September 2004
Volume 45, Issue 9
Free
Cornea  |   September 2004
Expression of Neuregulin 1, a Member of the Epidermal Growth Factor Family, Is Expressed as Multiple Splice Variants in the Adult Human Cornea
Author Affiliations
  • Donald J. Brown
    From the Department of Ophthalmology, College of Medicine, University of California at Irvine, Irvine, California.
  • Brian Lin
    From the Department of Ophthalmology, College of Medicine, University of California at Irvine, Irvine, California.
  • Bret Holguin
    From the Department of Ophthalmology, College of Medicine, University of California at Irvine, Irvine, California.
Investigative Ophthalmology & Visual Science September 2004, Vol.45, 3021-3029. doi:10.1167/iovs.04-0229
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Donald J. Brown, Brian Lin, Bret Holguin; Expression of Neuregulin 1, a Member of the Epidermal Growth Factor Family, Is Expressed as Multiple Splice Variants in the Adult Human Cornea. Invest. Ophthalmol. Vis. Sci. 2004;45(9):3021-3029. doi: 10.1167/iovs.04-0229.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

purpose. To determine whether neuregulin 1 (Nrg-1) is expressed in the normal adult human cornea.

methods. cDNA for Nrg-1 was obtained by direct amplification of RNA isolated from human corneal cell cultures. After sequencing, the likely exon/intron structure was determined by comparison to genomic sequence. RNA was purified from isolated corneal epithelium, corneal stroma, and primary cultures of both epithelial cells and stromal fibroblasts. Quantitative real-time polymerase chain reactions (qPCR) were performed to determine the overall levels of Nrg-1. A combination of fluorescent primers, restriction endonucleases, and image analysis was used to determine the proportion of each splice variant. Finally, the receptor family known to interact with Nrg-1 was examined to confirm its expression in corneal tissue.

results. RT-PCR and Western blot analyses demonstrated that Nrg-1 and its receptor are expressed in adult corneal tissue and cultured cells derived from this tissue. qPCR suggested that epithelial cells and stromal cells produce equivalent levels of Nrg-1, but distinct variants were present that differ in proportion with each source of RNA.

conclusions. Eight distinct forms of Nrg-1 were expressed in the adult human cornea that differ by the alternate use of four exons. This altered the predicted coding sequence in three domains of Nrg-1. These domains are known to direct ligand/receptor interaction and the trafficking, processing, and release of Nrg-1 from the cell. Finally, there was a preference of exon usage that varied by location in the cornea and this pattern changed when cells were placed into culture.

Neuregulins (Nrg) are paracrine, autocrine, and juxtacrine signaling peptides that belong to the epidermal growth factor (EGF) family. 1 Originally, the individual Nrgs were variously described as 1) a ligand for the oncogene ErbB2 2 3 4 ; 2) a glial growth factor 5 6 ; or 3) a factor that stimulates acetylcholine receptor synthesis in muscle. 7 It is now appreciated that these peptides with very distinct functions are all produced from a single gene, Nrg-1. Unlike other members of the EGF family, Nrg-1 is subject to extensive alternative splicing, giving rise to a rich and diverse number of distinct peptides. Nrg-1 produces at least 15 distinct proteins that are developmentally regulated and whose expression in the adult is restricted in a cell and tissue specific manner (extensively reviewed in Ref. 1 ). Nrg-1 variants differ in four distinct domains: 1) the N-terminal domain that dictates membrane orientation and glycosylation patterns; 2) the EGF-like domain that directs binding and affinity to the receptor; 3) the juxtamembrane region that is cleaved to release the factor from the cell membrane; and 4) the C-terminal domain that affects intracellular trafficking. Functionally, various products of this gene have been implicated in diverse biological processes ranging from embryogenesis, angiogenesis, breast cancer, nervous system development, myogenesis, gonadogenesis, and heart disease. 8 Indeed, knockout mice lacking the Nrg-1 gene die midway through gestation at day 10.5 with severe cardiac defects and a disruption in the maturation and migration of neural derived cell populations. 9  
As mentioned, Nrg-1 was originally isolated as a ligand for ErbB2, an oncogene and a member of the EGF receptor family of transmembrane receptor tyrosine kinases (RTK). However, further studies demonstrated that Nrg-1 interacts selectively with the related RTKs, ErbB3 and ErbB4. 10 11 12 After interaction with Nrg-1, these receptors form receptor homo- and heterodimers. 13 14 For both ErbB3 and ErbB4, ErbB2 is the preferred binding partner. The ability of these RTKs (which include the EGF receptor) to form both homo- and heterodimers alters the downstream effects of Nrg-1 binding. 15 Adding further complexity to this signaling pathway, is the observation that Nrg-1 peptides are expressed with differing EGF domains that have varying affinities for the RTKs. 10 11 12 This affects both the longevity and intensity of the signaling events downstream from the receptor. 1 16 Interestingly, mice containing knockouts of either ErbB3 or ErbB4 display partial and overlapping phenotypes with Nrg-1 knockout mice. 8 Collectively, these studies indicate that Nrg-1, acting through one or the other of these RTKs, plays a critical role in mammalian development. 
In the cornea, it has long been appreciated that EGF and perhaps more relevant, the EGF receptor (ErbB1) plays an important role in cell migration, proliferation, and synthesis of extracellular matrix and basement membrane components. 17 18 19 20 21 In corneal wound models, activation of ErbB1 is associated with accelerated healing. 10 11 12 22 However, clinical trials show that the exogenous addition of EGF to wounded corneas is of only limited benefit. 20 23 24 25 TGF alpha, another ErbB1 ligand, may not play a prominent role in wound healing, as knockout mice show no impairment in wound healing. 26 Other ErbB RTKs, including ErbB2, ErbB3, and ErbB4, are expressed in the mammalian cornea. 27 28 29 30 Given the ability of these RTKs to form heterodimers, it is possible that stimulation of EGFR after corneal wounding is mediated through the binding of other, additional ligands to ErbB3 and/or ErbB4. 
This report provides the first evidence that Nrg-1 is expressed in the adult human cornea. The splice variants produced in both the epithelium and stroma were characterized, demonstrating that the pattern of exon usage varies by location in the cornea. Accepting that cultured stromal fibroblasts resemble activated fibroblasts in the wounded cornea, 31 32 33 34 it was suggested that the form of Nrg-1 produced changes with keratocyte activation. Further, as interest in Nrg-1 was initiated by preliminary studies examining differential gene expression between normal and keratoconus corneas, the hypothesis was made that Nrg-1, similar to its role in other systems, may prove to be important in corneal homeostasis, wound healing, and other disorders. 
Materials and Methods
Fresh autopsy corneas stored under Optisol (Bausch & Lomb Surgical, San Dimas, CA) were received within 24 hours postmortem from the National Disease Research Interchange (Philadelphia, PA). In this study, 12 corneas were used from donors ranging in age from 14 years to 59 years. After receipt, some corneas were used to establish corneal fibroblast cultures. Briefly, corneas were incubated in Hank’s balanced salt solution (HBSS) for 15 minutes before Descemet’s membrane was peeled away from the cornea. The remainder was placed in Dispase Protease II (Worthington Biochemical Corp., Lakewood, NJ) for 15 minutes at 37°C. The epithelium was removed. The stroma was minced and placed into minimal essential media (MEM)/10% fetal bovine serum (FBS) with bacterial collagenase (1 mg/mL) and hyaluronidase (2.5 mg/mL; all from Invitrogen Corp., Carlsbad, CA) at 37°C. Cells were recovered by centrifugation and cultured in MEM with 10% FBS. 
Corneoscleral rims with the central cornea removed during surgery were obtained as excess donor material from penetrating keratoplasty. The rims were divided with a scalpel into 16 pie-shaped pieces. Two pieces of rim were placed on a 60 × 15 mm collagen type I coated culture dish (Becton Dickinson Labware, Franklin Lakes, NJ), with the addition of 2.5 mL serum free keratinocyte medium (Gibco Invitrogen Corp., Carlsbad, CA) supplemented with recombinant epidermal growth factor (EGF, 5 ng/mL) and bovine pituitary extract (BPE, 50 μg/mL) to each dish. The tissues were incubated at 37°C at 5% CO2 in a tissue culture incubator. The tissues were evaluated every 3 days by standard light microscopy and a 70% change of the media was done every 3 days. After 7 to 10 days, the cells were approximately 80% confluent. The culture media was then discarded and the cells were rinsed with HBSS and subcultured using 0.2% Trypsin EDTA (Sigma, St. Louis, MO). 
Other corneas were rinsed immediately with cold PBS-EDTA buffer, trephined with an 8-mm disposable trephine and snap frozen under liquid nitrogen. Alternatively, the central cornea was dissected under a dissecting microscope and the epithelium, endothelium, and stroma were collected and snap frozen individually. After freezing, the tissues were crushed under liquid nitrogen with the use of a mortar and pestle. The powders were collected and stored frozen at −80°C until use. 
RNA Extraction
The frozen tissue powders or cells were placed in Trizol (Invitrogen Corp.) and then thawed on ice. This was then homogenized at maximum speed using a Polytron Tissue Disrupter (Brinkmann Instruments, Westbury, NY) for 5 minutes. Chloroform was added (to 20% of the volume) and the phases were broken by centrifugation. The aqueous phase was collected, linear acrylamide was added to 10 μg/mL (as carrier), and the RNA was precipitated by the addition of 0.5 volumes of isoproponal. The RNA was recovered by centrifugation at 4°C, and the pellet washed with 75% ethanol. The pellet was air dried, resuspended in buffer and processed over RNeasy columns (Qiagen, Valencia, CA). The RNA was eluted from the silica column with 50 μL water, and 10 μg of linear acrylamide was added. The solution was adjusted with 2 M sodium acetate (pH 5.0) to 10% volume and precipitated with 2.5 volumes of ethanol. The RNA was recovered by centrifugation, washed with 75% ethanol, and resuspended in 11 μL of water. One microliter of the product was analyzed using an Agilent 2100 Bioanalyzer (Agilent, Palo Alto, CA) using the nano-RNA protocol to verify both the quantity and quality of the RNA. 
cDNA Synthesis and Polymerase Chain Reaction
The RNA obtained from cultured cells was converted to cDNA using the Smart synthesis protocol (Clontech, Palo Alto, CA, and Refs. 35 , 36 ). The RNA yield from the dissected corneal layers was low (<1 μg). For these samples, 500 ng of RNA were reverse transcribed in 50 μL reaction volume containing 500 μM deoxyribonucleoside triphosphate, 2.5 μM random decamer primers, 20 U RNase inhibitor, and 200 U SuperScript II reverse transcriptase (Invitrogen Corp.). Reactions were carried out for 10 minutes at 25°C, 1 hour at 42°C, and 5 minutes at 95°C, followed by cooling to 4°C. After synthesis, the cDNA from all sources was diluted to equivalent input RNA levels with TE (10 mM Tris-Cl, 1 mM EDTA [pH 7.5]; 10 ng input RNA/μL) and stored at −20°C until use. 
cDNA samples were subjected to PCR using specific primers (Table 1) . Primers were designed using Primer 3 Internet software program (The Whitehead Institute, Cambridge, MA), and their specificities were confirmed by a BLAST Internet software-assisted search of the nonredundant nucleotide sequence database (National Library of Medicine, Bethesda, MD). 
Polymerase chain reactions were carried out with 5–25 ng reverse-transcribed RNA, Taq polymerase buffer (200 μM deoxyribonucleoside triphosphates, 1.25 U Taq polymerase (Invitrogen), and 200 nM forward and reverse primers, in a total volume of 50 μL. For long accurate PCR amplification of full length Nrg-1, Advantage Taq polymerase (Clontech) was used. For quantitative real time PCR (qPCR), samples were normalized by β2-MG amplification and were amplified using the QuantiTect SYBR Green reagents (Qiagen) and fivefold serial cDNA dilutions in triplicate using an MJ Research Opticon Thermal Cycler (MJ Research, Inc., Waltham, MA). PCR controls without reverse transcriptase (water control) or with normal human genomic DNA as a template were routinely negative. 
Sequencing
Amplified products were separated by electrophoresis in 2% agarose gels and visualized under ultraviolet light after staining with ethidium bromide. The specific bands produced by all amplifications presented here were excised from the gel and the DNA extracted using Qiagen spin columns. Isolated DNA was then submitted to the core facility for sequencing. Products obtained by long accurate PCR were also resolved on agarose gels, extracted, and then used in a ligation reaction with pGem-T Easy vector (Promega, Madison, WI) using the manufacturer’s recommendations and reagents. Individual bacterial colonies were isolated and propagated before DNA isolation for sequencing. 
Western Blot Analysis
Normal corneal fibroblast cultures (n = 4) and powdered extracts of corneal epithelium and stroma (n = 2) were directly extracted in 500 μL of immunoprecipitation (IP) buffer, 37 centrifuged at 4°C for 30 minutes, and then frozen at −70°C. Equal amounts of protein, as determined by the BCA protein assay kit (Pierce, Rockford, IL), were electrophoresed on precast 4–20% Tris-glycine sodium dodecyl sulfate polyacrylamide (SDS-PAGE) gels (Invitrogen). As a positive control, MCF-7 cell lysate, containing neuregulin (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) was also run on some gels. Protein was transferred to polyvinylidene difluoride membrane (Bio-Rad, Hercules, CA) and analyzed using a polyclonal antibody to neuregulin (C-20; Santa Cruz Biotechnology, Inc.) or the antibody mixed with a fivefold (W/W) excess of blocking peptide (Santa Cruz Biotechnology, Inc.). The blots were blocked overnight with 5% bovine serum albumin, Tris-saline, and 0.5% Tween 20. Primary antibody (1 μg/mL) or antibody/peptide mixture was applied and incubated at 4°C overnight. Blots were washed with Tris-Tween-saline (TTBS) and incubated for 1 hour with alkaline phosphatase conjugated goat anti-rabbit IgG antibody (1:5000). Blots were developed with Immuno-Star chemiluminescent substrate buffer (Bio-Rad). 
Results
Analysis of nucleic acid arrays using RNA from both normal and keratoconus corneas suggested that both Nrg-1 and ErbB3 mRNA were differentially expressed (data not shown). As the Nrg-1 gene gives rise to multiple splice variants, primers were designed to amplify a region present in all published splice variants. When RT-PCR was performed using RNA isolated from normal and keratoconus fibroblast cultures, no differences in the level of transcript were apparent (Fig. 1) . However, these results did suggest that these cultures were producing neuregulin 1 transcripts. 
To examine whether these cultures also produced neuregulin protein, primary corneal fibroblast cultures were examined by Western blot analysis using a polyclonal antibody to a specific peptide of Nrg-1. As seen in Figure 2A , the antibody recognized a band of the expected size migrating very near the 50 kDa marker in stromal fibroblast cell lysates. Preincubation of the antibody with the peptide used as an immunogen abolished this band (Fig. 2B) , suggesting that this band was related to neuregulin. Figure 2C demonstrates that direct lysates of either cells scraped from the corneal surface (epithelium) or extracts of the corneal stroma also demonstrated staining of a protein band migrating near the 50 kDa marker. These data strongly suggest that corneas contain neuregulin, and cultured stromal fibroblasts continue to express this protein in primary cultures. 
Neuregulin growth factor has never been described in corneal tissues. As a large number of variants are expressed in a tissue specific pattern, full-length cDNA clones were isolated from the primary cultures for further analysis. Primers were designed to encompass the entire coding region of neuregulin and long accurate PCR was performed on full-length cDNAs produced using the Smart cDNA synthesis system. As seen in Figure 3 , fibroblast cultures from normal, keratoconus, and bullous keratopathy corneas all produced PCR products of the expected size. Not surprisingly, given the splice variants reported in the literature, two prominent bands of ∼1.9 kb were obtained. These bands were excised from the agarose gels and subcloned into the pGem-T Easy vector. Individual colonies were isolated and sequenced. Sequence analysis of these clones indicated that multiple splice variants were present in the fibroblast cultures. Using the Blast algorithm (www.ncbi.nlm.nih.gov) to query genomic sequences yielded the apparent exon structure for each cDNA (Fig. 4) . These analyses indicated that four exons were alternately used, depicted as exons A-D in the schematic. Examination of the predicted protein sequences of these cDNAs (Fig. 5) indicated that all the clones contained long open reading frames. Differences between the clones led to predicted changes in three regions of the protein: the EGF domain, the N-terminal juxtamembrane domain containing the cleavage site, and the length of the cytoplasmic tail. All the cDNAs contain an Ig-like domain and a transmembrane domain. 
While these results are interesting, it is well accepted that corneal stromal cells placed into culture with serum become activated and no longer represent the normally quiescent cells found in the cornea. 31 32 33 34 To assess the in vivo expression of Nrg-1, primers were designed to span exons 6 through 10 (as designated in Fig. 4 ). Using qPCR and beta 2 microglubulin as an internal standard, samples of isolated corneal epithelium (n = 4), corneal stroma (n = 4), and primary explant cultures of epithelium and cultured stromal fibroblasts (n = 3) were assayed in triplicate at two different dilutions. Unless otherwise noted, these RNA sources were assessed in all experiments described in this manuscript. The qPCR data (Table 2) showed no significant differences in the overall quantity of Nrg-1 among these groups. This suggests that the overall expression level was similar between corneal epithelial cells and stromal keratocytes in the cornea, and the level of expression was not significantly changed by placing these cells into primary cultures. 
The cDNA evidence, however, clearly indicated that splice variants were produced by cultured stromal fibroblasts. To test whether similar variants were present in the cornea, primers were designed to amplify the region specifically from either exon A or B to exon 10 from each of the samples. Other primers were designed to amplify the region from exon 10 to exon 14 to test for the presence of the alternate exon D. Figure 6 shows a representative gel of the results of these amplifications using cDNA from cultured fibroblasts. Often two prominent bands were visible (note lanes marked 7B-10 and 10–14), suggesting the presence of splice variants in the cDNA sample. All samples generated specific products with these primer pairs, although the apparent intensities and presence of additional bands varied between samples (not shown). These data suggest that multiple transcripts were present in each of the samples and that many permutations of splicing could be present in the cDNA. 
Having established that multiple splice variants of Nrg-1 were present in both the corneal epithelium and stroma, the relative proportion of each splice variant was measured. To assess this, fluorescent primers to exons A and B with a similar Tm (64.2 and 64.9, respectively) were designed. The fluorescent intensities of both primers were indistinguishable over a range of molarities (not shown). The primers were then used to amplify the cDNA with a downstream primer located in exon 14 and a cycle number representing the mid log-linear phase of amplification (determined in qPCR experiments). The products of this amplification were isolated by phenol/chloroform extraction and ethanol precipitation. The isolated DNA products were then aliquoted and either digested with 5 units of ApoI (representing a unique restriction site in the exon designated as C in Fig. 4 ), BglII (representing a unique site in the exon designated as D in Fig. 4 ), or mock digested overnight at 37°C. The products were then run on agarose gels and the size and fluorescent intensities of the products recorded. As exons C and D contain unique restriction sites for ApoI and BglII, respectively, a loss of fluorescent signal after restriction digestion could indicate the presence of these exons. Figure 7 shows a representative gel of the results obtained using this approach for one sample of cDNA obtained from a primary stromal fibroblast culture. As seen, both fluorescent primer pairs gave rise to multiple bands. After restriction digestion with the indicated endonucleases, the intensity of specific bands was reduced, whereas other bands retained the fluorescent signal. This suggested that the reduction in band intensity correlated with the presence of a specific exon in the context of the other exons located between the primers. 
This methodology therefore appeared useful for estimating the frequency of a particular exon within the linear context of other exons. All samples were examined by this technique and the fluorescent intensities were analyzed using an FMBio III imaging station (Hitachi Genetic Systems, Alameda, CA). The data were extracted and each variant form was normalized as a percent of the total fluorescence obtained for each sample before restriction. Table 3 indicates the estimates obtained by these analyses for the frequency of transcripts containing these alternatively used exons. Table 4 indicates the frequency estimates for each of the eight transcript permutations. Transcripts isolated from corneal epithelium and explant cultures of epithelium were similar to each other, though exon D was included more frequently in transcripts isolated from the cultured cells. The most striking aspect of these data was the clear preference for exon B inclusion in transcripts from corneal stroma while transcripts from cultured fibroblasts included all these exons in near equal proportions. 
ErbB3 and ErbB4 were demonstrated to be the specific receptors for neuregulin. 10 11 12 Since neuregulin-1 transcripts were expressed equally well in both stromal and epithelial tissues, whether these tissues also expressed RNA for its receptor was examined. Primers were designed to amplify ErbB1, ErbB2, and ErbB3. Representative results of these amplifications for epithelial and stromal tissue extracts and primary cultures derived from these tissues are shown in Figure 8 . These RTKs were present in corneal extracts of epithelium and stroma, as well as epithelial explant cultures. In contrast, cultured stromal fibroblasts show products for ErbB1 and ErbB2, with little product detected for ErbB3. Three different primer pairs were also designed for ErbB4 to evaluate its expression in these samples. No specific product was seen for these primers in any of the samples (data not shown), suggesting that this RTK is either absent or expressed at very low levels. 
Discussion
It has been appreciated for a number of years that the mammalian cornea expresses RTKs of the EGF family. Multiple studies showed that in various mammalian species, ErbB1, ErbB2, ErbbB3, and ErbB4 are distributed in the anterior eye. 27 28 29 30 The signaling potential for these RTKs are complex and regulated in part by the observation that receptor activation and trafficking is dependent on their ability to form both homo- and heterodimers after ligand binding. 13 14 The present study showed that the adult human cornea expresses RNA for ErbB1, ErbB2, and ErbB3, confirming the results of Liu et al. 29 30 However, our results suggest that these receptors are also expressed in stromal cells; earlier studies concluded that they are restricted to the ocular surface. 27 28 29 30 While ErbB1 activation has been closely linked with corneal epithelial cell migration and proliferation, these other family members have received little attention. ErbB2 is often referred to as an orphan receptor having no obvious ligand. Recently, it was shown that in rats, ErbB2/mucin 4 complexes exist on the ocular surface. 27 28 Other studies demonstrate that mucin forms complexes with ErbB2 and can directly activate the receptor. 38 Further, mucin/ErbB2 interactions can modify the heterodimerization with other ErbB family members after ligand binding and enhance the signal response. ErbB3 is somewhat unusual as this receptor has no intrinsic tyrosine kinase activity, but is capable of initiating a signal cascade through interaction and dimerization with another ErbB. 13 14 Typically, the preferred binding partner of ErbB3 is ErbB2, though interactions with the other family members can occur. 
This report provides evidence that Nrg-1, a ligand for ErbB3, is locally produced in the adult cornea. The data suggest that the overall expression levels of Nrg-1 in the corneal epithelium and stroma, as well as in primary explant cultures of epithelium and stromal fibroblasts, are equivalent. Nrg-1 and its many splice variants are critical in tissue development and maintenance. 1 8 Indeed, knockout mice lacking Nrg-1 die during embryogenesis, illustrating its critical function. 9 However, one report noted that Nrg-1 implanted in the cornea resulted in corneal neovascularization. 39 This suggests that the expression of this growth factor in the cornea must be carefully regulated to maintain corneal clarity. Mouse models illustrate the role this growth factor plays in neural development and migration of cells from the neural crest during development. 8 Lung, 40 heart, 9 and mammary development 41 are all associated with the expression and function of various forms of Nrg-1. 1 Most notably, Nrg-1 and its receptor/s have been associated with various neoplasms and many investigators are exploring mechanisms to interrupt Nrg-1 signaling for cancer treatment. 16 Using a lung model of columnar epithelial damage, Vermeer and colleagues 42 demonstrated the central role Nrg-1 plays in wound healing. In the skin, Nrg-1 has been implicated in wound healing and epithelial migration and differentiation. 43 It is not surprising that the cornea also expresses this important growth factor. 
However, our data also show that the cornea produces multiple forms of Nrg-1. This report demonstrates that four exons are alternatively used to generate eight distinct transcripts. All these transcripts contain either exon A or B and this alters the amino acid sequence of the EGF domain. Those peptides derived from the inclusion of exon A are referred to in the literature as alpha forms, those derived from the inclusion of exon B represent beta forms. This distinction in the EGF domain has biological relevance. Alpha forms of Nrg-1 display lower affinity for the receptor and tend to produce a more transient signal, whereas the beta forms display both higher affinity and a more robust, longer lasting signal. 1 Generally, alpha has been associated with epithelial migration and maturation while beta has been associated with cell proliferation. In the present study, the corneal stroma produced predominantly the beta form (∼ 70%) while the epithelium produced equivalent levels of both. Placing these cells into culture shifted this distribution and the level of beta was reduced while alpha increased. 
In addition to the complex expression pattern presented by the alpha and beta forms of EGF, the presence or absence of exons C and D may also have biological implications. The presence or absence of exon C leads to predicted changes in the juxtamembrane domain of the molecule. Only a few reports examine the mechanism and protease/s involved in the release of this growth factor from the cell membrane. 44 45 46 47 However, it is clear that a protease is involved. For some forms, a disintegrin and metalloproteinase-like activity (ADAM) is involved. 46 47 Other studies suggest that a secretase activity is involved for some Nrg-1 variants. 48 From molecular studies it is clear that the juxtamembrane region is important in the degree of proteolytic processing that occurs and the degree to which phorbol ester treatment affects release from the membrane. 44 45 46 47 Therefore, the variants noted here with differing juxtamembrane domains are potentially processed and released in a distinct manner, regardless of whether the alpha or beta form of the EGF domain is present. 
The inclusion of the exon referred to as D leads to a truncation in the predicted coding sequence of the intracellular domain (ICD) by some 200 amino acids. Normally, the conserved sequence of the ICD contains both a LIM kinase binding domain 49 and a domain that binds a zinc finger protein of unknown function. 50 Interestingly, recent studies have demonstrated that the ICD is required for Nrg-1 function in vivo, and that constructs that abbreviate the ICD lead to inhibition of the release of Nrg-1 from the cell surface. 51 52 More importantly, the transmembrane forms of Nrg-1 back signal within the Nrg-1 expressing cell, 50 that is, the cell producing Nrg-1 can both stimulate a neighboring cell that possesses ErbB3 and respond to that interaction. This juxtacrine-like behavior, similar to the Notch/Notch ligand-signaling paradigm, is associated with the ICD. 53 In fact, after interaction with a soluble form of ErbB, Nrg-1 is proteolytically processed at the membrane and the ICD is translocated into the nucleus, altering the expression of genes in that cell. 50 The truncations in the ICD reported here are similar to the truncation mutants produced and tested in vitro by Liu et al., 51 52 and these forms may behave in a similar manner, that is, the presence of the exon referred to as D will interfere with the normal processing and release of Nrg-1 from the cell. However, the implications of the truncation in terms of back signaling within the expressing cell are unknown. 
Our data demonstrate that both explant epithelial cultures and fibroblast cultures change the pattern of exon usage with no change in the overall amount of Nrg-1 produced. This observation may simply reflect that the cultured cells are actively dividing while cells resident in the cornea are not. Of interest is the dramatic change in expression profile associated with the fibroblast cultures. Many investigators have shown that the phenotype of these cells is more closely aligned with that of the activated cell found after corneal wounding rather than the normally quiescent keratocyte. The quiescent keratocyte almost exclusively produces the well-characterized Nrg-1 beta form (∼ 90%) and the cultured stromal fibroblasts dramatically reduce the production of this form in favor of the alpha form. Because the beta form is known to have higher affinity for its receptor and typically initiates a mitogenic response, the Nrg-1 beta found in the stroma may be exclusively membrane bound (not released) and/or partitioned away from the receptor in keratocytes. However, further studies examining this in both normal and wounded cornea will be required to address this issue directly. 
In summary, this report established that Nrg-1 is expressed in the adult human cornea and alternative splicing produces at least eight distinct variants. The role that these forms play in corneal homeostasis and/or wounding remains to be explored. However, the data from other systems suggest that the gene products from Nrg-1 may play crucial and pivotal roles in the cornea. Clearly, Nrg-1 and its ability to serve as an autocrine, paracrine, and juxtacrine signaling molecule by interacting with ErbB receptors, as well as to initiate back signaling in the expressing cell, illustrates a complex and intricate system present in the adult human cornea. 
 
Table 1.
 
Primers Used for PCR Reactions
Table 1.
 
Primers Used for PCR Reactions
β2-MGF CTCGCGCTACTCTCTCTTTCTG
β2-MGR GCTTACATGTCTCGATCCCACTT
Nrg1-E2F CTTCGGTGTGAAACCAGTTCTGAATACTCCTC
Nrg1-E7R AACTCATTTGGGCACTTGCACAAGTATCTCGA
Nrg1-E1CF ATGTCCGAGCGCAAAGAAGGACG
Nrg1-E13CR TTATACAGCAATAGGGTCTTGGTTAGC
Nrg1-E6F CCTTTCAAACCCCTCGAGAT
Nrg1-E10R GAGTGATGGGCTGTGGAAGT
Nrg1-E7aF* *GAATGTGCCCATGAAAGTCC
Nrg1-E7bF* *GGTGATCGCTGCCAAAACTA
Nrg1-E10F AACGTCATCTCCAGTGAGCA
Nrg1-E14R TATCCTCAAGGGGCTAGCAG
ErbB1F CCTTTGGGGCATAGATCAGA
ErbB1R GCACCTGTAAAATGCCCTGT
ErbB2F AGTACCTGGGTCTGGACGTG
ErbB2R CTGGGAACTCAAGCAGGAAG
ErbB3F TTACACAAAGGGAAGTCGGG
ErbB3R GCTGGTCTCAAACTCCTTGC
Figure 1.
 
Primary fibroblast cultures produce Nrg-1. Normal (n = 4) and keratoconus (KC, n = 4) stromal fibroblast cultures were established and the RNA isolated. RT-PCR was performed using primers specific to a region shared by all known variants of Nrg-1. Products were assessed by agarose gel electrophoresis and ethidium bromide staining. The lane marked (−) indicates a control amplification performed without reverse transcription. Note that all samples contained similar amounts of product of the expected size.
Figure 1.
 
Primary fibroblast cultures produce Nrg-1. Normal (n = 4) and keratoconus (KC, n = 4) stromal fibroblast cultures were established and the RNA isolated. RT-PCR was performed using primers specific to a region shared by all known variants of Nrg-1. Products were assessed by agarose gel electrophoresis and ethidium bromide staining. The lane marked (−) indicates a control amplification performed without reverse transcription. Note that all samples contained similar amounts of product of the expected size.
Figure 2.
 
Stromal fibroblast cultures and adult corneas contain Nrg-1. (A) Stromal fibroblast cultures (n = 3) were extracted and equal amounts of protein (lanes 1 to 3) or a control cell lysate containing Nrg-1 (Ctl) were separated on SDS polyacrylamide gels and transferred to PVDF membranes. The blots were probed with an antibody to Nrg-1. The control lysate and stromal cell lysates show a heavily stained band that migrates with an apparent molecular weight (∼50 kDa) that is consistent with Nrg-1. (B) A replicate blot to that shown in panel (A) probed with the antibody to Nrg-1 but preincubated with an excess of the Nrg-1 peptide used for immunization. Here, the staining of the band seen in (A) is markedly reduced. (C) Fresh human corneas were obtained (n = 2). The epithelium was scraped from the surface and extracted directly with buffer (lanes 5 and 6). The endothelium was peeled away and the remaining stroma was pulverized under liquid nitrogen and the powder extracted (lanes 7 and 8). These samples were then probed with the antibody to Nrg-1. A strongly stained band was present that migrated with the same mobility as the band seen in (A).
Figure 2.
 
Stromal fibroblast cultures and adult corneas contain Nrg-1. (A) Stromal fibroblast cultures (n = 3) were extracted and equal amounts of protein (lanes 1 to 3) or a control cell lysate containing Nrg-1 (Ctl) were separated on SDS polyacrylamide gels and transferred to PVDF membranes. The blots were probed with an antibody to Nrg-1. The control lysate and stromal cell lysates show a heavily stained band that migrates with an apparent molecular weight (∼50 kDa) that is consistent with Nrg-1. (B) A replicate blot to that shown in panel (A) probed with the antibody to Nrg-1 but preincubated with an excess of the Nrg-1 peptide used for immunization. Here, the staining of the band seen in (A) is markedly reduced. (C) Fresh human corneas were obtained (n = 2). The epithelium was scraped from the surface and extracted directly with buffer (lanes 5 and 6). The endothelium was peeled away and the remaining stroma was pulverized under liquid nitrogen and the powder extracted (lanes 7 and 8). These samples were then probed with the antibody to Nrg-1. A strongly stained band was present that migrated with the same mobility as the band seen in (A).
Figure 3.
 
Stromal fibroblast cultures express at least two forms of Nrg-1. RNAs from normal (lane 1), keratoconus (lane 2), and bullous keratopathy (lane 3) stromal fibroblast cultures were amplified using LA-PCR with primers designed to encompass the entire coding region of the transcript for Nrg-1. Two distinct bands migrating between 1.6 and 2 Kb were evident. Lane 4 represents a control amplification performed without reverse transcription.
Figure 3.
 
Stromal fibroblast cultures express at least two forms of Nrg-1. RNAs from normal (lane 1), keratoconus (lane 2), and bullous keratopathy (lane 3) stromal fibroblast cultures were amplified using LA-PCR with primers designed to encompass the entire coding region of the transcript for Nrg-1. Two distinct bands migrating between 1.6 and 2 Kb were evident. Lane 4 represents a control amplification performed without reverse transcription.
Figure 4.
 
Sequence variants of Nrg-1 isolated from stromal fibroblasts. Sequence analysis of cDNAs obtained from stromal fibroblast cultures revealed multiple variants of Nrg-1. Alignment of the cDNA with the reference sequence NT_007995 (http://www.ncbi.nlm.nih.gov/entrez/) determined the apparent exon structure (numbers below boxes). Boxes indicate the nucleotides found in the cDNA with white numbers inside to indicate exon length in base pairs. Numbers above and below the exons indicate the genomic position for each in the genomic reference sequence. Exons 7A or 7B indicate that all cDNAs contain one OR the other of these. The ± above the exons labeled C and D indicate that these are included in some cDNA and not others.
Figure 4.
 
Sequence variants of Nrg-1 isolated from stromal fibroblasts. Sequence analysis of cDNAs obtained from stromal fibroblast cultures revealed multiple variants of Nrg-1. Alignment of the cDNA with the reference sequence NT_007995 (http://www.ncbi.nlm.nih.gov/entrez/) determined the apparent exon structure (numbers below boxes). Boxes indicate the nucleotides found in the cDNA with white numbers inside to indicate exon length in base pairs. Numbers above and below the exons indicate the genomic position for each in the genomic reference sequence. Exons 7A or 7B indicate that all cDNAs contain one OR the other of these. The ± above the exons labeled C and D indicate that these are included in some cDNA and not others.
Figure 5.
 
Predicted peptide sequence of the Nrg-1 variants detected. Each cDNA variant was translated and a schematic of the peptide sequence shown. The amino terminus and the immunoglobulin-like domain are shared by all variants. The EGF domain varies as shown with the use of either exon 7A or 7B (Fig. 4) . The inclusion of exon C alters the juxtamembrane domain. All variants are then followed by a common transmembrane (TM) domain and a cytoplasmic domain. The inclusion of exon D inserts a termination codon, truncating the protein by approximately 200 amino acids.
Figure 5.
 
Predicted peptide sequence of the Nrg-1 variants detected. Each cDNA variant was translated and a schematic of the peptide sequence shown. The amino terminus and the immunoglobulin-like domain are shared by all variants. The EGF domain varies as shown with the use of either exon 7A or 7B (Fig. 4) . The inclusion of exon C alters the juxtamembrane domain. All variants are then followed by a common transmembrane (TM) domain and a cytoplasmic domain. The inclusion of exon D inserts a termination codon, truncating the protein by approximately 200 amino acids.
Table 2.
 
Relative Quantitation of Nrg-1 by Real-Time PCR
Table 2.
 
Relative Quantitation of Nrg-1 by Real-Time PCR
RNA Source Nrg-1 CT β2MG CT ΔCT Nrg-1 − β2MG, a ΔΔCT ΔCT − ΔCT , b Nrg-1 Relative to Epithelium, c
Epithelial extracts (n = 4) 28.26 ± 1.16 19.16 ± 1.10 9.10 ± 1.59 0.00 ± 1.59 1.00 (0.33–3.02)
Stromal extracts (n = 4) 28.26 ± 0.58 19.40 ± 0.81 8.85 ± 0.99 −0.25 ± 0.99 1.19 (0.59–2.37)
Explant culture* 26.37 17.72 8.65 −0.45 1.37
Fibroblast cultures (n = 3) 23.90 ± 1.24 14.33 ± 0.70 9.57 ± 1.42 0.46 ± 1.42 0.72 (0.27–1.94)
Figure 6.
 
Multiple transcripts of Nrg-1 are detected in adult cornea. RNA directly isolated from corneal layers and primary cultures were evaluated by RT-PCR using various primers. Shown is a single sample of RNA from a stromal fibroblast culture. (6 to 10) indicates the amplification product obtained using the primers specific for exons 6 and 10 used to perform qPCR (see Table 2 ). (7A-10) shows the product obtained using a primer specific for exon A; (7B-10) uses an exon B specific primer. (10–14) uses primers specific for exons 10 and 14. Note that some primer pairs generated multiple products (white arrowheads).
Figure 6.
 
Multiple transcripts of Nrg-1 are detected in adult cornea. RNA directly isolated from corneal layers and primary cultures were evaluated by RT-PCR using various primers. Shown is a single sample of RNA from a stromal fibroblast culture. (6 to 10) indicates the amplification product obtained using the primers specific for exons 6 and 10 used to perform qPCR (see Table 2 ). (7A-10) shows the product obtained using a primer specific for exon A; (7B-10) uses an exon B specific primer. (10–14) uses primers specific for exons 10 and 14. Note that some primer pairs generated multiple products (white arrowheads).
Figure 7.
 
Identification of exon usage in Nrg-1 transcripts. Fluorescent primers to exons A and B were used to amplify RNA from various sources with an unlabelled reverse primer in exon 14. Products were separated on agarose gels and the fluorescent signals detected on a FMBio III instrument and recorded. The left panel shows the fluorescent image obtained with the 7A primer and the effect of restriction digestion with either ApoI or BglII on the bands. The right panel is similar except that this image represents the fluorescence from the 7B primer. Exon C contains a unique ApoI site while exon D contains a BglII site.
Figure 7.
 
Identification of exon usage in Nrg-1 transcripts. Fluorescent primers to exons A and B were used to amplify RNA from various sources with an unlabelled reverse primer in exon 14. Products were separated on agarose gels and the fluorescent signals detected on a FMBio III instrument and recorded. The left panel shows the fluorescent image obtained with the 7A primer and the effect of restriction digestion with either ApoI or BglII on the bands. The right panel is similar except that this image represents the fluorescence from the 7B primer. Exon C contains a unique ApoI site while exon D contains a BglII site.
Table 3.
 
Percent of cDNAs Containing a Particular Exon
Table 3.
 
Percent of cDNAs Containing a Particular Exon
EXON Corneal Epithelium (n = 4) Cultured Epithelium Corneal Stroma (n = 4) Cultured Fibroblasts (n = 3)
A 51 62 33 52
B 49 38 67 44
C 23 18 3 34
D 13 28 <1 36
Table 4.
 
Frequency and Pattern of Particular Nrg-1 Splice Variants
Table 4.
 
Frequency and Pattern of Particular Nrg-1 Splice Variants
A B C D Corneal Epithelium (n = 4) Cultured Epithelium, c Corneal Stroma (n = 4) Cultured Fibroblasts (n = 3)
+ 33.8 ± 3.0a 38.2 30.6 ± 2.4 26.1 ± 1.4
+ 34.7 ± 3.3 34.7 45.3 ± 5.2 11.2 ± 1.7
+ + 9.1 ± 0.8 6.3 3.0 ± 2.1 5.7 ± 0.9
+ + 9.3 ± 1.4 6.4 17.6 ± 3.0 17.0 ± 2.7
+ + 4.9 ± 0.6 13.8 ND, b 17.3 ± 2.1
+ + 3.9 ± 0.3 9.1 3.5 ± 2.1 8.1 ± 0.7
+ + + 3.2 ± 1.0 ND ND 2.9 ± 0.6
+ + + 1.2 ± 0.1 1.7 ND 8.1 ± 0.7
Figure 8.
 
Stromal fibroblast cultures and adult corneas express ErbB1, ErbB2, and ErbB3. Specific primers designed to amplify the ErbB receptor family were used to assess RNA from various sources. B1-B3 indicates products representing ErbB1, ErbB2, and ErbB3, respectively, from representative samples of corneal RNA extracted from epithelium and stromal fibroblast and epithelial explant cultures. (−) indicates the results obtained without the inclusion of reverse transcriptase.
Figure 8.
 
Stromal fibroblast cultures and adult corneas express ErbB1, ErbB2, and ErbB3. Specific primers designed to amplify the ErbB receptor family were used to assess RNA from various sources. B1-B3 indicates products representing ErbB1, ErbB2, and ErbB3, respectively, from representative samples of corneal RNA extracted from epithelium and stromal fibroblast and epithelial explant cultures. (−) indicates the results obtained without the inclusion of reverse transcriptase.
The authors thank M. Cristina Kenney for helpful advise, encouragement, and expertise, as well as Hamdi Hamdi and Steven Wechsler for critically reading the manuscript. 
Falls DL. Neuregulins: functions, forms, and signaling strategies. Exp Cell Res. 2003;284:14–30. [CrossRef] [PubMed]
Wen D, Peles E, Cupples R, et al. Neu differentiation factor: a transmembrane glycoprotein containing an EGF domain and an immunoglobulin homology unit. Cell. 1992;69:559–572. [CrossRef] [PubMed]
Peles E, Bacus SS, Koski RA, et al. Isolation of the neu/HER-2 stimulatory ligand: a 44 kd glycoprotein that induces differentiation of mammary tumor cells. Cell. 1992;69:205–216. [CrossRef] [PubMed]
Holmes WE, Sliwkowski MX, Akita RW, et al. Identification of heregulin, a specific activator of p185erbB2. Science. 1992;256:1205–1210. [CrossRef] [PubMed]
Goodearl AD, Davis JB, Mistry K, et al. Purification of multiple forms of glial growth factor. J Biol Chem. 1993;268:18095–18102. [PubMed]
Marchionni MA, Goodearl AD, Chen MS, et al. Glial growth factors are alternatively spliced erbB2 ligands expressed in the nervous system. Nature. 1993;362:312–318. [CrossRef] [PubMed]
Falls DL, Harris DA, Johnson FA, Morgan MM, Corfas G, Fischbach GD. Mr 42,000 ARIA: a protein that may regulate the accumulation of acetylcholine receptors at developing chick neuromuscular junctions. Cold Spring Harb Symp Quant Biol. 1990;55:397–406. [CrossRef] [PubMed]
Crone SA, Lee KF. Gene targeting reveals multiple essential functions of the neuregulin signaling system during development of the neuroendocrine and nervous systems. Ann N Y Acad Sci. 2002;971:547–553. [CrossRef] [PubMed]
Meyer D, Birchmeier C. Multiple essential functions of neuregulin in development. Nature. 1995;378:386–390. [CrossRef] [PubMed]
Hobbs SS, Coffing SL, Le AT, et al. Neuregulin isoforms exhibit distinct patterns of ErbB family receptor activation. Oncogene. 2002;21:8442–8452. [CrossRef] [PubMed]
Ballinger MD, Jones JT, Lofgren JA, et al. Selection of heregulin variants having higher affinity for the ErbB3 receptor by monovalent phage display. J Biol Chem. 1998;273:11675–11684. [CrossRef] [PubMed]
Jones JT, Akita RW, Sliwkowski MX. Binding specificities and affinities of egf domains for ErbB receptors. FEBS Lett. 1999;447:227–231. [CrossRef] [PubMed]
Yarden Y, Sliwkowski MX. Untangling the ErbB signaling network. Nat Rev Mol Cell Biol. 2001;2:127–137. [CrossRef] [PubMed]
Tzahar E, Waterman H, Chen X, et al. A hierarchical network of interreceptor interactions determines signal transduction by Neu differentiation factor/neuregulin and epidermal growth factor. Mol Cell Biol. 1996;16:5276–5287. [PubMed]
Burgess AW, Cho HS, Eigenbrot C, et al. An open-and-shut case? Recent insights into the activation of EGF/ErbB receptors. Mol Cell. 2003;12:541–552. [CrossRef] [PubMed]
Citri A, Skaria KB, Yarden Y. The deaf and the dumb: the biology of ErbB-2 and ErbB-3. Exp Cell Res. 2003;284:54–65. [CrossRef] [PubMed]
Wilson SE, He YG, Weng J, Zieske JD, Jester JV, Schultz GS. Effect of epidermal growth factor, hepatocyte growth factor, and keratinocyte growth factor, on proliferation, motility and differentiation of human corneal epithelial cells. Exp Eye Res. 1994;59:665–678. [CrossRef] [PubMed]
Soltau JB, McLaughlin BJ. Effects of growth factors on wound healing in serum-deprived kitten corneal endothelial cell cultures. Cornea. 1993;12:208–215. [CrossRef] [PubMed]
Weng J, Liang Q, Mohan RR, Li Q, Wilson SE. Hepatocyte growth factor, keratinocyte growth factor, and other growth factor-receptor systems in the lens. Invest Ophthalmol Vis Sci. 1997;38:1543–1554. [PubMed]
Dellaert MM, Casey TA, Wiffen S, et al. Influence of topical human epidermal growth factor on postkeratoplasty re-epithelialisation. Br J Ophthalmol. 1997;81:391–395. [CrossRef] [PubMed]
Zieske JD, Takahashi H, Hutcheon AE, Dalbone AC. Activation of epidermal growth factor receptor during corneal epithelial migration. Invest Ophthalmol Vis Sci. 2000;41:1346–1355. [PubMed]
Lu L, Reinach PS, Kao WW. Corneal epithelial wound healing. Exp Biol Med (Maywood). 2001;226:653–664. [PubMed]
Pastor JC, Calonge M. Epidermal growth factor and corneal wound healing. A multicenter study. Cornea. 1992;11:311–314. [CrossRef] [PubMed]
Scardovi C, De Felice GP, Gazzaniga A. Epidermal growth factor in the topical treatment of traumatic corneal ulcers. Ophthalmologica. 1993;206:119–124. [CrossRef] [PubMed]
Kandarakis AS, Page C, Kaufman HE. The effect of epidermal growth factor on epithelial healing after penetrating keratoplasty in human eyes. Am J Ophthalmol. 1984;98:411–415. [CrossRef] [PubMed]
Guo L, Degenstein L, Fuchs E. Keratinocyte growth factor is required for hair development but not for wound healing. Genes Dev. 1996;10:165–175. [CrossRef] [PubMed]
Price-Schiavi SA, Jepson S, Li P, et al. Rat Muc4 (sialomucin complex) reduces binding of anti-ErbB2 antibodies to tumor cell surfaces, a potential mechanism for herceptin resistance. Int J Cancer. 2002;99:783–791. [CrossRef] [PubMed]
Swan JS, Arango ME, Carothers Carraway CA, Carraway KL. An ErbB2-Muc4 complex in rat ocular surface epithelia. Curr Eye Res. 2002;24:397–402. [CrossRef] [PubMed]
Liu Z, Carvajal M, Carothers Carraway CA, Carraway KL, Pflugfelder SC. Increased expression of the type 1 growth factor receptor family in the conjunctival epithelium of patients with keratoconjunctivitis sicca. Am J Ophthalmol. 2000;129:472–480. [CrossRef] [PubMed]
Liu Z, Carvajal M, Carraway CA, Carraway K, Pflugfelder SC. Expression of the receptor tyrosine kinases, epidermal growth factor receptor, ErbB2, and ErbB3, in human ocular surface epithelia. Cornea. 2001;20:81–85. [CrossRef] [PubMed]
Jester JV, Huang J, Fisher S, et al. Myofibroblast differentiation of normal human keratocytes and hTERT, extended-life human corneal fibroblasts. Invest Ophthalmol Vis Sci. 2003;44:1850–1858. [CrossRef] [PubMed]
Jester JV, Barry-Lane PA, Cavanagh HD, Petroll WM. Induction of alpha-smooth muscle actin expression and myofibroblast transformation in cultured corneal keratocytes. Cornea. 1996;15:505–516. [PubMed]
Jester JV, Barry PA, Lind GJ, Petroll WM, Garana R, Cavanagh HD. Corneal keratocytes: in situ and in vitro organization of cytoskeletal contractile proteins. Invest Ophthalmol Vis Sci. 1994;35:730–743. [PubMed]
Beales MP, Funderburgh JL, Jester JV, Hassell JR. Proteoglycan synthesis by bovine keratocytes and corneal fibroblasts: maintenance of the keratocyte phenotype in culture. Invest Ophthalmol Vis Sci. 1999;40:1658–1663. [PubMed]
Saghizadeh M, Brown DJ, Tajbakhsh J, et al. Evaluation of techniques using amplified nucleic acid probes for gene expression profiling. Biomol Eng. 2003;20:97–106. [CrossRef] [PubMed]
Spirin KS, Ljubimov AV, Castellon R, et al. Analysis of gene expression in human bullous keratopathy corneas containing limiting amounts of RNA. Invest Ophthalmol Vis Sci. 1999;40:3108–3115. [PubMed]
Brady-Kalnay SM, Tonks NK. Protein tyrosine phosphatases as adhesion receptors. Curr Opin Cell Biol. 1995;7:650–657. [CrossRef] [PubMed]
Carraway KL, Ramsauer VP, Haq B, Carothers Carraway CA. Cell signaling through membrane mucins. Bioessays. 2003;25:66–71. [CrossRef] [PubMed]
Russell KS, Stern DF, Polverini PJ, Bender JR. Neuregulin activation of ErbB receptors in vascular endothelium leads to angiogenesis. Am J Physiol. 1999;277:H2205–H2211. [PubMed]
Patel NV, Acarregui MJ, Snyder JM, Klein JM, Sliwkowski MX, Kern JA. Neuregulin-1 and human epidermal growth factor receptors 2 and 3 play a role in human lung development in vitro. Am J Respir Cell Mol Biol. 2000;22:432–440. [CrossRef] [PubMed]
Troyer KL, Lee DC. Regulation of mouse mammary gland development and tumorigenesis by the ERBB signaling network. J Mamm Gland Biol Neoplasia. 2001;6:7–21. [CrossRef]
Vermeer PD, Einwalter LA, Moninger TO, et al. Segregation of receptor and ligand regulates activation of epithelial growth factor receptor. Nature. 2003;422:322–326. [CrossRef] [PubMed]
Schelfhout VR, Coene ED, Delaey B, et al. The role of heregulin-alpha as a motility factor and amphiregulin as a growth factor in wound healing. J Pathol. 2002;198:523–533. [CrossRef] [PubMed]
Burgess TL, Ross SL, Qian YX, Brankow D, Hu S. Biosynthetic processing of neu differentiation factor. Glycosylation trafficking, and regulated cleavage from the cell surface. J Biol Chem. 1995;270:19188–19196. [CrossRef] [PubMed]
Loeb JA, Susanto ET, Fischbach GD. The neuregulin precursor proARIA is processed to ARIA after expression on the cell surface by a protein kinase C-enhanced mechanism. Mol Cell Neurosci. 1998;11:77–91. [CrossRef] [PubMed]
Montero JC, Yuste L, Diaz-Rodriguez E, Esparis-Ogando A, Pandiella A. Differential shedding of transmembrane neuregulin isoforms by the tumor necrosis factor-alpha-converting enzyme. Mol Cell Neurosci. 2000;16:631–648. [CrossRef] [PubMed]
Shirakabe K, Wakatsuki S, Kurisaki T, Fujisawa-Sehara A. Roles of Meltrin beta /ADAM19 in the processing of neuregulin. J Biol Chem. 2001;276:9352–9358. [CrossRef] [PubMed]
Lai C, Feng L. Implication of gamma-secretase in neuregulin-induced maturation of oligodendrocytes. Biochem Biophys Res Commun. 2004;314:535–542. [CrossRef] [PubMed]
Wang JY, Frenzel KE, Wen D, Falls DL. Transmembrane neuregulins interact with LIM kinase 1, a cytoplasmic protein kinase implicated in development of visuospatial cognition. J Biol Chem. 1998;273:20525–20534. [CrossRef] [PubMed]
Bao J, Wolpowitz D, Role LW, Talmage DA. Back signaling by the Nrg-1 intracellular domain. J Cell Biol. 2003;161:1133–1141. [CrossRef] [PubMed]
Liu X, Hwang H, Cao L, et al. Domain-specific gene disruption reveals critical regulation of neuregulin signaling by its cytoplasmic tail. Proc Natl Acad Sci USA. 1998;95:13024–13029. [CrossRef] [PubMed]
Liu X, Hwang H, Cao L, et al. Release of the neuregulin functional polypeptide requires its cytoplasmic tail. J Biol Chem. 1998;273:34335–34340. [CrossRef] [PubMed]
Rida PC, Le Minh N, Jiang YJ. A Notch feeling of somite segmentation and beyond. Dev Biol. 2004;265:2–22. [CrossRef] [PubMed]
Figure 1.
 
Primary fibroblast cultures produce Nrg-1. Normal (n = 4) and keratoconus (KC, n = 4) stromal fibroblast cultures were established and the RNA isolated. RT-PCR was performed using primers specific to a region shared by all known variants of Nrg-1. Products were assessed by agarose gel electrophoresis and ethidium bromide staining. The lane marked (−) indicates a control amplification performed without reverse transcription. Note that all samples contained similar amounts of product of the expected size.
Figure 1.
 
Primary fibroblast cultures produce Nrg-1. Normal (n = 4) and keratoconus (KC, n = 4) stromal fibroblast cultures were established and the RNA isolated. RT-PCR was performed using primers specific to a region shared by all known variants of Nrg-1. Products were assessed by agarose gel electrophoresis and ethidium bromide staining. The lane marked (−) indicates a control amplification performed without reverse transcription. Note that all samples contained similar amounts of product of the expected size.
Figure 2.
 
Stromal fibroblast cultures and adult corneas contain Nrg-1. (A) Stromal fibroblast cultures (n = 3) were extracted and equal amounts of protein (lanes 1 to 3) or a control cell lysate containing Nrg-1 (Ctl) were separated on SDS polyacrylamide gels and transferred to PVDF membranes. The blots were probed with an antibody to Nrg-1. The control lysate and stromal cell lysates show a heavily stained band that migrates with an apparent molecular weight (∼50 kDa) that is consistent with Nrg-1. (B) A replicate blot to that shown in panel (A) probed with the antibody to Nrg-1 but preincubated with an excess of the Nrg-1 peptide used for immunization. Here, the staining of the band seen in (A) is markedly reduced. (C) Fresh human corneas were obtained (n = 2). The epithelium was scraped from the surface and extracted directly with buffer (lanes 5 and 6). The endothelium was peeled away and the remaining stroma was pulverized under liquid nitrogen and the powder extracted (lanes 7 and 8). These samples were then probed with the antibody to Nrg-1. A strongly stained band was present that migrated with the same mobility as the band seen in (A).
Figure 2.
 
Stromal fibroblast cultures and adult corneas contain Nrg-1. (A) Stromal fibroblast cultures (n = 3) were extracted and equal amounts of protein (lanes 1 to 3) or a control cell lysate containing Nrg-1 (Ctl) were separated on SDS polyacrylamide gels and transferred to PVDF membranes. The blots were probed with an antibody to Nrg-1. The control lysate and stromal cell lysates show a heavily stained band that migrates with an apparent molecular weight (∼50 kDa) that is consistent with Nrg-1. (B) A replicate blot to that shown in panel (A) probed with the antibody to Nrg-1 but preincubated with an excess of the Nrg-1 peptide used for immunization. Here, the staining of the band seen in (A) is markedly reduced. (C) Fresh human corneas were obtained (n = 2). The epithelium was scraped from the surface and extracted directly with buffer (lanes 5 and 6). The endothelium was peeled away and the remaining stroma was pulverized under liquid nitrogen and the powder extracted (lanes 7 and 8). These samples were then probed with the antibody to Nrg-1. A strongly stained band was present that migrated with the same mobility as the band seen in (A).
Figure 3.
 
Stromal fibroblast cultures express at least two forms of Nrg-1. RNAs from normal (lane 1), keratoconus (lane 2), and bullous keratopathy (lane 3) stromal fibroblast cultures were amplified using LA-PCR with primers designed to encompass the entire coding region of the transcript for Nrg-1. Two distinct bands migrating between 1.6 and 2 Kb were evident. Lane 4 represents a control amplification performed without reverse transcription.
Figure 3.
 
Stromal fibroblast cultures express at least two forms of Nrg-1. RNAs from normal (lane 1), keratoconus (lane 2), and bullous keratopathy (lane 3) stromal fibroblast cultures were amplified using LA-PCR with primers designed to encompass the entire coding region of the transcript for Nrg-1. Two distinct bands migrating between 1.6 and 2 Kb were evident. Lane 4 represents a control amplification performed without reverse transcription.
Figure 4.
 
Sequence variants of Nrg-1 isolated from stromal fibroblasts. Sequence analysis of cDNAs obtained from stromal fibroblast cultures revealed multiple variants of Nrg-1. Alignment of the cDNA with the reference sequence NT_007995 (http://www.ncbi.nlm.nih.gov/entrez/) determined the apparent exon structure (numbers below boxes). Boxes indicate the nucleotides found in the cDNA with white numbers inside to indicate exon length in base pairs. Numbers above and below the exons indicate the genomic position for each in the genomic reference sequence. Exons 7A or 7B indicate that all cDNAs contain one OR the other of these. The ± above the exons labeled C and D indicate that these are included in some cDNA and not others.
Figure 4.
 
Sequence variants of Nrg-1 isolated from stromal fibroblasts. Sequence analysis of cDNAs obtained from stromal fibroblast cultures revealed multiple variants of Nrg-1. Alignment of the cDNA with the reference sequence NT_007995 (http://www.ncbi.nlm.nih.gov/entrez/) determined the apparent exon structure (numbers below boxes). Boxes indicate the nucleotides found in the cDNA with white numbers inside to indicate exon length in base pairs. Numbers above and below the exons indicate the genomic position for each in the genomic reference sequence. Exons 7A or 7B indicate that all cDNAs contain one OR the other of these. The ± above the exons labeled C and D indicate that these are included in some cDNA and not others.
Figure 5.
 
Predicted peptide sequence of the Nrg-1 variants detected. Each cDNA variant was translated and a schematic of the peptide sequence shown. The amino terminus and the immunoglobulin-like domain are shared by all variants. The EGF domain varies as shown with the use of either exon 7A or 7B (Fig. 4) . The inclusion of exon C alters the juxtamembrane domain. All variants are then followed by a common transmembrane (TM) domain and a cytoplasmic domain. The inclusion of exon D inserts a termination codon, truncating the protein by approximately 200 amino acids.
Figure 5.
 
Predicted peptide sequence of the Nrg-1 variants detected. Each cDNA variant was translated and a schematic of the peptide sequence shown. The amino terminus and the immunoglobulin-like domain are shared by all variants. The EGF domain varies as shown with the use of either exon 7A or 7B (Fig. 4) . The inclusion of exon C alters the juxtamembrane domain. All variants are then followed by a common transmembrane (TM) domain and a cytoplasmic domain. The inclusion of exon D inserts a termination codon, truncating the protein by approximately 200 amino acids.
Figure 6.
 
Multiple transcripts of Nrg-1 are detected in adult cornea. RNA directly isolated from corneal layers and primary cultures were evaluated by RT-PCR using various primers. Shown is a single sample of RNA from a stromal fibroblast culture. (6 to 10) indicates the amplification product obtained using the primers specific for exons 6 and 10 used to perform qPCR (see Table 2 ). (7A-10) shows the product obtained using a primer specific for exon A; (7B-10) uses an exon B specific primer. (10–14) uses primers specific for exons 10 and 14. Note that some primer pairs generated multiple products (white arrowheads).
Figure 6.
 
Multiple transcripts of Nrg-1 are detected in adult cornea. RNA directly isolated from corneal layers and primary cultures were evaluated by RT-PCR using various primers. Shown is a single sample of RNA from a stromal fibroblast culture. (6 to 10) indicates the amplification product obtained using the primers specific for exons 6 and 10 used to perform qPCR (see Table 2 ). (7A-10) shows the product obtained using a primer specific for exon A; (7B-10) uses an exon B specific primer. (10–14) uses primers specific for exons 10 and 14. Note that some primer pairs generated multiple products (white arrowheads).
Figure 7.
 
Identification of exon usage in Nrg-1 transcripts. Fluorescent primers to exons A and B were used to amplify RNA from various sources with an unlabelled reverse primer in exon 14. Products were separated on agarose gels and the fluorescent signals detected on a FMBio III instrument and recorded. The left panel shows the fluorescent image obtained with the 7A primer and the effect of restriction digestion with either ApoI or BglII on the bands. The right panel is similar except that this image represents the fluorescence from the 7B primer. Exon C contains a unique ApoI site while exon D contains a BglII site.
Figure 7.
 
Identification of exon usage in Nrg-1 transcripts. Fluorescent primers to exons A and B were used to amplify RNA from various sources with an unlabelled reverse primer in exon 14. Products were separated on agarose gels and the fluorescent signals detected on a FMBio III instrument and recorded. The left panel shows the fluorescent image obtained with the 7A primer and the effect of restriction digestion with either ApoI or BglII on the bands. The right panel is similar except that this image represents the fluorescence from the 7B primer. Exon C contains a unique ApoI site while exon D contains a BglII site.
Figure 8.
 
Stromal fibroblast cultures and adult corneas express ErbB1, ErbB2, and ErbB3. Specific primers designed to amplify the ErbB receptor family were used to assess RNA from various sources. B1-B3 indicates products representing ErbB1, ErbB2, and ErbB3, respectively, from representative samples of corneal RNA extracted from epithelium and stromal fibroblast and epithelial explant cultures. (−) indicates the results obtained without the inclusion of reverse transcriptase.
Figure 8.
 
Stromal fibroblast cultures and adult corneas express ErbB1, ErbB2, and ErbB3. Specific primers designed to amplify the ErbB receptor family were used to assess RNA from various sources. B1-B3 indicates products representing ErbB1, ErbB2, and ErbB3, respectively, from representative samples of corneal RNA extracted from epithelium and stromal fibroblast and epithelial explant cultures. (−) indicates the results obtained without the inclusion of reverse transcriptase.
Table 1.
 
Primers Used for PCR Reactions
Table 1.
 
Primers Used for PCR Reactions
β2-MGF CTCGCGCTACTCTCTCTTTCTG
β2-MGR GCTTACATGTCTCGATCCCACTT
Nrg1-E2F CTTCGGTGTGAAACCAGTTCTGAATACTCCTC
Nrg1-E7R AACTCATTTGGGCACTTGCACAAGTATCTCGA
Nrg1-E1CF ATGTCCGAGCGCAAAGAAGGACG
Nrg1-E13CR TTATACAGCAATAGGGTCTTGGTTAGC
Nrg1-E6F CCTTTCAAACCCCTCGAGAT
Nrg1-E10R GAGTGATGGGCTGTGGAAGT
Nrg1-E7aF* *GAATGTGCCCATGAAAGTCC
Nrg1-E7bF* *GGTGATCGCTGCCAAAACTA
Nrg1-E10F AACGTCATCTCCAGTGAGCA
Nrg1-E14R TATCCTCAAGGGGCTAGCAG
ErbB1F CCTTTGGGGCATAGATCAGA
ErbB1R GCACCTGTAAAATGCCCTGT
ErbB2F AGTACCTGGGTCTGGACGTG
ErbB2R CTGGGAACTCAAGCAGGAAG
ErbB3F TTACACAAAGGGAAGTCGGG
ErbB3R GCTGGTCTCAAACTCCTTGC
Table 2.
 
Relative Quantitation of Nrg-1 by Real-Time PCR
Table 2.
 
Relative Quantitation of Nrg-1 by Real-Time PCR
RNA Source Nrg-1 CT β2MG CT ΔCT Nrg-1 − β2MG, a ΔΔCT ΔCT − ΔCT , b Nrg-1 Relative to Epithelium, c
Epithelial extracts (n = 4) 28.26 ± 1.16 19.16 ± 1.10 9.10 ± 1.59 0.00 ± 1.59 1.00 (0.33–3.02)
Stromal extracts (n = 4) 28.26 ± 0.58 19.40 ± 0.81 8.85 ± 0.99 −0.25 ± 0.99 1.19 (0.59–2.37)
Explant culture* 26.37 17.72 8.65 −0.45 1.37
Fibroblast cultures (n = 3) 23.90 ± 1.24 14.33 ± 0.70 9.57 ± 1.42 0.46 ± 1.42 0.72 (0.27–1.94)
Table 3.
 
Percent of cDNAs Containing a Particular Exon
Table 3.
 
Percent of cDNAs Containing a Particular Exon
EXON Corneal Epithelium (n = 4) Cultured Epithelium Corneal Stroma (n = 4) Cultured Fibroblasts (n = 3)
A 51 62 33 52
B 49 38 67 44
C 23 18 3 34
D 13 28 <1 36
Table 4.
 
Frequency and Pattern of Particular Nrg-1 Splice Variants
Table 4.
 
Frequency and Pattern of Particular Nrg-1 Splice Variants
A B C D Corneal Epithelium (n = 4) Cultured Epithelium, c Corneal Stroma (n = 4) Cultured Fibroblasts (n = 3)
+ 33.8 ± 3.0a 38.2 30.6 ± 2.4 26.1 ± 1.4
+ 34.7 ± 3.3 34.7 45.3 ± 5.2 11.2 ± 1.7
+ + 9.1 ± 0.8 6.3 3.0 ± 2.1 5.7 ± 0.9
+ + 9.3 ± 1.4 6.4 17.6 ± 3.0 17.0 ± 2.7
+ + 4.9 ± 0.6 13.8 ND, b 17.3 ± 2.1
+ + 3.9 ± 0.3 9.1 3.5 ± 2.1 8.1 ± 0.7
+ + + 3.2 ± 1.0 ND ND 2.9 ± 0.6
+ + + 1.2 ± 0.1 1.7 ND 8.1 ± 0.7
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×