglycan distribution during healing of corneal stromal wounds in chick. Exp Eye Res. 1998;67:433–442. [CrossRef] [PubMed]
MatsudaH, SmelserGK. Electron microscopy of corneal wound healing. Exp Eye Res. 1973;16:427–442. [CrossRef] [PubMed]
CintronC, HassingerLC, KublinCL, CannonDJ. Biochemical and ultrastructural changes in collagen during corneal wound healing. J Ultrastruct Res. 1978;65:13–22. [CrossRef] [PubMed]
GaranaRM, PetrollWM, ChenWT, et al. Radial keratotomy. II. Role of the myofibroblast in corneal wound contraction. Invest Ophthalmol Vis Sci. 1992;33:3271–3282. [PubMed]
FiniME. Keratocyte and fibroblast phenotypes in the repairing cornea. Prog Retin Eye Res. 1999;18:529–551. [CrossRef] [PubMed]
JesterJV, PetrollWM, BarryPA, CavanaghHD. Expression of alpha-smooth muscle (alpha-SM) actin during corneal stromal wound healing. Invest Ophthalmol Vis Sci. 1995;36:809–819. [PubMed]
JesterJV, HuangJ, Barry-LanePA, KaoWW, PetrollWM, CavanaghHD. Transforming growth factor(beta)-mediated corneal myofibroblast differentiation requires actin and fibronectin assembly. Invest Ophthalmol Vis Sci. 1999;40:1959–1967. [PubMed]
PetrollWM, JesterJV, Barry-LanePA, CavanaghHD. Effects of basic FGF and TGF beta 1 on F-actin and ZO-1 organization during cat endothelial wound healing. Cornea. 1996;15:525–532. [PubMed]
PetridouS, MasurSK. Immunodetection of connexins and cadherins in corneal fibroblasts and myofibroblasts. Invest Ophthalmol Vis Sci. 1996;37:1740–1748. [PubMed]
JesterJV, Barry-LanePA, CavanaghHD, PetrollWM. Induction of alpha-smooth muscle actin expression and myofibroblast transformation in cultured corneal keratocytes. Cornea. 1996;15:505–516. [PubMed]
BealesMP, FunderburghJL, JesterJV, HassellJR. Proteoglycan synthesis by bovine keratocytes and corneal fibroblasts: maintenance of the keratocyte phenotype in culture. Invest Ophthalmol Vis Sci. 1999;40:1658–1663. [PubMed]
JesterJV, Ho-ChangJ. Modulation of cultured corneal keratocyte phenotype by growth factors/cytokines control in vitro contractility and extracellular matrix contraction. Exp Eye Res. 2003;77:581–592. [CrossRef] [PubMed]
MasurSK, DewalHS, DinhTT, ErenburgI, PetridouS. Myofibroblasts differentiate from fibroblasts when plated at low density. Proc Natl Acad Sci USA. 1996;93:4219–4223. [CrossRef] [PubMed]
LongCJ, RothMR, TashevaES, et al. Fibroblast growth factor-2 promotes keratan sulfate proteoglycan expression by keratocytes in vitro. J Biol Chem. 2000;275:13918–13923. [CrossRef] [PubMed]
FunderburghJL, MannMM, FunderburghML. Keratocyte phenotype mediates proteoglycan structure: a role for fibroblasts in corneal fibrosis. J Biol Chem. 2003;278:45629–45637. [CrossRef] [PubMed]
FunderburghJL, FunderburghML, MannMM, PrakashS, ConradGW. Synthesis of corneal keratan sulfate proteoglycans by bovine keratocytes in vitro. J Biol Chem. 1996;271:31431–31436. [CrossRef] [PubMed]
FunderburghJL, FunderburghML, MannMM, CorpuzL, RothMR. Proteoglycan expression during transforming growth factor beta-induced keratocyte-myofibroblast transdifferentiation. J Biol Chem. 2001;276:44173–44178. [CrossRef] [PubMed]
BerryhillBL, BealesMP, HassellJR. Production of prostaglandin D synthase as a keratan sulfate proteoglycan by cultured bovine keratocytes. Invest Ophthalmol Vis Sci. 2001;42:1201–1207. [PubMed]
BerryhillBL, KaderR, KaneB, BirkDE, FengJ, HassellJR. Partial restoration of the keratocyte phenotype to bovine keratocytes made fibroblastic by serum. Invest Ophthalmol Vis Sci. 2002;43:3416–3421. [PubMed]
ReynoldsBA, WeissS. Generation of neurons and astrocytes from isolated cells of the adult mammalian central nervous system. Science. 1992;255:1707–1710. [CrossRef] [PubMed]
ReynoldsBA, TetzlaffW, WeissS. A multipotent EGF-responsive striatal embryonic progenitor cell produces neurons and astrocytes. J Neurosci. 1992;12:4565–4574. [PubMed]
MilwardEA, LundbergCG, GeB, LipsitzD, ZhaoM, DuncanID. Isolation and transplantation of multipotential populations of epidermal growth factor-responsive, neural progenitor cells from the canine brain. J Neurosci Res. 1997;50:862–871. [CrossRef] [PubMed]
ZhaoX, DasAV, ThoresonWB, et al. Adult corneal limbal epithelium: a model for studying neural potential of non-neural stem cells/progenitors. Dev Biol. 2002;250:317–331. [CrossRef] [PubMed]
EspanaEM, HeH, KawakitaT, et al. Human keratocytes cultured on amniotic membrane stroma preserve morphology and express keratocan. Invest Ophthalmol Vis Sci. 2003;44:5136–5141. [CrossRef] [PubMed]
DavisJ, DuncanMK, RobisonWG, Jr, PiatigorskyJ. Requirement for Pax6 in corneal morphogenesis: a role in adhesion. J Cell Sci. 2003;116:2157–2167. [CrossRef] [PubMed]
NakamuraK. Interaction between injured corneal epithelial cells and stromal cells. Cornea. 2003;22:S35–S47. [CrossRef] [PubMed]
KurosakaH, KurosakaD, KatoK, MashimaY, TanakaY. Transforming growth factor-beta 1 promotes contraction of collagen gel by bovine corneal fibroblasts through differentiation of myofibroblasts. Invest Ophthalmol Vis Sci. 1998;39:699–704. [PubMed]
GuidryC, McFarlandRJ, MorrisR, WitherspoonCD, HookM. Collagen gel contraction by cells associated with proliferative vitreoretinopathy. Invest Ophthalmol Vis Sci. 1992;33:2429–2435. [PubMed]
AsagaH, KikuchiS, YoshizatoK. Collagen gel contraction by fibroblasts requires cellular fibronectin but not plasma fibronectin. Exp Cell Res. 1991;193:167–174. [CrossRef] [PubMed]
GuidryC, GrinnellF. Contraction of hydrated collagen gels by fibroblasts: evidence for two mechanisms by which collagen fibrils are stabilized. Coll Relat Res. 1987;6:515–529. [CrossRef] [PubMed]
BertoleroF, KaighnME, GondaMA, SaffiottiU. Mouse epidermal keratinocytes: clonal proliferation and response to hormones and growth factors in serum-free medium. Exp Cell Res. 1984;155:64–80. [CrossRef] [PubMed]
KawakitaT, EspanaEM, HeH, YehLK, LiuCY, TsengSC. Calcium-induced abnormal epidermal-like differentiation in cultures of mouse corneal-limbal epithelial cells. Invest Ophthalmol Vis Sci. 2004;45:3507–3512. [CrossRef] [PubMed]
LiuCY, ShiraishiA, KaoCW, et al. The cloning of mouse keratocan cDNA and genomic DNA and the characterization of its expression during eye development. J Biol Chem. 1998;273:22584–22588. [CrossRef] [PubMed]
CorpuzLM, FunderburghJL, FunderburghML, BottomleyGS, PrakashS, ConradGW. Molecular cloning and tissue distribution of keratocan: bovine corneal keratan sulfate proteoglycan 37A. J Biol Chem. 1996;271:9759–9763. [CrossRef] [PubMed]
EspanaEM, KawakitaT, LiuCY, TsengSC. CD-34 expression by cultured human keratocytes is downregulated during myofibroblast differentiation induced by TGF-beta1. Invest Ophthalmol Vis Sci. 2004;45:2985–2991. [CrossRef] [PubMed]
JosephA, HossainP, JhamS, et al. Expression of CD34 and L-selectin on human corneal keratocytes. Invest Ophthalmol Vis Sci. 2003;44:4689–4692. [CrossRef] [PubMed]
TotiP, TosiGM, TraversiC, SchurfeldK, CardoneC, CaporossiA. CD-34 stromal expression pattern in normal and altered human corneas. Ophthalmology. 2002;109:1167–1171. [CrossRef] [PubMed]
KoromaBM, YangJM, SundinOH. The Pax-6 homeobox gene is expressed throughout the corneal and conjunctival epithelia. Invest Ophthalmol Vis Sci. 1997;38:108–120. [PubMed]
LiuCY, ZhuG, Westerhausen-LarsonA, et al. Cornea-specific expression of K12 keratin during mouse development. Curr Eye Res. 1993;12:963–974. [CrossRef] [PubMed]
ShiraishiA, ConverseRL, LiuCY, ZhouF, KaoCW, KaoWW. Identification of the cornea-specific keratin 12 promoter by in vivo particle-mediated gene transfer. Invest Ophthalmol Vis Sci. 1998;39:2554–2561. [PubMed]
LiuJJ, KaoWW, WilsonSE. Corneal epithelium-specific mouse keratin K12 promoter. Exp Eye Res. 1999;68:295–301. [CrossRef] [PubMed]
JesterJV, Møller-PedersenT, HuangJ, et al. The cellular basis of corneal transparency: evidence for ‘corneal crystallins’. J Cell Sci. 1999;112:613–622. [PubMed]
StramerBM, ZieskeJD, JungJC, AustinJS, FiniME. Molecular mechanisms controlling the fibrotic repair phenotype in cornea: implications for surgical outcomes. Invest Ophthalmol Vis Sci. 2003;44:4237–4246. [CrossRef] [PubMed]
HassellJR, NewsomeDA, HascallVC. Characterization and biosynthesis of proteoglycans of corneal stroma from rhesus monkey. J Biol Chem. 1979;254:12346–12354. [PubMed]
Figure 1.
 
Sphere cells derived from the mouse corneal stroma. (A) Mouse corneal stroma and epithelium were separated by dispase treatment. Cells were cultured in DMEM/F12 supplemented with EGF and FGF2. After 7days’ culture, spheres formed from stromal cells, but not from epithelial cells. (B) Mouse corneal discs were cultured in K-SFM or DMEM/F12 with 10% FBS. Epithelial cells migrated from intact corneal discs in K-SFM (top left) but not from dispase-treated (denuded) discs (top right). Expanding fibroblastic cells were still observed after dispase treatment. (C) Confocal images of the sphere in two different focal planes, a and b, as shown schematically (left). Blue: DAPI-stained nuclei. Scale bar: (A) 50 μm; (B) 100 μm; (C) 10 μm.
Figure 1.
 
Sphere cells derived from the mouse corneal stroma. (A) Mouse corneal stroma and epithelium were separated by dispase treatment. Cells were cultured in DMEM/F12 supplemented with EGF and FGF2. After 7days’ culture, spheres formed from stromal cells, but not from epithelial cells. (B) Mouse corneal discs were cultured in K-SFM or DMEM/F12 with 10% FBS. Epithelial cells migrated from intact corneal discs in K-SFM (top left) but not from dispase-treated (denuded) discs (top right). Expanding fibroblastic cells were still observed after dispase treatment. (C) Confocal images of the sphere in two different focal planes, a and b, as shown schematically (left). Blue: DAPI-stained nuclei. Scale bar: (A) 50 μm; (B) 100 μm; (C) 10 μm.
Figure 2.
 
Sphere cells express keratocyte markers. (A, B) Total RNA was prepared from epithelial, stromal, and sphere cells. RT-PCR was performed with gene-specific primers. The epithelial markers K12 and Pax6 were not detected in the spheres (A). In contrast, the keratocyte markers keratocan, lumican, and CD34 were detected (B). Immunocytochemical analysis showed expression of the mesenchymal marker, vimentin, in spheres (C). Blue: nuclei of cells counterstained with DAPI. Scale bar, 50 μm.
Figure 2.
 
Sphere cells express keratocyte markers. (A, B) Total RNA was prepared from epithelial, stromal, and sphere cells. RT-PCR was performed with gene-specific primers. The epithelial markers K12 and Pax6 were not detected in the spheres (A). In contrast, the keratocyte markers keratocan, lumican, and CD34 were detected (B). Immunocytochemical analysis showed expression of the mesenchymal marker, vimentin, in spheres (C). Blue: nuclei of cells counterstained with DAPI. Scale bar, 50 μm.
Figure 3.
 
Phenotype of corneal stromal sphere cells stained by calcein-AM. Dissociated sphere cells were dendritic in SFM (A) and fibroblastic in adherent culture with medium containing 10% FBS (B). In the presence of TGF-β, morphology of adherent cells became myofibroblastic (C), and the cells expressed α-SMA, detected by immunocytochemistry (D, green). Blue: nuclei of cells counterstained with DAPI. Scale bar, 50 μm.
Figure 3.
 
Phenotype of corneal stromal sphere cells stained by calcein-AM. Dissociated sphere cells were dendritic in SFM (A) and fibroblastic in adherent culture with medium containing 10% FBS (B). In the presence of TGF-β, morphology of adherent cells became myofibroblastic (C), and the cells expressed α-SMA, detected by immunocytochemistry (D, green). Blue: nuclei of cells counterstained with DAPI. Scale bar, 50 μm.
Figure 4.
 
RT-PCR analysis of keratocyte markers expressed in sphere cells subcultured on plastic. Keratocan and Aldh were expressed only in cells in SFM, whereas lumican, CD34, and vimentin were also detected in cells cultured in the presence of 10% FBS.
Figure 4.
 
RT-PCR analysis of keratocyte markers expressed in sphere cells subcultured on plastic. Keratocan and Aldh were expressed only in cells in SFM, whereas lumican, CD34, and vimentin were also detected in cells cultured in the presence of 10% FBS.
Figure 5.
 
Collagen gel contraction assay of fibroblasts. Mouse corneal spheres were allowed to differentiate in 10% serum-containing medium. Dose-dependent TGF-β-induced collagen gel contraction was observed, which was inhibited by an anti-TGF-β antibody (*P < 0.01).
Figure 5.
 
Collagen gel contraction assay of fibroblasts. Mouse corneal spheres were allowed to differentiate in 10% serum-containing medium. Dose-dependent TGF-β-induced collagen gel contraction was observed, which was inhibited by an anti-TGF-β antibody (*P < 0.01).
Table 1.
 
PCR Primers
Table 1.
 
PCR Primers
Gene Primer Sequence (5′–3′) Product Size (bp) GenBank Accession ID
Cytokeratin K12 Forward: TCCTCCTGCAGATTGACAACG 511 NM_010661
Reverse: TTCCAGGGACGACTTCATGG
Pax6 Forward: AGTTCTTCGCAACCTGGCTA 500 NM_013627
Reverse: TGAAGCTGCTGCTGATAGGA
Keratocan Forward: AGGATGCCTTCATTCACGGAC 491 NM_008438
Reverse: GCTCATTGTGGTGCTTATGGGG
Lumican Forward: TGCTGTCTCGGCTTCTCTGAAAG 567 NM_008524
Reverse: AACATCCCCCACATTCCCAACC
CD34 Forward: CCTTATTACACGGAGAATGGTGGAG 477 NM_133654
Reverse: AAGAGGCGAGAGAGGAGAAATGGG
Vimentin Forward: GAACGGAAAGTGGAATCCTTGC 591 NM_011701
Reverse: GGTTGGCAGAGGCAGAGAAATC
Aldh Forward: CTTCCAGCGGGTCATAAATCTG 528 NM_007436
Reverse: AGCCAGCAAAACAAGTGTCAGG
Gapd Forward: GACCACAGTCCATGCCATCAC 453 NM_008084
Reverse: TCCACCACCCTGTTGCTGTAG
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×