December 2012
Volume 53, Issue 13
Free
Retina  |   December 2012
Regulation of Vascular Endothelial Growth Factor Expression by Extra Domain B Segment of Fibronectin in Endothelial Cells
Author Affiliations & Notes
  • Shali Chen
    From the
  • Rana Chakrabarti
    From the
  • Emily C. Keats
    From the
  • Megan Chen
    From the
  • Subrata Chakrabarti
    From the
    Department of Pathology, University of Western Ontario, London, Ontario, Canada; and the
  • Zia A. Khan
    From the
    Department of Pathology, University of Western Ontario, London, Ontario, Canada; and the
  • * Each of the following is a corresponding author: Zia A. Khan, Department of Pathology, University of Western Ontario, 4011 Dental Sciences Building, 1151 Richmond Street, London, ON N6A 5C1; zia.khan@schulich.uwo.ca
  • Subrata Chakrabarti, Department of Pathology, University of Western Ontario, 4045 Dental Sciences Building, 1151 Richmond Street, London, ON N6A 5C1; subrata.chakrabarti@schulich.uwo.ca
Investigative Ophthalmology & Visual Science December 2012, Vol.53, 8333-8343. doi:10.1167/iovs.12-9766
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to Subscribers Only
      Sign In or Create an Account ×
    • Get Citation

      Shali Chen, Rana Chakrabarti, Emily C. Keats, Megan Chen, Subrata Chakrabarti, Zia A. Khan; Regulation of Vascular Endothelial Growth Factor Expression by Extra Domain B Segment of Fibronectin in Endothelial Cells. Invest. Ophthalmol. Vis. Sci. 2012;53(13):8333-8343. doi: 10.1167/iovs.12-9766.

      Download citation file:


      © 2016 Association for Research in Vision and Ophthalmology.

      ×
  • Supplements
Abstract

Purpose.: Diabetic retinopathy entails proliferation of vascular endothelial cells (ECs) and unregulated angiogenesis. We have previously shown that ECs increase the expression of an embryonic variant of fibronectin (FN), called extra domain-B FN (ED-B FN) in response to high glucose. We also showed that ED-B FN regulates EC tube morphogenesis, possibly through vascular endothelial growth factor (VEGF). In the present study, we have attempted to decipher the mechanisms by which ED-B FN may modulate EC phenotype.

Methods.: We hypothesized that ED-B FN regulates VEGF expression in ECs through interaction with selected integrin receptors. To test this hypothesis, we first cultured ECs in high levels of glucose to investigate for any alteration. We then used integrin-specific matrix mimetic peptides, neutralizing antibodies, and RNAi to identify the integrin(s) involved in VEGF expression. Finally, we used an animal model of diabetes to study whether these in vitro mechanisms also take place in the retina.

Results.: Our results show that exposure of ECs to high levels of glucose increased VEGF expression. ED-B FN mediated this increase since knockdown of ED-B FN completely prevented glucose-induced VEGF expression. We then identified β1 integrin as the essential receptor involved in high glucose-induced VEGF expression. We also showed that diabetes increased β1 integrin and VEGF expression in the retina, which normalized upon ED-B knockdown.

Conclusions.: These findings showed that high levels of glucose in diabetes increased VEGF expression in ECs through ED-B FN and β1 integrin interaction. These results provide novel mechanistic basis of increased VEGF expression in diabetes.

Introduction
Diabetic retinopathy (DR), a microvascular complication of longstanding diabetes, is the most common cause of blindness in the working population. All people with diabetes (types 1 and 2) eventually develop some form of retinopathy. 1 Early pathogenic events in DR include altered expression of vasoactive factors and basement membrane (BM) proteins. Ultimately, endothelial cell (EC) dysfunction ensues. The loss of vasoregulation, thickening of the BM, increased permeability, and the eventual EC loss converge to create an ischemic retina. 2,3 In response, new blood vessels form, however, this reactive angiogenesis is unregulated and leads to blindness. 24  
The mechanisms of unregulated reactive angiogenesis in DR are becoming known. We know that a number of growth factors are elaborated, including the EC-specific mitogen, vascular endothelial growth factor (VEGF). 2 Numerous VEGF isoforms arise from alternative splicing. 57 These include isoforms of 121, 145, 148, 165, 183, 189, and 206 amino acids. 8 VEGF121 is the most soluble form, whereas VEGF189 and VEGF206 are almost exclusively sequestered in the extracellular matrix (ECM). VEGF binds to VEGF receptors (VEGFR1 and VEGFR2) to alter EC properties such as proliferation and permeability. 911 Evidence for a role of VEGF in DR comes from studies that show elevated levels in the vitreous samples of patients with active late-stage DR. 1214 In experimental models, chimeric VEGF receptor proteins (which sequester VEGF) have been shown to suppress neovascularization in almost all animal models studied. 1517  
The source of elevated VEGF in DR is not fully elucidated, but may include retinal ECs and pigment epithelial cells. 2,18,19 EC-derived VEGF has been recently shown to be an essential autocrine mechanism for cell survival. 20, 21 We and others have shown that culture of ECs in high levels of glucose increases VEGF mRNA and protein levels. 22,23 The signaling pathway involved in high glucose–induced VEGF expression remains enigmatic. One possible mechanism may be through altered ECM. ECM of cells expressing VEGF can stimulate proliferation. 24 This could be because of sequestration of VEGF in the ECM or because the ECM composition of VEGF-expressing cells is different. We have demonstrated that high levels of glucose, which increase VEGF expression, also alter the composition of EC-derived ECM proteins. Specifically, we reported increased expression of an embryonic splice variant of fibronectin (FN) (called extra domain-B FN [ED-B FN]) by ECs challenged with high levels of glucose. Targeted inhibition of ED-B FN caused decreased EC proliferation and tube morphogenesis. 22 These two cellular activities are reminiscent of EC response to VEGF. Therefore, we hypothesized that ED-B FN regulated autogenous VEGF expression in ECs. This ECM protein-mediated VEGF expression may be due to an interaction between matrix protein receptors on EC surface. In the present study, we tested this hypothesis in cultured ECs. Using integrin-binding peptides, neutralizing antibodies, and RNAi, we showed that ED-B caused increased VEGF expression through interaction with β1 integrin. 
Methods
EC Culture
Human umbilical vein endothelial cells (HUVECs) (Cat # PCS-100-010; American Type Culture Collection, Rockville, MD) were plated at 2500 cells/cm2 in endothelial basal medium (EBM) (CC-3121; Lonza Inc., Walkerville, MD) with endothelial growth supplements (EGM SingleQuots, CC-4133; Lonza Inc.) and 2% fetal bovine serum. Human retinal microvascular endothelial cells (HRMECs) (Cat # HEC09; Olaf Pharmaceuticals, Worcester, MA) were cultured in EBM2 media (CC-3156; Lonza Inc.) supplemented with 20% fetal bovine serum and endothelial growth supplements (EGM-2 SingleQuots, CC-4176; Lonza Inc.).Before performing experiments, cells were washed in PBS and incubated in basal media containing 1% FBS for 24 hours. To study the effect of high glucose levels, we cultured ECs in 25 mmol/L D-glucose (with 1% FBS). L-glucose (25 mmol/L) was used as the osmotic control. All experiments were carried out after 24 hours of glucose incubation unless otherwise indicated. At least three different batches of cells, each in triplicate, were used for each experiment. 
Cellular Activity Assays
Tube formation assay was performed as described by us previously. 22 Briefly, we plated ECs on growth factor–reduced matrix (Matrigel; BD Biosciences, Mississauga, Ontario, Canada). After allowing cells to attach, we washed the plates with PBS and overlaid the cells with a collagen gel. 25 Type 1 collagen (C7661; Sigma-Aldrich, Oakville, Ontario, Canada) was prepared by mixing seven parts of a 1.4 mg/mL type I collagen with one part EBM2 basal media and with two parts of an 11.8 mg/mL sodium bicarbonate. Two investigators assessed EC branching after 24-hour treatment. 
Cell viability and proliferation were determined by 2-(4-iodophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium (WST-1; Roche, Laval, Quebec, Canada) assay. ECs were seeded onto 96-well plates at a density of 1.0 × 104 cells per well in 100 μL of culture medium with or without specific reagents for 24 hours. To measure the number of viable cells, 10 microliters of WST-1 was added per well, and the cells were incubated for 4 hours at 37°C. We then measured absorbance at 450 nm. 
Integrin-Binding Peptides, ED-B FN Peptide, and Neutralizing Antibodies
ED-B FN peptide (sequence as reported in Khan et al. 22 ) was obtained from Sigma-Aldrich and used at 2 μg/mL concentration.We have previously shown that 2 μg/mL ED-B peptide increases EC tube formation and enhances EC proliferation. 22 To examine the effect of VEGF on FN expression, we treated ECs with 10 ng/mL VEGF (VEGF165) (293-VE-010; R & D Systems, Minneapolis, MN) for 24 hours (HUVECs and HRMECs) or 48 hours (HRMECs). Integrin-binding peptides were used at 5 mmol/L concentration. The peptides included DGEA (α2β1 binding) (H-Asp-Gly-Glu-Ala-OH; Bachem Americas Inc., Torrance, CA), KDGE (α2β1 scramble sequence) (H-Lys-Asp-Gly-Glu-OH; Bachem Americas Inc.), and RGDS (α5β1) (H-Arg-Gly-Asp-Ser-OH; Bachem Americas Inc.). 26 Integrin α2β1, α5β1, β1, and β3 antibodies were obtained from Millipore (Temecula, CA) and used at 0.1 to 0.5 μg/mL.ECs were pretreated with the integrin-binding peptides or the neutralizing antibodies for 30 minutes before exposure to high glucose or ED-B peptide. For some experiments, we coated the culture plates with ED-B peptide (1 μg/cm2) before treating the cells with IgG control antibody or integrin neutralizing antibodies. 
siRNA Transfections
We used small interfering RNA (siRNA) to silence the expression of ED-B FN and integrins in ECs. Four pooled ED-B FN siRNAs (100 nmol/L final concentration) were used in a single reaction using lipid siRNA transfection reagent (1 μL reagent per 500 μL transfection volume) (siPORT; Ambion Inc., Burlington, Ontario, Canada). The sequence of the siRNAs is the same as shown by us previously. 22 Predesigned and validated integrin β1 (ITGB1) and β3 (ITGB3) siRNA were obtained from (gene IDs: 3688, 3690, respectively; Dharmacon Inc., Chicago, IL). Scrambled siRNAs were used as controls. siRNA transfection efficiency was assessed by measuring mRNA expression by real time reverse transcriptase-PCR (RT-PCR). We performed all experiments at optimal conditions with at least 75% knockdown. 
Animal Model of Chronic Diabetes
Male B6 mice (Charles River Canada Ltd., Quebec, Canada), weighing approximately 20 g, were randomly divided into four groups (n = 6 per group): nondiabetic controls (Control), nondiabetic animals treated with ED-B siRNA (ED-B siRNA), diabetic animals treated with scrambled siRNA (Diab), and diabetic animals treated with ED-B siRNA (Diab + ED-B siRNA). Diabetes was induced by three intravenous injections of streptozotocin (STZ) (65 mg/kg in citrate buffer), while the control animals received the same volume of citrate buffer. Animals received 150 μg ED-B siRNAs weekly for 4 weeks by intravenous route (tail vein) using Lipofectamine 2000 transfection reagent. The animals were sacrificed 1 week after the fourth injection, and the retinal tissues were collected for gene expression analyses. All animal were treated in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. All experiments were approved by the University of Western Ontario Council on Animal Care Committee. 
RNA Isolation and RT-PCR
A nucleic acid isolation reagent (TRIzol; Life Technologies, Burlington, Ontario, Canada) was used to isolate total RNA as described previously. 22 First-strand cDNA synthesis was performed with reverse transcriptase (Superscript II system; Life Technologies).The resulting cDNA products were stored at −20°C. Real-time quantitative PCR was performed with fast cycling real time instrument (LightCycler; Roche Diagnostic Canada, Laval, Quebec, Canada) as described previously. 22 The data were analyzed by the standard curve method and normalized to 18S rRNA or β-actin mRNA. Primer sequences are given in the Table
Table. 
 
Primer Sequences for RT-PCR
Table. 
 
Primer Sequences for RT-PCR
Genes (sp) Sequence (5′ → 3′)
β1 integrin (hu) CGAGGTCATGGTTCATGTTC
CAGTGTTGTGGGATTTGCAC
β1 integrin (mo) GGTGTCGTGTTTGTGAATGC
CTCCTGTGCACACGTGTCTT
ED-B FN (hu/mo) CCGCCATTAATGAGAGTGAT
AGTTAGTTGCGGCAGGAGAAG
Total FN (hu) GATAAATCAACAGTGGGAGC
CCCAGATCATGGAGTCTTTA
VEGF (hu) ATCTTCAAGCCATCCTGTGTGC
GCTCACCGCCTCGGCTTGT
VEGF (mo) CCATGAACTTTCTGCTCTCTTG
GGTGAGAGGTCTGGTTCCCGAA
VEGF121 (hu) ATCTTCAAGCCATCCTGTGTGC
TGCGCTTGTCACATTTTTCTTG
VEGF145 (hu) ATCTTCAAGCCATCCTGTGTGC
TCGGCTTGTCACATACGCTCC
VEGF148 (hu) ATCTTCAAGCCATCCTGTGTGC
TCGGCTTGTCACATCTTGCAAC
VEGF165 (hu) ATCTTCAAGCCATCCTGTGTGC
CAAGGCCCACAGGGATTTTC
VEGF183 (hu) ATCTTCAAGCCATCCTGTGTGC
GCCCACAGGGACGGGATTT
VEGF189 (hu) ATCTTCAAGCCATCCTGTGTGC
CACAGGGAACGCTCCAGGAC
VEGFR1 (hu) AGGGGAAGAAATCCTCCAGA
CGTGCTGCTTCCTGGTCC
VEGFR2 (hu) GTGACCAACATGGAGTCGTG
TGCTTCACAGAAGACCATGC
β-actin (hu/mo) CCTCTATGCCAACACAGTGC
CATCGTACTCCTGCTTGCTG
18S rRNA (hu/mo) GTAACCCGTTGAACCCCATT
CCATCCAACGGTAGTAGCG
Immunofluorescence Staining and Western Blotting
We performed immunofluorescence staining for ED-B FN, CD31 (EC cell surface marker), and β1 integrin. Integrin antibody was obtained from Millipore, CD31 antibody from Santa Cruz Biotechnology (Santa Cruz, CA), and ED-B antibody was previously generated in our laboratory. 22 After treating the cells with high glucose levels, we used methanol to fix the cells. Primary antibodies were used at 1:200 concentrations in PBS (containing 1% bovine serum albumin) and the cells were incubated for 1 hour at room temperature. 
Alexa Fluor-488 and -594 conjugated secondary antibodies (Life Technologies) were used for detection (1:200 at room temperature) and DAPI (Vector Laboratories, Burlington, Ontario, Canada) for counterstaining. Images were taken using a compound fluorescent microscope (Olympus BX-51; Olympus Canada Inc., Richmond Hill, Ontario, Canada) equipped with a digital camera (Spot Pursuit; SPOT Imaging Solutions, Sterling Heights, MI). 
For western blotting, we used 20 micrograms of total proteins per lane, resolved by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and analyzed using VEGF and β-actin antibodies (Santa Cruz Biotechnology). The signals were detected with horseradish peroxidase-conjugated secondary antibody (Santa Cruz Biotechnology) and developed with the chemiluminescent substrate (Amersham Pharmacia Biotechnology, Amersham, UK). 
Statistical Analysis
The data were expressed as means ± SEM. Differences were determined using ANOVA with post hoc Bonferroni's correction. P values < 0.05 were considered statistically significant. 
Results
High Glucose-Induced VEGF Expression Is Mediated by ED-B FN
We first investigated whether high levels of glucose alter the expression of VEGF in ECs and whether any change in VEGF was mediated by ED-B FN. A previous study has reported 40% induction in VEGF protein after 72 hours treatment with 30 mmol/L glucose. 23 We have shown that glucose increases FN mRNA and protein in as early as 24 hours in HUVECs. 22,2729 Therefore, we exposed the cells to media containing 25 mmol/L glucose for 24 hours and assayed for VEGF transcript levels. Our results showed that HG increased VEGF mRNA levels as compared to cells exposed to 5 mmol/L glucose (Fig. 1a). An increase was also observed in ED-B containing FN mRNA levels. Twenty-five mmol/L L-glucose, used as osmotic control, did not produce any changes in VEGF mRNA levels (data not shown). These results showed that the newly expressed FN (induced by HG) predominantly contains ED-B. We hypothesized that the VEGF induction by high glucose levels is mediated by ED-B FN. To test this, we silenced ED-B FN in ECs and measured VEGF expression. If the hypothesis is true, we should see a reduction in glucose-induced VEGF expression upon ED-B FN knockdown. Our results showed that, indeed, HG-induced VEGF was completely normalized with ED-B siRNA transfection (Fig. 1a). 
Figure 1. 
 
Expression of ED-B FN and VEGF in HUVECs. (a) Exposure of HUVECs to 25 mmol/L glucose (HG) caused increased mRNA expression of VEGF, ED-B FN, and total FN compared to 5 mmol/L glucose (Control) after 24 hours. This glucose-induced expression of VEGF and ED-B FN was prevented when HUVECs were transfected with ED-B FN siRNA. *P < 0.05 compared to control, †P < 0.05, compared to HG. (b) Immunofluorescence staining for ED-B FN in HUVECs exposed to HG for 24 hrs (images taken at 20x; scale bar = 100 μm; insert showing high power image; green = ED-B FN, exposure time 16 seconds, and blue = DAPI, exposure time 3 seconds). (c) RT-PCR analysis of VEGF isoform expression in HUVECs exposed to HG or 2 μg/mL ED-B peptide. *P < 0.05 compared to control. (d) Expression of FN in cells treated with 10 ng/mL recombinant VEGF165 for 24 hours. *P < 0.05 compared to control.
Figure 1. 
 
Expression of ED-B FN and VEGF in HUVECs. (a) Exposure of HUVECs to 25 mmol/L glucose (HG) caused increased mRNA expression of VEGF, ED-B FN, and total FN compared to 5 mmol/L glucose (Control) after 24 hours. This glucose-induced expression of VEGF and ED-B FN was prevented when HUVECs were transfected with ED-B FN siRNA. *P < 0.05 compared to control, †P < 0.05, compared to HG. (b) Immunofluorescence staining for ED-B FN in HUVECs exposed to HG for 24 hrs (images taken at 20x; scale bar = 100 μm; insert showing high power image; green = ED-B FN, exposure time 16 seconds, and blue = DAPI, exposure time 3 seconds). (c) RT-PCR analysis of VEGF isoform expression in HUVECs exposed to HG or 2 μg/mL ED-B peptide. *P < 0.05 compared to control. (d) Expression of FN in cells treated with 10 ng/mL recombinant VEGF165 for 24 hours. *P < 0.05 compared to control.
We next determined whether HG increases ED-B protein levels or localization by immunofluorescence staining. Our results showed no significant changes in ED-B FN fibril formation upon glucose challenge (Fig. 1b). However, the ED-B FN immunoreactivity was clearly higher in cells exposed to HG (images taken at the same exposure time). 
Selective Upregulation of VEGF121 and VEGF165 by HG and ED-B Peptide
Alternative splicing of VEGF produces a number of isoforms that differ in their heparin– and heparin–sulfate-binding capacities. 30 We wanted to determine whether HG or ED-B peptide selectively upregulated certain VEGF isoforms. Therefore, we performed qPCR analysis (primer sequences presented in the Table; VEGF isoform sequences from Zygalaki et al. 31 ) of major VEGF isoforms in ECs exposed to HG or ED-B peptide for 24 hours. Our results showed that both HG and ED-B peptide upregulated VEGF121 and VEGF165 isoforms (Fig. 1c). Other isoforms including VEGF145, 148, 183, and 189 showed no significant changes. It is possible that HG- or ED-B FN- induced VEGF may create a positive feedback loop to increase FN. In support of this notion are reports of VEGF increasing ECM proteins in ECs. 32 We treated ECs with recombinant VEGF165 and assayed for FN expression. Our results show a positive feedback loop where exogenous VEGF increased expression of total FN and ED-B containing FN (Fig. 1d). 
Human Retinal Microvascular Endothelial Cells Show the Same Alterations as HUVECs
We have previously shown that ED-B FN is selectively increased in vitreous samples from patients with proliferative DR. 33 However, it remains to be determined whether HRMECs also increase ED-B FN expression upon exposure to high levels of glucose. We tested this possibility in cultured HRMECs and showed that with 48 hours of exposure to 25 mmol/L glucose, ED-B FN and VEGF expression was increased (Fig. 2a). Unlike HUVECs (Fig. 1), no changes were observed at 24 hours (data not shown). We also assayed for VEGF isoform expression in response to HG and found the same pattern as with HUVECs (Fig. 2b). 
Figure 2. 
 
Expression of ED-B FN and VEGF in human retinal microvascular ECs (HRMECs). (a) Exposure of HRMECs to HG caused increased mRNA expression of VEGF, ED-B FN, and total FN compared to control glucose levels after 48 hours. *P < 0.05 compared to control. (b) RT-PCR analysis of VEGF isoform expression in HRMECs exposed to HG for 48 hours. *P < 0.05 compared to control.
Figure 2. 
 
Expression of ED-B FN and VEGF in human retinal microvascular ECs (HRMECs). (a) Exposure of HRMECs to HG caused increased mRNA expression of VEGF, ED-B FN, and total FN compared to control glucose levels after 48 hours. *P < 0.05 compared to control. (b) RT-PCR analysis of VEGF isoform expression in HRMECs exposed to HG for 48 hours. *P < 0.05 compared to control.
Inhibiting α2β1 and α5β1 Prevents Glucose- and ED-B FN Induced VEGF Expression
ECs express a number of integrin receptors. 34 These include 4x β1 (α1, α2, α3, and α5), αvβ3, and αvβ5 integrins. FN is recognized by α5β1 and αVβ3. The remaining integrins expressed by ECs interact with other matrix proteins such as collagen (α1β1, α2β1), laminin (α1β1, α2β1, α3β1), and vitronectin (αvβ5). The sequence of FN recognized by α5β1 and αVβ3 integrins is a tripeptide (Arg-Gly-Asp; RGD).In addition to the RGD site, α5β1 can also bind FN through a proximal site (32 Å; RGD). 35 We used a combination of antibodies and integrin-binding mimetics to determine whether ED-B FN increases VEGF expression through the engagement of integrins. Pretreatment of ECs with either α2β1 or α5β1 antibody prevented HG-induced and ED-B peptide-induced increase in VEGF mRNA and protein (Fig. 3). Pretreatment of HG- and ED-B peptide-exposed cells with IgG isotype control produced no changes at 0.5 μg/mL concentration (data not shown). Because of the limitation of reagents available for specific α-β integrin subunit combinations, we proceeded to test the involvement of integrins by using specific neutralizing antibodies against the β subunits (β1, β3, and β5) that inhibit the function of the integrin regardless of the α subunit partner. Our results showed that only β1 integrin neutralization prevents the increase in VEGF (Figs. 4a, 4b). Next, we determined whether β1 integrin inhibition would prevent VEGF expression by immobilized ED-B FN. To do this, we coated the culture plates with 1 μg/mL ED-B peptide and seeded the cells. Addition of β1 neutralizing antibody prevented VEGF expression (Fig. 4c). No changes were observed in cells treated with β3 or β5 neutralizing antibodies. 
Figure 3. 
 
Effect of α2β1 and α5β1 integrin neutralizing antibodies on VEGF expression. HG caused increased mRNA expression (a) and protein production of VEGF (b) in HUVECs. Increased VEGF expression was also observed with ED-B peptide (c, d). Both glucose- and ED-B peptide-induced VEGF was inhibited by α2β1 and α5β1 antibodies. *P < 0.05 compared to control and †P < 0.05, compared to HG or ED-B peptide. For western blotting experiments, we used neutralizing antibodies at 0.5 μg/mL concentration.
Figure 3. 
 
Effect of α2β1 and α5β1 integrin neutralizing antibodies on VEGF expression. HG caused increased mRNA expression (a) and protein production of VEGF (b) in HUVECs. Increased VEGF expression was also observed with ED-B peptide (c, d). Both glucose- and ED-B peptide-induced VEGF was inhibited by α2β1 and α5β1 antibodies. *P < 0.05 compared to control and †P < 0.05, compared to HG or ED-B peptide. For western blotting experiments, we used neutralizing antibodies at 0.5 μg/mL concentration.
Figure 4. 
 
Involvement of β1 integrin in HG and ED-B FN mediated VEGF expression. VEGF expression by HG (a) or ED-B peptide (b) was inhibited by a specific neutralizing antibody against integrin β1. β3 neutralizing antibody had no significant effect. (c) Effect of the neutralizing antibodies on control (5 mmol/L glucose) cells plated on ED-B FN peptide coated plates (1 μg/cm2). All neutralizing antibodies were applied at a concentration of 0.5 μg/mL. For (a, b), *P < 0.05 compared to control, †P < 0.05, compared to HG or ED-B peptide. For (c), *P < 0.05 compared to IgG control. (d) Immunofluorescence staining of β1 integrin in HUVECs exposed to HG (images taken at 20x; scale bar = 100 μm; inserts showing high power image; green = β1 integrin, red = CD31, and blue = DAPI).
Figure 4. 
 
Involvement of β1 integrin in HG and ED-B FN mediated VEGF expression. VEGF expression by HG (a) or ED-B peptide (b) was inhibited by a specific neutralizing antibody against integrin β1. β3 neutralizing antibody had no significant effect. (c) Effect of the neutralizing antibodies on control (5 mmol/L glucose) cells plated on ED-B FN peptide coated plates (1 μg/cm2). All neutralizing antibodies were applied at a concentration of 0.5 μg/mL. For (a, b), *P < 0.05 compared to control, †P < 0.05, compared to HG or ED-B peptide. For (c), *P < 0.05 compared to IgG control. (d) Immunofluorescence staining of β1 integrin in HUVECs exposed to HG (images taken at 20x; scale bar = 100 μm; inserts showing high power image; green = β1 integrin, red = CD31, and blue = DAPI).
We wanted to know whether changes we saw in VEGF were due to altered subcellular distribution of β1 integrin. We then performed immunofluorescence staining for β1 integrin in ECs exposed to HG. Our results showed no significant changes in the localization of β1 integrin upon HG exposure (Fig. 4d). Finally, we knocked down the expression of β1 integrin in ECs and observed similar results as with the neutralizing antibodies (Figs. 5a, 5b). Both HG- and ED-B peptide-mediated VEGF expression were completely normalized when β1 integrin was silenced. 
Figure 5. 
 
β1 silencing prevents VEGF expression. Silencing β1 integrin in HUVECs prevented both HG- (a) and ED-B peptide-induced (b) VEGF expression. *P < 0.05 compared to control, and †P < 0.05, compared to HG or ED-B peptide.
Figure 5. 
 
β1 silencing prevents VEGF expression. Silencing β1 integrin in HUVECs prevented both HG- (a) and ED-B peptide-induced (b) VEGF expression. *P < 0.05 compared to control, and †P < 0.05, compared to HG or ED-B peptide.
So far, our results showed that HG increases ED-B FN, which then leads to VEGF expression through the β1 integrin. To show that these changes were mediated by direct binding of ED-B FN to integrin, we used integrin-binding peptides to competitively block the interaction between β1 integrin and ED-B FN. DGEA peptide is recognized by the α2β1 integrin, and the RGDS peptide is recognized by α5β1. Pretreatment with these peptides prevented HG-induced increase in VEGF mRNA and protein (Figs. 6a, 6b).In contrast, KDGE (scrambled peptide; negative control for DGEA) showed no effect on VEGF expression at the mRNA or protein level (Figs. 6a, 6b). As a functional readout of these effects, we assayed for tube formation by ECs. Exposure of ECs to HG increases tube morphogenesis (branching), which was prevented by DGEA and RGDS peptide, but not KDGE peptide (Fig. 6c). These results confirmed that the interaction between ED-B FN and α2β1/ α5β1 was necessary for the increased VEGF expression. 
Figure 6. 
 
α2β1 and α5β1 integrin-binding peptides prevent VEGF expression and tube morphogenesis.
 
DGEA and RGDS peptides, but not KDGE, prevented VEGF mRNA (a) and protein (b) expression in HUVECs. The cells were pretreated with the integrin-binding peptides (5 mmol/L) before exposure to HG or 2 μg/mL ED-B peptide. *P < 0.05 compared to control, †P < 0.05, compared to HG. (c) Representative images of tube formation assay with or without pretreatment with the integrin-binding peptides (asterisks point to tube formation in HUVECs).
Figure 6. 
 
α2β1 and α5β1 integrin-binding peptides prevent VEGF expression and tube morphogenesis.
 
DGEA and RGDS peptides, but not KDGE, prevented VEGF mRNA (a) and protein (b) expression in HUVECs. The cells were pretreated with the integrin-binding peptides (5 mmol/L) before exposure to HG or 2 μg/mL ED-B peptide. *P < 0.05 compared to control, †P < 0.05, compared to HG. (c) Representative images of tube formation assay with or without pretreatment with the integrin-binding peptides (asterisks point to tube formation in HUVECs).
High Glucose Leads to Altered VEGFR2 Expression through ED-B Containing FN
We next determined whether HG altered the expression of VEGF receptors in ECs, and whether ED-B FN mediated these effects. Culture of ECs in HG significantly increased VEGFR2 expression (Fig. 7a), but not VEGFR1 (Fig. 7b). Since VEGFR1 has been shown to regulate the binding of VEGF to VEGFR2 (and thus the proliferative actions of VEGF), 36 these findings illustrate that HG increases VEGF-VEGFR2 signaling in ECs. Interestingly, we found that the HG-induced expression of VEGFR2 was mediated by ED-FN, as knockdown completely abolished VEGFR2 mRNA. VEGFR2 has been shown to cluster alongside integrins on the cell surface. It is possible that silencing ED-B FN modulates VEGFR2–integrin coupling and reduced VEGF expression. 
Figure 7. 
 
Alteration of VEGF receptor expression by HG in ECs. (a) Real-time PCR analysis of VEGFR2 expression in HUVECs exposed to HG. Silencing ED-B FN completely abolished the expression of VEGFR2. However, VEGFR1 (b) was not altered by HG. *P < 0.05 compared to control, and †P < 0.05, compared to HG.
Figure 7. 
 
Alteration of VEGF receptor expression by HG in ECs. (a) Real-time PCR analysis of VEGFR2 expression in HUVECs exposed to HG. Silencing ED-B FN completely abolished the expression of VEGFR2. However, VEGFR1 (b) was not altered by HG. *P < 0.05 compared to control, and †P < 0.05, compared to HG.
Inhibiting ED-B FN in the Retina Prevents Diabetes-Induced β1 Integrin Expression and VEGF Production
In order to study whether the changes we observed in in vitro studies translate to the in vivo setting, we used an established animal model of chronic diabetes. We have previously shown that this STZ-diabetic model exhibits all molecular alterations reminiscent of human diabetes. 3739 Although angiogenesis is not seen in animal models of diabetes, the molecular changes, including increased VEGF levels, have been reported by numerous laboratories. Here, we confirmed that 1 month of diabetes significantly increased VEGF expression in retinal tissues of diabetic mice (Fig. 8a). This increased VEGF was associated with augmented ED-B FN and β1 integrin. Because it is technically difficult to inhibit ED-B FN in the retina, we utilized systemic administration of ED-B siRNA. After administration of ED-B siRNA (every 7 days), we observed complete normalization of diabetes-induced ED-B expression in the retinal tissues. We then report that the augmented VEGF expression seen in the retinas of diabetic mice was normalized upon ED-B FN suppression. Treatment of nondiabetic animals with ED-B siRNA did not produce any significant effects (Fig. 8b). These findings indicated that diabetes led to VEGF expression in the retina through ED-B FN. Although we were not able to modulate β1 integrin levels directly, we showed that VEGF normalization, seen in the ED-B siRNA treated mice, was associated with reduced β1 integrin levels. 
Figure 8. 
 
Effect of in vivo administration of ED-B siRNA on β1 integrin expression in the retina. (a) Real-time PCR analysis showing increased mRNA expression of integrin β1 in the diabetic mouse retina, which is prevented by systemic administration of ED-B FN siRNA. (b) No significant alteration in β1 integrin mRNA levels was observed when ED-B siRNA was administered to nondiabetic mice (control = nondiabetic; ED-B siRNA = nondiabetic treated with ED-B siRNA; Diab = diabetic treated with scrambled siRNA; Diab + ED-B siRNA = diabetic treated with ED-B siRNA. *P < 0.05 compared to control and †P < 0.05, compared to Diab.
Figure 8. 
 
Effect of in vivo administration of ED-B siRNA on β1 integrin expression in the retina. (a) Real-time PCR analysis showing increased mRNA expression of integrin β1 in the diabetic mouse retina, which is prevented by systemic administration of ED-B FN siRNA. (b) No significant alteration in β1 integrin mRNA levels was observed when ED-B siRNA was administered to nondiabetic mice (control = nondiabetic; ED-B siRNA = nondiabetic treated with ED-B siRNA; Diab = diabetic treated with scrambled siRNA; Diab + ED-B siRNA = diabetic treated with ED-B siRNA. *P < 0.05 compared to control and †P < 0.05, compared to Diab.
Discussion
The salient findings of our study include (1) exposure of ECs to high levels of glucose increased VEGF through ED-B FN induction, (2) ED-B mediated the signals through β1 integrin, and (3) siRNA against ED-B FN decreased retinal VEGF and β1 integrin expression in diabetic mice. We also showed that ED-B peptide increased VEGF expression in ECs, which was inhibited by DGEA (containing the cell-binding domain of α2β1) and RGDS peptide (α5β1 binding peptide), but not KDGE peptide (without binding affinity for α2β1 integrin). The involvement of α2β1 and α5β1 was also confirmed by specific neutralizing antibodies and siRNA against β1 integrin. 
The mechanisms of increased VEGF expression in DR may involve a direct role of glucose. Studies have shown that increased glucose levels upregulate VEGF expression in ECs, 23 smooth muscle cells, 40 and retinal pigment epithelial cells. 19,41,42 Interestingly, glucose deprivation may also increase VEGF expression and augment angiogenesis. 43 Whether this happens in ECs remains to be determined, but pericytes do show this response. It is possible that both mechanisms (elevated glucose as well as glucose deprivation/hypoxia) are at play in DR. Elevated glucose levels may cause EC damage and VEGF expression early on. This may lead to sustained expression levels of VEGF because of reduced perfusion and increased permeability. However, these further events need experimental support. 
FN fragments have been shown to modulate EC adhesion and proliferation, and vasoregulation. 4446 Studies have also shown that FN is upregulated in the active zones of retinal vascularization during development. 47 Since DR entails neovascularization in the late stages, it is expected that FN is also increased. In fact, the BM of diabetic animals do show elevated FN. 48 This happens as early as 1 month after diabetes onset in mice and rats. 33,49,50 In addition to increased production, the FN species are different in diabetes. We have recently demonstrated increased expression of ED-B FN in the vitreous samples of proliferative DR and retinal tissues of diabetic rats. 33 When we specifically inhibited ED-B FN in ECs, we observed decreased proliferation and tube morphogenesis. 22 This phenotypic change in the ECs was possibly due to changes in VEGF expression, as supported by the present study. 
A novel finding of our study was the involvement of α2β1 integrin in ED-B mediated VEGF responses. This specific integrin (also known as VLA-2) has been shown to be a receptor for laminin and collagen. 51,52 Studies have also shown that antibodies directed against α2β1 inhibit adhesion of ECs to laminin- and collagen-coated surfaces, but have no inhibitory effects on FN-coated surfaces. 53 This raises a number of interesting questions regarding the mechanisms of ED-B mediated responses in ECs. These mechanisms may include modulation of collagen and/or laminin interaction with α2β1 by ED-B FN. ECs exposed to high levels of glucose increase collagen levels. 54 The presence of ED-B FN may modulate EC-collagen interaction leading to VEGF expression. Another possibility is that ED-B FN binds to α2β1 to cause VEGF expression. Interestingly, initial studies characterizing α2β1 have shown binding of this integrin to both plasma FN and a 110-Kd FN fragment (which contains the RGD site; close proximity to the ED-B segment). 55,56 The specificity of FN binding is similar to laminin and collagen IV. 55 Furthermore, this binding ability seems to be specific for ECs α2β1 integrin, as platelet-derived α2β1 did not bind FN. 56 As mentioned earlier, retinal pigment epithelial cells also induce VEGF expression in response to high levels of glucose. These cell types have been shown to express α2β1 integrin. 57 It would be interesting to determine whether retinal pigmental epithelial cell α2β1 integrin also binds to FN to mediate the high-glucose effect on VEGF expression. 
An additional finding of our study was the regulation of VEGFR2 (but not VEGFR1) by ED-B FN. Knocking down ED-B in ECs completely abolished the expression of VEGFR2. This may be because of a positive feedback loop between VEGF and VEGFR2 expression. 58 Another possibility is that ED-B siRNA alters the cell membrane and causes VEGFR2 downregulation. VEGFR2 has been shown to interact with β1 integrin. 59 Neuropilin-1, a co-receptor of VEGFR1 and VEGFR2, also signals through α5β1 integrin in ECs. 60 Therefore, if ED-B siRNA caused changes in β1 integrin, VEGFR2 may be affected. Our results support this notion. 
In summary, our results showed for the first time that high levels of glucose increased VEGF expression in ECs through the interaction of ED-B FN with β1 integrin. We have also shown that diabetes caused increased retinal VEGF and β1 integrin expression, which normalized upon ED-B FN inhibition. This represents a novel mechanism of autocrine VEGF expression and EC survival. EC-derived VEGF has previously been shown to be essential for cell survival through autocrine signals. 21 Mice with EC-specific VEGF knockout show systemic EC apoptosis. However, the same phenotype is not evident in the ED-B knockout animals. It is possible that in the ED-B knockout mice, a compensatory mechanism leads to VEGF expression from cell types adjacent to the ECs. Further studies are needed to determine whether ED-B FN induced VEGF expression is specific to ECs, or whether it represents a general biologic mechanism of VEGF expression. In addition, identifying the downstream signaling mechanisms may lead to new therapeutic targets for DR and other blood vessel–dependent diseases. 
References
Fong DS Aiello L Gardner TW Diabetic retinopathy. Diabetes Care . 2003;26 (suppl 1);S99–S102. [CrossRef] [PubMed]
Khan ZA Chakrabarti S. Growth factors in proliferative diabetic retinopathy. Exp Diabesity Res . 2003;4:287–301. [CrossRef] [PubMed]
Khan ZA Chakrabarti S. Therapeutic targeting of endothelial dysfunction in chronic diabetic complications. Recent Pat Cardiovasc Drug Discov . 2006;1:167–175. [CrossRef] [PubMed]
Khan ZA Farhangkhoee H Chakrabarti S. Towards newer molecular targets for chronic diabetic complications. Curr Vasc Pharmacol . 2006;4:45–57. [CrossRef] [PubMed]
Bates DO Cui TG Doughty JM VEGF165b, an inhibitory splice variant of vascular endothelial growth factor, is down-regulated in renal cell carcinoma. Cancer Res . 2002;62:4123–4131. [PubMed]
Takahashi H Shibuya M. The vascular endothelial growth factor (VEGF)/VEGF receptor system and its role under physiological and pathological conditions. Clin Sci (Lond) . 2005;109:227–241. [CrossRef] [PubMed]
Mineur P Colige AC Deroanne CF Newly identified biologically active and proteolysis-resistant VEGF-A isoform VEGF111 is induced by genotoxic agents. J Cell Biol . 2007;179:1261–1273. [CrossRef] [PubMed]
Biselli-Chicote PM Oliveira AR Pavarino EC Goloni-Bertollo EM. VEGF gene alternative splicing: pro- and anti-angiogenic isoforms in cancer. J Cancer Res Clin Oncol . 2012;138:363–370. [CrossRef] [PubMed]
Mustonen T Alitalo K. Endothelial receptor tyrosine kinases involved in angiogenesis. J Cell Biol . 1995;129:895–898. [CrossRef] [PubMed]
Waltenberger J Claesson-Welsh L Siegbahn A Shibuya M Heldin CH. Different signal transduction properties of KDR and Flt1, two receptors for vascular endothelial growth factor. J Biol Chem . 1994;269:26988–26995. [PubMed]
Zachary I. Signal transduction in angiogenesis. EXS . 2005;267–300.
Aiello LP Avery RL Arrigg PG Vascular endothelial growth factor in ocular fluid of patients with diabetic retinopathy and other retinal disorders. N Engl J Med . 1994;331:1480–1487. [CrossRef] [PubMed]
Endo H Naito T Asahara T Kajima M Shiota H. [Cytokines in the vitreous fluid of patients with proliferative diabetic retinopathy--vascular endothelial growth factor and platelet-derived growth factor are elevated in proliferative diabetic retinopathy]. Nihon Ganka Gakkai Zasshi . 2000;104:711–716. [PubMed]
Endo M Yanagisawa K Tsuchida K Increased levels of vascular endothelial growth factor and advanced glycation end products in aqueous humor of patients with diabetic retinopathy. Horm Metab Res . 2001;33:317–322. [CrossRef] [PubMed]
Aiello LP Pierce EA Foley ED Suppression of retinal neovascularization in vivo by inhibition of vascular endothelial growth factor (VEGF) using soluble VEGF-receptor chimeric proteins. Proc Natl Acad Sci U S A . 1995;92:10457–10461. [CrossRef] [PubMed]
Adamis AP Shima DT Tolentino MJ Inhibition of vascular endothelial growth factor prevents retinal ischemia-associated iris neovascularization in a nonhuman primate. Arch Ophthalmol . 1996;114:66–71. [CrossRef] [PubMed]
Ozaki H Seo MS Ozaki K Blockade of vascular endothelial cell growth factor receptor signaling is sufficient to completely prevent retinal neovascularization. Am J Pathol . 2000;156:697–707. [CrossRef] [PubMed]
Young TA Wang H Munk S Vascular endothelial growth factor expression and secretion by retinal pigment epithelial cells in high glucose and hypoxia is protein kinase C-dependent. Exp Eye Res . 2005;80:651–662. [CrossRef] [PubMed]
Sone H Kawakami Y Okuda Y Vascular endothelial growth factor is induced by long-term high glucose concentration and up-regulated by acute glucose deprivation in cultured bovine retinal pigmented epithelial cells. Biochem Biophys Res Commun . 1996;221:193–198. [CrossRef] [PubMed]
Vega-Diaz B Herron GS Michel S. An autocrine loop mediates expression of vascular endothelial growth factor in human dermal microvascular endothelial cells. J Invest Dermatol . 2001;116:525–530. [CrossRef] [PubMed]
Lee S Chen TT Barber CL Autocrine VEGF signaling is required for vascular homeostasis. Cell . 2007;130:691–703. [CrossRef] [PubMed]
Khan ZA Chan BM Uniyal S EDB fibronectin and angiogenesis–a novel mechanistic pathway. Angiogenesis . 2005;8:183–196. [CrossRef] [PubMed]
Hsu CC Yin MC Tian R. Ascorbic acid and uric acid suppress glucose-induced fibronectin and vascular endothelial growth factor production in human endothelial cells. J Diabetes Complications . 2005;19:96–100. [CrossRef] [PubMed]
Park JE Keller GA Ferrara N. The vascular endothelial growth factor (VEGF) isoforms: differential deposition into the subepithelial extracellular matrix and bioactivity of extracellular matrix-bound VEGF. Mol Biol Cell . 1993;4:1317–1326. [CrossRef] [PubMed]
Sweeney SM DiLullo G Slater SJ Angiogenesis in collagen I requires alpha2beta1 ligation of a GFP*GER sequence and possibly p38 MAPK activation and focal adhesion disassembly. J Biol Chem . 2003;278:30516–30524. [CrossRef] [PubMed]
Xiao G Wang D Benson MD Karsenty G Franceschi RT. Role of the alpha2-integrin in osteoblast-specific gene expression and activation of the Osf2 transcription factor. J Biol Chem . 1998;273:32988–32994. [CrossRef] [PubMed]
Khan ZA Barbin YP Farhangkhoee H Beier N Scholz W Chakrabarti S. Glucose-induced serum- and glucocorticoid-regulated kinase activation in oncofetal fibronectin expression. Biochem Biophys Res Commun . 2005;329:275–280. [CrossRef] [PubMed]
Xin X Khan ZA Chen S Chakrabarti S. Glucose-induced Akt1 activation mediates fibronectin synthesis in endothelial cells. Diabetologia . 2005;48:2428–2436. [CrossRef] [PubMed]
Xin X Khan ZA Chen S Chakrabarti S. Extracellular signal-regulated kinase (ERK) in glucose-induced and endothelin-mediated fibronectin synthesis. Lab Invest . 2004;84:1451–1459. [CrossRef] [PubMed]
Neufeld G Cohen T Gengrinovitch S Poltorak Z. Vascular endothelial growth factor (VEGF) and its receptors. FASEB J . 1999;13:9–22. [PubMed]
Zygalaki E Stathopoulou A Kroupis C Real-time reverse transcription-PCR quantification of vascular endothelial growth factor splice variants. Clin Chem . 2005;51:1518–1520. [CrossRef] [PubMed]
Kuiper EJ Hughes JM Van Geest RJ Effect of VEGF-A on expression of profibrotic growth factor and extracellular matrix genes in the retina. Invest Ophthalmol Vis Sci . 2007;48:4267–4276. [CrossRef] [PubMed]
Khan ZA Cukiernik M Gonder JR Chakrabarti S. Oncofetal fibronectin in diabetic retinopathy. Invest Ophthalmol Vis Sci . 2004;45:287–295. [CrossRef] [PubMed]
Rupp PA Little CD. Integrins in vascular development. Circ Res . 2001;89:566–572. [CrossRef] [PubMed]
Johansson S Svineng G Wennerberg K Armulik A Lohikangas L. Fibronectin-integrin interactions. Front Biosci . 1997;2:d126–146. [PubMed]
Zeng H Dvorak HF Mukhopadhyay D. Vascular permeability factor (VPF)/vascular endothelial growth factor (VEGF) peceptor-1 down-modulates VPF/VEGF receptor-2-mediated endothelial cell proliferation, but not migration, through phosphatidylinositol 3-kinase-dependent pathways. J Biol Chem . 2001;276:26969–26979. [CrossRef] [PubMed]
Chiu J Farhangkhoee H Xu BY Chen S George B Chakrabarti S. PARP mediates structural alterations in diabetic cardiomyopathy. J Mol Cell Cardiol . 2008;45:385–393. [CrossRef] [PubMed]
Chiu J Xu BY Chen S Feng B Chakrabarti S. Oxidative stress-induced, poly(ADP-ribose) polymerase-dependent upregulation of ET-1 expression in chronic diabetic complications. Can J Physiol Pharmacol . 2008;86:365–372. [CrossRef] [PubMed]
Xin X Chen S Khan ZA Chakrabarti S. Akt activation and augmented fibronectin production in hyperhexosemia. Am J Physiol Endocrinol Metab . 2007;293:E1036–1044. [CrossRef] [PubMed]
Williams B Gallacher B Patel H Orme C. Glucose-induced protein kinase C activation regulates vascular permeability factor mRNA expression and peptide production by human vascular smooth muscle cells in vitro. Diabetes . 1997;46:1497–1503. [CrossRef] [PubMed]
Ahmado A Carr AJ Vugler AA Induction of differentiation by pyruvate and DMEM in the human retinal pigment epithelium cell line ARPE-19. Invest Ophthalmol Vis Sci . 2011;52:7148–7159. [CrossRef] [PubMed]
Wang W Matsukura M Fujii I Inhibition of high glucose-induced VEGF and ICAM-1 expression in human retinal pigment epithelium cells by targeting ILK with small interference RNA. Mol Biol Rep . 2012;39:613–620. [CrossRef] [PubMed]
Kim BS Chen J Weinstein T Noiri E Goligorsky MS. VEGF expression in hypoxia and hyperglycemia: reciprocal effect on branching angiogenesis in epithelial-endothelial co-cultures. J Am Soc Nephrol . 2002;13:2027–2036. [CrossRef] [PubMed]
Wilson SH Ljubimov AV Morla AO Fibronectin fragments promote human retinal endothelial cell adhesion and proliferation and ERK activation through alpha5beta1 integrin and PI 3-kinase. Invest Ophthalmol Vis Sci . 2003;44:1704–1715. [CrossRef] [PubMed]
Laplante C St-Pierre S Beaulieu AD Marceau F. Small fibronectin fragments induce endothelium-dependent vascular relaxations. Can J Physiol Pharmacol . 1988;66:745–748. [CrossRef] [PubMed]
Grant MB Caballero S Bush DM Spoerri PE. Fibronectin fragments modulate human retinal capillary cell proliferation and migration. Diabetes . 1998;47:1335–1340. [CrossRef] [PubMed]
Jiang B Liou GI Behzadian MA Caldwell RB. Astrocytes modulate retinal vasculogenesis: effects on fibronectin expression. J Cell Sci . 1994;107; 2499–2508. [PubMed]
Nishikawa T Giardino I Edelstein D Brownlee M. Changes in diabetic retinal matrix protein mRNA levels in a common transgenic mouse strain. Curr Eye Res . 2000;21:581–587. [CrossRef] [PubMed]
Evans T Deng DX Chen S Chakrabarti S. Endothelin receptor blockade prevents augmented extracellular matrix component mRNA expression and capillary basement membrane thickening in the retina of diabetic and galactose-fed rats. Diabetes . 2000;49:662–666. [CrossRef] [PubMed]
Chen S Khan ZA Cukiernik M Chakrabarti S. Differential activation of NF-kappa B and AP-1 in increased fibronectin synthesis in target organs of diabetic complications. Am J Physiol Endocrinol Metab . 2003;284:E1089–1097. [CrossRef] [PubMed]
van der Flier A Sonnenberg A. Function and interactions of integrins. Cell Tissue Res . 2001;305:285–298. [CrossRef] [PubMed]
Zutter MM Edelson BT. The alpha2beta1 integrin: a novel collectin/C1q receptor. Immunobiology . 2007;212:343–353. [CrossRef] [PubMed]
O'Connell PJ Faull R Russ GR D'Apice AJ. VLA-2 is a collagen receptor on endothelial cells. Immunol Cell Biol . 1991;69;103–110. [CrossRef] [PubMed]
Moritani S Negishi K Watanabe T Glucose-induced production of type IV collagen and laminin P1 from cultured human umbilical vein endothelial cells. J Diabet Complications . 1991;5:201–203. [CrossRef] [PubMed]
Languino LR Gehlsen KR Wayner E Carter WG Engvall E Ruoslahti E. Endothelial cells use alpha 2 beta 1 integrin as a laminin receptor. J Cell Biol . 1989;109:2455–2462. [CrossRef] [PubMed]
Kirchhofer D Languino LR Ruoslahti E Pierschbacher MD. Alpha 2 beta 1 integrins from different cell types show different binding specificities. J Biol Chem . 1990;265:615–618. [PubMed]
Bando H Ikuno Y Hori Y Sayanagi K Tano Y. Mitogen-activated protein kinase (MAPK) and phosphatidylinositol-3 kinase (PI3K) pathways differently regulate retinal pigment epithelial cell-mediated collagen gel contraction. Exp Eye Res . 2006;82:529–537. [CrossRef] [PubMed]
Cao Y EG Bhattacharya S Dutta S Wang E Mukhopadhyay D. Endogenous Vascular Endothelial Growth Factor-A (VEGF-A) Maintains Endothelial Cell Homeostasis by Regulating VEGF Receptor-2 Transcription. J Biol Chem . 2012;287:3029–3041. [CrossRef] [PubMed]
Chen TT Luque A Lee S Anderson SM Segura T Iruela-Arispe ML. Anchorage of VEGF to the extracellular matrix conveys differential signaling responses to endothelial cells. J Cell Biol . 2010;188:595–609. [CrossRef] [PubMed]
Valdembri D Caswell PT Anderson KI Neuropilin-1/GIPC1 signaling regulates alpha5beta1 integrin traffic and function in endothelial cells. PLoS Biol . 2009;7:e25. [CrossRef] [PubMed]
Footnotes
 Supported by grants from the Canadian Institutes of Health Research (SCha) and the Canadian Diabetes Association (ZAK), and a New Investigator Award from the Heart and Stroke Foundation of Canada (ZAK).
Footnotes
 Disclosure: S. Chen, None; R. Chakrabarti, None; E.C. Keats, None; M. Chen, None; S. Chakrabarti, None; Z.A. Khan, None
Figure 1. 
 
Expression of ED-B FN and VEGF in HUVECs. (a) Exposure of HUVECs to 25 mmol/L glucose (HG) caused increased mRNA expression of VEGF, ED-B FN, and total FN compared to 5 mmol/L glucose (Control) after 24 hours. This glucose-induced expression of VEGF and ED-B FN was prevented when HUVECs were transfected with ED-B FN siRNA. *P < 0.05 compared to control, †P < 0.05, compared to HG. (b) Immunofluorescence staining for ED-B FN in HUVECs exposed to HG for 24 hrs (images taken at 20x; scale bar = 100 μm; insert showing high power image; green = ED-B FN, exposure time 16 seconds, and blue = DAPI, exposure time 3 seconds). (c) RT-PCR analysis of VEGF isoform expression in HUVECs exposed to HG or 2 μg/mL ED-B peptide. *P < 0.05 compared to control. (d) Expression of FN in cells treated with 10 ng/mL recombinant VEGF165 for 24 hours. *P < 0.05 compared to control.
Figure 1. 
 
Expression of ED-B FN and VEGF in HUVECs. (a) Exposure of HUVECs to 25 mmol/L glucose (HG) caused increased mRNA expression of VEGF, ED-B FN, and total FN compared to 5 mmol/L glucose (Control) after 24 hours. This glucose-induced expression of VEGF and ED-B FN was prevented when HUVECs were transfected with ED-B FN siRNA. *P < 0.05 compared to control, †P < 0.05, compared to HG. (b) Immunofluorescence staining for ED-B FN in HUVECs exposed to HG for 24 hrs (images taken at 20x; scale bar = 100 μm; insert showing high power image; green = ED-B FN, exposure time 16 seconds, and blue = DAPI, exposure time 3 seconds). (c) RT-PCR analysis of VEGF isoform expression in HUVECs exposed to HG or 2 μg/mL ED-B peptide. *P < 0.05 compared to control. (d) Expression of FN in cells treated with 10 ng/mL recombinant VEGF165 for 24 hours. *P < 0.05 compared to control.
Figure 2. 
 
Expression of ED-B FN and VEGF in human retinal microvascular ECs (HRMECs). (a) Exposure of HRMECs to HG caused increased mRNA expression of VEGF, ED-B FN, and total FN compared to control glucose levels after 48 hours. *P < 0.05 compared to control. (b) RT-PCR analysis of VEGF isoform expression in HRMECs exposed to HG for 48 hours. *P < 0.05 compared to control.
Figure 2. 
 
Expression of ED-B FN and VEGF in human retinal microvascular ECs (HRMECs). (a) Exposure of HRMECs to HG caused increased mRNA expression of VEGF, ED-B FN, and total FN compared to control glucose levels after 48 hours. *P < 0.05 compared to control. (b) RT-PCR analysis of VEGF isoform expression in HRMECs exposed to HG for 48 hours. *P < 0.05 compared to control.
Figure 3. 
 
Effect of α2β1 and α5β1 integrin neutralizing antibodies on VEGF expression. HG caused increased mRNA expression (a) and protein production of VEGF (b) in HUVECs. Increased VEGF expression was also observed with ED-B peptide (c, d). Both glucose- and ED-B peptide-induced VEGF was inhibited by α2β1 and α5β1 antibodies. *P < 0.05 compared to control and †P < 0.05, compared to HG or ED-B peptide. For western blotting experiments, we used neutralizing antibodies at 0.5 μg/mL concentration.
Figure 3. 
 
Effect of α2β1 and α5β1 integrin neutralizing antibodies on VEGF expression. HG caused increased mRNA expression (a) and protein production of VEGF (b) in HUVECs. Increased VEGF expression was also observed with ED-B peptide (c, d). Both glucose- and ED-B peptide-induced VEGF was inhibited by α2β1 and α5β1 antibodies. *P < 0.05 compared to control and †P < 0.05, compared to HG or ED-B peptide. For western blotting experiments, we used neutralizing antibodies at 0.5 μg/mL concentration.
Figure 4. 
 
Involvement of β1 integrin in HG and ED-B FN mediated VEGF expression. VEGF expression by HG (a) or ED-B peptide (b) was inhibited by a specific neutralizing antibody against integrin β1. β3 neutralizing antibody had no significant effect. (c) Effect of the neutralizing antibodies on control (5 mmol/L glucose) cells plated on ED-B FN peptide coated plates (1 μg/cm2). All neutralizing antibodies were applied at a concentration of 0.5 μg/mL. For (a, b), *P < 0.05 compared to control, †P < 0.05, compared to HG or ED-B peptide. For (c), *P < 0.05 compared to IgG control. (d) Immunofluorescence staining of β1 integrin in HUVECs exposed to HG (images taken at 20x; scale bar = 100 μm; inserts showing high power image; green = β1 integrin, red = CD31, and blue = DAPI).
Figure 4. 
 
Involvement of β1 integrin in HG and ED-B FN mediated VEGF expression. VEGF expression by HG (a) or ED-B peptide (b) was inhibited by a specific neutralizing antibody against integrin β1. β3 neutralizing antibody had no significant effect. (c) Effect of the neutralizing antibodies on control (5 mmol/L glucose) cells plated on ED-B FN peptide coated plates (1 μg/cm2). All neutralizing antibodies were applied at a concentration of 0.5 μg/mL. For (a, b), *P < 0.05 compared to control, †P < 0.05, compared to HG or ED-B peptide. For (c), *P < 0.05 compared to IgG control. (d) Immunofluorescence staining of β1 integrin in HUVECs exposed to HG (images taken at 20x; scale bar = 100 μm; inserts showing high power image; green = β1 integrin, red = CD31, and blue = DAPI).
Figure 5. 
 
β1 silencing prevents VEGF expression. Silencing β1 integrin in HUVECs prevented both HG- (a) and ED-B peptide-induced (b) VEGF expression. *P < 0.05 compared to control, and †P < 0.05, compared to HG or ED-B peptide.
Figure 5. 
 
β1 silencing prevents VEGF expression. Silencing β1 integrin in HUVECs prevented both HG- (a) and ED-B peptide-induced (b) VEGF expression. *P < 0.05 compared to control, and †P < 0.05, compared to HG or ED-B peptide.
Figure 6. 
 
α2β1 and α5β1 integrin-binding peptides prevent VEGF expression and tube morphogenesis.
 
DGEA and RGDS peptides, but not KDGE, prevented VEGF mRNA (a) and protein (b) expression in HUVECs. The cells were pretreated with the integrin-binding peptides (5 mmol/L) before exposure to HG or 2 μg/mL ED-B peptide. *P < 0.05 compared to control, †P < 0.05, compared to HG. (c) Representative images of tube formation assay with or without pretreatment with the integrin-binding peptides (asterisks point to tube formation in HUVECs).
Figure 6. 
 
α2β1 and α5β1 integrin-binding peptides prevent VEGF expression and tube morphogenesis.
 
DGEA and RGDS peptides, but not KDGE, prevented VEGF mRNA (a) and protein (b) expression in HUVECs. The cells were pretreated with the integrin-binding peptides (5 mmol/L) before exposure to HG or 2 μg/mL ED-B peptide. *P < 0.05 compared to control, †P < 0.05, compared to HG. (c) Representative images of tube formation assay with or without pretreatment with the integrin-binding peptides (asterisks point to tube formation in HUVECs).
Figure 7. 
 
Alteration of VEGF receptor expression by HG in ECs. (a) Real-time PCR analysis of VEGFR2 expression in HUVECs exposed to HG. Silencing ED-B FN completely abolished the expression of VEGFR2. However, VEGFR1 (b) was not altered by HG. *P < 0.05 compared to control, and †P < 0.05, compared to HG.
Figure 7. 
 
Alteration of VEGF receptor expression by HG in ECs. (a) Real-time PCR analysis of VEGFR2 expression in HUVECs exposed to HG. Silencing ED-B FN completely abolished the expression of VEGFR2. However, VEGFR1 (b) was not altered by HG. *P < 0.05 compared to control, and †P < 0.05, compared to HG.
Figure 8. 
 
Effect of in vivo administration of ED-B siRNA on β1 integrin expression in the retina. (a) Real-time PCR analysis showing increased mRNA expression of integrin β1 in the diabetic mouse retina, which is prevented by systemic administration of ED-B FN siRNA. (b) No significant alteration in β1 integrin mRNA levels was observed when ED-B siRNA was administered to nondiabetic mice (control = nondiabetic; ED-B siRNA = nondiabetic treated with ED-B siRNA; Diab = diabetic treated with scrambled siRNA; Diab + ED-B siRNA = diabetic treated with ED-B siRNA. *P < 0.05 compared to control and †P < 0.05, compared to Diab.
Figure 8. 
 
Effect of in vivo administration of ED-B siRNA on β1 integrin expression in the retina. (a) Real-time PCR analysis showing increased mRNA expression of integrin β1 in the diabetic mouse retina, which is prevented by systemic administration of ED-B FN siRNA. (b) No significant alteration in β1 integrin mRNA levels was observed when ED-B siRNA was administered to nondiabetic mice (control = nondiabetic; ED-B siRNA = nondiabetic treated with ED-B siRNA; Diab = diabetic treated with scrambled siRNA; Diab + ED-B siRNA = diabetic treated with ED-B siRNA. *P < 0.05 compared to control and †P < 0.05, compared to Diab.
Table. 
 
Primer Sequences for RT-PCR
Table. 
 
Primer Sequences for RT-PCR
Genes (sp) Sequence (5′ → 3′)
β1 integrin (hu) CGAGGTCATGGTTCATGTTC
CAGTGTTGTGGGATTTGCAC
β1 integrin (mo) GGTGTCGTGTTTGTGAATGC
CTCCTGTGCACACGTGTCTT
ED-B FN (hu/mo) CCGCCATTAATGAGAGTGAT
AGTTAGTTGCGGCAGGAGAAG
Total FN (hu) GATAAATCAACAGTGGGAGC
CCCAGATCATGGAGTCTTTA
VEGF (hu) ATCTTCAAGCCATCCTGTGTGC
GCTCACCGCCTCGGCTTGT
VEGF (mo) CCATGAACTTTCTGCTCTCTTG
GGTGAGAGGTCTGGTTCCCGAA
VEGF121 (hu) ATCTTCAAGCCATCCTGTGTGC
TGCGCTTGTCACATTTTTCTTG
VEGF145 (hu) ATCTTCAAGCCATCCTGTGTGC
TCGGCTTGTCACATACGCTCC
VEGF148 (hu) ATCTTCAAGCCATCCTGTGTGC
TCGGCTTGTCACATCTTGCAAC
VEGF165 (hu) ATCTTCAAGCCATCCTGTGTGC
CAAGGCCCACAGGGATTTTC
VEGF183 (hu) ATCTTCAAGCCATCCTGTGTGC
GCCCACAGGGACGGGATTT
VEGF189 (hu) ATCTTCAAGCCATCCTGTGTGC
CACAGGGAACGCTCCAGGAC
VEGFR1 (hu) AGGGGAAGAAATCCTCCAGA
CGTGCTGCTTCCTGGTCC
VEGFR2 (hu) GTGACCAACATGGAGTCGTG
TGCTTCACAGAAGACCATGC
β-actin (hu/mo) CCTCTATGCCAACACAGTGC
CATCGTACTCCTGCTTGCTG
18S rRNA (hu/mo) GTAACCCGTTGAACCCCATT
CCATCCAACGGTAGTAGCG
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×