December 2006
Volume 47, Issue 12
Free
Retina  |   December 2006
Spatial and Temporal Expression of MFRP and Its Interaction with CTRP5
Author Affiliations
  • Md Nawajes A. Mandal
    From the Department of Ophthalmology and Visual Sciences, University of Michigan, Ann Arbor, Michigan; the
  • Vidyullatha Vasireddy
    From the Department of Ophthalmology and Visual Sciences, University of Michigan, Ann Arbor, Michigan; the
  • Monica M. Jablonski
    Retinal Degeneration Research Center, Ophthalmology, University of Tennessee Health Sciences Center, Memphis, Tennessee; and the
  • XiaoFei Wang
    Retinal Degeneration Research Center, Ophthalmology, University of Tennessee Health Sciences Center, Memphis, Tennessee; and the
  • John R. Heckenlively
    From the Department of Ophthalmology and Visual Sciences, University of Michigan, Ann Arbor, Michigan; the
  • Bret A. Hughes
    From the Department of Ophthalmology and Visual Sciences, University of Michigan, Ann Arbor, Michigan; the
  • G. Bhanuprakash Reddy
    From the Department of Ophthalmology and Visual Sciences, University of Michigan, Ann Arbor, Michigan; the
    National Institute of Nutrition, Hyderabad, India.
  • Radha Ayyagari
    From the Department of Ophthalmology and Visual Sciences, University of Michigan, Ann Arbor, Michigan; the
Investigative Ophthalmology & Visual Science December 2006, Vol.47, 5514-5521. doi:10.1167/iovs.06-0449
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Md Nawajes A. Mandal, Vidyullatha Vasireddy, Monica M. Jablonski, XiaoFei Wang, John R. Heckenlively, Bret A. Hughes, G. Bhanuprakash Reddy, Radha Ayyagari; Spatial and Temporal Expression of MFRP and Its Interaction with CTRP5. Invest. Ophthalmol. Vis. Sci. 2006;47(12):5514-5521. doi: 10.1167/iovs.06-0449.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

purpose. Mutations in the membrane frizzled-related protein (MFRP) gene cause nanophthalmos in humans, and a splice site mutation causes recessive retinal degeneration in the rd6 mouse. In human and mouse genomes, the MFRP gene lies adjoining to the complement 1q tumor necrosis factor–related protein 5 (CTRP5/C1QTNF5) gene involved in causing retinal degeneration and abnormal lens zonules in human. The purpose of this study was to characterize the spatial and temporal expression of the mouse Mfrp gene, determine tissue and subcellular localization of MFRP protein, and study its interaction with CTRP5.

methods. Expression of the Mfrp gene in the mouse was studied by quantitative (q)RT-PCR. MFRP protein expression and distribution were studied by Western blot analysis, immunohistochemistry, and immunoelectron microscopy. Interaction with CTRP5 was studied by immunoprecipitation and immunoblot analysis, using mouse eye and human retinal pigmented epithelium (RPE) choroid extracts and by expressing full-length CTRP5 and MFRP in a heterologous system.

results. The Mfrp gene is specifically expressed in RPE and ciliary body (CB), and its expression starts during early stages of embryogenesis. In the albino mouse eye, MFRP is localized to the apical and basal membranes of RPE and ciliary epithelium (CE). In addition, MFRP and CTRP5 were found to colocalize in RPE, CE, and MDCK cells, a general model of polarized epithelia. These proteins interact with each other in ocular tissues and also in a heterologous system.

conclusions. MFRP is localized to the plasma membrane of CE and RPE, and colocalizes and interacts with CTRP5 indicating a functional relationship between these two proteins.

Membrane frizzled-related protein (MFRP) is implicated in causing ocular abnormalities. MFRP was identified as a protein containing a frizzled-type cysteine-rich domain (CRD), which is a binding motif for glycoprotein WNTs. 1 Frizzled proteins (FZDs) are seven-transmembrane-type WNT receptors that transduce WNT signals to the intracellular signaling pathways. The CRD of MFRP is homologous to the FZDs, corin, and secreted frizzled-related proteins (SFRP). 2 3 4 5 MFRP is a type II transmembrane protein. It contains an N-terminal cytoplasmic region, a transmembrane domain, and an extracellular region with tandem repeats of two cubilin (CUB) domains, low-density lipoprotein receptor related sequence (LdLa), and a CRD at the C terminus. 1  
A splice-site mutation was reported in the Mfrp gene in a mouse model rd6 with progressive retinal degeneration. 6 The rd6 mutation results in in-frame deletion of exon 4 (58 amino acids) from the MFRP protein, and the homozygous rd6 mouse shows progressive retinal dysfunction starting at approximately 1 month of age and affects both rods and cones. 7 The mouse homologue of Mfrp is located on human chromosome 11 at q23.3. Mutations in the MFRP gene cause extreme hyperopia or nanophthalmos in humans. 8 All mutations except one detected in humans result in truncation of the MFRP protein. 8 The homozygous mutations reported in six of the nine patients result in loss of the CRD and/or CUB domains. In two patients, a compound heterozygous mutation with a deletion, resulting in the loss of both CRD and CUBs, and a substitution of an extremely conserved amino acid (I182T) in the first CUB domain was observed. 8 All these mutations are predicted to cause a nonfunctional MFRP and thereby a null genotype. 8 The pathologic features observed in patients with MFRP gene mutations indicate that this gene may play a role in the regulation of the axial length of the eye determining the eye size, with no apparent effect on retinal function. 8 9  
In the human and mouse genome, the MFRP gene is located very close to the CTRP5 gene. In both species, the 3′ untranslated region of the MFRP transcript was found to contain the complete open reading frame (ORF) of CTRP5. 6 Therefore, MFRP and CTRP5 were reported to be dicistronic. 6 10 We observed a S163R missense mutation in the CTRP5 gene, which resulted in a complex phenotype involving both anterior and posterior segment (PS) of eyes with early-onset abnormal anterior lens zonules and late-onset retinal degeneration (L-ORD). 11 We also detected the expression of both CTRP5 and MFRP in the eye, with the highest level of expression in the RPE and ciliary body, the tissues that are involved in the disease. 11 MFRP has been shown to be expressed in the RPE, ciliary body, and brain. 6 11 The functional implication of the existence of CTRP5 and MFRP as dicistronic genes and their roles in ocular disease is not known. 
In this study, we have determined the spatial and temporal expression of the Mfrp gene and subcellular localization of MFRP protein, to understand the probable role this gene plays during development and aging of the eye. In addition, we have studied the interaction of MFRP with CTRP5 protein. The results of the study indicated a potential functional relationship between the CTRP5 and MFRP genes associated with anterior and PS abnormalities in the eye. 
Materials and Methods
Animals and Tissue Collection
Maintenance and care of the C57BL/6 and BALBc mice used in this study were in accordance with the NIH Guidelines for the Use of Laboratory Animals and the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. All animals were maintained on a 12-hour light–dark cycle, and tissues were collected at the end of a dark cycle at the appropriate age. We collected the retina, lens, iris-ciliary body (I-CB), PS (containing the RPE, choroid, and sclera), and other tissues, including brain, heart, lungs, liver, spleen, kidney, skeletal muscle, testes, skin, and uterus from 33-week-old C57BL/6 mice, to isolate RNA and measure expression of the Mfrp gene. Eyes were collected from 1-, 3-, 5-, 10- and 30-day-old C57BL/6 mice to study the expression of this gene during postnatal development. To measure the expression of Mfrp during aging, eyes were obtained from 1-, 2-, 6-, 10-, 12-, 14-, 17- and 20-month-old C57BL/6 mice, and I-CB, PS, lens, and retina were dissected for RNA isolation. Heads from embryonic day (E)18 and postnatal day (P)1 to P10 C57BL/6 mice and eyes from adult (90-day-old) BALBc mice (albino) were fixed and processed for cryosectioning, as described earlier. 12 Ten-micrometer-thick radial cryosections were used for immunohistochemical analysis. 
Real-Time Quantitative RT-PCR
Quantitative (q)RT-PCR was performed, and data were analyzed according to previously published protocols. 11 13 Primers for qRT-PCR were designed from regions of Mfrp sequences that span at least one intron (Table 1) . We used the expression of the four genes Gapdh, Hgprt, Actin-b, and RpL19 as the control, to normalize the Mfrp gene expression. 11 13 Mean (±SD) relative expression values calculated from at least three independent reactions are presented on arbitrary scales. 
Antibodies and Their Sources
Affinity-purified goat anti-MFRP antibodies were obtained from R&D Systems, Inc. (Minneapolis, MN). We raised rabbit anti-CTRP5 antibodies; purification and characterization of these antibodies are described elsewhere. 14 Monoclonal anti-ezrin antibodies (clone 3C12; Sigma-Aldrich, St. Louis, MO); monoclonal anti-TIMP3 antibodies (Chemicon, Temecula, CA); anti-mouse monoclonal antibody (Xpress; Invitrogen, Carlsbad, CA), anti-V5, and secondary antibodies conjugated to either Alexa Fluor 488 or Alexa Fluor 555 (Invitrogen); anti-goat, anti-rabbit, and anti-mouse secondary antibodies conjugated to horseradish peroxidase (HRP; Santa Cruz Biotechnology, Inc., Santa Cruz, CA) were obtained from the commercial sources indicated. 
Immunohistochemistry
Immunolocalization of MFRP protein and its colocalization with other proteins in the mouse eye was performed according to previously described protocols. 12 15 The following dilutions of the primary antibodies were used: anti-MFRP (1:2500), anti-CTRP5 (1:1000), anti-ezrin (1:4000), and anti-TIMP3 (1:2500). Images were captured with a confocal microscope (LSM 510; Carl Zeiss Meditec, Dublin, CA). 
Madin-Darby canine kidney (MDCK) cells were fixed in absolute methanol at −10°C for 15 minutes and then incubated for 1 hour in blocking solution containing 5% horse serum, 1% IgG-free BSA (Jackson ImmunoResearch Laboratories, West Grove, PA) in PBS (Sigma-Aldrich) followed by incubation with anti-MFRP (1:500) and anti-CTRP5 (1:250) antibodies, both separately and in combination, to locate endogenously expressed MFRP and CTRP5 proteins in subcellular structures. 16  
Immunoelectron Microscopy
The electron microscopic immunohistochemical analysis was performed as previously described 17 using formalin-fixed retinal sections from mouse eyes embedded in resin (Unicryl; Electron Microscopy Sciences, Fort Washington, PA). Thin sections were collected on 200-mesh nickel grids. The sections were blocked with 5% normal goat serum (Vector Laboratories, Burlingame, CA) and incubated in anti-MFRP affinity-purified antibodies (1:20 dilution) at 4°C overnight, followed by incubation with a gold-conjugated secondary antibody (1:10 dilution, 25-nm gold particles; Sigma-Aldrich, St. Louis, MO). Sections were rinsed and poststained with uranyl acetate and lead citrate before viewing and photography with an electron microscope (model JEM1200EX II; JEOL, Tokyo, Japan). 
Generation of MFRP Constructs and Expression of MFRP and CTRP5 in COS-7 Cells
Primers with BamHI and NotI restriction sites were designed to amplify the full-length coding region of MFRP by using the human IMAGE clone 5262504 as a template (Table 1) . An MFRP fragment containing complete coding sequence was ligated into the pcDNA4C vector (Invitrogen) to obtain an Xpress tag at the N terminus of the protein (X-M). Similarly, C-terminal V5 tagged CTRP5 (C-V5) construct was generated using the pcDNA3B vector. 14 All cloned DNA fragments were completely sequence verified. COS-7 cells were transfected with expression constructs or control vectors (Lipofectamine Plus; Invitrogen). 16 Mock transfections were performed by using transfection reagents only. Cells were harvested after 36 hours of transfection for protein isolation. 
Immunoprecipitation and Immunoblot
Cell lysates were prepared in lysis buffer (50 mM Tris-HCl [pH 7.4], 0.15 M NaCl, 1 mM EDTA, 0.1% Triton X-100, and 0.1% [wt/vol] SDS), containing protease inhibitor cocktail (Sigma-Aldrich). For immunoprecipitation cell lysates containing ∼300 μg proteins were incubated with the respective primary antibodies overnight at 4°C with gentle shaking. Immunocomplexes were collected by incubation with protein G-Sepharose beads (GE Healthcare, Piscataway, NJ) at 4°C with gentle shaking for 2 hours. The beads were washed, suspended in Laemmli sample buffer, and then analyzed by SDS-PAGE, followed by Western blot analysis. 16  
Total protein extract was prepared from mouse whole eye, and from human RPE-choroid in lysis buffer containing complete protease inhibitor cocktail. The extracts containing approximately 300 μg of protein were subjected to immunoprecipitation and followed by immunoblot analysis, as described. 
Results
Spatial and Temporal Expression of Mfrp Gene in Mouse Tissue
Analysis of various tissues from 33-week-old C57BL/6 mouse detected highest levels of Mfrp gene transcripts in the PS of the mouse eye, followed by the I-CB (Fig. 1A) . In addition to these tissues, expression of Mfrp was observed in testis (Fig. 1A) . All other tissue showed no significant level of expression. Expression of Mfrp in the PS and ciliary body is consistent with our previous observations in human tissues and the expression pattern observed by in situ hybridization in mouse tissues. 6 11  
Katoh 1 reported faint expression of MFRP in the adult and fetal brain by Northern blot analysis and by the isolation of a cDNA clone of MFRP gene from fetal brain. Using a probe specific to Mfrp, Kameya et al., 6 failed to detect the presence of Mfrp transcript in the adult mouse brain by Northern blot analysis. 6 To evaluate the expression of Mfrp in the brain tissue further, we measured the levels of Mfrp expression in the adult mouse brain tissue by qRT-PCR. Consistent with the findings reported by Kameya et al., we did not detect measurable amounts of Mfrp transcript in the adult mouse brain (Fig 1A) . These observations indicate that Mfrp is either not expressed or expressed at very low levels in brain. 
Expression of this gene during embryonic development was determined by qRT-PCR using the RNA isolated from whole embryos between E7 and E17. Presence of Mfrp transcript was first observed at E11 and continued at E15 and E17 (Fig. 1B) . Alterations observed in the levels of Mfrp expression during embryonic development could be due to the changing ratio of the tissues expressing the gene to the total size of the embryo (Fig. 1B)
In whole eyeballs, the highest level of Mfrp was detected at P1 (Fig. 1B) . At P3, the level decreased to almost 50% of P1 and at P5 to almost 75% (Fig. 1B) . From P7 to P30, the expression levels remained unchanged (Fig. 1B) . Very high levels of Mfrp observed at the day of birth and up to P5, indicate a higher requirement of this protein at this particular phase of eye development of mouse and suggest a possible role for MFRP in developmental processes of the eye. 
Subsequently, we studied the expression of the Mfrp gene as a function of age in ocular tissues that express this gene in high abundance: the PS and I-CB. The expression of Mfrp in both these tissues was significantly higher at 6 months when compared with the levels observed at 1 and 2 months (Fig 2 ; P < 0.01). This high level of expression in both the tissues was maintained up to 20 months (the highest age point we tested; Fig. 2 ). These data indicate that Mfrp expression is not only important for the development of the eye but also it may have a role in maintenance of the eye tissues with the progression of age. 
Distribution of MFRP Protein in Mouse Ocular Tissues
Using polyclonal antibodies raised against MFRP protein, expression of this protein was observed in the presumptive RPE layer of the developing eyes of C57BL/6 mice at E18 (Fig 3A , arrows). These observations are consistent with the findings using qRT-PCR. Predominant localization of the MFRP protein was found to be consistent in the RPE layer at all the developing stages analyzed from P1 to P15. Figure 3B(arrows) shows localization in P5 retina, and Figure 3C(arrows) shows localization in P10 retina. Intense MFRP labeling was detected in the developing ciliary body and iris tissues at P5 (Fig. 3D)and P10 (Fig. 3E)
In adult mouse eye, intense MFRP labeling was observed at the apical side of the RPE (Fig. 4B , arrows). In a parallel experiment when the primary antibodies were replaced with goat preimmune sera, no staining was detected in the RPE (Fig. 4A) . The pattern of staining indicates that MFRP in the RPE is located predominantly on apical membrane (Fig. 4B , arrow) and to a lesser extent on basal membrane (Fig. 4C , arrowhead). The labeling observed on the nerve fibers below the ganglion cell layer could be due to nonspecific staining, as similar labeling was also observed in the negative controls (Figs. 4A 4B) . Colocalization with ezrin (Fig. 4D) , a marker of RPE microvilli, indicates that MFRP protein is mainly restricted to the base of the apical processes (Fig. 4E , yellow). MFRP did not colocalize with TIMP3 (data not shown), indicating that it is predominantly a RPE membrane protein rather than a component of extracellular matrix (ECM). 
Based on qRT-PCR analysis, the other region of the eye that showed significant expression of this gene is the CB. MFRP protein localized predominantly to the membranes of ciliary epithelium (CE; Figs. 4F 4G ). In contrast to its localization in RPE, a uniform distribution of MFRP protein was observed in both apical and basal membranes of the CE (Figs. 4F 4G) . TIMP3 localized to the extracellular spaces between the basement membranes of the pigmented CE (Fig. 4G , red, arrowheads) and MFRP did not colocalize with TIMP3. These data indicate that MFRP is a membrane protein of retinal pigmented and ciliary epithelia and does not belong to the extracellular matrix complexes. 
When localization of MFRP protein in mouse RPE was evaluated by immunoelectron microscopy, MFRP immunolabeling was detected on both apical and basal RPE membranes. On the apical surface, immunolabeling was primarily localized to the base of the apical process with little to no labeling of the apical processes surrounding the photoreceptor outer segments (Fig. 5A , arrows). This is consistent with the localization observed by light microscopy. On the basal side, MFRP immunolabeling was present on the membranes of the basal infoldings of the RPE cells (Fig. 5B , arrows). In addition, MFRP was found in Bruch’s membrane (Fig. 5B , arrows). Control sections in which the anti-MFRP antibodies were replaced with normal goat serum, served as negative control and contained no gold particles (Figs. 5A ′, 5B ′). 
Colocalization of MFRP with CTRP5 in the RPE and CB
Colocalization of MFRP and CTRP5 in the RPE was studied on selected tangential sections of albino mouse eyes in which the orientation of the RPE layer enabled us to observe the hexagonal RPE morphology more clearly. As reported earlier, CTRP5 protein was observed in a punctuate pattern on the hexagonal RPE membrane (Fig. 6A , red). In the same section, MFRP showed a slightly diffused localization pattern on the RPE membranes (Fig. 6B , green). Colocalization of CTRP5 and MFRP is detected on the RPE membranes (Figs. 6C , yellow). 
In the CB, CTRP5 is distinctly localized to the apposed apical surfaces of the bilayered CE (Fig. 6D , red), whereas MFRP was localized in a slightly diffused fashion, more or less uniformly on the ciliary epithelial membranes (Fig. 6E , green; also shown in Figs. 4F 4G ). Prominent colocalization of these proteins is seen mainly on the apical surface of pigmented epithelium (Fig. 6F , yellow). 
Colocalization of MFRP with CTRP5 on the Apical Membrane of MDCK Cells
RPE and CE are polarized epithelial cells. We previously showed that CTRP5 localizes to the apical membranes as well as to the lateral membranes (near the junction) of cultured MDCK cells, a model of polarized epithelium. 14 Endogenous expression of CTRP5 and MFRP was detected by qRT-PCR in MDCK cells (data not shown). In the confluent MDCK cells forming junctions, MFRP was distributed on the apical membrane (Fig. 7A , red, arrows on the x-z and y-z axis). CTRP5 localized to both the apical (Fig. 7B , green, arrowheads) and lateral membranes (Fig. 7B , green, arrows). On the apical surface of MDCK cells, a significant colocalization of MFRP and CTRP5 was observed (Fig. 7C , yellow, arrows). This observation indicates that the colocalization of CTRP5 and MFRP observed on the apical membranes of RPE and CE could be a generalized feature of polarized epithelia. Further, this colocalization suggests a possible physical interaction between these two proteins. 
Interaction of MFRP with CTRP5
In vivo interaction of MFRP with CTRP5 proteins was studied by immunoprecipitation followed by immunoblot analysis of tissue extracts of human RPE-choroid and mouse eye. With polyclonal antibodies raised against CTRP5 and MFRP proteins, bands corresponding to the predicted sizes of CTRP5 (∼25 kDa) and MFRP (∼65 kDa) were detected in human RPE-choroid and mouse whole eye extracts by Western blot analysis (Fig. 8A) . The immunocomplex pulled down from the extracts of human RPE-choroid and mouse eye with the anti-MFRP antibodies showed the presence of bands corresponding to CTRP5 proteins when blotted with anti-CTRP5 antibodies (Fig. 8B , lanes 1, 2). In a reciprocal experiment, bands corresponding to the size of MFRP were detected by anti-MFRP antibodies in the immunoprecipitates obtained using anti-CTRP5 antibodies (Fig. 8B , lanes 3, 4). The coimmunoprecipitation of CTRP5 along with MFRP from the RPE-choroid of the human or eye extracts of mouse suggests a putative interaction between CTRP5 and MFRP in these tissues. 
To establish further the potential interaction of CTRP5 and MFRP proteins, we expressed these proteins in a heterologous system with specific tags. MFRP protein was produced with an N-terminal Xpress tag and CTRP5 with C-terminal V5. COS-7 cells were cotransfected with the two expression constructs encoding Xpress-tagged MFRP protein (∼70 kDa, X-M) and V5-tagged CTRP5 protein (∼ 29kDa, C-V5). Western blot analysis using tag-specific antibodies showed the expression of these proteins in transfected COS-7 cells (Fig. 9A) . Vector alone or mock-transfected cell lysates did not show the presence of CTRP5-V5 or Xpress-MFRP proteins (Fig. 9A ; lanes 3, 4, 7). 
Extracts of these cells were immunoprecipitated with antibodies specific to (1) V5, (2) CTRP5, and (3) Xpress. On immunoprecipitation with anti-V5 antibodies, which pulls down the CTRP5 protein (Fig. 9B , lanes 1, 2, respectively), the presence of MFRP was also detected in the immunocomplex when it was probed with anti-MFRP antibodies or anti-Xpress antibodies (Fig. 9B , lanes 3, 4, respectively). Similarly, when COS-7 cell extracts were immunoprecipitated with CTRP5-specific antibodies and probed with anti-MFRP or anti-Xpress antibodies, bands corresponding to MFRP (70 kDa) were observed (Fig. 9C , lanes 3, 4, respectively). Likewise, when the cell extracts were immunoprecipitated with anti-Xpress antibodies and probed with anti-CTRP5 and anti-V5 antibodies, bands corresponding to the size of CTRP5 were detected (Fig. 9D , lanes 1, 2, respectively). When unrelated antibodies (anti-ABCA4) were used for pull-down assays, no protein bands were detected in the immunocomplex with CTRP5 or MFRP antibodies (Fig. 9D , lane 3 and data not shown). These results support the hypothesis that there is a physical interaction between CTRP5 and MFRP proteins. 
Discussion
Ctrp5 and Mfrp as Dicistronic Genes
CTRP5 and MFRP have been suggested to be dicistronic, as both open reading frames (ORFs) of these genes are observed on a single mRNA transcript in the mouse. 6 The presence of dicistronic mRNA has also been shown by PCR amplification of cDNA with primers designed from the regions of human CTRP5 and MFRP genes. 6 10 We also identified a human cDNA clone (IMAGE 5262504), containing MFRP mRNA sequence, and subsequent sequence analysis of this clone revealed that it contains the ORFs of both the CTRP5 and MFRP genes (GenBank ID AJ862823; http://www.ncbi.nlm.nih.gov/Genbank; provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD), suggesting possible dicistronic structure of CTRP5 and MFRP transcripts. The CTRP5 gene is located in the 3′ untranslated region of the MFRP gene. Although this evidence supports the structural dicistronic nature of CTRP5 and MFRP, no experimental proof is yet available to confirm its functional characteristics (i.e., the production of two proteins), and it does not rule out the possible existence of an independent CTRP5 mRNA. 
In eukaryotes, dicistronic transcripts are rare, and those that are transcribed as dicistronic due to the closeness of the genes are usually structurally dicistronic, and only the first gene (or, the 5′ open reading frame [ORF]) is functional. 18 We observed that there is no polyA signal between the MFRP and CTRP5 gene sequences, and this may result in continuation of transcription beyond the MFRP sequence up to the polyA signal of CTRP5 resulting in a dicistronic transcript. Nevertheless, the translation from the second ORF is a rare event and requires ribosomal re-entry after falling off of the ribosomal complex at the stop codon of the first ORF. 18 19 We observed the presence of ∼1.5-kb transcripts in mouse tissues by Northern blot analysis using a Ctrp5 probe (data not shown). Kameya et al., 6 also detected a 1.4-kb transcript in mouse brain and eye by using a Ctrp5 probe. In addition, the expression profile of Ctrp5 and Mfrp in various tissues was observed to be distinctly different. Ctrp5 is expressed in several human and mouse tissues, 14 but Mfrp expression is restricted to eyes and testes. These observations suggest possible independent transcription of Ctrp5. Detailed experimental evaluation is needed to establish the nature of these genes, which are located in close proximity in the genome. 
Role of MFRP in Eye Development and Retinal Physiology
MFRP mutations in humans resulted in microphthalmia, suggesting abnormality in ocular development. 8 We observed the expression of Mfrp in mouse embryo at E11, and a very high level in the eye at birth, which dramatically decreased in a week’s time (Fig. 1B) . The expression of Mfrp at E11 coincides with the development of the pigmented layer in the presumptive retina. At birth, the iris, CB, and trabecular meshwork have a primitive appearance represented by a continuous mass of cells with densely stained nuclei and develop into mature structures within eight postnatal days. 20 The high level of expression of Mfrp during early postnatal days might suggest a critical role for this gene in the development of the anterior segment of the eye, which eventually determines the eye size. The nanophthalmos (extremely small eye) and angle-closure glaucoma observed in patients with MFRP mutations could be due to developmental abnormalities of the anterior segments. 8  
Of note, no anterior segment abnormalities or reduction in eye size were reported in rd6 mice with a Mfrp splice-site mutation. 6 7 The MFRP protein is a frizzled-related protein, containing a transmembrane domain followed by a proline-rich intracellular region and a large extracellular portion comprising a serine-threonine-proline–rich interval (STP) domain, two CUB domains, two LdLa receptor domains, and a CRD, or frizzled (Fz), domain. 1 MFRP with diverse functional domains may have more than one functional activity in a cell. The CUB domains in other proteins participate in protein–protein interactions, and frizzled domain-containing proteins participate in WNT signaling and are known to be involved in the development, differentiation, and polarity determination of tissues. 21 In rd6 mice, the mutation in Mfrp causes an in-frame deletion of 58 amino acids that results in the loss of a small part of the transmembrane domain and the STP domain, but the CUB, LdLa, and Fz domains remain unaffected. It is possible that the in-frame deletion of Mfrp in rd6 mice does not affect its function in the development and differentiation of the eye, which would explain the normal anterior segment in these mice. 
Individuals with null mutations in the MFRP gene showed normal development and function of the retina even in adulthood, suggesting that MFRP function may not be critical for the normal development or function of the retina. However, rd6 mice develop recessive retinal degeneration. The loss of the STP domain in rd6 mice probably alters the interaction of MFRP with other proteins and/or may result in gain of function, leading to retinal degeneration. Variations in the phenotype of the anterior and PSs of the rd6 mouse eye may indicate that the MFRP gene may have a different functional role in the CE and RPE. Alternatively, the function of MFRP may be significantly different in the eyes of mice and humans. 9  
Interaction of MFRP with CTRP5
Highest level of expression of Ctrp5 and Mfrp was observed in the RPE and CE, the tissues involved in the pathogenesis of nanophthalmos, recessive retinal degeneration and L-ORD. 6 10 11 In both RPE and CE, we observed colocalization of these proteins (Figs. 6C 6F) . In addition, we detected the presence of both these proteins in the same immunocomplex on pull-down from tissues, and cultured cells expressing these proteins (Figs. 8 9) . These observations indicate potential interaction between CTRP5 and MFRP and a possible role for these proteins in a common biological pathway. A recent report by Shu et al., 22 further supports colocalization of CTRP5 with MFRP and interaction between these proteins. We and others observed that CTRP5 exists as a secreted protein in addition to the membrane associated form. 14 22 The CTRP5 protein contains a globular C1q domain (gC1q). 23 The C1q-containing proteins are known to interact with C1s and C1r proteins to form the first complex of complement system C1. 24 25 This interaction takes place through the extracellular CUB domains present in C1r and C1s proteins. 26 The two CUB domains of C1r and C1s at their N-terminal region are structurally very similar to the CUB domains of MFRP. Therefore, it is possible that the secretory protein CTRP5 interacts with MFRP protein on the extracellular surface through the gC1q and CUB domains to activate the specific cellular processes necessary for ocular development and functioning. 
In summary, the localization of the MFRP protein to the membrane of two polarized epithelia, ciliary and retinal pigment, suggests its likely involvement in polarity determination of these tissues. In addition, developmental abnormalities observed in the eye due to null mutations in the MFRP gene indicate that MFRP plays a key role in the development of ocular tissues. 8 Interaction of MFRP with CTRP5 and their involvement in anterior (hyperopia, glaucoma) and PS abnormalities (retinal degeneration, L-ORD) indicate that these two genes play a key role in the development and aging of the RPE and CE. Additional studies on these genes and their products along with the related class of proteins will define the functional role of these genes and assist in understanding the mechanism of ocular development and disease due to mutations in these genes. 
 
Table 1.
 
PCR Primers
Table 1.
 
PCR Primers
Gene Forward (5′–3′) Reverse (5′–3′)
Mfrp Primers for qRT-PCR:
TGCAATGGATGTGTGACTTA GACAAGGGGGTAGGATAGTG
MFRP Primers for cloning:
GAGAGAGGATCCATGAAGGACTTCTCAGATGTCATC GAGGAGGCGGCCGCTCAGGGCTGGGCACAAGCTTCC
Figure 1.
 
(A) Quantitative expression of Mfrp in different tissues of adult mouse. Expression values are determined by qRT-PCR and presented on an arbitrary scale (y-axis) after normalization with mouse Gapdh, Hgprt, Actin-b, and Rpl 19. Data represent the mean (±SD) on an arbitrary scale and were calculated from at least three independent observations. LI, liver; LU, lungs; B, brain; iris-ciliary body, I-CB; PS, posterior eye including RPE, choroid and sclera; R, retina; L, lens; H, heart; SP, spleen; K, kidney; SM, skeletal muscle; S, skin; T, testis; U, uterus. (B) Expression of Mfrp during embryonic and postnatal development of mouse. RNA isolated from whole embryos at E7 to E17 were used for cDNA preparation. Similarly, RNA isolated from the whole eye at P1 to P30 were used for cDNA preparation and qRT-PCR. The scale used to present the data is comparable to the scale used in (A).
Figure 1.
 
(A) Quantitative expression of Mfrp in different tissues of adult mouse. Expression values are determined by qRT-PCR and presented on an arbitrary scale (y-axis) after normalization with mouse Gapdh, Hgprt, Actin-b, and Rpl 19. Data represent the mean (±SD) on an arbitrary scale and were calculated from at least three independent observations. LI, liver; LU, lungs; B, brain; iris-ciliary body, I-CB; PS, posterior eye including RPE, choroid and sclera; R, retina; L, lens; H, heart; SP, spleen; K, kidney; SM, skeletal muscle; S, skin; T, testis; U, uterus. (B) Expression of Mfrp during embryonic and postnatal development of mouse. RNA isolated from whole embryos at E7 to E17 were used for cDNA preparation. Similarly, RNA isolated from the whole eye at P1 to P30 were used for cDNA preparation and qRT-PCR. The scale used to present the data is comparable to the scale used in (A).
Figure 2.
 
Relative expression of Mfrp in mouse eye tissues during aging. Expression of Mfrp measured in PSs and in the I-CB tissues by qRT-PCR at different time points during aging. Data represent the mean (± SD) on an arbitrary scale (y-axis) and were calculated from at least three independent observations.
Figure 2.
 
Relative expression of Mfrp in mouse eye tissues during aging. Expression of Mfrp measured in PSs and in the I-CB tissues by qRT-PCR at different time points during aging. Data represent the mean (± SD) on an arbitrary scale (y-axis) and were calculated from at least three independent observations.
Figure 3.
 
Distribution of MFRP protein in the developing mouse eye. Immunofluorescence microscopy was used to detect MFRP labeling (red) in sections of developing mouse eye from E18 to P10. MFRP is localized to the presumptive RPE layer at E18 (A, arrows). A similar localization pattern was observed at P5 (B, arrows) and P10 (C, arrows) in the section of mouse eye showing the presumptive retina. In the anterior segments of the eye, intense MFRP labeling was detected on the developing ciliary body and iris at P5 (D) and P10 (E). RPE, retinal pigment epithelium; NR, neural retina; GCL, ganglion cell layer; ONL, outer nuclear layer; INL, inner nuclear layer; CB, ciliary body.
Figure 3.
 
Distribution of MFRP protein in the developing mouse eye. Immunofluorescence microscopy was used to detect MFRP labeling (red) in sections of developing mouse eye from E18 to P10. MFRP is localized to the presumptive RPE layer at E18 (A, arrows). A similar localization pattern was observed at P5 (B, arrows) and P10 (C, arrows) in the section of mouse eye showing the presumptive retina. In the anterior segments of the eye, intense MFRP labeling was detected on the developing ciliary body and iris at P5 (D) and P10 (E). RPE, retinal pigment epithelium; NR, neural retina; GCL, ganglion cell layer; ONL, outer nuclear layer; INL, inner nuclear layer; CB, ciliary body.
Figure 4.
 
Localization of MFRP protein in the mouse eye. By immunofluorescence microscopy, MFRP labeling (green) was detected on apical and basal membranes of RPE (B, C). (A) Mouse retinal section in which the anti-MFRP antibodies were replaced with normal goat serum, served as a negative control. (D) Localization of the apical process marker ezrin (red) (E) colocalization of MFRP with ezrin (yellow, arrow, arrowhead). (F) Localization of MFRP (green) in mouse ciliary body. (G) Localization of MFRP (green) in comparison to TIMP3 (red). RPE, retinal pigment epithelium; PR, photoreceptors; ONL, outer nuclear layer; OPL, outer plexiform layer; INL, inner nuclear layer; IPL, inner plexiform layer; GCL, ganglion cell layer; CE, ciliary epithelia. Scales bars are in micrometers.
Figure 4.
 
Localization of MFRP protein in the mouse eye. By immunofluorescence microscopy, MFRP labeling (green) was detected on apical and basal membranes of RPE (B, C). (A) Mouse retinal section in which the anti-MFRP antibodies were replaced with normal goat serum, served as a negative control. (D) Localization of the apical process marker ezrin (red) (E) colocalization of MFRP with ezrin (yellow, arrow, arrowhead). (F) Localization of MFRP (green) in mouse ciliary body. (G) Localization of MFRP (green) in comparison to TIMP3 (red). RPE, retinal pigment epithelium; PR, photoreceptors; ONL, outer nuclear layer; OPL, outer plexiform layer; INL, inner nuclear layer; IPL, inner plexiform layer; GCL, ganglion cell layer; CE, ciliary epithelia. Scales bars are in micrometers.
Figure 5.
 
Immunoelectron microscopic localization of the MFRP protein in the mouse RPE. MFRP immunolabeling (25-nm gold particles) was detected on the apical and basal membranes of RPE. At the apical surface, immunolabeling was primarily localized to the apical plasma membrane. Little or no labeling of the apical processes surrounding the photoreceptor outer segments was observed (A, arrows). On the basal side, MFRP immunolabeling was present on the membranes of the basal infoldings of the RPE cells (B, arrows). In addition, MFRP was found in Bruch’s membrane (B, arrows). A′, B′: Apical and basal RPE, respectively, in which the anti-MFRP antibodies were replaced with normal goat serum, served as negative controls. RPE, retinal pigment epithelium; AP, apical processes; ROS, rod outer segments; BM, Bruch’s membrane. Scale bars: 500 nm.
Figure 5.
 
Immunoelectron microscopic localization of the MFRP protein in the mouse RPE. MFRP immunolabeling (25-nm gold particles) was detected on the apical and basal membranes of RPE. At the apical surface, immunolabeling was primarily localized to the apical plasma membrane. Little or no labeling of the apical processes surrounding the photoreceptor outer segments was observed (A, arrows). On the basal side, MFRP immunolabeling was present on the membranes of the basal infoldings of the RPE cells (B, arrows). In addition, MFRP was found in Bruch’s membrane (B, arrows). A′, B′: Apical and basal RPE, respectively, in which the anti-MFRP antibodies were replaced with normal goat serum, served as negative controls. RPE, retinal pigment epithelium; AP, apical processes; ROS, rod outer segments; BM, Bruch’s membrane. Scale bars: 500 nm.
Figure 6.
 
Colocalization of MFRP and CTRP5 proteins on RPE and ciliary epithelia. By immunofluorescence labeling of a tangential section of the mouse eye with a flattened RPE layer, localization of the CTRP5 (red) and MFRP (green) proteins was detected using confocal microscopy (A, B). Both proteins are localized to RPE membrane. (C) Merged image (yellow) of (A) and (B). Similarly, CTRP5 and MFRP localization and colocalization on ciliary body tissues are shown in (D), (E), and (F), respectively. Scale bars: 20 μm.
Figure 6.
 
Colocalization of MFRP and CTRP5 proteins on RPE and ciliary epithelia. By immunofluorescence labeling of a tangential section of the mouse eye with a flattened RPE layer, localization of the CTRP5 (red) and MFRP (green) proteins was detected using confocal microscopy (A, B). Both proteins are localized to RPE membrane. (C) Merged image (yellow) of (A) and (B). Similarly, CTRP5 and MFRP localization and colocalization on ciliary body tissues are shown in (D), (E), and (F), respectively. Scale bars: 20 μm.
Figure 7.
 
Colocalization of MFRP and CTRP5 proteins on polarized epithelial cells. In MDCK cells, endogenous MFRP (red) showed apical membrane localization (A), arrows showing the apical membranes, also in y-z and x-z plane). The CTRP5 protein (green) showed both apical and lateral membrane localization (B, arrowheads show the apical membrane and the arrows show the lateral membrane). The MFRP localization on apical membrane coincides with the localization of CTRP5 as shown in (C, yellow, arrows). The scale bar is in micrometers.
Figure 7.
 
Colocalization of MFRP and CTRP5 proteins on polarized epithelial cells. In MDCK cells, endogenous MFRP (red) showed apical membrane localization (A), arrows showing the apical membranes, also in y-z and x-z plane). The CTRP5 protein (green) showed both apical and lateral membrane localization (B, arrowheads show the apical membrane and the arrows show the lateral membrane). The MFRP localization on apical membrane coincides with the localization of CTRP5 as shown in (C, yellow, arrows). The scale bar is in micrometers.
Figure 8.
 
(A) Western blot analysis of RPE-choroid and the whole eye tissue with CTRP5 and MFRP antibodies. Lanes 1 and 2: probed with anti-CTRP5 antibodies; lanes 3 and to 4:probed with anti-MFRP antibodies. Lane 1, human RPE-choroid; lane 2, mouse whole eye; lane 3, human RPE-choroid; lane 4, mouse whole eye. (B) Coimmunoprecipitation of CTRP5 and MFRP proteins from tissue extracts. Lanes 1 to 2: IP with anti-MFRP antibodies and probed with anti-CTRP5 antibodies; lanes 3 to 4: IP with anti-CTRP5 antibodies and probed with anti-MFRP antibodies. Lane contents are as in (A). Molecular masses (kDa) for both blots are marked on the left of (A). IP, immunoprecipitation; IB, immunoblot analysis.
Figure 8.
 
(A) Western blot analysis of RPE-choroid and the whole eye tissue with CTRP5 and MFRP antibodies. Lanes 1 and 2: probed with anti-CTRP5 antibodies; lanes 3 and to 4:probed with anti-MFRP antibodies. Lane 1, human RPE-choroid; lane 2, mouse whole eye; lane 3, human RPE-choroid; lane 4, mouse whole eye. (B) Coimmunoprecipitation of CTRP5 and MFRP proteins from tissue extracts. Lanes 1 to 2: IP with anti-MFRP antibodies and probed with anti-CTRP5 antibodies; lanes 3 to 4: IP with anti-CTRP5 antibodies and probed with anti-MFRP antibodies. Lane contents are as in (A). Molecular masses (kDa) for both blots are marked on the left of (A). IP, immunoprecipitation; IB, immunoblot analysis.
Figure 9.
 
(A) Expression of V5-tagged CTRP5 and Xpress-tagged MFRP in COS-7 cells. Lanes 1 to 4: cell extracts probed with anti-V5 antibodies; lanes 5 to 8: cell extracts probed with anti-Xpress antibodies. Lane1: extract of COS-7 cells transfected with C-terminal-V5–tagged CTRP5 (C-V5); lane 2; C-V5 and N-terminal Xpress–tagged MFRP (X-M); lane 3: vector only; lane 4: transfection reagent only (mock); lane 5: C-V5; lane 6: X-M; lane 7: vector only; and lane 8: C-V5 and X-M. (BD) Interaction of CTRP5 with MFRP. (B) COS-7 cells were cotransfected with C-V5 and X-M and immunoprecipitated with anti-V5 antibodies. The immunoprecipitate was probed with anti-CTRP5 antibodies (lane 1); anti-V5 antibodies (lane 2); anti-MFRP antibodies (lane 3); and anti-Xpress antibodies (lane 4). (C) COS-7 cells were cotransfected with C-V5 and X-M and immunoprecipitated with anti-CTRP5 antibodies. The immunocomplex was probed with anti-CTRP5 antibodies (lane 1); anti-V5 antibodies (lane 2); anti-MFRP antibodies (lane 3); and anti-Xpress antibodies (lane 4). (D) Extracts of COS-7 cells cotransfected with C-V5 and X-M were immunoprecipitated with anti-Xpress antibodies (lanes 1 and 2) and anti-ABCA4 antibodies (lane 3). Lane 1, probed with anti-CTRP5 antibodies; lanes 2 and 3, probed with anti-V5 antibodies. Left: molecular masses (kDa) for all blots. *, IgG heavy chain.
Figure 9.
 
(A) Expression of V5-tagged CTRP5 and Xpress-tagged MFRP in COS-7 cells. Lanes 1 to 4: cell extracts probed with anti-V5 antibodies; lanes 5 to 8: cell extracts probed with anti-Xpress antibodies. Lane1: extract of COS-7 cells transfected with C-terminal-V5–tagged CTRP5 (C-V5); lane 2; C-V5 and N-terminal Xpress–tagged MFRP (X-M); lane 3: vector only; lane 4: transfection reagent only (mock); lane 5: C-V5; lane 6: X-M; lane 7: vector only; and lane 8: C-V5 and X-M. (BD) Interaction of CTRP5 with MFRP. (B) COS-7 cells were cotransfected with C-V5 and X-M and immunoprecipitated with anti-V5 antibodies. The immunoprecipitate was probed with anti-CTRP5 antibodies (lane 1); anti-V5 antibodies (lane 2); anti-MFRP antibodies (lane 3); and anti-Xpress antibodies (lane 4). (C) COS-7 cells were cotransfected with C-V5 and X-M and immunoprecipitated with anti-CTRP5 antibodies. The immunocomplex was probed with anti-CTRP5 antibodies (lane 1); anti-V5 antibodies (lane 2); anti-MFRP antibodies (lane 3); and anti-Xpress antibodies (lane 4). (D) Extracts of COS-7 cells cotransfected with C-V5 and X-M were immunoprecipitated with anti-Xpress antibodies (lanes 1 and 2) and anti-ABCA4 antibodies (lane 3). Lane 1, probed with anti-CTRP5 antibodies; lanes 2 and 3, probed with anti-V5 antibodies. Left: molecular masses (kDa) for all blots. *, IgG heavy chain.
The authors thank Austra Liepa, Mitchell Gillett, Bruce Donohoe, and Deborah Eadie for their assistance in different aspects of this study and preparation of the manuscript. 
KatohM. Molecular cloning and characterization of MFRP, a novel gene encoding a membrane-type frizzled-related protein. Biochem Biophys Res Commun. 2001;282:116–123. [CrossRef] [PubMed]
WangY, MackeJP, AbellaBS, et al. A large family of putative transmembrane receptors homologous to the product of the Drosophila tissue polarity gene frizzled. J Biol Chem. 1996;271:4468–4476. [CrossRef] [PubMed]
SagaraN, TodaG, HiraiM, TeradaM, KatohM. Molecular cloning, differential expression, and chromosomal localization of human frizzled-1, frizzled-2, and frizzled-7. Biochem Biophys Res Commun. 1998;252:117–122. [CrossRef] [PubMed]
RattnerA, HsiehJC, SmallwoodPM, et al. A family of secreted proteins contains homology to the cysteine-rich ligand-binding domain of frizzled receptors. Proc Natl Acad Sci USA. 1997;94:2859–2863. [CrossRef] [PubMed]
ChangJT, EsumiN, MooreK, et al. Cloning and characterization of a secreted frizzled-related protein that is expressed by the retinal pigment epithelium. Hum Mol Genet. 1999;8:575–583. [CrossRef] [PubMed]
KameyaS, HawesNL, ChangB, HeckenlivelyJR, NaggertJK, NishinaPM. Mfrp, a gene encoding a frizzled related protein, is mutated in the mouse retinal degeneration 6. Hum Mol Genet. 2002;11:1879–1886. [CrossRef] [PubMed]
HawesNL, ChangB, HagemanGS, et al. Retinal degeneration 6 (rd6): a new mouse model for human retinitis punctata albescens. Invest Ophthalmol Vis Sci. 2000;41:3149–3157. [PubMed]
SundinOH, LeppertGS, SilvaED, et al. Extreme hyperopia is the result of null mutations in MFRP, which encodes a frizzled-related protein. Proc Natl Acad Sci USA. 2005;102:9553–9558. [CrossRef] [PubMed]
SundinOH. The mouse’s eye and Mfrp: not quite human. Ophthalmic Genet. 2005;26:153–155. [CrossRef] [PubMed]
HaywardC, ShuX, CideciyanAV, et al. Mutation in a short-chain collagen gene, CTRP5, results in extracellular deposit formation in late-onset retinal degeneration: a genetic model for age-related macular degeneration. Hum Mol Genet. 2003;12:2657–2667. [CrossRef] [PubMed]
AyyagariR, MandalMN, KaroukisAJ, et al. late-onset macular degeneration and long anterior lens zonules result from a CTRP5 gene mutation. Invest Ophthalmol Vis Sci. 2005;46:3363–3371. [CrossRef] [PubMed]
AmbasudhanR, WangX, JablonskiMM, et al. Atrophic macular degeneration mutations in ELOVL4 result in the intracellular misrouting of the protein. Genomics. 2004;83:615–625. [CrossRef] [PubMed]
MandalMN, AmbasudhanR, WongPW, GagePJ, SievingPA, AyyagariR. Characterization of mouse orthologue of ELOVL4: genomic organization and spatial and temporal expression. Genomics. 2004;83:626–635. [CrossRef] [PubMed]
MandalMNA, VasireddyV, ReddyGB, et al. CTRP5 is a membrane-associated and secretory protein in the RPE and ciliary body and the S163R mutation of CTRP5 impairs its secretion. Invest Ophthalmol Vis Sci. 2006;47:5505–5513. [CrossRef] [PubMed]
YangD, PanA, SwaminathanA, KumarG, HughesBA. Expression and localization of the inwardly rectifying potassium channel Kir7.1 in native bovine retinal pigment epithelium. Invest Ophthalmol Vis Sci. 2003;44:3178–3185. [CrossRef] [PubMed]
VasireddyV, VijayasarathyC, HuangJ, et al. Stargardt-like macular dystrophy protein ELOVL4 exerts a dominant negative effect by recruiting wild-type protein into aggresomes. Mol Vis. 2005;11:665–676. [PubMed]
WohabrebbiA, UmstotES, IannacconeA, DesiderioDM, JablonskiMM. Downregulation of a unique photoreceptor protein correlates with improper outer segment assembly. J Neurosci Res. 2002;67:298–308. [CrossRef] [PubMed]
KozakM. A second look at cellular mRNA sequences said to function as internal ribosome entry sites. Nucleic Acids Res. 2005;33:6593–6602. [CrossRef] [PubMed]
KozakM. Regulation of translation via mRNA structure in prokaryotes and eukaryotes. Gene. 2005;361:13–37. [CrossRef] [PubMed]
SmithRS, JohnSWM. Ocular development.SmithRS JohnSWM NishinaPM SundbergJP eds. Systemic Evaluation of the Mouse Eye: Anatomy, Pathology, and Biomethods. 2002;45–63.CRC Press New York.
LoganCY, NusseR. The Wnt signaling pathway in development and disease. Annu Rev Cell Dev Biol. 2004;20:781–810. [CrossRef] [PubMed]
ShuX, TullochB, LennonA, et al. Disease mechanisms in late-onset retinal macular degeneration associated with mutation in C1QTNF5. Hum Mol Genet. 2006;15:1680–1689. [CrossRef] [PubMed]
KishoreU, GhaiR, GreenhoughTJ, et al. Structural and functional anatomy of the globular domain of complement protein C1q. Immunol Lett. 2004;95:113–128. [CrossRef] [PubMed]
ArlaudGJ, GaboriaudC, ThielensNM, Budayova-SpanoM, RossiV, Fontecilla-CampsJC. Structural biology of the C1 complex of complement unveils the mechanisms of its activation and proteolytic activity. Mol Immunol. 2002;39:383–394. [CrossRef] [PubMed]
KishoreU, KojouharovaMS, ReidKB. Recent progress in the understanding of the structure-function relationships of the globular head regions of C1q. Immunobiology. 2002;205:355–364. [CrossRef] [PubMed]
Marchler-BauerA, AndersonJB, CherukuriPF, et al. CDD: a conserved domain database for protein classification. Nucleic Acids Res. 2005;33:D192–D196. [CrossRef] [PubMed]
Figure 1.
 
(A) Quantitative expression of Mfrp in different tissues of adult mouse. Expression values are determined by qRT-PCR and presented on an arbitrary scale (y-axis) after normalization with mouse Gapdh, Hgprt, Actin-b, and Rpl 19. Data represent the mean (±SD) on an arbitrary scale and were calculated from at least three independent observations. LI, liver; LU, lungs; B, brain; iris-ciliary body, I-CB; PS, posterior eye including RPE, choroid and sclera; R, retina; L, lens; H, heart; SP, spleen; K, kidney; SM, skeletal muscle; S, skin; T, testis; U, uterus. (B) Expression of Mfrp during embryonic and postnatal development of mouse. RNA isolated from whole embryos at E7 to E17 were used for cDNA preparation. Similarly, RNA isolated from the whole eye at P1 to P30 were used for cDNA preparation and qRT-PCR. The scale used to present the data is comparable to the scale used in (A).
Figure 1.
 
(A) Quantitative expression of Mfrp in different tissues of adult mouse. Expression values are determined by qRT-PCR and presented on an arbitrary scale (y-axis) after normalization with mouse Gapdh, Hgprt, Actin-b, and Rpl 19. Data represent the mean (±SD) on an arbitrary scale and were calculated from at least three independent observations. LI, liver; LU, lungs; B, brain; iris-ciliary body, I-CB; PS, posterior eye including RPE, choroid and sclera; R, retina; L, lens; H, heart; SP, spleen; K, kidney; SM, skeletal muscle; S, skin; T, testis; U, uterus. (B) Expression of Mfrp during embryonic and postnatal development of mouse. RNA isolated from whole embryos at E7 to E17 were used for cDNA preparation. Similarly, RNA isolated from the whole eye at P1 to P30 were used for cDNA preparation and qRT-PCR. The scale used to present the data is comparable to the scale used in (A).
Figure 2.
 
Relative expression of Mfrp in mouse eye tissues during aging. Expression of Mfrp measured in PSs and in the I-CB tissues by qRT-PCR at different time points during aging. Data represent the mean (± SD) on an arbitrary scale (y-axis) and were calculated from at least three independent observations.
Figure 2.
 
Relative expression of Mfrp in mouse eye tissues during aging. Expression of Mfrp measured in PSs and in the I-CB tissues by qRT-PCR at different time points during aging. Data represent the mean (± SD) on an arbitrary scale (y-axis) and were calculated from at least three independent observations.
Figure 3.
 
Distribution of MFRP protein in the developing mouse eye. Immunofluorescence microscopy was used to detect MFRP labeling (red) in sections of developing mouse eye from E18 to P10. MFRP is localized to the presumptive RPE layer at E18 (A, arrows). A similar localization pattern was observed at P5 (B, arrows) and P10 (C, arrows) in the section of mouse eye showing the presumptive retina. In the anterior segments of the eye, intense MFRP labeling was detected on the developing ciliary body and iris at P5 (D) and P10 (E). RPE, retinal pigment epithelium; NR, neural retina; GCL, ganglion cell layer; ONL, outer nuclear layer; INL, inner nuclear layer; CB, ciliary body.
Figure 3.
 
Distribution of MFRP protein in the developing mouse eye. Immunofluorescence microscopy was used to detect MFRP labeling (red) in sections of developing mouse eye from E18 to P10. MFRP is localized to the presumptive RPE layer at E18 (A, arrows). A similar localization pattern was observed at P5 (B, arrows) and P10 (C, arrows) in the section of mouse eye showing the presumptive retina. In the anterior segments of the eye, intense MFRP labeling was detected on the developing ciliary body and iris at P5 (D) and P10 (E). RPE, retinal pigment epithelium; NR, neural retina; GCL, ganglion cell layer; ONL, outer nuclear layer; INL, inner nuclear layer; CB, ciliary body.
Figure 4.
 
Localization of MFRP protein in the mouse eye. By immunofluorescence microscopy, MFRP labeling (green) was detected on apical and basal membranes of RPE (B, C). (A) Mouse retinal section in which the anti-MFRP antibodies were replaced with normal goat serum, served as a negative control. (D) Localization of the apical process marker ezrin (red) (E) colocalization of MFRP with ezrin (yellow, arrow, arrowhead). (F) Localization of MFRP (green) in mouse ciliary body. (G) Localization of MFRP (green) in comparison to TIMP3 (red). RPE, retinal pigment epithelium; PR, photoreceptors; ONL, outer nuclear layer; OPL, outer plexiform layer; INL, inner nuclear layer; IPL, inner plexiform layer; GCL, ganglion cell layer; CE, ciliary epithelia. Scales bars are in micrometers.
Figure 4.
 
Localization of MFRP protein in the mouse eye. By immunofluorescence microscopy, MFRP labeling (green) was detected on apical and basal membranes of RPE (B, C). (A) Mouse retinal section in which the anti-MFRP antibodies were replaced with normal goat serum, served as a negative control. (D) Localization of the apical process marker ezrin (red) (E) colocalization of MFRP with ezrin (yellow, arrow, arrowhead). (F) Localization of MFRP (green) in mouse ciliary body. (G) Localization of MFRP (green) in comparison to TIMP3 (red). RPE, retinal pigment epithelium; PR, photoreceptors; ONL, outer nuclear layer; OPL, outer plexiform layer; INL, inner nuclear layer; IPL, inner plexiform layer; GCL, ganglion cell layer; CE, ciliary epithelia. Scales bars are in micrometers.
Figure 5.
 
Immunoelectron microscopic localization of the MFRP protein in the mouse RPE. MFRP immunolabeling (25-nm gold particles) was detected on the apical and basal membranes of RPE. At the apical surface, immunolabeling was primarily localized to the apical plasma membrane. Little or no labeling of the apical processes surrounding the photoreceptor outer segments was observed (A, arrows). On the basal side, MFRP immunolabeling was present on the membranes of the basal infoldings of the RPE cells (B, arrows). In addition, MFRP was found in Bruch’s membrane (B, arrows). A′, B′: Apical and basal RPE, respectively, in which the anti-MFRP antibodies were replaced with normal goat serum, served as negative controls. RPE, retinal pigment epithelium; AP, apical processes; ROS, rod outer segments; BM, Bruch’s membrane. Scale bars: 500 nm.
Figure 5.
 
Immunoelectron microscopic localization of the MFRP protein in the mouse RPE. MFRP immunolabeling (25-nm gold particles) was detected on the apical and basal membranes of RPE. At the apical surface, immunolabeling was primarily localized to the apical plasma membrane. Little or no labeling of the apical processes surrounding the photoreceptor outer segments was observed (A, arrows). On the basal side, MFRP immunolabeling was present on the membranes of the basal infoldings of the RPE cells (B, arrows). In addition, MFRP was found in Bruch’s membrane (B, arrows). A′, B′: Apical and basal RPE, respectively, in which the anti-MFRP antibodies were replaced with normal goat serum, served as negative controls. RPE, retinal pigment epithelium; AP, apical processes; ROS, rod outer segments; BM, Bruch’s membrane. Scale bars: 500 nm.
Figure 6.
 
Colocalization of MFRP and CTRP5 proteins on RPE and ciliary epithelia. By immunofluorescence labeling of a tangential section of the mouse eye with a flattened RPE layer, localization of the CTRP5 (red) and MFRP (green) proteins was detected using confocal microscopy (A, B). Both proteins are localized to RPE membrane. (C) Merged image (yellow) of (A) and (B). Similarly, CTRP5 and MFRP localization and colocalization on ciliary body tissues are shown in (D), (E), and (F), respectively. Scale bars: 20 μm.
Figure 6.
 
Colocalization of MFRP and CTRP5 proteins on RPE and ciliary epithelia. By immunofluorescence labeling of a tangential section of the mouse eye with a flattened RPE layer, localization of the CTRP5 (red) and MFRP (green) proteins was detected using confocal microscopy (A, B). Both proteins are localized to RPE membrane. (C) Merged image (yellow) of (A) and (B). Similarly, CTRP5 and MFRP localization and colocalization on ciliary body tissues are shown in (D), (E), and (F), respectively. Scale bars: 20 μm.
Figure 7.
 
Colocalization of MFRP and CTRP5 proteins on polarized epithelial cells. In MDCK cells, endogenous MFRP (red) showed apical membrane localization (A), arrows showing the apical membranes, also in y-z and x-z plane). The CTRP5 protein (green) showed both apical and lateral membrane localization (B, arrowheads show the apical membrane and the arrows show the lateral membrane). The MFRP localization on apical membrane coincides with the localization of CTRP5 as shown in (C, yellow, arrows). The scale bar is in micrometers.
Figure 7.
 
Colocalization of MFRP and CTRP5 proteins on polarized epithelial cells. In MDCK cells, endogenous MFRP (red) showed apical membrane localization (A), arrows showing the apical membranes, also in y-z and x-z plane). The CTRP5 protein (green) showed both apical and lateral membrane localization (B, arrowheads show the apical membrane and the arrows show the lateral membrane). The MFRP localization on apical membrane coincides with the localization of CTRP5 as shown in (C, yellow, arrows). The scale bar is in micrometers.
Figure 8.
 
(A) Western blot analysis of RPE-choroid and the whole eye tissue with CTRP5 and MFRP antibodies. Lanes 1 and 2: probed with anti-CTRP5 antibodies; lanes 3 and to 4:probed with anti-MFRP antibodies. Lane 1, human RPE-choroid; lane 2, mouse whole eye; lane 3, human RPE-choroid; lane 4, mouse whole eye. (B) Coimmunoprecipitation of CTRP5 and MFRP proteins from tissue extracts. Lanes 1 to 2: IP with anti-MFRP antibodies and probed with anti-CTRP5 antibodies; lanes 3 to 4: IP with anti-CTRP5 antibodies and probed with anti-MFRP antibodies. Lane contents are as in (A). Molecular masses (kDa) for both blots are marked on the left of (A). IP, immunoprecipitation; IB, immunoblot analysis.
Figure 8.
 
(A) Western blot analysis of RPE-choroid and the whole eye tissue with CTRP5 and MFRP antibodies. Lanes 1 and 2: probed with anti-CTRP5 antibodies; lanes 3 and to 4:probed with anti-MFRP antibodies. Lane 1, human RPE-choroid; lane 2, mouse whole eye; lane 3, human RPE-choroid; lane 4, mouse whole eye. (B) Coimmunoprecipitation of CTRP5 and MFRP proteins from tissue extracts. Lanes 1 to 2: IP with anti-MFRP antibodies and probed with anti-CTRP5 antibodies; lanes 3 to 4: IP with anti-CTRP5 antibodies and probed with anti-MFRP antibodies. Lane contents are as in (A). Molecular masses (kDa) for both blots are marked on the left of (A). IP, immunoprecipitation; IB, immunoblot analysis.
Figure 9.
 
(A) Expression of V5-tagged CTRP5 and Xpress-tagged MFRP in COS-7 cells. Lanes 1 to 4: cell extracts probed with anti-V5 antibodies; lanes 5 to 8: cell extracts probed with anti-Xpress antibodies. Lane1: extract of COS-7 cells transfected with C-terminal-V5–tagged CTRP5 (C-V5); lane 2; C-V5 and N-terminal Xpress–tagged MFRP (X-M); lane 3: vector only; lane 4: transfection reagent only (mock); lane 5: C-V5; lane 6: X-M; lane 7: vector only; and lane 8: C-V5 and X-M. (BD) Interaction of CTRP5 with MFRP. (B) COS-7 cells were cotransfected with C-V5 and X-M and immunoprecipitated with anti-V5 antibodies. The immunoprecipitate was probed with anti-CTRP5 antibodies (lane 1); anti-V5 antibodies (lane 2); anti-MFRP antibodies (lane 3); and anti-Xpress antibodies (lane 4). (C) COS-7 cells were cotransfected with C-V5 and X-M and immunoprecipitated with anti-CTRP5 antibodies. The immunocomplex was probed with anti-CTRP5 antibodies (lane 1); anti-V5 antibodies (lane 2); anti-MFRP antibodies (lane 3); and anti-Xpress antibodies (lane 4). (D) Extracts of COS-7 cells cotransfected with C-V5 and X-M were immunoprecipitated with anti-Xpress antibodies (lanes 1 and 2) and anti-ABCA4 antibodies (lane 3). Lane 1, probed with anti-CTRP5 antibodies; lanes 2 and 3, probed with anti-V5 antibodies. Left: molecular masses (kDa) for all blots. *, IgG heavy chain.
Figure 9.
 
(A) Expression of V5-tagged CTRP5 and Xpress-tagged MFRP in COS-7 cells. Lanes 1 to 4: cell extracts probed with anti-V5 antibodies; lanes 5 to 8: cell extracts probed with anti-Xpress antibodies. Lane1: extract of COS-7 cells transfected with C-terminal-V5–tagged CTRP5 (C-V5); lane 2; C-V5 and N-terminal Xpress–tagged MFRP (X-M); lane 3: vector only; lane 4: transfection reagent only (mock); lane 5: C-V5; lane 6: X-M; lane 7: vector only; and lane 8: C-V5 and X-M. (BD) Interaction of CTRP5 with MFRP. (B) COS-7 cells were cotransfected with C-V5 and X-M and immunoprecipitated with anti-V5 antibodies. The immunoprecipitate was probed with anti-CTRP5 antibodies (lane 1); anti-V5 antibodies (lane 2); anti-MFRP antibodies (lane 3); and anti-Xpress antibodies (lane 4). (C) COS-7 cells were cotransfected with C-V5 and X-M and immunoprecipitated with anti-CTRP5 antibodies. The immunocomplex was probed with anti-CTRP5 antibodies (lane 1); anti-V5 antibodies (lane 2); anti-MFRP antibodies (lane 3); and anti-Xpress antibodies (lane 4). (D) Extracts of COS-7 cells cotransfected with C-V5 and X-M were immunoprecipitated with anti-Xpress antibodies (lanes 1 and 2) and anti-ABCA4 antibodies (lane 3). Lane 1, probed with anti-CTRP5 antibodies; lanes 2 and 3, probed with anti-V5 antibodies. Left: molecular masses (kDa) for all blots. *, IgG heavy chain.
Table 1.
 
PCR Primers
Table 1.
 
PCR Primers
Gene Forward (5′–3′) Reverse (5′–3′)
Mfrp Primers for qRT-PCR:
TGCAATGGATGTGTGACTTA GACAAGGGGGTAGGATAGTG
MFRP Primers for cloning:
GAGAGAGGATCCATGAAGGACTTCTCAGATGTCATC GAGGAGGCGGCCGCTCAGGGCTGGGCACAAGCTTCC
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×