September 2011
Volume 52, Issue 10
Free
Retinal Cell Biology  |   September 2011
Induction of Differentiation by Pyruvate and DMEM in the Human Retinal Pigment Epithelium Cell Line ARPE-19
Author Affiliations & Notes
  • Ahmad Ahmado
    From Departments of Ocular Biology and Therapeutics and
    the Department of Vitreoretinal Surgery, Moorfields Eye Hospital, London, United Kingdom.
  • Amanda-Jayne Carr
    From Departments of Ocular Biology and Therapeutics and
  • Anthony A. Vugler
    From Departments of Ocular Biology and Therapeutics and
  • Ma'ayan Semo
    From Departments of Ocular Biology and Therapeutics and
  • Carlos Gias
    From Departments of Ocular Biology and Therapeutics and
  • Jean M. Lawrence
    From Departments of Ocular Biology and Therapeutics and
  • Li Li Chen
    From Departments of Ocular Biology and Therapeutics and
  • Fred K. Chen
    From Departments of Ocular Biology and Therapeutics and
    the Department of Vitreoretinal Surgery, Moorfields Eye Hospital, London, United Kingdom.
  • Patric Turowski
    Cell Biology, University College London (UCL) Institute of Ophthalmology, London, United Kingdom; and
  • Lyndon da Cruz
    From Departments of Ocular Biology and Therapeutics and
    the Department of Vitreoretinal Surgery, Moorfields Eye Hospital, London, United Kingdom.
  • Peter J. Coffey
    From Departments of Ocular Biology and Therapeutics and
  • Corresponding author: Ahmad Ahmado, The London Project to Cure Blindness, Department of Ocular Biology and Therapeutics, UCL Institute of Ophthalmology, 11-43 Bath Street, London EC1V 9EL, United Kingdom; a.ahmado@ucl.ac.uk
Investigative Ophthalmology & Visual Science September 2011, Vol.52, 7148-7159. doi:10.1167/iovs.10-6374
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Ahmad Ahmado, Amanda-Jayne Carr, Anthony A. Vugler, Ma'ayan Semo, Carlos Gias, Jean M. Lawrence, Li Li Chen, Fred K. Chen, Patric Turowski, Lyndon da Cruz, Peter J. Coffey; Induction of Differentiation by Pyruvate and DMEM in the Human Retinal Pigment Epithelium Cell Line ARPE-19. Invest. Ophthalmol. Vis. Sci. 2011;52(10):7148-7159. doi: 10.1167/iovs.10-6374.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

Purpose.: Cultured retinal pigment epithelium (RPE) may become a therapeutic option for transplantation in retinal disease. However maintaining a native RPE phenotype in vitro has proven challenging. The human RPE cell-line ARPE-19 is used widely as an alternative to primary RPE. It is grown in DMEM/F12 medium as standard, but its phenotype is dependent on culture conditions, and many differentiation markers are usually absent. The purpose of this study was to examine how this sensitive phenotype of ARPE-19 can be modulated by growth media with or without the metabolite pyruvate to elucidate better RPE growth conditions.

Methods.: ARPE-19 cells at passages p22 to p28 were cultured on filters for up to 3 months in DMEM/F12 or DMEM media with or without pyruvate and 1% fetal calf serum. Assessment of differentiation was performed using pigmentation, immunocytochemistry, protein/mRNA expression, transepithelial resistance, VEGF secretion, and ultrastructure.

Results.: Pyruvate, in combination with DMEM, induced dark pigmentation and promoted differentiation markers such as CRALBP and MerTK. Importantly, RPE65 protein was detected by Western blotting and was enhanced by pyruvate, high glucose, and DMEM. ARPE-19 cells maintained in this medium could also phagocytose human photoreceptor outer segments (POS). VEGF secretion was greater in DMEM cultures and was affected by glucose but not by pyruvate. Pigmentation never occurred in DMEM/F12.

Conclusions.: This study demonstrated important differentiation markers, including pigmentation and Western blots of RPE65 protein, and showed human POS phagocytosis in ARPE-19 cultures using a simple differentiation protocol. The results favor the use of high-glucose DMEM with pyruvate for future RPE differentiation studies.

Establishing cultured cells that faithfully model their native tissue has always been a considerable challenge. Primary cultures are known to best retain native tissue characteristics. However, repeatedly preparing primary cultures from eyes may create problems of consistency with experimental results. Furthermore, RPE cells undergo de-differentiation in culture, losing favorable characteristics. 1 4 This phenomenon appears to be a product of cell substrate 5,6 and growth media. 3,7 This is particularly true after repeated passages because cell spreading and proliferation are known to be inversely related to differentiation. 1,8,9  
ARPE-19 is a spontaneously arising human RPE cell line that has become a good alternative, though not a superior one, to primary culture. 10 Dunn et al. 11 extensively characterized this cell line in 1996 and demonstrated several phenotypic characteristics similar to those of primary RPE. However, available passages for this cell line are limited to those above p20, and it has become difficult to replicate some differentiation characteristics, such as pigmentation, initially reported by these authors, especially when using DMEM/F12, the standard recommended growth medium for ARPE-19. One reason for this may be that higher passages of this cell line have become sensitive to culture conditions, and, unless specialized media are used, the RPE phenotype is suboptimal and lacks pigmentation. 7 Furthermore, this cell line has had low transepithelial resistance (TER) and lacks some major RPE differentiation and polarity markers. 7,12 Indeed ARPE-19 has been described as amelanotic and as lacking tyrosinase in recent literature 13 such that some have resorted to incubation of ARPE-19 with non–human melanin-granules to produce melanosome-rich cultures. 14 16 Additionally, Western blot analysis of ARPE-19 cells shows they do not produce RPE65 protein, 17 which is necessary for retinoid recycling. 
We decided to explore the effects of alternative growth media, some supplemented with pyruvate, to define requirements for differentiation without resorting to specialized additives. Pyruvate was selected because of its importance as a metabolic substrate and because there is evidence demonstrating the protective effect of pyruvate on cells in vivo and in vitro. 18 21  
Materials and Methods
Cell Culture
Unless otherwise stated, reagents were purchased from Invitrogen (Paisley, UK) and culture plastics from Fisher Scientific (Loughborough, UK). ARPE-19 passages used were p22 to p28. ARPE-19 cells were a kind gift from Naheed Kanuga (University College London, UK). Cells were initially maintained either in DMEM/F12 (1:1 mixture of Dulbecco's modified Eagle's medium and Ham's F12) or in DMEM with 4.5g/L glucose (high glucose) and pyruvate. All growth media in this study were supplemented with 1% heat-inactivated fetal calf serum. Penicillin-streptomycin liquid containing 10,000 U penicillin and 10 mg streptomycin in 0.85% saline was added to all media at a final concentration of 1%. All cultures were maintained in a humidified incubator at 37°C with an atmosphere of 5% CO2 and 95% air. A 90% media exchange was performed twice a week. Postconfluent cultures of ARPE-19 were maintained in high-glucose DMEM with pyruvate for up to 2 months in T75 flasks (Nunc) before use. Experimental cells were simultaneously seeded onto uncoated polyester filters (Transwell; Costar), pore size 0.4 μm. In some experiments filters were coated with 1:30 growth factor–reduced extracellular matrix (Matrigel; BD Biosciences, Oxford, UK). Final cell seeding densities were between 1 and 1.5 × 105 cell/cm2. Standard maintenance medium was removed, and the experimental media were applied at least 24 hours after seeding. Medium in apical and basal chambers was changed twice a week. For 6.5-mm inserts, feeding volumes were 200 μL apical and 700 μL basal. For 24-mm inserts, they were 2 mL apical and 3 mL basal. However, basal volumes were adjusted to eliminate hydrostatic pressure for transepithelial resistance measurements. Inserts were maintained for up to 3 months. We compared four commercially available media types—high-glucose DMEM with pyruvate, high-glucose DMEM without pyruvate, low-glucose DMEM with pyruvate, and DMEM/F12—which were purchased as liquids and were tested simultaneously using identical batches of all the additives mentioned. Unless otherwise indicated, the glucose concentration in DMEM/F12 (3.15 g/L) was adjusted to that of high-glucose DMEM (4.5 g/L). 
Transepithelial Resistance
Our TER method has been reported previously. 22 Briefly, measurements were taken using an epithelial voltohmmeter with an STX2 electrode (EVOM; World Precision Instruments Inc., Sarasota, FL). All measurements were performed at ambient temperature within 5 minutes of removal from the incubator. 
Immunocytochemistry
Our method and antibodies have been described in detail previously. 17 Briefly, samples were fixed in either cold methanol for 5 minutes, or 2% to 4% paraformaldehyde for 30 minutes. All staining was carried out using donkey serum (Jackson ImmunoResearch, West Grove, PA) and 0.15% to 0.3% Triton in phosphate-buffered saline. Additional antibodies used in this study were the following rabbit polyclonals: claudin-1 (1:200; Zymed, Invitrogen), claudin-2 (1:50; Zymed), claudin-3 (1:100; Zymed), and occludin (1:500; Zymed). Antibodies were visualized by incubation in fluorescent secondary antibodies (Jackson ImmunoResearch). Phalloidin staining for F-actin (actin) was performed with 488 phalloidin (Oregon Green, 1:500; Molecular Probes, Invitrogen) at the secondary antibody stage. Cell nuclei were counterstained with 4′6-diamindino-2-phenylindole dihydrochloride (DAPI, 1:5000; Sigma-Aldrich, Dorset, UK), and samples were mounted in mounting medium (Vectashield; Vector Laboratories, Peterborough, UK). 
Western Blot Analysis
Our western blot methods have been described previously. 12 Briefly, ARPE-19 cells were cultured for 3 months as described and were harvested from 24-mm inserts. Western blotting was performed in triplicate. Proteins were identified with the following primary antibodies: mouse monoclonals—CRALBP (1:2000; Affinity BioReagents, Denver, CO), cytokeratin 8 (1:2000; Millipore, Watford, UK), RPE65 (1:2000; Millipore), and PEDF (1:500; Millipore); rabbit monoclonals—MerTK (1:500; Abcam, Cambridge, UK), and tyrosinase (1:2000, Abcam). These were visualized with HRP-conjugated secondary antibodies (Dako, Cambridge, UK). After incubation in solution (Lumi-Light; Roche, Hertfordshire, UK), proteins were detected by autoradiographic film. Blots were stripped and reprobed with primary GAPDH antibody (1:1000; goat polyclonal; Everest Biotech, Upper Heyford, UK) as a loading control. Protein levels were quantified by densitometry of Western blot film using ImageJ software (developed by Wayne Rasband, National Institutes of Health, Bethesda, MD; available at http://rsb.info.nih.gov/ij/index.html), 23 and protein expression intensity was normalized to GAPDH. 
Quantitative Real-Time PCR
cDNA was prepared from cells as previously described. 12 Q-PCR was performed on a PCR system (7900HT Fast Real-Time; Applied Biosystems, Warrington, Cheshire, UK). Triplicate PCR reactions were prepared for each cDNA sample (n = 3) using 0.2 μM intron-spanning gene-specific primer (Eurofins MWG Operon, Ebersberg, Germany) and PCR master mix (Power SYBR Green; Applied Biosystems). The cycle parameters consisted of an initial denature step of 95°C for 10 minutes followed by 40 cycles of 95°C for 15 seconds and 60°C for 30 seconds. Data were analyzed (SDS 2.2.2; Applied Biosystems) and exported to DART-PCR (version 1.0) 24 to calculate Ro values, which were then normalized to the geometric mean of Gapdh, β-tubulin (Tubb), and β-2-microglobulin (B2M). Primer specificity was tested by electrophoresis, sequencing, and melt curve analysis. Amplification was not observed in the non–template and –reverse transcriptase controls. Details of gene-specific primers can be found in Table 1
Table 1.
 
Primers Used for Quantitative PCR
Table 1.
 
Primers Used for Quantitative PCR
Gene Forward Primer 5′-3′ Reverse Primer 5′-3′ Accession Size (bp) Temperature 3°C
Cralbp GCCGAGTGGTCATGCTGTTG AGCCTGCTGCATGGTAAGC NM_000326 180 60
Krt8 AAGGATGCCAACGCCAAGTT CCGCTGGTGGTCTTCGTATG NM_002273 214 60
MerTK ATCCTGGGGTCCAGAACCAT TTCCGAACGTCAGGCAAACT NM_006343 162 60
Pedf CCCATGATGTCGGACCCTAA CAGGGGCAGGAAGAAGATGA NM_002615 117 60
RPE65 CAAGGCTGACACAGGCAAGA TTGACGAGGCCCTGAAAAGA NM_000329 118 60
Tyr TAGCGGATGCCTCTCAAAGC CAATGGGTGCATTGGCTTCT NM_000372 195 60
VegfA TCTGCTGTCTTGGGTGCATT ATGTCCACCAGGGTCTCGAT NM_001171623 175 60
Gapdh CCCCACCACACTGAATCTCC GGTACTTTATTGATGGTACATGACAAG NM_002046 104 60
Tubb AATCCCCACCTTTTCTTACTCC AAAGATGGAGGAGGGTTCCC NM_004048 119 60
B2M TGTTGATGTATCTGAGCAGGTTG AAGATGTTGATGTTGGATAAGAGAATC NM_178014 100 60
ELISA for VEGF
Secreted vascular endothelial growth factor (VEGF-A) was measured using an enzyme-linked immunosorbent assay (ELISA) as follows. At 10 weeks after seeding, media were collected 4 days after the last media change from apical and basal chambers of 24-mm uncoated polyester filters (Transwell; Costar). Samples were kept on ice or at 4°C and were processed the same day. ELISA was conducted on conditioned experimental media (n = 3 per treatment group) using a kit (RayBio Human VEGF ELISA; RayBiotech, Inc., Norcross, GA) according to the manufacturer's guidelines. Each individual sample was further run in duplicate. Plates were read with a fluorescence plate reader (FLUOstar OPTIMA; BMG Labtech GmbH, Offenburg, Germany), and the concentration of VEGF was extrapolated from a VEGF standard curve for each sample. Secreted VEGF was measured in picograms per square centimeter per 24 hours. Total VEGF was calculated for each insert as the sum of the apical and basal values. 
Electron Microscopy
All chemicals and consumables used to prepare specimens were obtained from Agar Scientific (Stansted, UK). Transmission electron microscope (TEM) sample preparation methods have been described previously. 12 Ultra-thin sections were examined under a TEM (JEOL 1010; JEOL, Tokyo, Japan) operating at 80 kV, and images were taken using a digital camera (Orius B; Gatan, Pleasanton, CA) and image processing software (Digital Micrograph; Gatan). Then the digital images were recorded using digital image acquisition software (Semafore; JEOL). Specimens destined for scanning electron microscopy (SEM) were either critical point-dried using carbon dioxide as the transmission medium or air-dried after 2 × 5-minute passages through hexamethyldisilazane. Once dried, specimens were mounted on conductive carbon and sputter-coated with gold-palladium using a sputter coater (K 550; Emitech, Ashford, UK) before imaging in an SEM (6100; JEOL) operating at 15 kV. Again the digital images were recorded using digital image acquisition software (Semafore; JEOL). 
Phagocytosis Assay: Human Photoreceptor Outer Segments
Surplus retina was collected from a patient undergoing retinal translocation surgery at Moorfields Eye Hospital. Requirements of the Central Office for Research Ethics Committees and the UK Human Tissue Authority were fully met. Thus, our study adheres to the tenets of the Declaration of Helsinki. ARPE-19 was seeded onto extracellular matrix (Matrigel)–coated cellulose filters (Millicell; Sigma-Aldrich) and was maintained in high-glucose DMEM with pyruvate for 10 weeks before coculture. The retinal explant was incubated with cell cultures using a method described previously. 12 ARPE-19 cells, substrate, and neural retina composites were fixed for TEM at 24 and 48 hours after coculture. 
Pyruvate Transport Inhibition
A well-established reversible pyruvate transport-inhibitor, α-cyano-4-hydroxycinnamate 25 (4-CIN; Sigma-Aldrich), was dissolved in pure dimethyl sulfoxide (DMSO; Sigma-Aldrich), and diluted into high-glucose DMEM with 1 mM pyruvate. 4-CIN was adjusted to final concentrations of 50 μM and 500 μM. The DMSO concentration was adjusted in all experimental media, including control media, to 0.1%. Cells were cultured as described for 3 months. 
Statistical Analysis
Statistical analysis was conducted with software packages (SPSS [IBM, Armonk, NY] and Sigmastat [Systat Software, San Jose, CA]). One-way analysis of variance followed by Tukey's HSD multiple comparison test were used to compare more than two groups. For one experiment, Student-Newman-Keuls analysis was used. A two-tailed value of P < 0.05 was considered significant. Unless stated, all experiments were conducted at least in triplicate or were repeated at least three times on different occasions. 
Results
Visible Pigmentation of ARPE-19 and Light Microscopy
Cells grown on uncoated filters (Transwell; Costar) in DMEM with pyruvate (irrespective of glucose concentration; this term will now be referred to as DMEM/pyruvate) developed heavy pigmentation at 3 months that was often visible with the naked eye, in contrast to those grown without pyruvate (Figs. 1A–D, 2A). Pigmentation was never observed in DMEM/F12, even when corrected with 1 mM pyruvate (not shown) and glucose. Pigmentation was also evident in DMEM/pyruvate-maintained cells grown on extracellular matrix (Matrigel)–coated polyester and cellulose filters (Millicell; Sigma-Aldrich) and on coated/uncoated glass and tissue-culture polystyrene flasks (not shown). Microscopic pigmentation was usually evident at 2 to 3 months after seeding (Figs. 1A–D, 2A). 
Immunocytochemistry Suggests DMEM and Pyruvate Are Important Factors in Differentiation
RPE differentiation markers were examined in ARPE-19 cultures under all media conditions. Cells grown in DMEM/pyruvate developed several RPE differentiation markers found in native RPE cells. Expression of the immature melanosome marker pmel-17 correlated well with the development of pigmentation. There were abundant pmel-17–positive cells in all DMEM types irrespective of pyruvate and glucose concentrations, indicating that melanogenesis had been initiated under these conditions. However, there were few pmel-17–positive cells in DMEM/F12 cultured cells (Fig. 1, insets), which is consistent with the pigmentation results. 
Actin distribution was also affected by culture medium. Cells maintained in DMEM/pyruvate displayed circumferential distribution of actin fibers, which is similar to native RPE. 1,2 Onset of this more natural distribution of actin fibers was delayed in DMEM without pyruvate and DMEM/F12, and stress fibers were abundant in DMEM/F12 (Figs. 2B, 3A). Cells cultured in DMEM/pyruvate lacked cytokeratin 8 (will now be referred to as keratin 8 or KRT8); in other words, the expression of keratin 8 showed a negative correlation with pigmentation because positive staining was observed only in DMEM/F12 cultured cells and to some extent in DMEM without pyruvate (Fig. 2C). 
Figure 1.
 
Assessment of pigmentation in cultured RPE (ARPE-19) in various media conditions with and without pyruvate at 14 weeks after seeding. (A) No pigmentation is seen in DMEM/F12. (B) Some pigmentation is seen in high-glucose DMEM medium. (C) Heavily pigmented cells grown in DMEM/pyruvate with low glucose. (D) A similar appearance in DMEM/pyruvate with high glucose. Insets: abundance of the immature melanosome marker pmel17 (green) in a low-magnification confocal image with Nomarski optics. Note that both pmel17 staining and Nomarski pigment correlate with the presence/absence of pigmentation in the light micrographs. Scale bars: 100 μm (AD); 50 μm (inset).
Figure 1.
 
Assessment of pigmentation in cultured RPE (ARPE-19) in various media conditions with and without pyruvate at 14 weeks after seeding. (A) No pigmentation is seen in DMEM/F12. (B) Some pigmentation is seen in high-glucose DMEM medium. (C) Heavily pigmented cells grown in DMEM/pyruvate with low glucose. (D) A similar appearance in DMEM/pyruvate with high glucose. Insets: abundance of the immature melanosome marker pmel17 (green) in a low-magnification confocal image with Nomarski optics. Note that both pmel17 staining and Nomarski pigment correlate with the presence/absence of pigmentation in the light micrographs. Scale bars: 100 μm (AD); 50 μm (inset).
Figure 2.
 
Confocal micrographs of immunostained ARPE-19 under various commercially available media conditions at 8 weeks. (A) Nomarski view of ARPE-19 cells. In DMEM-based medium, pigmentation of the cells is intense in the presence of pyruvate (DH+P and DL+P). The morphology of the cells is polygonal, producing a characteristic mosaic. In DFH and DH, no pigmentation was detectable at this time point. (B) Confocal projections of actin reveal a favorable circumferential actin distribution throughout the height of the cells in DH+P and DL+P. (C) No keratin 8 expression in DH+P or DL+P irrespective of glucose. Keratin 8 expression is retained in DFH and DH. (D) CRALBP expression is markedly increased in DH+P and DL+P with a subset of intensely positive cells. DFH = DMEM/F12 high glucose; DH = DMEM high glucose (no pyruvate); DH+P = DMEM high glucose + pyruvate; DL+P = DMEM low glucose + pyruvate. Scale bar, 20 μm.
Figure 2.
 
Confocal micrographs of immunostained ARPE-19 under various commercially available media conditions at 8 weeks. (A) Nomarski view of ARPE-19 cells. In DMEM-based medium, pigmentation of the cells is intense in the presence of pyruvate (DH+P and DL+P). The morphology of the cells is polygonal, producing a characteristic mosaic. In DFH and DH, no pigmentation was detectable at this time point. (B) Confocal projections of actin reveal a favorable circumferential actin distribution throughout the height of the cells in DH+P and DL+P. (C) No keratin 8 expression in DH+P or DL+P irrespective of glucose. Keratin 8 expression is retained in DFH and DH. (D) CRALBP expression is markedly increased in DH+P and DL+P with a subset of intensely positive cells. DFH = DMEM/F12 high glucose; DH = DMEM high glucose (no pyruvate); DH+P = DMEM high glucose + pyruvate; DL+P = DMEM low glucose + pyruvate. Scale bar, 20 μm.
Figure 3.
 
Effect of growth medium and pyruvate on apical-basal polarity and junctional proteins in ARPE-19 cells at 15 weeks. (A) A single confocal frame taken through the upper portion of the cells reveals extensive stress fibers in DFH medium, whereas DMEM media (DH, DH+P, DL+P) have circumferential actin staining at 3 months. (B) The basal compartment of the cells shows stress fibers of varying appearance in all media. ZO-1 (C) and occludin (D) expression indicates good junctional development, and both markers can be seen in all media types. (E) SEM of cells grown without pyruvate shows sparse apical microvilli. (F) SEM of numerous apical microvilli on cells grown in presence of pyruvate. (G) Z-sections (cross-sections) through the confocal stack with Nomarski optics to aid identification of the subset of pigmented cells within the culture. Cells were fed with DH+P. ZO-1 (red points) is polarized to the apical region, whereas Na,K-ATPase (green) is basolateral except in pigmented cells (vertical arrows), which have apical expression of Na,K-ATPase (horizontal arrows). This suggests better polarization in pigmented cells. See also Supplementary Figure S1. DFH = DMEM/F12 high glucose; DH = DMEM high glucose; DH+P = DMEM high glucose + pyruvate; DL+P = DMEM low glucose + pyruvate. Scale bars: 10 μm (E, F); 20 μm (all others).
Figure 3.
 
Effect of growth medium and pyruvate on apical-basal polarity and junctional proteins in ARPE-19 cells at 15 weeks. (A) A single confocal frame taken through the upper portion of the cells reveals extensive stress fibers in DFH medium, whereas DMEM media (DH, DH+P, DL+P) have circumferential actin staining at 3 months. (B) The basal compartment of the cells shows stress fibers of varying appearance in all media. ZO-1 (C) and occludin (D) expression indicates good junctional development, and both markers can be seen in all media types. (E) SEM of cells grown without pyruvate shows sparse apical microvilli. (F) SEM of numerous apical microvilli on cells grown in presence of pyruvate. (G) Z-sections (cross-sections) through the confocal stack with Nomarski optics to aid identification of the subset of pigmented cells within the culture. Cells were fed with DH+P. ZO-1 (red points) is polarized to the apical region, whereas Na,K-ATPase (green) is basolateral except in pigmented cells (vertical arrows), which have apical expression of Na,K-ATPase (horizontal arrows). This suggests better polarization in pigmented cells. See also Supplementary Figure S1. DFH = DMEM/F12 high glucose; DH = DMEM high glucose; DH+P = DMEM high glucose + pyruvate; DL+P = DMEM low glucose + pyruvate. Scale bars: 10 μm (E, F); 20 μm (all others).
Cellular retinaldehyde-binding protein (CRALBP) is widely expressed in native RPE and is involved in retinol recycling. 26 Cells grown for 15 weeks in DMEM/pyruvate developed widespread CRALBP expression, while cultures at 8 weeks developed CRALBP to a lesser extent, though intense staining was still apparent in a subpopulation of cells (Fig. 2D). CRALBP expression in DMEM/F12 was absent, but correction of pyruvate levels to 1 mM induced a subset of weakly positive cells (not shown). Another marker of native RPE, RPE65, was detected weakly in limited areas within high-glucose DMEM/pyruvate-maintained cultures (Fig. 4G), which prompted quantification of RPE65; this is demonstrated by our Western blot and Q-PCR data. 
Figure 4.
 
Western blot and Q-PCR analyses of expression in ARPE-19 cells after culture in various media types at 15 weeks. (AF) Proteins were probed using antibodies against CRALBP (37 kDa), keratin 8 (KRT8; 53 kDa), MerTK (180 kDa), RPE65 (65 kDa), tyrosinase (TYR; 70 kDa), and GAPDH (36 kDa). (A) Representative Western blot image. (BF) Relative protein expression of CRALBP, keratin 8, MerTK, RPE65, and tyrosinase. (G) ICC of RPE65 is subtle. (HL) mRNA relative expression patterns. All data represent mean relative intensity ± SEM. Unless specified, asterisks indicate the following significance levels compared with DFH: *P < 0.05, **P < 0.01, ***P < 0.001 (n = 3). DFH = DMEM/F12 high glucose; DH = DMEM high glucose; DH+P = DMEM high glucose + pyruvate; DL+P = DMEM low glucose + pyruvate (n = 3). †The only occurrence of changed order of media in this article.
Figure 4.
 
Western blot and Q-PCR analyses of expression in ARPE-19 cells after culture in various media types at 15 weeks. (AF) Proteins were probed using antibodies against CRALBP (37 kDa), keratin 8 (KRT8; 53 kDa), MerTK (180 kDa), RPE65 (65 kDa), tyrosinase (TYR; 70 kDa), and GAPDH (36 kDa). (A) Representative Western blot image. (BF) Relative protein expression of CRALBP, keratin 8, MerTK, RPE65, and tyrosinase. (G) ICC of RPE65 is subtle. (HL) mRNA relative expression patterns. All data represent mean relative intensity ± SEM. Unless specified, asterisks indicate the following significance levels compared with DFH: *P < 0.05, **P < 0.01, ***P < 0.001 (n = 3). DFH = DMEM/F12 high glucose; DH = DMEM high glucose; DH+P = DMEM high glucose + pyruvate; DL+P = DMEM low glucose + pyruvate (n = 3). †The only occurrence of changed order of media in this article.
Another feature of differentiated RPE cells is that they are normally polarized, as evidenced by Na,K-ATPase. We analyzed whether pigmented cells in DMEM/pyruvate are able to produce polarized Na,K-ATPase, which is a characteristic of this marker in native RPE cells. Although ARPE-19 generally expressed this marker basolaterally, a subset of pigmented cells produced a subtle appearance consistent with apically localized Na,K-ATPase (Fig. 3G; Supplementary Fig. S1). 
The junctional proteins ZO1 and occludin were present in all preparations (Figs. 3C, 3D), and both were invariably polarized toward the apical segment of the cellular membrane as seen in (Fig. 3G). Junctional claudins 1 and 3 were detected under all media conditions, whereas claudin-2 was detected in DMEM-based media only (not shown). 
Quantification of Expression by Western Blots and Q-PCR Corroborates ICC Findings and Highlights the Importance of Glucose
Western blot analysis and Q-PCR was performed to quantify protein and mRNA to corroborate or to complement immunocytochemistry results (Fig. 4A). Protein expression of keratin 8 correlated negatively with pigmentation because it was abundant only in DMEM/F12 (P < 0.001; Fig. 4C). DMEM/pyruvate-maintained cells expressed higher levels of RPE differentiation protein markers as follows: DMEM/pyruvate had greater CRALBP expression than either DMEM P < 0.01 or DMEM/F12 P < 0.001 (Fig. 4B). MerTK levels in DMEM/pyruvate were higher than DMEM (P < 0.05), but only high-glucose DMEM/pyruvate produced significantly more MerTK than DMEM/F12 (P = 0.01; Fig. 4D). Surprisingly, RPE65 protein was expressed in all conditions but was greatest in high-glucose DMEM/pyruvate. This difference was significant compared with other DMEM conditions (P < 0.05; Fig. 4E). Paradoxically, the nonpigmented cultures of DMEM/F12 had significantly higher levels of tyrosinase than any other culture condition (P < 0.01). Therefore, DMEM-maintained cultures were associated with lower tyrosinase levels, but low glucose was responsible for a further reduction among DMEM types (P < 0.05; Fig. 4F). 
Messenger RNA expression generally followed a pattern similar to that of protein expression. An obvious exception was the case of high-glucose DMEM/pyruvate producing more MerTK message than its low-glucose counterpart (Figs. 4D, 4J). 
Transepithelial Resistance Reiterates the Benefits of DMEM and Pyruvate
Maturity of cell-cell tight junctions was assessed by TER. TER was stable in high-glucose DMEM/pyruvate over the entire 6-week experimental period, whereas other media showed a gradual decline (Fig. 5A). The 6-week average TER was 45.4 ± 0.8 Ω · cm2 for DMEM/F12, 51.8 ± 0.7 Ω · cm2 for high-glucose DMEM, and 51.3 ± 1 Ω · cm2 for high-glucose DMEM/pyruvate (mean ± SEM). There is a significant difference between DMEMF12 and DMEM irrespective of pyruvate supplementation (P < 0.001; Fig. 5B). 
Figure 5.
 
Comparison of TER of ARPE-19 cells grown on uncoated filters in various media conditions over the course of 6 weeks. (A) TER values at 3, 4.5, and 6 weeks. (B) Average TER over the same time period. Data are mean ± SEM. Asterisks indicate the following significance levels compared with DMEM/F12: *P < 0.05, ***P < 0.001 (n = 6).
Figure 5.
 
Comparison of TER of ARPE-19 cells grown on uncoated filters in various media conditions over the course of 6 weeks. (A) TER values at 3, 4.5, and 6 weeks. (B) Average TER over the same time period. Data are mean ± SEM. Asterisks indicate the following significance levels compared with DMEM/F12: *P < 0.05, ***P < 0.001 (n = 6).
VEGF and PEDF Expression Profiles Further Confirm Optimal Growth Conditions
Because VEGF is a major growth factor secreted by native RPE, we examined its secretion by ELISA of ARPE-19–conditioned media under our experimental media conditions at 10 weeks. VEGF output was 2152 ± 198 pg/cm2/24 hours for DMEM/F12, 6136 ± 958 pg/cm2/24 hours for DMEM, 5997 ± 1017 pg/cm2/24 hours for high-glucose DMEM/pyruvate, and 12,950 ± 2030 pg/cm2/24 hours for low-glucose DMEM/pyruvate (mean ± SEM). Total VEGF output was higher in DMEM media compared to DMEM/F12 (P < 0.05; Fig. 6A). There was no difference in total VEGF output between pyruvate and non–pyruvate-supplemented high-glucose DMEM (P = 0.99). There was also no significant difference between apical and basal VEGF secretion in DMEM media; however, it appears that DMEM induced a significant increase in basal VEGF compared with DMEM/F12 (P < 0.05; Fig. 6B). Low-glucose DMEM/pyruvate produced significantly higher basal VEGF than its high-glucose counterpart (P < 0.05). We also examined mRNA expression of VEGF and PEDF in the same experiment at 15 weeks. Surprisingly, the effect of low glucose was to lower VEGF expression, but no effect of pyruvate was seen (Fig. 6C). Pyruvate and glucose both appeared to contribute to increased PEDF mRNA because the lack of either factor caused a significant drop (Fig. 6D). Favorable (low) VEGF/PEDF ratios are seen only in DMEM irrespective of pyruvate and glucose (Fig. 6E). PEDF protein was detected in Western blots of high-glucose DMEM/pyruvate (Fig. 6F). 
Figure 6.
 
(A, B) Comparison of VEGF secretion by ARPE-19 cells grown on uncoated filters under various media conditions at 10 weeks. (A) Total VEGF output (pg/cm2/24 hours) by ARPE-19 grown on uncoated 24-mm inserts at 10 weeks after seeding. (B) The same groups with apical and basal VEGF shown separately. Basal VEGF is significantly increased in DMEM media compared with DFH. (CE) Comparison of VEGF and PEDF mRNA at 15 weeks. (C) Effect of low glucose was to lower VEGF expression, but no effect of pyruvate is seen. (D) Pyruvate and glucose contribute to increased PEDF expression. (E) Favorable (low) VEGF/PEDF ratios are seen in DMEM media. (F) Triplicate Western blot demonstrating PEDF expression in DH+P medium. DFH = DMEM/F12 high glucose; DH = DMEM high glucose; DH+P = DMEM high glucose + pyruvate; DL+P = DMEM low glucose + pyruvate. All data are mean ± SEM. Unless otherwise specified, asterisks indicate the following significance levels compared with DFH: *P < 0.05, **P < 0.01. Hatched symbols: significance compared with DFH when only high-glucose media are analyzed (DFH, DH, DH+P): #P < 0.05, ##P < 0.01 (n = 3).
Figure 6.
 
(A, B) Comparison of VEGF secretion by ARPE-19 cells grown on uncoated filters under various media conditions at 10 weeks. (A) Total VEGF output (pg/cm2/24 hours) by ARPE-19 grown on uncoated 24-mm inserts at 10 weeks after seeding. (B) The same groups with apical and basal VEGF shown separately. Basal VEGF is significantly increased in DMEM media compared with DFH. (CE) Comparison of VEGF and PEDF mRNA at 15 weeks. (C) Effect of low glucose was to lower VEGF expression, but no effect of pyruvate is seen. (D) Pyruvate and glucose contribute to increased PEDF expression. (E) Favorable (low) VEGF/PEDF ratios are seen in DMEM media. (F) Triplicate Western blot demonstrating PEDF expression in DH+P medium. DFH = DMEM/F12 high glucose; DH = DMEM high glucose; DH+P = DMEM high glucose + pyruvate; DL+P = DMEM low glucose + pyruvate. All data are mean ± SEM. Unless otherwise specified, asterisks indicate the following significance levels compared with DFH: *P < 0.05, **P < 0.01. Hatched symbols: significance compared with DFH when only high-glucose media are analyzed (DFH, DH, DH+P): #P < 0.05, ##P < 0.01 (n = 3).
Electron Microscopy and Human Photoreceptor Outer Segment-Phagocytosis by Differentiated ARPE-19 Cells
Melanosomes of varying maturity were abundant in ARPE-19 cells grown in the presence of high-glucose DMEM/pyruvate (Figs. 7A, 7B) and in low-glucose DMEM/pyruvate (not shown) before exposure to human retina. In samples incubated with retina (high-glucose DMEM/pyruvate), internalized human POS could be seen within ARPE-19 cells in TEM sections at both 24 and 48 hours. The same number of TEM sections was examined for both groups. Internalization of outer segments increased with time; four incidences of internalized outer segments were identified in 24-hour sections compared with 35 unique incidences at 48 hours (Figs. 7C–H). 
Figure 7.
 
TEM of pigmented post-confluent ARPE-19 cells on extracellular matrix–coated cellulose filters maintained with DH+P and human POS phagocytosis assay at 10 weeks. (A) Control ARPE-19. (B) Various stages of melanogenesis found in these cells (increasing from left to right). (C) Cells cocultured with human retina for 24 hours, with an example of noninternalized human POS (retina became separated from RPE cells during processing). (DH) Presence of phagosomes in ARPE-19 cells at 48 hours after coculture, consistent with internalized POS. Arrows: internalized POS. Asterisks indicate lipid-rich phagosomes, which may be the result of POS digestion. (D) Note the cuboidal polarized profile of some cells. (F) Also note desmosomes (ds) at the cell-cell border and the apical junctional complex (AJC), which indicate junction development and polarity. (I) High-magnification image of an ingested POS (from H). Note the appearance is consistent with a tight-junction (TJ) and an adherens junction (AJ). Scale bars, 2 μm (A, C, D); 200 nm (B); 1 μm (all others).
Figure 7.
 
TEM of pigmented post-confluent ARPE-19 cells on extracellular matrix–coated cellulose filters maintained with DH+P and human POS phagocytosis assay at 10 weeks. (A) Control ARPE-19. (B) Various stages of melanogenesis found in these cells (increasing from left to right). (C) Cells cocultured with human retina for 24 hours, with an example of noninternalized human POS (retina became separated from RPE cells during processing). (DH) Presence of phagosomes in ARPE-19 cells at 48 hours after coculture, consistent with internalized POS. Arrows: internalized POS. Asterisks indicate lipid-rich phagosomes, which may be the result of POS digestion. (D) Note the cuboidal polarized profile of some cells. (F) Also note desmosomes (ds) at the cell-cell border and the apical junctional complex (AJC), which indicate junction development and polarity. (I) High-magnification image of an ingested POS (from H). Note the appearance is consistent with a tight-junction (TJ) and an adherens junction (AJ). Scale bars, 2 μm (A, C, D); 200 nm (B); 1 μm (all others).
Inhibition of Pyruvate Transport Prevents Differentiation
4-CIN was added to high-glucose DMEM/pyruvate at either 50 μM or 500 μM. An almost total inhibition of pigmentation of our ARPE-19 cultures was observed at the higher concentration of 4-CIN by 11 weeks after seeding. Abundant pigmentation could be seen in 50 μM 4-CIN and control groups. On further analysis by ICC, abundant stress fibers were seen in the 500-μM concentration of 4-CIN, whereas 50 μM appeared to have no effect on ARPE-19 cells in this respect (Fig. 8). 
Figure 8.
 
Effect of α-cyano-4-hydroxycinnamate (4-CIN) on the differentiation of ARPE-19 cells in high-glucose DMEM/pyruvate medium at 11 weeks. (A) Light microscopy of cells grown in the presence of 50 μM 4-CIN shows visible pigmentation, similar to that of controls (not shown). (B) 500 μM 4-CIN visibly reduces pigmentation. Scale bar, 100 μm. (C) Actin fibers are circumferential in control and 50-μM groups, but abundant stress fibers occur at the highest concentration of 4-CIN. (D) Nomarski optics confirm pigmentation levels (n = 3). Scale bar, 20 μm.
Figure 8.
 
Effect of α-cyano-4-hydroxycinnamate (4-CIN) on the differentiation of ARPE-19 cells in high-glucose DMEM/pyruvate medium at 11 weeks. (A) Light microscopy of cells grown in the presence of 50 μM 4-CIN shows visible pigmentation, similar to that of controls (not shown). (B) 500 μM 4-CIN visibly reduces pigmentation. Scale bar, 100 μm. (C) Actin fibers are circumferential in control and 50-μM groups, but abundant stress fibers occur at the highest concentration of 4-CIN. (D) Nomarski optics confirm pigmentation levels (n = 3). Scale bar, 20 μm.
Discussion
The use of cell lines is a highly efficient way to examine the properties of human RPE cells. Thus, the ARPE-19 cell line has been widely studied. However, one of the major limitations of this line, and of other established RPE lines, is the propensity to dedifferentiate away from the classic RPE phenotype with repeated passage. In this study, we sought to find a simple protocol that would restore RPE features to cultured ARPE-19 cells in the hope of finding an optimum RPE medium. 
One essential marker of RPE differentiation that has eluded many is RPE65, the essential isomerohydrolase that converts retinal to retinyl esters. 27,28 Numerous studies have documented RPE65 mRNA in ARPE-19, but none have demonstrated RPE65 protein. 8,11,17,29 32 We have demonstrated Western blots of RPE65 in ARPE-19 cultures with an antibody that has been validated on human eye sections. 17 RPE65 levels were highest in high-glucose DMEM/pyruvate and were significantly reduced by the removal of pyruvate or glucose, suggesting that both are contributory. MerTK is another marker of mature RPE cells and is regarded as conditio sine qua non for diurnal POS phagocytosis. 12,33 35 Sadly, MerTK is absent when ARPE-19 cells are cultured in standard medium, although the phagocytosis-specific integrins αv and β5 are both detectable. 12 Given that high-glucose DMEM/pyruvate induced the highest expression of MerTK and that specific uptake of POS is dependent on MerTK, 12,33 35 we chose this medium in our human POS phagocytosis assay. We have documented internalized human POS within the ARPE-19 cells maintained in this medium. 
Pyruvate per se enhanced several differentiation characteristics in ARPE-19 in our study. Dark pigmentation and strong CRALBP expression were hallmarks of cells grown with pyruvate. Pyruvate also promoted significantly higher levels of MerTK by Western blot analysis. The mechanism of the effect of pyruvate is still under investigation, and many studies have implicated pyruvate as a hydrogen peroxide scavenger though none could demonstrate a molecular mechanism. 20,36 41 We have shown through the use of a well-established pyruvate transport inhibitor, 4-CIN, 25,42 that favorable effects of DMEM/pyruvate are markedly reduced by modest inhibition 18 of pyruvate transport into and within the cell using 500 μM 4-CIN. Because the metabolic pathways involving pyruvate and its subsequent derivatives are located within the cell, we can postulate that pyruvate must be allowed to exert an intracellular presence for it to promote differentiation. In a strikingly similar tone to that of our study, the induction of differentiation by pyruvate has been reported in myeloid cells, but no mechanism was suggested. 43 Pyruvate has also been reported to augment pigmentation in non-RPE cells. In cultured melanoma cells, pyruvate increased pigmentation, 44 a finding strikingly similar to our own results. 
Pigmentation is a hallmark of native RPE, but one of the most common limitations of cultured RPE cells has been lack of pigmentation. In vitro, cultured RPE cells undergo depigmentation with passage as melanin granules become diluted, and pigment is not usually synthesized thereafter. 6 Some reports have suggested specialized substrates, 22,45 48 or a specialized medium can induce repigmentation, differentiation, or both. 3,7 We examined ARPE-19 pigmentation in DMEM/pyruvate on several substrates, including some not used in this study (Ahmado A et al. IOVS 2008;49:ARVO E-Abstract 489), but we found no correlation between pigmentation and substrate, suggesting that the repigmentation of ARPE-19 is related to properties of culture medium. This is supported by the observation that DMEM/F12 never induced pigmentation. 
We demonstrated that several aspects of ARPE-19 differentiation improved alongside pigmentation. First, the lack of keratin 8 correlated with pigmentation, consistent with previous studies demonstrating that keratin 8 expression is lost in confluent cultures. 2,17,49 54 Second, circumferential actin and the absence of stress fibers is a characteristic of native RPE, 1,2 which was best seen in pigmented cultures. Third, we have shown that DMEM-maintained cultures produced more VEGF (particularly basally secreted VEGF) while having higher TER. It is unclear whether VEGF adversely affects TER because previous studies show conflicting results. 55 59 Our data suggest that barrier function of cells in DMEM were at the very least not affected by VEGF. On the other hand, it may be that TER and VEGF are both products of differentiation and increase in tandem. 59 These TER levels might also have been sustained by the high-glucose in our media, which has been reported previously. 60 Nevertheless, all TERs were generally low, as is expected of ARPE-19. 7  
VEGF is a physiological product of RPE and an essential autocrine factor affecting RPE behavior. 8,61,62 VEGF also provides maintenance for the choriocapillaris and retina 63,64 and is reported to increase in tandem with differentiation in primary cultured RPE. 59,65 67 It is reassuring that our VEGF values correspond to concentrations between 1.9 and 12.1 ng/mL/24 hours, comparable to primary RPE. 59 Previous studies on primary cultured RPE indicate preferential basal VEGF secretion, 10,59 whereas RPE cell lines exhibit apical secretion. 68,69 However, our data clearly demonstrate an increase in basal VEGF in DMEM compared with DMEM/F12. This improved basal secretion is a valuable element of differentiation in our study because it is one step closer to primary culture phenotype. High glucose can increase VEGF levels; this is reported widely. 70 73 In particular, the reduction of glucose below 5.5 mM is also reported to increase VEGF output by RPE. 70 Our results are consistent with such reported effects because we measured glucose consumption in 24-mm inserts (unpublished data, November 2010) and found that ARPE-19 cells consume approximately 1g/L over a 5-day starvation period. This would correspond to near-total glucose depletion in the low-glucose group, and it is of great interest that this was a more potent stimulus for VEGF than sustained high glucose. PEDF is an important neurotrophic growth factor that is regarded as a potent antagonist of VEGF and has been reported to be expressed by fetal and adult RPE, 65,74 but several studies documented its absence in ARPE-19. 75 77 On the other hand, we have demonstrated that PEDF expression can be modulated by optimizing growth medium. This is a significant finding in our study because we show PEDF can be regulated at the transcriptional level. 78 We have also shown PEDF protein expressed in cells grown in high-glucose DMEM/pyruvate, which corroborates our Q-PCR findings. 
Other effects of glucose in our study are worthy of mention given that this has been a subject of debate in previous literature. 70,73,79 High glucose was significant in determining increased expression of CRALBP, RPE65, tyrosinase, and PEDF at both protein and mRNA levels. High glucose also led to greater MerTK messaging, but the protein difference was not significant. Each millimole of glucose is expected to yield 2 mM pyruvate by glycolysis; hence, the lack of 1 mM pyruvate, in terms of energy, is equal to the loss of a mere 0.5 mM glucose. Therefore, we do not believe the beneficial effects of pyruvate are a function of energy-substrate availability because the high-glucose concentration in nonpyruvate medium would have compensated for the lack of pyruvate-derived energy. 
It is known that melanin synthesis cannot occur in the absence of tyrosinase 52 and that adult native-RPE has minimal tyrosinase and does not synthesize new melanin in vivo. 13,50 On the other hand, our data demonstrate that cultured RPE can express tyrosinase and can synthesize pigment. Paradoxically, tyrosinase levels were highest in our nonpigmented cultures of DMEM/F12 and were significantly lower in the pigmented cultures maintained by DMEM. This suggests first that melanogenesis was inhibited downstream of tyrosinase in DMEM/F12. Second, one or more melanogenesis byproducts or end-products might have exerted feedback inhibition on tyrosinase in heavily pigmented cultures. We acknowledge Dunn et al. 11 reported pigmentation using DMEM/F12, but we believe this was attributed to their use of low-passage ARPE-19 because the currently available high passages have consistently lacked pigment. 14 16  
Thus, the question arises: Why is DMEM/F12 preventing pigmentation and differentiation? Although DMEM/F12 cultures never developed pigmentation despite the presence of pyruvate, we did measure high tyrosinase in DMEM/F12, which indicates that the process of pigmentation was stalled by the presence or absence of one or more factors. The problem may be a presumed anti–melanogenic component of Ham's F12 or a pro–melanogenic component of DMEM that has become diluted below a requisite level (DMEM/F12 is a 1:1 dilution of DMEM and F12). In addition to the ingredients unique to DMEM/F12, nearly 30 other ingredients occur at different concentrations in basal preparations of these two media (Supplementary Table S1). 
Thus, the list of media components to consider is vast. However, after an initial analysis, we found a noticeable difference in bicarbonate concentration: 44 mM in DMEM to 29 mM in DMEM/F12. We came across a previous study that showed 44 mM bicarbonate supports in vitro repigmentation of aged human RPE whereas 26 mM does not. 80 We now have unpublished data (February 2010) that indicate the correction of bicarbonate levels in DMEM/F12 dramatically increases Pmel17 expression among other markers, though it does not allow pigmentation. Therefore, the correction of bicarbonate may become a necessary step for RPE melanogenesis studies unless DMEM or a similar bicarbonate-corrected medium is used. 
In conclusion, the human RPE cell line ARPE-19 is a widely available source of RPE for experiments, but dedifferentiation is common in standard culture medium, and it has become superseded by RPE cultures generated in recent years. 10,66 However, we have shown that ARPE-19 phenotypic sensitivity is a tool that can be used to elucidate more favorable growth media types for in vitro RPE. Pyruvate in combination with DMEM restores pigmentation and the expression of mature RPE cell markers such as RPE65, MerTK, and CRALBP in ARPE-19 cells, and this effect may be further enhanced by high-glucose concentration. Given that the ARPE-19 phenotype is sensitive to culture conditions, such observed improvements in its phenotype warrant renewed attention to culturing techniques of other superior primary RPE cultures because differentiation might have been masked by nonoptimal media. We have also demonstrated that ARPE-19 cells are capable of human POS phagocytosis while it was maintained in this medium, making it an excellent medium with which to study human RPE cell function. Therefore, we recommend that high-glucose DMEM/pyruvate be used for in vitro RPE differentiation and pigmentation studies. 
Supplementary Materials
Figure sf01, PDF - Figure sf01, PDF 
Table st1, PDF - Table st1, PDF 
Footnotes
 Supported by The London Project to Cure Blindness and The Lincy Foundation.
Footnotes
 Disclosure: A. Ahmado, None; A.-J. Carr, None; A.A. Vugler, None; M. Semo, None; C. Gias, None; J.M. Lawrence, None; L.L. Chen, None; F.K. Chen, None; P. Turowski, None; L. da Cruz, None; P.J. Coffey, None
The authors thank the London Project to Cure Blindness and the Lincy Foundation for supporting this study, and they thank Clare Futter and Glen Jeffery for assistance with data interpretation and Peter Munro and Robin Howes for assistance with SEM and TEM. 
References
Opas M . Expression of the differentiated phenotype by epithelial cells in vitro is regulated by both biochemistry and mechanics of the substratum. Dev Biol. 1989;131:281–293. [CrossRef] [PubMed]
McKay BS Burke JM . Separation of phenotypically distinct subpopulations of cultured human retinal pigment epithelial cells. Exp Cell Res. 1994;213:85–92. [CrossRef] [PubMed]
Hu J Bok D . A cell culture medium that supports the differentiation of human retinal pigment epithelium into functionally polarized monolayers. Mol Vis. 2001;7:14–19. [PubMed]
Alge CS Suppmann S Priglinger SG . Comparative proteome analysis of native differentiated and cultured dedifferentiated human RPE cells. Invest Ophthalmol Vis Sci. 2003;44:3629–3641. [CrossRef] [PubMed]
Opas M Dziak E . Effects of substrata and method of tissue dissociation on adhesion, cytoskeleton, and growth of chick retinal pigmented epithelium in vitro. In Vitro Cell Dev Biol. 1988;24:885–892. [CrossRef] [PubMed]
Opas M . Substratum mechanics and cell differentiation. Int Rev Cytol. 1994;150:119–137. [PubMed]
Luo Y Zhuo Y Fukuhara M Rizzolo LJ . Effects of culture conditions on heterogeneity and the apical junctional complex of the ARPE-19 cell line. Invest Ophthalmol Vis Sci. 2006;47:3644–3655. [CrossRef] [PubMed]
Krugluger W Seidel S Steindl K Binder S . Epidermal growth factor inhibits glycogen synthase kinase-3 (GSK-3) and beta-catenin transcription in cultured ARPE-19 cells. Graefes Arch Clin Exp Ophthalmol. 2007;245:1543–1548. [CrossRef] [PubMed]
Steindl-Kuscher K Krugluger W Boulton ME . Activation of the beta-catenin signaling pathway and its impact on RPE cell cycle. Invest Ophthalmol Vis Sci. 2009;50:4471–4476. [CrossRef] [PubMed]
Maminishkis A Chen S Jalickee S . Confluent monolayers of cultured human fetal retinal pigment epithelium exhibit morphology and physiology of native tissue. Invest Ophthalmol Vis Sci. 2006;47:3612–3624. [CrossRef] [PubMed]
Dunn KC Otaki-Keen AE Putkey FR Hjelmeland LM . ARPE-19, a human retinal pigment epithelial cell line with differentiated properties. Exp Eye Res. 1996;62:155–169. [CrossRef] [PubMed]
Carr AJ Vugler A Lawrence J . Molecular characterization and functional analysis of phagocytosis by human embryonic stem cell-derived RPE cells using a novel human retinal assay. Mol Vis. 2009;15:283–295. [PubMed]
Biesemeier A Kreppel F Kochanek S Schraermeyer U . The classical pathway of melanogenesis is not essential for melanin synthesis in the adult retinal pigment epithelium. Cell Tissue Res. 2010;339:551–560. [CrossRef] [PubMed]
Wang Z Dillon J Gaillard ER . Antioxidant properties of melanin in retinal pigment epithelial cells. Photochem Photobiol. 2006;82:474–479. [CrossRef] [PubMed]
Song Q Risco R Latina M Berthiaume F Nahmias Y Yarmush ML . Selective targeting of pigmented retinal pigment epithelial (RPE) cells by a single pulsed laser irradiation: an in vitro study. Opt Express. 2008;16:10518–10528. [CrossRef] [PubMed]
Burke JM Zareba M . Sublethal photic stress and the motility of RPE phagosomes and melanosomes. Invest Ophthalmol Vis Sci. 2009;50:1940–1947. [CrossRef] [PubMed]
Vugler A Carr AJ Lawrence J . Elucidating the phenomenon of HESC-derived RPE: anatomy of cell genesis, expansion and retinal transplantation. Exp Neurol. 2008;214:347–361. [CrossRef] [PubMed]
Bui BV Kalloniatis M Vingrys AJ . Retinal function loss after monocarboxylate transport inhibition. Invest Ophthalmol Vis Sci. 2004;45:584–593. [CrossRef] [PubMed]
Frenzel J Richter J Eschrich K . Pyruvate protects glucose-deprived Muller cells from nitric oxide-induced oxidative stress by radical scavenging. Glia. 2005;52:276–288. [CrossRef] [PubMed]
Hegde KR Varma SD . Prevention of oxidative stress to the retina by pyruvate: a preliminary report. Ophthalmologica. 2008;222:194–198. [CrossRef] [PubMed]
Paquin J Aouffen M De Grandpré E Nadeau R Langlois D Mateescu MA . Neuroprotective and cardioprotective actions of an association of pyruvate, vitamin E and fatty acids. Arzneimittelforschung. 2005;55:359–369. [PubMed]
Turowski P Adamson P Sathia J . Basement membrane-dependent modification of phenotype and gene expression in human retinal pigment epithelial ARPE-19 cells. Invest Ophthalmol Vis Sci. 2004;45:2786–2794. [CrossRef] [PubMed]
Abramoff MD Magelhaes PJ Ram SJ . Image processing with ImageJ. Biophotonics Int. 2004;11:36–42.
Peirson SN Butler JN Foster RG . Experimental validation of novel and conventional approaches to quantitative real-time PCR data analysis. Nucleic Acids Res. 2003;31:e73. [CrossRef] [PubMed]
Halestrap AP Denton RM . The specificity and metabolic implications of the inhibition of pyruvate transport in isolated mitochondria and intact tissue preparations by alpha-Cyano-4-hydroxycinnamate and related compounds. Biochem J. 1975;148:97–106. [PubMed]
Saari JC Nawrot M Kennedy BN . Visual cycle impairment in cellular retinaldehyde binding protein (CRALBP) knockout mice results in delayed dark adaptation. Neuron. 2001;29:739–748. [CrossRef] [PubMed]
Cai X Conley SM Naash MI . RPE65: role in the visual cycle, human retinal disease, and gene therapy. Ophthalmic Genet. 2009;30:57–62. [CrossRef] [PubMed]
Moiseyev G Chen Y Takahashi Y Wu BX Ma JX . RPE65 is the isomerohydrolase in the retinoid visual cycle. Proc Natl Acad Sci U S A. 2005;102:12413–12418. [CrossRef] [PubMed]
Janssen JJ Kuhlmann ED van Vugt AH . Retinoic acid delays transcription of human retinal pigment neuroepithelium marker genes in ARPE-19 cells. Neuroreport. 2000;11:1571–1579. [CrossRef] [PubMed]
Alizadeh M Wada M Gelfman CM Handa JT Hjelmeland LM . Downregulation of differentiation specific gene expression by oxidative stress in ARPE-19 cells. Invest Ophthalmol Vis Sci. 2001;42:2706–2713. [PubMed]
Boulanger A Redmond TM . Expression and promoter activation of the Rpe65 gene in retinal pigment epithelium cell lines. Curr Eye Res. 2002;24:368–375. [CrossRef] [PubMed]
Kanuga N Winton HL Beauchene L . Characterization of genetically modified human retinal pigment epithelial cells developed for in vitro and transplantation studies. Invest Ophthalmol Vis Sci. 2002;43:546–555. [PubMed]
Vollrath D Feng W Duncan JL . Correction of the retinal dystrophy phenotype of the RCS rat by viral gene transfer of Mertk. Proc Natl Acad Sci U S A. 2001;98:12584–12589. [CrossRef] [PubMed]
Gal A Li Y Thompson DA . Mutations in MERTK, the human orthologue of the RCS rat retinal dystrophy gene, cause retinitis pigmentosa. Nat Genet. 2000;26:270–271. [CrossRef] [PubMed]
D'Cruz PM Yasumura D Weir J . Mutation of the receptor tyrosine kinase gene Mertk in the retinal dystrophic RCS rat. Hum Mol Genet. 2000;9:645–651. [CrossRef] [PubMed]
Andrae U Singh J Ziegler-Skylakakis K . Pyruvate and related alpha-ketoacids protect mammalian cells in culture against hydrogen peroxide-induced cytotoxicity. Toxicol Lett. 1985;28:93–98. [CrossRef] [PubMed]
Giandomenico AR Cerniglia GE Biaglow JE Stevens CW Koch CJ . The importance of sodium pyruvate in assessing damage produced by hydrogen peroxide. Free Radic Biol Med. 1997;23:426–434. [CrossRef] [PubMed]
Nath KA Ngo EO Hebbel RP Croatt AJ Zhou B Nutter LM . α-Ketoacids scavenge H2O2 in vitro and in vivo and reduce menadione-induced DNA injury and cytotoxicity. Am J Physiol. 1995;268:C227–C236. [PubMed]
Babich H Liebling EJ Burger RF Zuckerbraun HL Schuck AG . Choice of DMEM, formulated with or without pyruvate, plays an important role in assessing the in vitro cytotoxicity of oxidants and prooxidant nutraceuticals. In Vitro Cell Dev Biol Anim. 2009;45:226–233. [CrossRef] [PubMed]
Desagher S Glowinski J Premont J . Pyruvate protects neurons against hydrogen peroxide-induced toxicity. J Neurosci. 1997;17:9060–9067. [PubMed]
Wang X Perez E Liu R Yan LJ Mallet RT Yang SH . Pyruvate protects mitochondria from oxidative stress in human neuroblastoma SK-N-SH cells. Brain Res. 2007;1132:1–9. [CrossRef] [PubMed]
Halestrap AP . The mitochondrial pyruvate carrier: kinetics and specificity for substrates and inhibitors. Biochem J. 1975;148:85–96. [PubMed]
Liu Y Geng L Suo Z . Differentiation effect of pyruvate and uridine on cultured U937-rho degrees cells. Ultrastruct Pathol. 2009;33:160–164. [CrossRef] [PubMed]
Nakayasu M Saeki H Tohda H Oikawa A . Effects of sugars on melanogenesis in cultured melanoma cells. J Cell Physiol. 1977;92:49–55. [CrossRef] [PubMed]
Stanzel BV Espana EM Grueterich M . Amniotic membrane maintains the phenotype of rabbit retinal pigment epithelial cells in culture. Exp Eye Res. 2005;80:103–112. [CrossRef] [PubMed]
Campochiaro PA Hackett SF . Corneal endothelial cell matrix promotes expression of differentiated features of retinal pigmented epithelial cells: implication of laminin and basic fibroblast growth factor as active components. Exp Eye Res. 1993;57:539–547. [CrossRef] [PubMed]
Tezel TH Del Priore LV . Reattachment to a substrate prevents apoptosis of human retinal pigment epithelium. Graefes Arch Clin Exp Ophthalmol. 1997;235:41–47. [CrossRef] [PubMed]
Tezel TH Del Priore LV Kaplan HJ . Reengineering of aged Bruch's membrane to enhance retinal pigment epithelium repopulation. Invest Ophthalmol Vis Sci. 2004;45:3337–3348. [CrossRef] [PubMed]
Hunt RC Davis AA . Altered expression of keratin and vimentin in human retinal pigment epithelial cells in vivo and in vitro. J Cell Physiol. 1990;145:187–199. [CrossRef] [PubMed]
Lopes VS Wasmeier C Seabra MC Futter CE . Melanosome maturation defect in Rab38-deficient retinal pigment epithelium results in instability of immature melanosomes during transient melanogenesis. Mol Biol Cell. 2007;18:3914–3927. [CrossRef] [PubMed]
McKay BS Irving PE Skumatz CM Burke JM . Cell-cell adhesion molecules and the development of an epithelial phenotype in cultured human retinal pigment epithelial cells. Exp Eye Res. 1997;65:661–671. [CrossRef] [PubMed]
Riley PA . Mechanistic aspects of the control of tyrosinase activity. Pigment Cell Res. 1993;6:182–185. [CrossRef] [PubMed]
Rozanowski B Burke JM Boulton ME Sarna T Rozanowska M . Human RPE melanosomes protect from photosensitized and iron-mediated oxidation but become pro-oxidant in the presence of iron upon photodegradation. Invest Ophthalmol Vis Sci. 2008;49:2838–2847. [CrossRef] [PubMed]
Schraermeyer U Heimann K . Current understanding on the role of retinal pigment epithelium and its pigmentation. Pigment Cell Res. 1999;12:219–236. [CrossRef] [PubMed]
Ablonczy Z Crosson CE . VEGF modulation of retinal pigment epithelium resistance. Exp Eye Res. 2007;85:762–771. [CrossRef] [PubMed]
Ghassemifar R Lai CM Rakoczy PE . VEGF differentially regulates transcription and translation of ZO-1alpha+ and ZO-1alpha- and mediates trans-epithelial resistance in cultured endothelial and epithelial cells. Cell Tissue Res. 2006;323:117–125. [CrossRef] [PubMed]
Miyamoto N de Kozak Y Normand N . PlGF-1 and VEGFR-1 pathway regulation of the external epithelial hemato-ocular barrier: a model for retinal edema. Ophthalmic Res. 2008;40:203–207. [CrossRef] [PubMed]
Peng S Adelman RA Rizzolo LJ . Minimal effects of VEGF and anti-VEGF drugs on the permeability or selectivity of RPE tight junctions. Invest Ophthalmol Vis Sci. 2010;51:3216–3225. [CrossRef] [PubMed]
Blaauwgeers HG Holtkamp GM Rutten H . Polarized vascular endothelial growth factor secretion by human retinal pigment epithelium and localization of vascular endothelial growth factor receptors on the inner choriocapillaris: evidence for a trophic paracrine relation. Am J Pathol. 1999;155:421–428. [CrossRef] [PubMed]
Villarroel M Garcia-Ramirez M Corraliza L Hernandez C Simo R . Effects of high glucose concentration on the barrier function and the expression of tight junction proteins in human retinal pigment epithelial cells. Exp Eye Res. 2009;89:913–920. [CrossRef] [PubMed]
Guerrin M Moukadiri H Chollet P . Vasculotropin/vascular endothelial growth factor is an autocrine growth factor for human retinal pigment epithelial cells cultured in vitro. J Cell Physiol. 1995;164:385–394. [CrossRef] [PubMed]
Wu JH Wang F Xu P Huang Q . [In vitro transdifferentiation of adult human retinal pigment epithelium cells to neuro-like cells induced by blocking VEGF expression.]. Zhonghua Yan Ke Za Zhi. 2005;41:114–118. [PubMed]
Saint-Geniez M Kurihara T Sekiyama E Maldonado AE D'Amore PA . An essential role for RPE-derived soluble VEGF in the maintenance of the choriocapillaris. Proc Natl Acad Sci U S A. 2009;106:18751–18756. [CrossRef] [PubMed]
Saint-Geniez M Maharaj AS Walshe TE . Endogenous VEGF is required for visual function: evidence for a survival role on Muller cells and photoreceptors. PLoS One. 2008;3:e3554. [CrossRef] [PubMed]
Ohno-Matsui K Morita I Tombran-Tink J . Novel mechanism for age-related macular degeneration: an equilibrium shift between the angiogenesis factors VEGF and PEDF. J Cell Physiol. 2001;189:323–333. [CrossRef] [PubMed]
Sonoda S Spee C Barron E Ryan SJ Kannan R Hinton DR . A protocol for the culture and differentiation of highly polarized human retinal pigment epithelial cells. Nat Protoc. 2009;4:662–673. [CrossRef] [PubMed]
Sonoda S Sreekumar PG Kase S . Attainment of polarity promotes growth factor secretion by retinal pigment epithelial cells: relevance to age-related macular degeneration. Aging. 2010;2:28–42.
Kannan R Zhang N Sreekumar PG . Stimulation of apical and basolateral VEGF-A and VEGF-C secretion by oxidative stress in polarized retinal pigment epithelial cells. Mol Vis. 2006;12:1649–1659. [PubMed]
Slomiany MG Rosenzweig SA . IGF-1-induced VEGF and IGFBP-3 secretion correlates with increased HIF-1 alpha expression and activity in retinal pigment epithelial cell line D407. Invest Ophthalmol Vis Sci. 2004;45:2838–2847. [CrossRef] [PubMed]
Sone H Kawakami Y Okuda Y . Vascular endothelial growth factor is induced by long-term high glucose concentration and up-regulated by acute glucose deprivation in cultured bovine retinal pigmented epithelial cells. Biochem Biophys Res Commun. 1996;221:193–198. [CrossRef] [PubMed]
Young TA Wang H Munk S . Vascular endothelial growth factor expression and secretion by retinal pigment epithelial cells in high glucose and hypoxia is protein kinase C-dependent. Exp Eye Res. 2005;80:651–662. [CrossRef] [PubMed]
Xiao Q Zeng S Ling S Lv M . Up-regulation of HIF-1alpha and VEGF expression by elevated glucose concentration and hypoxia in cultured human retinal pigment epithelial cells. J Huazhong Univ Sci Technolog Med Sci. 2006;26:463–465. [CrossRef] [PubMed]
Heimsath EGJr Unda R Vidro E Muniz A Villazana-Espinoza ET Tsin A . ARPE-19 cell growth and cell functions in euglycemic culture media. Curr Eye Res. 2006;31:1073–1080. [CrossRef] [PubMed]
Tombran-Tink J Shivaram SM Chader GJ Johnson LV Bok D . Expression, secretion, and age-related downregulation of pigment epithelium-derived factor, a serpin with neurotrophic activity. J Neurosci. 1995;15:4992–5003. [PubMed]
Klimanskaya I Hipp J Rezai KA West M Atala A Lanza R . Derivation and comparative assessment of retinal pigment epithelium from human embryonic stem cells using transcriptomics. Cloning Stem Cells. 2004;6:217–245. [CrossRef] [PubMed]
Sharma RK Orr WE Schmitt AD Johnson DA . A functional profile of gene expression in ARPE-19 cells. BMC Ophthalmol. 2005;5:25. [CrossRef] [PubMed]
Tian J Ishibashi K Honda S Boylan SA Hjelmeland LM Handa JT . The expression of native and cultured human retinal pigment epithelial cells grown in different culture conditions. Br J Ophthalmol. 2005;89:1510–1517. [CrossRef] [PubMed]
Coljee VW Rotenberg MO Tresini M Francis MK Cristofalo VJ Sell C . Regulation of EPC-1/PEDF in normal human fibroblasts is posttranscriptional. J Cell Biochem. 2000;79:442–452. [CrossRef] [PubMed]
Senanayake P Calabro A Hu JG . Glucose utilization by the retinal pigment epithelium: evidence for rapid uptake and storage in glycogen, followed by glycogen utilization. Exp Eye Res. 2006;83:235–246. [CrossRef] [PubMed]
Kurtz MJ Edwards RB . Influence of bicarbonate and insulin on pigment synthesis by cultured adult human retinal pigment epithelial cells. Exp Eye Res. 1991;53:681–684. [CrossRef] [PubMed]
Figure 1.
 
Assessment of pigmentation in cultured RPE (ARPE-19) in various media conditions with and without pyruvate at 14 weeks after seeding. (A) No pigmentation is seen in DMEM/F12. (B) Some pigmentation is seen in high-glucose DMEM medium. (C) Heavily pigmented cells grown in DMEM/pyruvate with low glucose. (D) A similar appearance in DMEM/pyruvate with high glucose. Insets: abundance of the immature melanosome marker pmel17 (green) in a low-magnification confocal image with Nomarski optics. Note that both pmel17 staining and Nomarski pigment correlate with the presence/absence of pigmentation in the light micrographs. Scale bars: 100 μm (AD); 50 μm (inset).
Figure 1.
 
Assessment of pigmentation in cultured RPE (ARPE-19) in various media conditions with and without pyruvate at 14 weeks after seeding. (A) No pigmentation is seen in DMEM/F12. (B) Some pigmentation is seen in high-glucose DMEM medium. (C) Heavily pigmented cells grown in DMEM/pyruvate with low glucose. (D) A similar appearance in DMEM/pyruvate with high glucose. Insets: abundance of the immature melanosome marker pmel17 (green) in a low-magnification confocal image with Nomarski optics. Note that both pmel17 staining and Nomarski pigment correlate with the presence/absence of pigmentation in the light micrographs. Scale bars: 100 μm (AD); 50 μm (inset).
Figure 2.
 
Confocal micrographs of immunostained ARPE-19 under various commercially available media conditions at 8 weeks. (A) Nomarski view of ARPE-19 cells. In DMEM-based medium, pigmentation of the cells is intense in the presence of pyruvate (DH+P and DL+P). The morphology of the cells is polygonal, producing a characteristic mosaic. In DFH and DH, no pigmentation was detectable at this time point. (B) Confocal projections of actin reveal a favorable circumferential actin distribution throughout the height of the cells in DH+P and DL+P. (C) No keratin 8 expression in DH+P or DL+P irrespective of glucose. Keratin 8 expression is retained in DFH and DH. (D) CRALBP expression is markedly increased in DH+P and DL+P with a subset of intensely positive cells. DFH = DMEM/F12 high glucose; DH = DMEM high glucose (no pyruvate); DH+P = DMEM high glucose + pyruvate; DL+P = DMEM low glucose + pyruvate. Scale bar, 20 μm.
Figure 2.
 
Confocal micrographs of immunostained ARPE-19 under various commercially available media conditions at 8 weeks. (A) Nomarski view of ARPE-19 cells. In DMEM-based medium, pigmentation of the cells is intense in the presence of pyruvate (DH+P and DL+P). The morphology of the cells is polygonal, producing a characteristic mosaic. In DFH and DH, no pigmentation was detectable at this time point. (B) Confocal projections of actin reveal a favorable circumferential actin distribution throughout the height of the cells in DH+P and DL+P. (C) No keratin 8 expression in DH+P or DL+P irrespective of glucose. Keratin 8 expression is retained in DFH and DH. (D) CRALBP expression is markedly increased in DH+P and DL+P with a subset of intensely positive cells. DFH = DMEM/F12 high glucose; DH = DMEM high glucose (no pyruvate); DH+P = DMEM high glucose + pyruvate; DL+P = DMEM low glucose + pyruvate. Scale bar, 20 μm.
Figure 3.
 
Effect of growth medium and pyruvate on apical-basal polarity and junctional proteins in ARPE-19 cells at 15 weeks. (A) A single confocal frame taken through the upper portion of the cells reveals extensive stress fibers in DFH medium, whereas DMEM media (DH, DH+P, DL+P) have circumferential actin staining at 3 months. (B) The basal compartment of the cells shows stress fibers of varying appearance in all media. ZO-1 (C) and occludin (D) expression indicates good junctional development, and both markers can be seen in all media types. (E) SEM of cells grown without pyruvate shows sparse apical microvilli. (F) SEM of numerous apical microvilli on cells grown in presence of pyruvate. (G) Z-sections (cross-sections) through the confocal stack with Nomarski optics to aid identification of the subset of pigmented cells within the culture. Cells were fed with DH+P. ZO-1 (red points) is polarized to the apical region, whereas Na,K-ATPase (green) is basolateral except in pigmented cells (vertical arrows), which have apical expression of Na,K-ATPase (horizontal arrows). This suggests better polarization in pigmented cells. See also Supplementary Figure S1. DFH = DMEM/F12 high glucose; DH = DMEM high glucose; DH+P = DMEM high glucose + pyruvate; DL+P = DMEM low glucose + pyruvate. Scale bars: 10 μm (E, F); 20 μm (all others).
Figure 3.
 
Effect of growth medium and pyruvate on apical-basal polarity and junctional proteins in ARPE-19 cells at 15 weeks. (A) A single confocal frame taken through the upper portion of the cells reveals extensive stress fibers in DFH medium, whereas DMEM media (DH, DH+P, DL+P) have circumferential actin staining at 3 months. (B) The basal compartment of the cells shows stress fibers of varying appearance in all media. ZO-1 (C) and occludin (D) expression indicates good junctional development, and both markers can be seen in all media types. (E) SEM of cells grown without pyruvate shows sparse apical microvilli. (F) SEM of numerous apical microvilli on cells grown in presence of pyruvate. (G) Z-sections (cross-sections) through the confocal stack with Nomarski optics to aid identification of the subset of pigmented cells within the culture. Cells were fed with DH+P. ZO-1 (red points) is polarized to the apical region, whereas Na,K-ATPase (green) is basolateral except in pigmented cells (vertical arrows), which have apical expression of Na,K-ATPase (horizontal arrows). This suggests better polarization in pigmented cells. See also Supplementary Figure S1. DFH = DMEM/F12 high glucose; DH = DMEM high glucose; DH+P = DMEM high glucose + pyruvate; DL+P = DMEM low glucose + pyruvate. Scale bars: 10 μm (E, F); 20 μm (all others).
Figure 4.
 
Western blot and Q-PCR analyses of expression in ARPE-19 cells after culture in various media types at 15 weeks. (AF) Proteins were probed using antibodies against CRALBP (37 kDa), keratin 8 (KRT8; 53 kDa), MerTK (180 kDa), RPE65 (65 kDa), tyrosinase (TYR; 70 kDa), and GAPDH (36 kDa). (A) Representative Western blot image. (BF) Relative protein expression of CRALBP, keratin 8, MerTK, RPE65, and tyrosinase. (G) ICC of RPE65 is subtle. (HL) mRNA relative expression patterns. All data represent mean relative intensity ± SEM. Unless specified, asterisks indicate the following significance levels compared with DFH: *P < 0.05, **P < 0.01, ***P < 0.001 (n = 3). DFH = DMEM/F12 high glucose; DH = DMEM high glucose; DH+P = DMEM high glucose + pyruvate; DL+P = DMEM low glucose + pyruvate (n = 3). †The only occurrence of changed order of media in this article.
Figure 4.
 
Western blot and Q-PCR analyses of expression in ARPE-19 cells after culture in various media types at 15 weeks. (AF) Proteins were probed using antibodies against CRALBP (37 kDa), keratin 8 (KRT8; 53 kDa), MerTK (180 kDa), RPE65 (65 kDa), tyrosinase (TYR; 70 kDa), and GAPDH (36 kDa). (A) Representative Western blot image. (BF) Relative protein expression of CRALBP, keratin 8, MerTK, RPE65, and tyrosinase. (G) ICC of RPE65 is subtle. (HL) mRNA relative expression patterns. All data represent mean relative intensity ± SEM. Unless specified, asterisks indicate the following significance levels compared with DFH: *P < 0.05, **P < 0.01, ***P < 0.001 (n = 3). DFH = DMEM/F12 high glucose; DH = DMEM high glucose; DH+P = DMEM high glucose + pyruvate; DL+P = DMEM low glucose + pyruvate (n = 3). †The only occurrence of changed order of media in this article.
Figure 5.
 
Comparison of TER of ARPE-19 cells grown on uncoated filters in various media conditions over the course of 6 weeks. (A) TER values at 3, 4.5, and 6 weeks. (B) Average TER over the same time period. Data are mean ± SEM. Asterisks indicate the following significance levels compared with DMEM/F12: *P < 0.05, ***P < 0.001 (n = 6).
Figure 5.
 
Comparison of TER of ARPE-19 cells grown on uncoated filters in various media conditions over the course of 6 weeks. (A) TER values at 3, 4.5, and 6 weeks. (B) Average TER over the same time period. Data are mean ± SEM. Asterisks indicate the following significance levels compared with DMEM/F12: *P < 0.05, ***P < 0.001 (n = 6).
Figure 6.
 
(A, B) Comparison of VEGF secretion by ARPE-19 cells grown on uncoated filters under various media conditions at 10 weeks. (A) Total VEGF output (pg/cm2/24 hours) by ARPE-19 grown on uncoated 24-mm inserts at 10 weeks after seeding. (B) The same groups with apical and basal VEGF shown separately. Basal VEGF is significantly increased in DMEM media compared with DFH. (CE) Comparison of VEGF and PEDF mRNA at 15 weeks. (C) Effect of low glucose was to lower VEGF expression, but no effect of pyruvate is seen. (D) Pyruvate and glucose contribute to increased PEDF expression. (E) Favorable (low) VEGF/PEDF ratios are seen in DMEM media. (F) Triplicate Western blot demonstrating PEDF expression in DH+P medium. DFH = DMEM/F12 high glucose; DH = DMEM high glucose; DH+P = DMEM high glucose + pyruvate; DL+P = DMEM low glucose + pyruvate. All data are mean ± SEM. Unless otherwise specified, asterisks indicate the following significance levels compared with DFH: *P < 0.05, **P < 0.01. Hatched symbols: significance compared with DFH when only high-glucose media are analyzed (DFH, DH, DH+P): #P < 0.05, ##P < 0.01 (n = 3).
Figure 6.
 
(A, B) Comparison of VEGF secretion by ARPE-19 cells grown on uncoated filters under various media conditions at 10 weeks. (A) Total VEGF output (pg/cm2/24 hours) by ARPE-19 grown on uncoated 24-mm inserts at 10 weeks after seeding. (B) The same groups with apical and basal VEGF shown separately. Basal VEGF is significantly increased in DMEM media compared with DFH. (CE) Comparison of VEGF and PEDF mRNA at 15 weeks. (C) Effect of low glucose was to lower VEGF expression, but no effect of pyruvate is seen. (D) Pyruvate and glucose contribute to increased PEDF expression. (E) Favorable (low) VEGF/PEDF ratios are seen in DMEM media. (F) Triplicate Western blot demonstrating PEDF expression in DH+P medium. DFH = DMEM/F12 high glucose; DH = DMEM high glucose; DH+P = DMEM high glucose + pyruvate; DL+P = DMEM low glucose + pyruvate. All data are mean ± SEM. Unless otherwise specified, asterisks indicate the following significance levels compared with DFH: *P < 0.05, **P < 0.01. Hatched symbols: significance compared with DFH when only high-glucose media are analyzed (DFH, DH, DH+P): #P < 0.05, ##P < 0.01 (n = 3).
Figure 7.
 
TEM of pigmented post-confluent ARPE-19 cells on extracellular matrix–coated cellulose filters maintained with DH+P and human POS phagocytosis assay at 10 weeks. (A) Control ARPE-19. (B) Various stages of melanogenesis found in these cells (increasing from left to right). (C) Cells cocultured with human retina for 24 hours, with an example of noninternalized human POS (retina became separated from RPE cells during processing). (DH) Presence of phagosomes in ARPE-19 cells at 48 hours after coculture, consistent with internalized POS. Arrows: internalized POS. Asterisks indicate lipid-rich phagosomes, which may be the result of POS digestion. (D) Note the cuboidal polarized profile of some cells. (F) Also note desmosomes (ds) at the cell-cell border and the apical junctional complex (AJC), which indicate junction development and polarity. (I) High-magnification image of an ingested POS (from H). Note the appearance is consistent with a tight-junction (TJ) and an adherens junction (AJ). Scale bars, 2 μm (A, C, D); 200 nm (B); 1 μm (all others).
Figure 7.
 
TEM of pigmented post-confluent ARPE-19 cells on extracellular matrix–coated cellulose filters maintained with DH+P and human POS phagocytosis assay at 10 weeks. (A) Control ARPE-19. (B) Various stages of melanogenesis found in these cells (increasing from left to right). (C) Cells cocultured with human retina for 24 hours, with an example of noninternalized human POS (retina became separated from RPE cells during processing). (DH) Presence of phagosomes in ARPE-19 cells at 48 hours after coculture, consistent with internalized POS. Arrows: internalized POS. Asterisks indicate lipid-rich phagosomes, which may be the result of POS digestion. (D) Note the cuboidal polarized profile of some cells. (F) Also note desmosomes (ds) at the cell-cell border and the apical junctional complex (AJC), which indicate junction development and polarity. (I) High-magnification image of an ingested POS (from H). Note the appearance is consistent with a tight-junction (TJ) and an adherens junction (AJ). Scale bars, 2 μm (A, C, D); 200 nm (B); 1 μm (all others).
Figure 8.
 
Effect of α-cyano-4-hydroxycinnamate (4-CIN) on the differentiation of ARPE-19 cells in high-glucose DMEM/pyruvate medium at 11 weeks. (A) Light microscopy of cells grown in the presence of 50 μM 4-CIN shows visible pigmentation, similar to that of controls (not shown). (B) 500 μM 4-CIN visibly reduces pigmentation. Scale bar, 100 μm. (C) Actin fibers are circumferential in control and 50-μM groups, but abundant stress fibers occur at the highest concentration of 4-CIN. (D) Nomarski optics confirm pigmentation levels (n = 3). Scale bar, 20 μm.
Figure 8.
 
Effect of α-cyano-4-hydroxycinnamate (4-CIN) on the differentiation of ARPE-19 cells in high-glucose DMEM/pyruvate medium at 11 weeks. (A) Light microscopy of cells grown in the presence of 50 μM 4-CIN shows visible pigmentation, similar to that of controls (not shown). (B) 500 μM 4-CIN visibly reduces pigmentation. Scale bar, 100 μm. (C) Actin fibers are circumferential in control and 50-μM groups, but abundant stress fibers occur at the highest concentration of 4-CIN. (D) Nomarski optics confirm pigmentation levels (n = 3). Scale bar, 20 μm.
Table 1.
 
Primers Used for Quantitative PCR
Table 1.
 
Primers Used for Quantitative PCR
Gene Forward Primer 5′-3′ Reverse Primer 5′-3′ Accession Size (bp) Temperature 3°C
Cralbp GCCGAGTGGTCATGCTGTTG AGCCTGCTGCATGGTAAGC NM_000326 180 60
Krt8 AAGGATGCCAACGCCAAGTT CCGCTGGTGGTCTTCGTATG NM_002273 214 60
MerTK ATCCTGGGGTCCAGAACCAT TTCCGAACGTCAGGCAAACT NM_006343 162 60
Pedf CCCATGATGTCGGACCCTAA CAGGGGCAGGAAGAAGATGA NM_002615 117 60
RPE65 CAAGGCTGACACAGGCAAGA TTGACGAGGCCCTGAAAAGA NM_000329 118 60
Tyr TAGCGGATGCCTCTCAAAGC CAATGGGTGCATTGGCTTCT NM_000372 195 60
VegfA TCTGCTGTCTTGGGTGCATT ATGTCCACCAGGGTCTCGAT NM_001171623 175 60
Gapdh CCCCACCACACTGAATCTCC GGTACTTTATTGATGGTACATGACAAG NM_002046 104 60
Tubb AATCCCCACCTTTTCTTACTCC AAAGATGGAGGAGGGTTCCC NM_004048 119 60
B2M TGTTGATGTATCTGAGCAGGTTG AAGATGTTGATGTTGGATAAGAGAATC NM_178014 100 60
Figure sf01, PDF
Table st1, PDF
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×