Free
Immunology and Microbiology  |   December 2012
Sphingosine 1-Phosphate Elicits Proinflammatory Responses in ARPE-19 Cells
Author Affiliations & Notes
  • Yanbin Qiao
    From The First Affiliated Hospital of Chongqing Medical University, Youyi Road 1, Chongqing Key Laboratory of Ophthalmology, and Chongqing Eye Institute, Chongqing, People's Republic of China; and the
  • Ranran Hu
    From The First Affiliated Hospital of Chongqing Medical University, Youyi Road 1, Chongqing Key Laboratory of Ophthalmology, and Chongqing Eye Institute, Chongqing, People's Republic of China; and the
  • Qian Wang
    From The First Affiliated Hospital of Chongqing Medical University, Youyi Road 1, Chongqing Key Laboratory of Ophthalmology, and Chongqing Eye Institute, Chongqing, People's Republic of China; and the
  • Jian Qi
    From The First Affiliated Hospital of Chongqing Medical University, Youyi Road 1, Chongqing Key Laboratory of Ophthalmology, and Chongqing Eye Institute, Chongqing, People's Republic of China; and the
  • Yan Yang
    From The First Affiliated Hospital of Chongqing Medical University, Youyi Road 1, Chongqing Key Laboratory of Ophthalmology, and Chongqing Eye Institute, Chongqing, People's Republic of China; and the
  • Aize Kijlstra
    University Eye Clinic Maastricht, Maastricht, The Netherlands.
  • Peizeng Yang
    From The First Affiliated Hospital of Chongqing Medical University, Youyi Road 1, Chongqing Key Laboratory of Ophthalmology, and Chongqing Eye Institute, Chongqing, People's Republic of China; and the
  • Corresponding author: Peizeng Yang, The First Affiliated Hospital of Chongqing Medical University, Youyi Road 1, Chongqing Key Laboratory of Ophthalmology, and Chongqing Eye Institute, Chongqing, P.R. China, 400016; peizengycmu@126.com
Investigative Ophthalmology & Visual Science December 2012, Vol.53, 8200-8207. doi:10.1167/iovs.12-10965
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Yanbin Qiao, Ranran Hu, Qian Wang, Jian Qi, Yan Yang, Aize Kijlstra, Peizeng Yang; Sphingosine 1-Phosphate Elicits Proinflammatory Responses in ARPE-19 Cells. Invest. Ophthalmol. Vis. Sci. 2012;53(13):8200-8207. doi: 10.1167/iovs.12-10965.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

Purpose.: To investigate the effects of sphingosine 1-phosphate (S1P) on the production of inflammatory mediators and the signaling pathways involved in S1P-mediated production of cytokines by ARPE-19 cells.

Methods.: Expression of S1P receptors was examined using RT-PCR and real-time PCR. ARPE-19 cells were stimulated with S1P or TNF-α, and by coculturing with S1P in the presence or absence of pertussis toxin (PTX) or a series of kinase inhibitors. The induction of inflammatory cytokine production was determined by ELISA. Western blot analysis was used to detect the activation of signaling mediators and S1P3 receptor.

Results.: ARPE-19 cells express all the known receptors for S1P. Moreover, exogenously applied S1P induces ARPE-19 cell secretion of interleukin-8 (IL-8) in a dose- and time-dependent manner, but not IL-6 and monocyte chemotactic protein-1 (MCP-1). S1P-mediated IL-8 secretion is regulated by PTX, extracellular regulated protein kinases 1/2 (ERK1/2), and p38 mitogen-activated protein kinase (MAPK). Interestingly, treatment of ARPE-19 cells with TNF-α increases S1P3 expression and correlates with the enhancement of S1P-induced IL-8 and IL-6 production.

Conclusions.: This study demonstrates that S1P significantly promoted ARPE-19 cells to secrete inflammatory mediators. extracellular regulated protein kinases 1/2 (ERK1/2), p38 MAPK, and Gi-dependent pathways are important signaling components in S1P-mediated IL-8 secretion by ARPE-19 cells. Moreover, these results provide evidence that S1P stimulation of RPE cells may play a role in regulating leukocyte function during ocular inflammation.

Introduction
Retinal pigment epithelial (RPE) cells form a blood-retina barrier that limits access of blood cells and proteins to the retina. There is evidence that RPE cell dysfunction plays a role in the pathogenesis of certain ocular diseases including age-related macular degeneration (AMD), 1 proliferative vitreoretinopathy (PVR), 2 and overtly inflammatory ocular diseases such as uveitis, 3 disorders in which leukocyte and macrophage infiltration is often seen. Furthermore, this cell is a rich source of cytokines that may contribute to or limit pathologic processes. In response to IL-1 and other proinflammatory stimuli, RPE cells have been found to produce a variety of cytokines, including IL-6, IL-8, monocyte chemotactic protein-1 (MCP-1), and granulocyte-macrophage colony-stimulating factor (GMCSF), 4 which may play important roles in ocular inflammation. 
Sphingosine 1-phosphate (S1P) is a naturally occurring lipid produced by many different cell types and is present in circulating blood at a low micromolar concentration. A number of studies have clearly demonstrated that S1P can modulate multiple key biological processes, including cell proliferation, motility, differentiation, and survival, by acting either as intracellular mediator or as ligand of at least five distinct G-protein–coupled receptors, termed S1P receptors (S1P1–5). 57 S1P receptors (S1P1–5) are part of the G protein–coupled receptor (GPCR) superfamily and are widely expressed in most tissues at different levels, suggesting that this receptor influences many cellular processes. Recent studies have established the involvement of S1P in regulating intracellular events in cytokine signaling and in the induction of inflammatory mediators. S1P has been shown to exhibit proinflammatory effects by regulating interleukin-6 (IL-6) secretion in smooth muscle cells and osteoblasts, MCP-1 secretion in vein endothelial cells, and IL-8 secretion in bronchial epithelial cells and synoviocytes. 812 Thus, it appears that extracellular S1P is a mediator of inflammation by regulating proinflammatory cytokine production. 
There is evidence that S1P is present in primary human RPE, conjunctival fibroblasts, corneal fibroblasts, 13 and rabbit vitreous fluid. 14 Moreover, S1P has been shown to participate in the ocular fibrogenic cascade and to contribute to scar formation in ocular diseases. 13 S1P stimulates neovascularization, whereas its selective binding with a monoclonal antibody significantly reduces the damage. 14 Moreover, lipopolysaccharide-induced inflammation increases S1P levels in rat retina, promoting astrogliosis, 15 suggesting that S1P may also participate in retinal inflammation. Control of S1P levels might therefore successfully be used for the treatment of several ocular diseases, such as AMD and diabetic retinopathy. 14,16 Despite the increasing amount of evidence implicating S1P as a proinflammatory mediator, very few studies have assessed the role of S1P in ocular inflammation. 17 In view of the important role of the RPE cell during ocular inflammation, we sought to fully characterize the role of the S1P/S1P receptor signaling pathway in RPE cell function. 
Herein, we report that ARPE-19 cells express the S1P1–5 receptors. We also provide evidence that S1P markedly stimulated IL-8 secretion in a pertussis toxin (PTX)-sensitive manner, as well as the elucidation role of extracellular regulated protein kinases 1/2 (ERK1/2) and p38 MAPK (mitogen-activated protein kinase) in S1P-induced IL-8 production. In addition, S1P3 expression by ARPE-19 cells was enhanced by TNF-α, and S1P-mediated cytokine secretion was super-induced in TNF-α-primed ARPE-19 cells. These results suggest that S1P effects on RPE cells may be important in regulating inflammatory responses in the eye. 
Materials and Methods
Cell Culture
Human ARPE-19 cells were obtained from the American Type Culture Collection (ATCC, Manassas, VA), and cells at passages 16 to 20 were used for the experiment described here. The cells were cultured in Dulbecco′s modified Eagle's medium/F12 (DMEM/F12; Invitrogen, Beijing, China) containing 10% fetal bovine serum (FBS; Invitrogen, Carlsbad, CA), 100 U/mL penicillin, and 100 μg/mL streptomycin. The cells were maintained under standard cell culture conditions at 37°C in humidified air with 5% CO2. Corning flasks were used with 1 × 106 cells/flask, resulting in completely confluent (≈2 × 106 cells/flask) cultures in 4 days. 
Cell Treatment
Completely confluent cells were starved with serum-free medium for 24 hours before treatment. At the moment of cell treatment, the culture medium was replaced with fresh serum-free medium containing various concentrations of the tested compounds as indicated below. 
Semiquantitative RT-PCR and Real-Time PCR Analyses
Total cellular RNA was extracted from ARPE-19 cells using TRIzol reagent according to the manufacturer's instructions (Invitrogen, Carlsbad, CA). RNA (1 μg) was reverse transcribed using random priming and the Superscript II Reverse Transcriptase system (Invitrogen). Oligonucleotides used as primers were designed to amplify specific cDNA sequences. Primer sequences are listed in the Table. PCR reactions were performed for 35 cycles. A total of 35 PCR cycles were run at 94°C with denaturation at 94°C for 1 minute, annealing at 63°C for S1P1–3 and 61°C for S1P4–5 for 1 minute, and finally extension at 72°C for 1 minute. PCR products were separated by a 2% agarose gel and photographed by laser densitometry scanning. In real-time PCR experiments, we used the same primers as for RT-PCR to amplify S1P1–5. The thermal cycling conditions were as follows: initial denaturation at 95°C for 3 minutes, followed by 40 cycles of denaturation at 95°C for 15 seconds, annealing at 63°C for S1P1–3 and 61°C for S1P4–5 for 20 seconds, and finally extension at 72°C extension for 20 seconds. The S1P1–5 PCR products were normalized in relation to the β-actin internal control. All experiments were repeated independently on four different occasions. 
Enzyme-Linked Immunosorbent Assay
ARPE-19 cells plated at a concentration of 1 × 106 cells/mL in six-well plates were stimulated with S1P at indicated concentrations or times. 10,18 Where indicated, cells were pretreated with an inhibitor of ERK1/2 (PD98059 at indicated dose for 1 hour), an inhibitor of p38 MAPK (SB203580 at indicated dose for 1 hour), or PTX (100 ng/mL for 24 hours) prior to stimulation with S1P (5 μM for 24 hours). To detect the effect of TNF-α on S1P-mediated cytokine secretion, cells were pretreated with TNF-α for 24 hours and washed extensively prior to stimulation with S1P (5 μM for 24 hours). Cell culture supernatants were centrifuged (1000g × 5 min) to remove particulates and stored at −80°C until the cytokine ELISAs were performed. IL-8, IL-6, and MCP-1 were measured using human ELISA development kits (Duoset; R&D Systems, Minneapolis, MN). Each stimulation experiment was performed in quadruplicate. 
Western Blot Analysis
To monitor the activation of ERK1/2, p38 MAPK, and C-Jun N-terminal Kinases (JNK), ARPE-19 cells were exposed to S1P (5 μM) for various times (5, 15, 30, 60 minutes). Where indicated, cells were pretreated with PD98059 (25 μM for 1 hour) or SB203580 (10 μM for 1 hour) prior to S1P stimulation (5 μM for 15 minutes). To determine whether TNF-α can regulate the expression of S1P3 receptor, cells were cultured for 24 hours in the presence of TNF-α (10 ng/mL). Cells were lysed in boiling sample buffer (50 mM Tris/HCl [pH 6.8], 10% [v/v] glycerol, 50 mM dithiothreitol (DTT), 4% [v/v] SDS) and boiled for 7 to 10 minutes. Equal amounts of protein (40 μg) were separated by 10% SDS-PAGE. 
Proteins were transferred to polyvinylidene difluoride membranes (Millipore, Bedford, MA), blocked by 5% skim milk or 5% BSA at 37°C for 2 hours, and incubated with the primary phosphorylated or total antibodies against ERK1/2, p38 MAPK, JNK (Cell Signaling Technology, Beverly, MA) and S1P3 (Epitomics, Inc., Burlingame, CA) at 4°C for 16 hours, followed by a horseradish peroxidase–conjugated secondary antibody at room temperature for 1 hour. The membranes were washed three additional times with Tris-Buffered Saline and Tween 20 (TBST), and antibody–antigen complexes were revealed using an enhanced chemiluminescent (ECL) technique, according to the manufacturer's instructions. Quantitation was performed by computer with commercial software (ImageQuant; Molecular Dynamics, Sunnyvale, CA). Each stimulation experiment was performed in quadruplicate. 
Statistical Analyses
One-way ANOVA and paired sample t-test were performed using SPSS 13.0 software (SPSS, Inc., Chicago, IL). Data are expressed as mean values ± SD. A value of P < 0.05 was considered significant. 
Results
S1P1–5 Receptor Expression in ARPE-19 Cells
To determine whether human ARPE-19 cells express all the known receptors for S1P, the mRNA expression of S1P1–5 receptors was investigated using both semiquantitative RT-PCR (Fig. 1A) and real-time PCR (Fig. 1B). As shown in Figure 1A, RT-PCR analysis confirmed the mRNA expression of S1P1–5 receptors in ARPE-19 cells. S1P3 was the most highly expressed, with lesser amounts of S1P1, S1P2, S1P4, and S1P5 (Fig. 1B). 
Figure 1. 
 
Detection of S1P receptor expression in ARPE-19 cells. (A, B) mRNA expression of S1P1–5 receptors in ARPE-19 cells was detected by RT-PCR and real-time PCR.
Figure 1. 
 
Detection of S1P receptor expression in ARPE-19 cells. (A, B) mRNA expression of S1P1–5 receptors in ARPE-19 cells was detected by RT-PCR and real-time PCR.
Influence of S1P on the Production of Inflammatory Mediators
To determine the influence of S1P on the production of inflammatory mediators by ARPE-19 cells, the amount of IL-8, IL-6, and MCP-1 produced by these cells was assayed. The results showed that S1P significantly enhanced the level of IL-8, but did not influence the constitutive production of IL-6 and MCP-1 (data not shown) by these cells. As shown in Figure 2A, a significantly enhanced level of IL-8 was detected following stimulation with 0.1 to 5 μM S1P (P = 0.001 for 0.1 μM S1P, P < 0.001 for both 1 μM and 5 μM S1P versus nontreated ARPE-19 cells). ARPE-19 cell treatment with S1P (5 μM) resulted in a time-dependent IL-8 increase (Fig. 2B), which became apparent when cells had been incubated in the presence of 5 μM S1P for 8 hours. 
Figure 2. 
 
S1P-mediated interleukin-8 (IL-8) secretion. (A) Dose–response effect of S1P on IL-8 secretion. Confluent ARPE-19 cells were treated with the indicated concentrations of S1P for 24 hours, and the amount of IL-8 was measured by ELISA. (B) Kinetics of IL-8 secretion. Cells were incubated with 5 μM S1P for the indicated times, and the amount of IL-8 was measured by ELISA. Each stimulation experiment was performed in quadruplicate, and the results are displayed as mean value ± SD.
Figure 2. 
 
S1P-mediated interleukin-8 (IL-8) secretion. (A) Dose–response effect of S1P on IL-8 secretion. Confluent ARPE-19 cells were treated with the indicated concentrations of S1P for 24 hours, and the amount of IL-8 was measured by ELISA. (B) Kinetics of IL-8 secretion. Cells were incubated with 5 μM S1P for the indicated times, and the amount of IL-8 was measured by ELISA. Each stimulation experiment was performed in quadruplicate, and the results are displayed as mean value ± SD.
Mediation of S1P-Enhanced IL-8 Production via PTX-Sensitive Pathway
It has been reported that S1P receptors couple to PTX-sensitive G proteins of the Gi/G0 family. 1921 To study whether the signal transduction involves coupling to Gi proteins, we next examined the IL-8 response in the presence or absence of PTX. ARPE-19 cells were preincubated with 100 ng/mL PTX for 24 hours. After rigorous washing, the cells were stimulated with 5 μM S1P. After 24 hours, IL-8 was measured in culture supernatants. As shown in Figure 3, PTX pretreatment for 24 hours effectively blocked (90.3 ± 6.1%) S1P-enhanced IL-8 secretion by ARPE-19 cells. These results indicate that S1P enhancement of IL-8 production by ARPE-19 cells depends on a Gi pathway. 
Figure 3. 
 
Effect of PTX on S1P-enhanced IL-8 production by ARPE-19 cells. IL-8 production by ARPE-19 cells with or without PTX pretreatment was measured in the absence or presence of 5 μM S1P. After 48 hours of culture, secreted IL-8 was measured by ELISA. Each stimulation experiment was performed in quadruplicate, and the results are displayed as mean value ± SD.
Figure 3. 
 
Effect of PTX on S1P-enhanced IL-8 production by ARPE-19 cells. IL-8 production by ARPE-19 cells with or without PTX pretreatment was measured in the absence or presence of 5 μM S1P. After 48 hours of culture, secreted IL-8 was measured by ELISA. Each stimulation experiment was performed in quadruplicate, and the results are displayed as mean value ± SD.
Signaling Pathways Involved in the Biological Response to S1P
We next examined the ability of S1P to activate ERK1/2, p38 MAPK, and JNK signaling pathways and their involvement in the biological response to S1P. S1P enhanced the phosphorylation of ERK1/2 and p38 MAPK (Fig. 4). As shown in Figures 4A and 4B, enhanced phosphorylation of ERK1/2 (2.24 ± 0.1-fold) was detected within 5 minutes of exposure to S1P, while maximum phosphorylation (4.45 ± 0.3-fold) occurred at 15 minutes. The response was sustained up to 30 minutes and declined at 60 minutes. Similarly, S1P-activated p38 MAPK (2.94 ± 0.1-fold) occurred within 5 minutes and peaked at 5 minutes. The response was sustained up to 30 minutes and attenuated at 60 minutes (Figs. 4C, 4D). No phosphorylation of JNK was detected following stimulation with S1P for up to 60 minutes (data not shown). These results indicated that S1P-induced IL-8 secretion was mediated through ERK1/2 and p38 MAPK pathway in ARPE-19 cells, but not JNK. 
Figure 4. 
 
S1P-induced activation of ERK1/2 and p38MAPK. (AD) Effect of S1P on the activation of ERK1/2 and p38 MAPK. Cells were stimulated with S1P (5 μM) for up to 60 minutes, and cell lysates were analyzed by Western blot. (E, F) Effect of ERK1/2 and p38 MAPK inhibitors on S1P-induced activation of ERK1/2 and p38 MAPK. Cells were pretreated with 25 μM PD98059 (E) and 10 μM SB203580 (F) for 60 minutes prior to stimulation with 5 μM S1P for 15 minutes. Cell lysates were analyzed by Western blot. Each stimulation experiment was performed in quadruplicate. ***P < 0.001.
Figure 4. 
 
S1P-induced activation of ERK1/2 and p38MAPK. (AD) Effect of S1P on the activation of ERK1/2 and p38 MAPK. Cells were stimulated with S1P (5 μM) for up to 60 minutes, and cell lysates were analyzed by Western blot. (E, F) Effect of ERK1/2 and p38 MAPK inhibitors on S1P-induced activation of ERK1/2 and p38 MAPK. Cells were pretreated with 25 μM PD98059 (E) and 10 μM SB203580 (F) for 60 minutes prior to stimulation with 5 μM S1P for 15 minutes. Cell lysates were analyzed by Western blot. Each stimulation experiment was performed in quadruplicate. ***P < 0.001.
To further examine the signaling pathways involved in the activation of ERK1/2 and P38 MAPK, ARPE-19 cells were pretreated with 10 μM PD98059 (ERK1/2 inhibitor) or 25 μM SB203580 (p38 MAPK inhibitor). As expected, PD98059 blocked S1P-induced phosphorylation of ERK1/2 (Fig. 4E), and SB203580 similarly attenuated S1P-induced phosphorylation of p38 MAPK (Fig. 4F). 
Treatment of ARPE-19 cells with PD98059 (ERK1/2 inhibitor) 1 hour before the S1P addition completely abolished S1P-induced release of IL-8 (Fig. 5A). The difference in the amount of IL-8 in medium between cells treated with and without PD98059 (positive control) was very significant; 10 μM and 25 μM PD98059 reduced S1P-mediated IL-8 secretion by 44.0 ± 3.2% (P = 0.003) and 72.5 ± 4.7% (n = 4, P < 0.001), respectively. The level of IL-8 in medium from PD98059 (25 μM)- and S1P-treated cells was slightly greater than that of negative controls (cells cultured without S1P); however, there was no significant difference between these two groups (P = 0.052). These results indicated that PD98059 (ERK1/2 inhibitor) completely abolished the S1P-induced increase of IL-8 secretion by ARPE-19 cells. On the other hand, pretreatment of ARPE-19 cells with SB203580 (p38 MAPK inhibitor) 1 hour before the S1P addition decreased S1P-induced release of IL-8 (Fig. 5B). The difference in the amount of IL-8 in medium between ARPE-19 cells treated with and without SB203580 (positive control) was significant (P = 0.022 and P = 0.003; Fig. 5B). The levels of IL-8 in medium from SB203580 (10 μM)- and S1P-treated cells were obviously greater than in negative controls (cells cultured without S1P, P < 0.001), indicating that the p38 inhibitor (SB203580) slightly inhibited the S1P-induced increase of the release of IL-8 by ARPE-19 cells. Treatment with p38 inhibitor 1 hour before the S1P addition showed only a minor influence on the S1P-induced release of IL-8 by ARPE-19 cells (Fig. 5B). 
Figure 5. 
 
Role of ERK1/2 and p38 MAPK in S1P-induced cytokine secretion. Cells were treated with S1P (5 μM) for 24 hours in the presence or absence of PD98059 (A) and SB203580 (B) at the indicated concentrations. Secreted IL-8 (A, B) was quantified by ELISA. Each stimulation experiment was performed in quadruplicate, and the results are displayed as mean value ± SD.
Figure 5. 
 
Role of ERK1/2 and p38 MAPK in S1P-induced cytokine secretion. Cells were treated with S1P (5 μM) for 24 hours in the presence or absence of PD98059 (A) and SB203580 (B) at the indicated concentrations. Secreted IL-8 (A, B) was quantified by ELISA. Each stimulation experiment was performed in quadruplicate, and the results are displayed as mean value ± SD.
Role of TNF-α in Regulation of S1P Receptor Expression
TNF-α is an important inflammatory molecule in multiple ocular disorders including AMD, 22 uveitis, 23 and PVR. 24 The following experiments were designed to detect the expression of S1P receptors in response to TNF-α by real-time PCR and Western blot. Treatment of ARPE-19 cells with TNF-α (1, 10, and 100 ng/mL) upregulated the expression of S1P3 mRNA (Fig. 6A). A 2.03 ± 0.3-fold (P = 0.008) enhancement in S1P3 expression was observed with 10 ng/mL TNF-α. S1P1, S1P2, S1P4, and S1P5 expression was not upregulated by TNF-α under the same conditions (data not shown). Enhancement of S1P3 receptor expression at the protein level was identified by Western blot (Fig. 6B). Our findings indicate that only S1P3 receptor expression is upregulated in TNF-α-activated ARPE-19 cells, whereby a maximal enhancement in S1P3 receptor expression was observed with 10 ng/mL TNF-α. 
Figure 6. 
 
Regulation of S1P3 receptor expression by TNF-α. (A) The mRNA expression of S1P3 upon TNF-α treatment was determined by real-time PCR. Cells were incubated with the indicated concentrations of TNF-α for 24 hours prior to RNA extraction and real-time PCR analyses. (B, C) S1P3 protein expression upon TNF-α treatment was analyzed by Western blot. Cells were treated with or without 10 ng/mL TNF-α for 24 hours. Each stimulation experiment was performed in quadruplicate. Data are presented as mean value ± SD.
Figure 6. 
 
Regulation of S1P3 receptor expression by TNF-α. (A) The mRNA expression of S1P3 upon TNF-α treatment was determined by real-time PCR. Cells were incubated with the indicated concentrations of TNF-α for 24 hours prior to RNA extraction and real-time PCR analyses. (B, C) S1P3 protein expression upon TNF-α treatment was analyzed by Western blot. Cells were treated with or without 10 ng/mL TNF-α for 24 hours. Each stimulation experiment was performed in quadruplicate. Data are presented as mean value ± SD.
Effect of TNF-α on S1P-Induced Inflammatory Mediator Secretion
To detect the role of TNF-α in S1P-induced inflammatory mediator production, ARPE-19 cells were primed with TNF-α. Starved ARPE-19 cells were treated with S1P (5 μM) for 24 hours with or without pretreatment with TNF-α (10 ng/mL) for 24 hours. Among the three cytokines tested, MCP-1 secretion was not enhanced in the presence of S1P (data not shown). As shown in Figure 7A, in contrast, the amount of IL-8 that was secreted following stimulation with S1P and, most importantly, S1P-mediated cytokine synthesis was significantly enhanced in TNF-α-primed ARPE-19 cells. The release of IL-8 was increased 1.41-fold (P = 0.001) in TNF-α-primed and S1P-stimulated samples as compared with unprimed cells stimulated with S1P. Moreover, S1P alone did not stimulate the secretion of IL-6; but in combination with TNF-α, it resulted in a significant enhanced secretion of this cytokine (P < 0.001) (Fig. 7B). The data suggest that the proinflammatory environment potentiates some of the functional outcomes of the S1P/S1P receptor signaling pathway in ARPE-19 cells. 
Figure 7. 
 
Super-induction of S1P-induced IL-8 and IL-6 secretion by cell priming with TNF-a. (A, B) Cells were pretreated with or without 10 ng/mL TNF-α for 24 hours, prior to stimulation with 5 μM S1P for 24 hours. IL-6 and IL-8 levels were measured by ELISA. Each stimulation experiment was performed in quadruplicate, and the results are presented as mean value ± SD.
Figure 7. 
 
Super-induction of S1P-induced IL-8 and IL-6 secretion by cell priming with TNF-a. (A, B) Cells were pretreated with or without 10 ng/mL TNF-α for 24 hours, prior to stimulation with 5 μM S1P for 24 hours. IL-6 and IL-8 levels were measured by ELISA. Each stimulation experiment was performed in quadruplicate, and the results are presented as mean value ± SD.
Discussion
The present study shows that ARPE-19 cells express all the known receptors for S1P. Among five subtypes of G protein–coupled S1P receptors, that is, S1P1, S1P2, S1P3, S1P4, and S1P5, we demonstrated abundant expression of S1P3 mRNA, whereas S1P5 mRNA was barely detectable. In the presence of its ligand S1P, ARPE-19 cells were readily stimulated to release IL-8. We furthermore demonstrated that the ERK1/2 and p38 MAPK pathways are involved in S1P-induced IL-8 release by these cells. Pretreatment of ARPE-19 cells with TNF-α increased S1P3 receptor expression, enhanced S1P-induced IL-8 production, and also stimulated the constitutive release of IL-6. Taken together, these data indicate that S1P can augment local inflammatory reactions mediated by RPE cells. 
S1P, a potent bioactive sphingolipid, mediates a number of cellular responses, including cell proliferation, chemotaxis, and angiogenesis. 25 S1P binds to five related GPCRs, termed S1P1–5. S1P1, S1P2, and S1P3 receptors are widely expressed in the immune, cardiovascular, and central nervous systems, with S1P1 being the dominant receptor also on lymphocytes/leukocytes. 26 S1P4 is specifically expressed in lymphoid tissue, 27 and S1P5 is present in spleen and white matter tracts of the central nervous system. 28 The major source of S1P is that produced from sphingosine through the action of sphingosine kinase (SphK1–2). Inflammatory mediators, such as C5a and TNF-α, have been found to stimulate the synthesis and secretion of S1P upon activation of sphingosine kinase. 29,30 Moreover, a reservoir of S1P is stored in and potentially released from red blood cells, platelets, and mast cells. 31 While human choroidal and retinal cells express SphK1, as a potential source for S1P in the posterior segment of the eye, we suggest that the RPE layer could be the major source of S1P in inflamed eyes. 
Although S1P signaling has been characterized in multiple tissue and organ systems, very few studies have investigated whether S1P has the potential to be a mediator of cellular signaling and function in the eye. Recent findings that S1P can promote RPE cell proliferation 13,32 and that it stimulates choroidal and retinal neovascularization 14 prompted us to examine whether S1P could also play a role in ocular inflammation. 
RPE cells are multifunctional cells that are uniquely positioned within the eye. They have properties similar to those of macrophages, among which are the capacity to phagocytose and the ability to generate several cytokines including IL-6, IL-8, and MCP-1. 3335 IL-8 and MCP-1 are known to have strong chemotactic activity for polymorphonuclear cells (PMN) and monocytes/macrophages, respectively. Since the infiltration of both cell types is commonly seen in many ocular diseases, these cytokines may play important roles in the initial stage of inflammation. IL-6 is an important mediator of the acute-phase response and possesses biological functions that support host immune reactions. There is evidence that IL-6, IL-8, and MCP-1 play an important role in the pathogenesis of retinal diseases such as AMD, 36,37 PVR, 38,39 and uveitis. 40,41  
Virtually all cells that participate in immune responses express multiple S1P receptors. A recent study showed that S1P signaling through the S1P1 receptor can control T-cell migration and tissue distribution, as well as the initiation of early events in the differentiation of T cells into effector cells. In experimental autoimmune uveoretinitis (EAU), controlling S1P1 activation via fingolimod blocks both T-cell entry and requisite signals for recruitment to the tissue, and thus also blocks subsequent mononuclear cell activation within the tissue. 17,42  
We showed that the receptors S1P1, S1P2, S1P4, and S1P5, but mainly S1P3, could be detected in human ARPE-19 cells. These observations explain the effects of S1P on ARPE-19 cells. S1P significantly stimulated ARPE-19 cells to secrete IL-8, but did not influence the constitutive production of IL-6 and MCP-1. We investigated whether S1P-enhanced IL-8 production by ARPE-19 cells used S1P/S1P receptor signaling pathways. Lysophospolipid receptors exhibit differential coupling to heterotrimeric G proteins. For instance, S1P1 and S1P4 couple directly to the Gi pathway, whereas S1P2 and S1P3 stimulate the Gi, Gq, and G12/13 pathways. 43 S1P5 activates both Gi and G12/13 proteins. 44 In this study, we showed that 100 ng/mL PTX pretreatment of RPE cells significantly prevented S1P-induced IL-8 secretion, so we can affirm that S1P-induced IL-8 production is dependent on Gi protein–mediated signaling response, which is probably mediated by the interaction with S1P3
TNF-α plays a key role in the pathogenesis of many ocular diseases. Recently it was reported that TNF-α can cross-talk with the G protein–coupled receptor adenosine A2A receptor. 45 Because S1P receptors are coupled to G proteins, we tried to determine whether the cross-talk between TNF-α and G protein–coupled receptors is present in ARPE-19 cells. We detected a significant enhancement of S1P-induced cytokine secretion, including IL-6 and IL-8, in ARPE-19 cells pretreated with TNF-α. However, the amount of MCP-1 expression was not increased when cells were treated with S1P and TNF-α. These results are in accordance with previous research, 46 which showed that S1P and TNF-α signaling pathway synergize. The enhancement in S1P-induced cytokine secretion by TNF-α can be partly explained by regulation of the expression of the S1P3 receptor by TNF-α. Although many genes regulated by TNF-α have been confirmed in ARPE-19 cells, this is the first demonstration of regulation of S1P3 receptor expression by TNF-α, proposing the possibility of a causal connection between enhanced increased S1P3 receptor expression and cytokine production by S1P pretreatment of ARPE-19 cells with TNF-α. 
S1P has been reported to act as an important mediator through activation of MAPK cascades in different cell types. 47 This family mainly consists of ERK1/2, JNK, and p38 kinase pathways. Therefore, we investigated the role of ERK1/2, JNK, and p38 MAPK involved in IL-8 expression in RPE cells. In this study, we found that S1P induces phosphorylation of ERK1/2 and p38 MAPK in ARPE-19 cells, but not JNK. On the other hand, our results also demonstrated that activation of ERK1/2 and p38 MAPK was necessary for S1P-induced IL-8 expression in RPE cells. PD98059 and SB203580, selective inhibitors of ERK1/2 and p38 MAPK, significantly attenuated S1P-induced IL-8 secretion and ERK1/2 and p38 MAPK phosphorylation in RPE cells. In addition, an ERK1/2 inhibitor could completely abolish the S1P-induced increase of IL-8 release by RPE cells, indicating that the stimulation of IL-8 production in ARPE-19 cells by S1P mainly occurs through the activation of the ERK1/2 signaling pathway, which is consistent with previous studies on other cell types. 48  
It is worthwhile to point out that there are some limitations of our study. Our experiments were performed with the ARPE-19 cell line, and we did not investigate whether there was a different effect of S1P on cytokine production using other types of RPE cells such as fetal or primary cultures of these cells. 
In conclusion, we have reported that IL-8 production is significantly induced by S1P in human ARPE-19 cells and that this effect is mediated by ERK1/2- and p38 MAPK-dependent signal transduction. The present study expands earlier studies on the role of S1P in ocular disease and provides a rationale for the use of inhibitors of this pathway to control intraocular inflammation. 
Table. 
 
Primers for PCR
Table. 
 
Primers for PCR
Gene Sense Antisense Product
S1P1 TGCTGGGTCATCTCCCTCAT AGCGCACTGATGCAGTTCC 101 bp
S1P2 CACAACAACTCGGAGCGGT ACACGCTCACCACAATCACC 142 bp
S1P3 TCCATCATCCTGTTGGCCA TGAGCGGACCACGCAGTAG 120 bp
S1P4 GATGCGGGAGCCCCTG GCAAGACTGCAACTTCAGATGC 141 bp
S1P5 TGGACGCTTGCTCCACTGT AGCACGCAGAAGAGCACGT  93 bp
β-actin GGATGCAGAAGGAGATCACTG CGATCCACACGGAGTACTTG  90 bp
Acknowledgments
Thanks to all donors enrolled in the present study. 
References
Donoso LA Kim D Frost A The role of inflammation in the pathogenesis of age-related macular degeneration. Surv Ophthalmol . 2006;51:137–152. [CrossRef] [PubMed]
Shi G Maminishkis A Banzon T Control of chemokine gradients by the retinal pigment epithelium. Invest Ophthalmol Vis Sci . 2008;49:4620–4630. [CrossRef] [PubMed]
Relvas LJ Bouffioux C Marcet B Extracellular nucleotides and interleukin-8 production by ARPE cells: potential role of danger signals in blood-retinal barrier activation. Invest Ophthalmol Vis Sci . 2009;50:1241–1246. [CrossRef] [PubMed]
Holtkamp GM Kijlstra A Peek R Retinal pigment epithelium-immune system interactions: cytokine production and cytokine-induced changes. Prog Retin Eye Res . 2001;20:29–48. [CrossRef] [PubMed]
Spiegel S Milstien S. Functions of a new family of sphingosine-1-phosphate receptors. Biochim Biophys Acta . 2000;1484:107–116. [CrossRef] [PubMed]
Hla T Lee MJ Ancellin N Lysophospholipids--receptor revelations. Science . 2001;294:1875–1878. [CrossRef] [PubMed]
Pyne S Pyne N. Sphingosine 1-phosphate signalling via the endothelial differentiation gene family of G-protein-coupled receptors. Pharmacol Ther . 2000;88:115–131. [CrossRef] [PubMed]
Ammit AJ Hastie AT Edsall LC Sphingosine 1-phosphate modulates human airway smooth muscle cell functions that promote inflammation and airway remodeling in asthma. FASEB J . 2001;15:1212–1214. [PubMed]
Kozawa O Tokuda H Matsuno H Activation of mitogen-activated protein kinase is involved in sphingosine 1-phosphate-stimulated interleukin-6 synthesis in osteoblasts. FEBS Lett . 1997;418:149–151. [CrossRef] [PubMed]
Cummings RJ Parinandi NL Zaiman A Phospholipase D activation by sphingosine 1-phosphate regulates interleukin-8 secretion in human bronchial epithelial cells. J Biol Chem . 2002;277:30227–30235. [CrossRef] [PubMed]
Zhao C Fernandes MJ Turgeon M Specific and overlapping sphingosine-1-phosphate receptor functions in human synoviocytes: impact of TNF-alpha. J Lipid Res . 2008;49:2323–2337. [CrossRef] [PubMed]
Lin CI Chen CN Chen JH Lysophospholipids increase IL-8 and MCP-1 expressions in human umbilical cord vein endothelial cells through an IL-1-dependent mechanism. J Cell Biochem . 2006;99:1216–1232. [CrossRef] [PubMed]
Swaney JS Moreno KM Gentile AM Sphingosine-1-phosphate (S1P) is a novel fibrotic mediator in the eye. Exp Eye Res . 2008;87:367–375. [CrossRef] [PubMed]
Xie B Shen J Dong A Blockade of sphingosine-1-phosphate reduces macrophage influx and retinal and choroidal neovascularization. J Cell Physiol . 2009;218:192–198. [CrossRef] [PubMed]
Jang S Lee JH Choi KR Cytochemical alterations in the rat retina by LPS administration. Neurochem Res . 2007;32:1–10. [CrossRef] [PubMed]
Rotstein NP Miranda GE Abrahan CE Regulating survival and development in the retina: key roles for simple sphingolipids. J Lipid Res . 2010;51:1247–1262. [CrossRef] [PubMed]
Copland DA Liu J Schewitz-Bowers LP Therapeutic dosing of fingolimod (FTY720) prevents cell infiltration, rapidly suppresses ocular inflammation, and maintains the blood-ocular barrier. Am J Pathol . 2012;180:672–681. [CrossRef] [PubMed]
Gurgui M Broere R Kalff JC Dual action of sphingosine 1-phosphate in eliciting proinflammatory responses in primary cultured rat intestinal smooth muscle cells. Cell Signal . 2010;22:1727–1733. [CrossRef] [PubMed]
Pettus BJ Chalfant CE Hannun YA. Ceramide in apoptosis: an overview and current perspectives. Biochim Biophys Acta . 2002;1585:114–125. [CrossRef] [PubMed]
Cuvillier O. Sphingosine in apoptosis signaling. Biochim Biophys Acta . 2002;1585:153–162. [CrossRef] [PubMed]
Kluk MJ Hla T. Signaling of sphingosine-1-phosphate via the S1P/EDG-family of G-protein-coupled receptors. Biochim Biophys Acta . 2002;1582:72–80. [CrossRef] [PubMed]
Oh H Takagi H Takagi C The potential angiogenic role of macrophages in the formation of choroidal neovascular membranes. Invest Ophthalmol Vis Sci . 1999;40:1891–1898. [PubMed]
Nakamura S Yamakawa T Sugita M The role of tumor necrosis factor-alpha in the induction of experimental autoimmune uveoretinitis in mice. Invest Ophthalmol Vis Sci . 1994;35:3884–3889. [PubMed]
Armstrong D Augustin AJ Spengler R Detection of vascular endothelial growth factor and tumor necrosis factor alpha in epiretinal membranes of proliferative diabetic retinopathy, proliferative vitreoretinopathy and macular pucker. Ophthalmologica . 1998;212:410–414. [CrossRef] [PubMed]
Rosen H Goetzl EJ. Sphingosine 1-phosphate and its receptors: an autocrine and paracrine network. Nat Rev Immunol . 2005;5:560–570. [CrossRef] [PubMed]
Chae SS Proia RL Hla T. Constitutive expression of the S1P1 receptor in adult tissues. Prostaglandins Other Lipid Mediat . 2004;73:141–150. [CrossRef] [PubMed]
Graeler M Goetzl EJ. Activation-regulated expression and chemotactic function of sphingosine 1-phosphate receptors in mouse splenic T cells. FASEB J . 2002;16:1874–1878. [CrossRef] [PubMed]
Jaillard C Harrison S Stankoff B Edg8/S1P5: an oligodendroglial receptor with dual function on process retraction and cell survival. J Neurosci . 2005;25:1459–1469. [CrossRef] [PubMed]
Xia P Wang L Gamble JR Activation of sphingosine kinase by tumor necrosis factor-alpha inhibits apoptosis in human endothelial cells. J Biol Chem . 1999;274:34499–34505. [CrossRef] [PubMed]
Melendez AJ Ibrahim FB. Antisense knockdown of sphingosine kinase 1 in human macrophages inhibits C5a receptor-dependent signal transduction, Ca2+ signals, enzyme release, cytokine production, and chemotaxis. J Immunol . 2004;173:1596–1603. [CrossRef] [PubMed]
Murata N Sato K Kon J Interaction of sphingosine 1-phosphate with plasma components, including lipoproteins, regulates the lipid receptor-mediated actions. Biochem J . 2000;352 (pt 3):809–815. [CrossRef] [PubMed]
Zhu D Sreekumar PG Hinton DR Expression and regulation of enzymes in the ceramide metabolic pathway in human retinal pigment epithelial cells and their relevance to retinal degeneration. Vision Res . 2010;50:643–651. [CrossRef] [PubMed]
Holtkamp GM De Vos AF Peek R Analysis of the secretion pattern of monocyte chemotactic protein-1 (MCP-1) and transforming growth factor-beta 2 (TGF-beta2) by human retinal pigment epithelial cells. Clin Exp Immunol . 1999;118:35–40. [CrossRef] [PubMed]
Elner VM Scales W Elner SG Interleukin-6 (IL-6) gene expression and secretion by cytokine-stimulated human retinal pigment epithelial cells. Exp Eye Res . 1992;54:361–368. [CrossRef] [PubMed]
Elner VM Strieter RM Elner SG Neutrophil chemotactic factor (IL-8) gene expression by cytokine-treated retinal pigment epithelial cells. Am J Pathol . 1990;136:745–750. [PubMed]
Higgins GT Wang JH Dockery P Induction of angiogenic cytokine expression in cultured RPE by ingestion of oxidized photoreceptor outer segments. Invest Ophthalmol Vis Sci . 2003;44:1775–1782. [CrossRef] [PubMed]
Seddon JM George S Rosner B Progression of age-related macular degeneration: prospective assessment of C-reactive protein, interleukin 6, and other cardiovascular biomarkers. Arch Ophthalmol . 2005;123:774–782. [CrossRef] [PubMed]
Canataroglu H Varinli I Ozcan AA Interleukin (IL)-6, interleukin (IL)-8 levels and cellular composition of the vitreous humor in proliferative diabetic retinopathy, proliferative vitreoretinopathy, and traumatic proliferative vitreoretinopathy. Ocul Immunol Inflamm . 2005;13:375–381. [CrossRef] [PubMed]
Abu El-Asrar AM Struyf S Kangave D Chemokines in proliferative diabetic retinopathy and proliferative vitreoretinopathy. Eur Cytokine Netw . 2006;17:155–165. [PubMed]
Nagata K Maruyama K Uno K Simultaneous analysis of multiple cytokines in the vitreous of patients with sarcoid uveitis. Invest Ophthalmol Vis Sci . 2012;53:3827–3833. [CrossRef] [PubMed]
Kramer M Monselise Y Bahar I Serum cytokine levels in active uveitis and remission. Curr Eye Res . 2007;32:669–675. [CrossRef] [PubMed]
Commodaro AG Peron JP Lopes CT Evaluation of experimental autoimmune uveitis in mice treated with FTY720. Invest Ophthalmol Vis Sci . 2010;51:2568–2574. [CrossRef] [PubMed]
Sanchez T Hla T. Structural and functional characteristics of S1P receptors. J Cell Biochem . 2004;92:913–922. [CrossRef] [PubMed]
Malek RL Toman RE Edsall LC Nrg-1 belongs to the endothelial differentiation gene family of G protein-coupled sphingosine-1-phosphate receptors. J Biol Chem . 2001;276:5692–5699. [CrossRef] [PubMed]
Khoa ND Postow M Danielsson J Tumor necrosis factor-alpha prevents desensitization of Galphas-coupled receptors by regulating GRK2 association with the plasma membrane. Mol Pharmacol . 2006;69:1311–1319. [CrossRef] [PubMed]
Kitano M Hla T Sekiguchi M Sphingosine 1-phosphate/sphingosine 1-phosphate receptor 1 signaling in rheumatoid synovium: regulation of synovial proliferation and inflammatory gene expression. Arthritis Rheum . 2006;54:742–753. [CrossRef] [PubMed]
Ohanian J Ohanian V. Sphingolipids in mammalian cell signalling. Cell Mol Life Sci . 2001;58:2053–2068. [CrossRef] [PubMed]
Wang L Cummings R Usatyuk P Involvement of phospholipases D1 and D2 in sphingosine 1-phosphate-induced ERK (extracellular-signal-regulated kinase) activation and interleukin-8 secretion in human bronchial epithelial cells. Biochem J . 2002;367:751–760. [CrossRef] [PubMed]
Footnotes
 Supported by National Basic Research Program of China (973 Program) (2011CB510200), Key Project of Natural Science Foundation (81130019), National Natural Science Foundation Project (30973242), Research Fund for the Doctoral Program of Higher Education of China (20115503110002), Chongqing Key Laboratory of Ophthalmology (CSTC, 2008CA5003), Key Project of Health Bureau of Chongqing (2012-1-003), Program for the Training of a Hundred Outstanding S&T Leaders of Chongqing Municipality, and Fund for PAR-EU Scholars Program.
Footnotes
 Disclosure: Y. Qiao, None; R. Hu, None; Q. Wang, None; J. Qi, None; Y. Yang, None; A. Kijlstra, None; P. Yang, None
Footnotes
3  These authors contributed equally to the work presented here.
Figure 1. 
 
Detection of S1P receptor expression in ARPE-19 cells. (A, B) mRNA expression of S1P1–5 receptors in ARPE-19 cells was detected by RT-PCR and real-time PCR.
Figure 1. 
 
Detection of S1P receptor expression in ARPE-19 cells. (A, B) mRNA expression of S1P1–5 receptors in ARPE-19 cells was detected by RT-PCR and real-time PCR.
Figure 2. 
 
S1P-mediated interleukin-8 (IL-8) secretion. (A) Dose–response effect of S1P on IL-8 secretion. Confluent ARPE-19 cells were treated with the indicated concentrations of S1P for 24 hours, and the amount of IL-8 was measured by ELISA. (B) Kinetics of IL-8 secretion. Cells were incubated with 5 μM S1P for the indicated times, and the amount of IL-8 was measured by ELISA. Each stimulation experiment was performed in quadruplicate, and the results are displayed as mean value ± SD.
Figure 2. 
 
S1P-mediated interleukin-8 (IL-8) secretion. (A) Dose–response effect of S1P on IL-8 secretion. Confluent ARPE-19 cells were treated with the indicated concentrations of S1P for 24 hours, and the amount of IL-8 was measured by ELISA. (B) Kinetics of IL-8 secretion. Cells were incubated with 5 μM S1P for the indicated times, and the amount of IL-8 was measured by ELISA. Each stimulation experiment was performed in quadruplicate, and the results are displayed as mean value ± SD.
Figure 3. 
 
Effect of PTX on S1P-enhanced IL-8 production by ARPE-19 cells. IL-8 production by ARPE-19 cells with or without PTX pretreatment was measured in the absence or presence of 5 μM S1P. After 48 hours of culture, secreted IL-8 was measured by ELISA. Each stimulation experiment was performed in quadruplicate, and the results are displayed as mean value ± SD.
Figure 3. 
 
Effect of PTX on S1P-enhanced IL-8 production by ARPE-19 cells. IL-8 production by ARPE-19 cells with or without PTX pretreatment was measured in the absence or presence of 5 μM S1P. After 48 hours of culture, secreted IL-8 was measured by ELISA. Each stimulation experiment was performed in quadruplicate, and the results are displayed as mean value ± SD.
Figure 4. 
 
S1P-induced activation of ERK1/2 and p38MAPK. (AD) Effect of S1P on the activation of ERK1/2 and p38 MAPK. Cells were stimulated with S1P (5 μM) for up to 60 minutes, and cell lysates were analyzed by Western blot. (E, F) Effect of ERK1/2 and p38 MAPK inhibitors on S1P-induced activation of ERK1/2 and p38 MAPK. Cells were pretreated with 25 μM PD98059 (E) and 10 μM SB203580 (F) for 60 minutes prior to stimulation with 5 μM S1P for 15 minutes. Cell lysates were analyzed by Western blot. Each stimulation experiment was performed in quadruplicate. ***P < 0.001.
Figure 4. 
 
S1P-induced activation of ERK1/2 and p38MAPK. (AD) Effect of S1P on the activation of ERK1/2 and p38 MAPK. Cells were stimulated with S1P (5 μM) for up to 60 minutes, and cell lysates were analyzed by Western blot. (E, F) Effect of ERK1/2 and p38 MAPK inhibitors on S1P-induced activation of ERK1/2 and p38 MAPK. Cells were pretreated with 25 μM PD98059 (E) and 10 μM SB203580 (F) for 60 minutes prior to stimulation with 5 μM S1P for 15 minutes. Cell lysates were analyzed by Western blot. Each stimulation experiment was performed in quadruplicate. ***P < 0.001.
Figure 5. 
 
Role of ERK1/2 and p38 MAPK in S1P-induced cytokine secretion. Cells were treated with S1P (5 μM) for 24 hours in the presence or absence of PD98059 (A) and SB203580 (B) at the indicated concentrations. Secreted IL-8 (A, B) was quantified by ELISA. Each stimulation experiment was performed in quadruplicate, and the results are displayed as mean value ± SD.
Figure 5. 
 
Role of ERK1/2 and p38 MAPK in S1P-induced cytokine secretion. Cells were treated with S1P (5 μM) for 24 hours in the presence or absence of PD98059 (A) and SB203580 (B) at the indicated concentrations. Secreted IL-8 (A, B) was quantified by ELISA. Each stimulation experiment was performed in quadruplicate, and the results are displayed as mean value ± SD.
Figure 6. 
 
Regulation of S1P3 receptor expression by TNF-α. (A) The mRNA expression of S1P3 upon TNF-α treatment was determined by real-time PCR. Cells were incubated with the indicated concentrations of TNF-α for 24 hours prior to RNA extraction and real-time PCR analyses. (B, C) S1P3 protein expression upon TNF-α treatment was analyzed by Western blot. Cells were treated with or without 10 ng/mL TNF-α for 24 hours. Each stimulation experiment was performed in quadruplicate. Data are presented as mean value ± SD.
Figure 6. 
 
Regulation of S1P3 receptor expression by TNF-α. (A) The mRNA expression of S1P3 upon TNF-α treatment was determined by real-time PCR. Cells were incubated with the indicated concentrations of TNF-α for 24 hours prior to RNA extraction and real-time PCR analyses. (B, C) S1P3 protein expression upon TNF-α treatment was analyzed by Western blot. Cells were treated with or without 10 ng/mL TNF-α for 24 hours. Each stimulation experiment was performed in quadruplicate. Data are presented as mean value ± SD.
Figure 7. 
 
Super-induction of S1P-induced IL-8 and IL-6 secretion by cell priming with TNF-a. (A, B) Cells were pretreated with or without 10 ng/mL TNF-α for 24 hours, prior to stimulation with 5 μM S1P for 24 hours. IL-6 and IL-8 levels were measured by ELISA. Each stimulation experiment was performed in quadruplicate, and the results are presented as mean value ± SD.
Figure 7. 
 
Super-induction of S1P-induced IL-8 and IL-6 secretion by cell priming with TNF-a. (A, B) Cells were pretreated with or without 10 ng/mL TNF-α for 24 hours, prior to stimulation with 5 μM S1P for 24 hours. IL-6 and IL-8 levels were measured by ELISA. Each stimulation experiment was performed in quadruplicate, and the results are presented as mean value ± SD.
Table. 
 
Primers for PCR
Table. 
 
Primers for PCR
Gene Sense Antisense Product
S1P1 TGCTGGGTCATCTCCCTCAT AGCGCACTGATGCAGTTCC 101 bp
S1P2 CACAACAACTCGGAGCGGT ACACGCTCACCACAATCACC 142 bp
S1P3 TCCATCATCCTGTTGGCCA TGAGCGGACCACGCAGTAG 120 bp
S1P4 GATGCGGGAGCCCCTG GCAAGACTGCAACTTCAGATGC 141 bp
S1P5 TGGACGCTTGCTCCACTGT AGCACGCAGAAGAGCACGT  93 bp
β-actin GGATGCAGAAGGAGATCACTG CGATCCACACGGAGTACTTG  90 bp
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×