May 2011
Volume 52, Issue 6
Free
Biochemistry and Molecular Biology  |   May 2011
Interactive Expressions of HtrA1 and VEGF in Human Vitreous Humors and Fetal RPE Cells
Author Affiliations & Notes
  • Tsz Kin Ng
    From the Departments of Ophthalmology & Visual Sciences and
  • Gary H. F. Yam
    From the Departments of Ophthalmology & Visual Sciences and
  • Wei Qi Chen
    Joint Shantou International Eye Center of Shantou University and Chinese University of Hong Kong, Shantou, China; and
  • Vincent Y. W. Lee
    From the Departments of Ophthalmology & Visual Sciences and
  • Haoyu Chen
    Joint Shantou International Eye Center of Shantou University and Chinese University of Hong Kong, Shantou, China; and
  • Li Jia Chen
    From the Departments of Ophthalmology & Visual Sciences and
  • Kwong Wai Choy
    Obstetrics & Gynaecology, Chinese University of Hong Kong, Hong Kong, China;
  • Zhenglin Yang
    Center for Human Molecular Biology and Genetics, Sichuan Academy of Medical Sciences, Chengdu, Sichuan, China; and
    Sichuan Provincial People's Hospital, Chengdu, Sichuan, China.
  • Chi Pui Pang
    From the Departments of Ophthalmology & Visual Sciences and
  • Corresponding author: Chi Pui Pang, Department of Ophthalmology & Visual Sciences, Chinese University of Hong Kong, Hong Kong Eye Hospital, 147K Argyle Street, Kowloon, Hong Kong; cppang@cuhk.edu.hk
Investigative Ophthalmology & Visual Science May 2011, Vol.52, 3706-3712. doi:10.1167/iovs.10-6773
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Tsz Kin Ng, Gary H. F. Yam, Wei Qi Chen, Vincent Y. W. Lee, Haoyu Chen, Li Jia Chen, Kwong Wai Choy, Zhenglin Yang, Chi Pui Pang; Interactive Expressions of HtrA1 and VEGF in Human Vitreous Humors and Fetal RPE Cells. Invest. Ophthalmol. Vis. Sci. 2011;52(6):3706-3712. doi: 10.1167/iovs.10-6773.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

Purpose.: High-temperature requirement factor A1 (HtrA1) is associated with exudative age-related macular degeneration, an angiogenic retinal disease related to vascular endothelial growth factor (VEGF). This study investigates the interactive relationship between the expressions of HtrA1 and VEGF.

Methods.: The vitreous humor levels of HtrA1, VEGF, and pigment epithelium-derived factor were determined in 55 unrelated Han Chinese patients who underwent ocular surgeries. Expressions of HTRA1 and VEGFA were studied interactively and under stress conditions in primary human fetal retinal pigment epithelial (RPE) cells to evaluate their regulations.

Results.: Vitreous levels of HtrA1 were significantly associated with that of VEGF in vitreous samples from all patients (Pearson's correlation coefficient test, r = 0.650, P = 7.91 × 10−8) and from patients with retinal detachment (r = 0.835, P = 2.14 × 10−7). On stress induction, HTRA1 and VEGFA were upregulated in human fetal RPE cells treated by tunicamycin and dithiothreitol, but reduced after treatment by MG132. However, HtrA1 and VEGF did not regulate each other in their expressions.

Conclusions.: This study revealed an association between HtrA1 and VEGF in human vitreous humors and RPE cells. They are both related to stress and inflammatory conditions.

Angiogenic retinal diseases, such as age-related macular degeneration (AMD) and diabetic retinopathy, are major causes of irreversible visual impairment and blindness worldwide. 1 Among the known angiogenic factors, vascular endothelial growth factor (VEGF) is widely accepted as one of the most important regulators in physiological and pathologic angiogenesis. 2 VEGF, a dimeric secreted glycoprotein, is an endothelial cell-specific mitogen, a vascular permeability factor, 3 and a cell survival factor. 4 Results from studies on animal models 5,6 and anti-VEGF treatments for human patients with ocular vascular diseases 7,8 have suggested that VEGF is one of the initiators or inducers of neovascularization in the eye. VEGF expression is elevated in the aqueous and vitreous humors of patients with different angiogenic ocular diseases. 9,10 In addition, angiogenesis is a consequence of the equilibrium between stimulation by VEGF and inhibition by pigment epithelium-derived factor (PEDF). 11,12 In the eye, PEDF downregulates VEGF expression and VEGF-induced vascular changes. 13,14  
AMD, a retinal angiogenic disease associated with VEGF, affects approximately 50 million elderly people worldwide. 15 We previously identified an association of exudative AMD with a single nucleotide polymorphism, rs11200638, in the promoter region of the high-temperature requirement factor A1 (HTRA1) gene. 16 18 HtrA1 belongs to the evolutionarily conserved HtrA family of chymotrypsin-like serine protease, which exhibits temperature-dependent proteolytic and molecular chaperone activities. 19,20 It carries a N-terminal secretory signal peptide, a mac25-like domain, and a C-terminal HtrA (proteolytic and PDZ) domain. 21,22 Human HTRA1 was identified as a differentially expressed gene in SV40-transformed fibroblasts 21 and osteoarthritic cartilage. 22 Downregulation of HTRA1 was detected in 11–63% cancer samples from different tissues. 23,24 In HtrA1-overexpressed cancer cell lines there was enhanced cell apoptosis and reduced cell proliferation. 23,24 In contrast to cancer, upregulation of HtrA1 occurs in placentation, 25 arthritis, 22,26 Alzheimer's disease, 27 and Duchenne muscular dystrophy. 28 HTRA1 mRNA and protein expressions were elevated in the lymphocytes and retinal pigment epithelium (RPE) of AMD patients carrying the risk-associated allele. 17 HtrA1 is also present in drusen, abnormal RPE, and choroidal neovascularization lesion, with elevated expressions in AMD eyes. 17,29 31 HtrA1 also inhibits TGFβ signaling and degrades extracellular matrix proteins. 26,32,33 These findings provide evidence for a contributory role of HtrA1 on AMD pathogenesis. 
HtrA1 and VEGF are independently contributed to AMD. In this study we determined HtrA1, VEGF, and PEDF levels in human vitreous samples and examined HTRA1 and VEGF expressions in cultured human fetal RPE cells under stress conditions, with a view to throwing light on their regulatory relationships. 
Materials and Methods
Study Subjects
Fifty-five unrelated Chinese patients who underwent ocular surgeries at the Prince of Wales Hospital in Hong Kong and the Joint Shantou International Eye Center (JSIEC) of Shantou University and the Chinese University of Hong Kong were recruited and given complete ophthalmoscopic examinations. In all patients, a standard three-port pars plana vitrectomy was performed as a part of the regular surgical procedures. The clinical and demographic information is summarized in Table 1. None of the subjects had received treatment with anti-VEGF agents. The study protocol was approved by the Ethics Committee for Human Research at the Chinese University of Hong Kong and JSIEC and was in accordance with the tenets of the Declaration of Helsinki. Informed consent was obtained from the study subjects after explanation of the nature and possible consequences of the study. 
Table 1.
 
A Summary of Clinical Diagnosis, Gender, and Age of All 55 Unrelated Han Chinese Patients
Table 1.
 
A Summary of Clinical Diagnosis, Gender, and Age of All 55 Unrelated Han Chinese Patients
Patients Number (Percent of Total)
Total 55
Sex
    Male 33 (60.0%)
    Female 22 (40.0%)
Clinical diagnosis*
    Ocular vascular diseases 12 (21.8%)
    Retinal detachment 25 (45.5%)
    Macular hole 8 (14.5%)
    Trauma 7 (12.7%)
    IOL-RO 2 (3.6%)
    ERM 1 (1.8%)
Age in years; mean ± SD 50.8 ± 17
Undiluted vitreous humor samples (0.5–1 mL) were collected into sterile tubes at the time of surgery, and aliquots were rapidly frozen at −80°C until assay. Peripheral venous blood samples (3 mL) were also collected and stored at −80°C before DNA extraction. 
Immunoblotting
Total protein concentrations in the vitreous samples were measured by protein assay (BioRad, Hercules, CA). Equal amount of total protein (10 μg) for each denatured vitreous humor sample was resolved on 12.5% SDS-polyacrylamide gel and electro-transferred to nitrocellulose membranes for sequential probing with the mouse monoclonal antibodies against VEGF (Santa Cruz Biotechnology, Santa Cruz, CA), HtrA1 (R&D Systems, Minneapolis, MN), and PEDF (Millipore, Billerica, MA) in the same blot and secondary antibody against mouse IgG conjugated with horseradish peroxidase (Jackson ImmunoResearch, West Grove, PA). The signals were detected by enhanced chemiluminescence (Amersham Pharmacia, Cleveland, OH), and the band intensities were quantified (Quantity One Image Analysis software, BioRad). Triplicates were performed. The intensities of HtrA1 and VEGF in the same blot were measured and compared directly. Therefore, normalization of a housekeeping protein was not needed. 
HTRA1 rs11200638 Genotyping
The HTRA1 rs11200638 genotypes were determined in all 55 patients by PCR and direct DNA sequencing as previously described. 18  
Cloning of Human HTRA1
A 1440-bp open reading frame of the HTRA1 gene (NM 002775.4; GenBank) was cloned into an empty pcDNA6/myc-His A vector (Invitrogen, Carlsbad, CA) between the BamHI and NotI sites (pHis/myc-HtrA1). The construct was verified by direct sequencing. Expression and proteolytic function of the recombinant human HtrA1 protein were validated by immunoblotting and casein digestion, respectively. 
Cell Culture Experiments
Primary human fetal RPE cells 34 were cultured in Dulbecco's modified Eagle's medium and F-12 nutrient mixture supplemented with 1× penicillin streptomycin (Gibco BRL, Rockville, MD) and 10% heat-inactivated fetal bovine serum (Gibco BRL) at 37°C in a humidified environment containing 5% CO2. Passage 5–10 of human fetal RPE cells was used. Triple experiments were performed. To study cellular stress, confluent human fetal RPE cells were treated with tunicamycin (0.5, 5, and 10 μg/mL; Sigma-Aldrich, St. Louis, MO), dithiothreitol (DTT, 0.1, 1, and 2 mM; Sigma-Aldrich), and Z-Leu-Leu-Leu-H (MG132, 10 μM; Sigma-Aldrich) in serum-free medium for 18 hours. For the VEGF regulatory experiments, confluent human fetal RPE cells were treated with recombinant human VEGF (10 ng/mL; Gibco BRL) in serum-free medium for 24 hours. For the HtrA1 regulatory experiments, 70% confluent human fetal RPE cells were transfected with 3 μg pHis/myc-HtrA1 construct in transfection reagent (Lipofectamine-2000, 9 μL; Invitrogen) and incubated for 24 hours after transfection. Total RNA was collected at each time point with an extraction kit (RNeasy; Qiagen, Hiden, Germany). 
Gene Expression Analysis
The RNA was reverse-transcripted to complementary DNA by reverse transcriptase (SuperScript III; Invitrogen) according to the manufacturer's instructions. The expressions of superoxide dismutase (SOD; stress maker), 35 interleukin-6 (IL6; inflammatory marker), 35 and HTRA1, VEGFA, and PEDF mRNA were analyzed using semiquantitative PCR (Table 2). β-ACTIN was used as a housekeeping gene for normalization. The PCR products were resolved in agarose gel and quantified (Quantity One Image Analysis software; BioRad) for comparison of relative band intensities. 
Table 2.
 
Primers Used for Gene Expression Analysis
Table 2.
 
Primers Used for Gene Expression Analysis
Gene Abbreviation Primer Sequence Tm (°C) Cycles
HTRA1 F: CAAAGCCAAAGAGCTGAAGG 60 28
R: ACCATGTTCAGGGTGCTTTC
VEGFA F: GAGCCTTGCCTTGCTGCTCTA 60 28
R: CACCAGGGTCTCGATTGGAT
PEDF F: CAGTGTGCAGGCTTAGAGGGACTA 60 31
R: AGGGTTCTGGCAGCTGCTGT
β-ACTIN F: CAACGGCTCCGGATGTGC 60 21
R: CTCTTGCTCTGGGCCTCG
Statistical Analysis
The χ2 test was used to calculate the statistical significance among categorical parameters, the Pearson's correlation coefficient to measure linear associations, and the Spearman's rank correlation test to measure the association between rank orders. With reference to reported methods, 23,24,36 the band intensities were categorized into three groups for association analysis: weak (+) expression was defined as the vitreous humor sample distributed lower than the 25 quartile, moderate (++) as the 25–75 quartile, and strong (+++) as higher than the 75 quartile. All analyses were performed using commercially available software 0 (SPSS v. 16; SPSS, Chicago, IL). Significance was defined as P < 0.05. 
Results
Association of HtrA1 with VEGF in Human Vitreous Humors
HtrA1, VEGF, and PEDF were constitutively expressed in all vitreous humor samples as detected by immunoblotting (Fig. 1A). HtrA1 levels were significantly associated with VEGF (Pearson's correlation coefficient test, r = 0.650, P = 7.91 × 10−8; Fig. 1B). However, there was no association for PEDF with VEGF or HtrA1 (Pearson's correlation coefficient test, r = 0.023, P = 0.865 and r = 0.077, P = 0.575, respectively; Figs. 1C and 1D). After categorization of the HtrA1, VEGF, and PEDF expressions into three groups (weak, moderate, and strong) according to a semiquantitative visual assessment of the expression levels, the association between the grouped vitreous humor levels of HtrA1 and VEGF remained significant (χ2 test, P = 9.09 × 10−10; Spearman's rank correlation test, ρ = 0.668, P = 2.55 × 10−8; Table 3). However, the vitreous level of PEDF was still not associated with that of VEGF or HtrA1 (χ2 test, P = 0.765 and 0.607, respectively; Spearman's rank correlation test, ρ = −0.145, P = 0.292, and ρ = −0.110, P = 0.422, respectively). In addition, the vitreous levels of HtrA1, VEGF, and PEDF were not related to gender or age (data not shown). 
Figure 1.
 
Immunoblotting analysis of the vitreous levels of HtrA1, VEGF, and PEDF. Denatured vitreous humor samples, all with 10 μg total protein, were analyzed by immunoblotting with sequential probing of monoclonal antibodies against VEGF, HtrA1, and PEDF in the same blot. The signals were detected by enhanced chemiluminescence and quantified (Quantity One Image Analysis software; BioRad). (A) HtrA1, VEGF, and PEDF expressions were detected in vitreous humor at different intensities (+, weak; ++, moderate; +++, strong). (B) Significant association existed between vitreous levels of HtrA1 and VEGF (Pearson's correlation coefficient test, r = 0.650, P = 7.91 × 10−8). (C) PEDF was not associated with VEGF (r = 0.023, P = 0.865). (D) PEDF was also not associated with HtrA1 (r = 0.077, P = 0.575).
Figure 1.
 
Immunoblotting analysis of the vitreous levels of HtrA1, VEGF, and PEDF. Denatured vitreous humor samples, all with 10 μg total protein, were analyzed by immunoblotting with sequential probing of monoclonal antibodies against VEGF, HtrA1, and PEDF in the same blot. The signals were detected by enhanced chemiluminescence and quantified (Quantity One Image Analysis software; BioRad). (A) HtrA1, VEGF, and PEDF expressions were detected in vitreous humor at different intensities (+, weak; ++, moderate; +++, strong). (B) Significant association existed between vitreous levels of HtrA1 and VEGF (Pearson's correlation coefficient test, r = 0.650, P = 7.91 × 10−8). (C) PEDF was not associated with VEGF (r = 0.023, P = 0.865). (D) PEDF was also not associated with HtrA1 (r = 0.077, P = 0.575).
Table 3.
 
Correlation of Vitreous HtrA1 Levels with Vitreous VEGF Levels in All Patients
Table 3.
 
Correlation of Vitreous HtrA1 Levels with Vitreous VEGF Levels in All Patients
Grouped HtrA1 Level* Grouped VEGF Level* n (Percent of Total Patients)
+ ++ +++
+ 9 (16.4%) 3 (5.5%) 1 (1.8%)
++ 4 (7.3%) 23 (41.8%) 1 (1.8%)
+++ 1 (1.8%) 2 (3.6%) 11 (20.0%)
The 55 patients, from whom we collected vitreous, were categorized into five groups according to the major disease phenotype: ocular vascular diseases, retinal detachment, idiopathic macular hole, and traumatic injury. The samples from patients with unclear diagnosis, that is, epi-retinal membrane (ERM) and intraocular lens reoperation (IOL-RO), were excluded from data analysis (Table 1). Vitreous HtrA1 was positively associated with vitreous VEGF in patients with retinal detachment (Pearson's correlation coefficient test, r = 0.835, P = 2.14 × 10−7) and mildly in patients with ocular vascular diseases (Pearson's correlation coefficient test, r = 0.778, P = 0.003; Figs. 2A and 2B). No association was observed in patients with macular hole or traumatic injuries (Pearson's correlation coefficient test, r = −0.390, P = 0.340 and r = 0.706, P = 0.077, respectively; Figs. 2C and 2D). In addition, the HTRA1 rs11200638 genotypes were not associated with vitreous HtrA1 levels in all patients (χ2 test; P = 0.529; Spearman's rank correlation test, ρ = 0.129, P = 0.368; Table 4) or in patients of each disease group, even after age-adjustment (data not shown). 
Figure 2.
 
Correlation of the vitreous HtrA1 and VEGF levels in patients of different clinical diagnosis. The clinical diagnosis was categorized into five groups: vascular diseases, retinal detachment, idiopathic macular hole, and traumatic injury. The samples from patients with unclear diagnosis, ERM and IOL-RO, were excluded. Vitreous HtrA1 levels were associated with vitreous VEGF levels (A) significantly in retinal detachment (Pearson's correlation coefficient test, r = 0.835, P = 2.14 × 10−7) and (B) mildly in vascular diseases (r = 0.778, P = 0.003). No association was observed in (C) macular hole (r = −0.390, P = 0.340) and (D) traumatic injuries (r = 0.706, P = 0.077).
Figure 2.
 
Correlation of the vitreous HtrA1 and VEGF levels in patients of different clinical diagnosis. The clinical diagnosis was categorized into five groups: vascular diseases, retinal detachment, idiopathic macular hole, and traumatic injury. The samples from patients with unclear diagnosis, ERM and IOL-RO, were excluded. Vitreous HtrA1 levels were associated with vitreous VEGF levels (A) significantly in retinal detachment (Pearson's correlation coefficient test, r = 0.835, P = 2.14 × 10−7) and (B) mildly in vascular diseases (r = 0.778, P = 0.003). No association was observed in (C) macular hole (r = −0.390, P = 0.340) and (D) traumatic injuries (r = 0.706, P = 0.077).
Table 4.
 
Correlation of Vitreous HtrA1 Levels with HTRA1 rs11200638 Genotypes
Table 4.
 
Correlation of Vitreous HtrA1 Levels with HTRA1 rs11200638 Genotypes
Grouped HtrA1 Level* rs11200638 Genotype n (Percent of Total Patients)
GG GA AA
+ 4 (7.8%) 8 (15.7%) 1 (2.0%)
++ 4 (7.8%) 14 (27.5%) 8 (15.8%)
+++ 3 (5.9%) 6 (11.8%) 3 (5.9%)
Association of HtrA1 with VEGF in Human Fetal RPE Cells
Association of endogenous HTRA1 and VEGFA was detected in human fetal RPE cells in culture under stress conditions. All the chemical-treated cells showed stress response, as indicated by the upregulation of SOD (Fig. 3). Moreover, inflammatory response (IL6 upregulation) was also induced in cells treated with tunicamycin and DTT (Fig. 3). HTRA1 and VEGFA expressions were simultaneously upregulated in human fetal RPE cells treated by tunicamycin or DTT in a dose-dependent manner (Fig. 4). Downregulation of HTRA1 and VEGFA expressions was found after MG132 treatment, suggesting that MG132 might override cell stress and regulate their gene expressions. Furthermore, no differential expression of HTRA1 and VEGFA was detected in the overexpression experiments or exogenous treatments (Fig. 5). HtrA1-transfected cells showed sevenfold elevation in HTRA1 expression but similar VEGFA and PEDF expressions when compared to the empty vector control (Figs. 5A and 5B). HTRA1 and VEGFA expressions in VEGF-treated cells were not different from that in control (Figs. 5C and 5D). The results suggested that HtrA1 and VEGF did not directly regulate each other. 
Figure 3.
 
SOD and IL6 expression analysis in stress-induced human fetal RPE cells. Confluent human fetal RPE cells were treated with tunicamycin (0.5, 5, and 10 μg/mL), DTT (0.1, 1, and 2 mM), or MG132 (10 μM) for 18 hours. Total RNA was collected and reverse-transcribed. (A) The gene expression levels of SOD, IL6, and β-ACTIN were analyzed by semiquantitative PCR. (B) Both SOD (solid line) and IL6 (dotted line) were upregulated in 10 μg/mL tunicamycin. (C) Both SOD and IL6 were upregulated in 2 mM DTT. (D) Only SOD was regulated in MG132. White bar: gene expressions in control; black bar: gene expressions after MG132 treatment.
Figure 3.
 
SOD and IL6 expression analysis in stress-induced human fetal RPE cells. Confluent human fetal RPE cells were treated with tunicamycin (0.5, 5, and 10 μg/mL), DTT (0.1, 1, and 2 mM), or MG132 (10 μM) for 18 hours. Total RNA was collected and reverse-transcribed. (A) The gene expression levels of SOD, IL6, and β-ACTIN were analyzed by semiquantitative PCR. (B) Both SOD (solid line) and IL6 (dotted line) were upregulated in 10 μg/mL tunicamycin. (C) Both SOD and IL6 were upregulated in 2 mM DTT. (D) Only SOD was regulated in MG132. White bar: gene expressions in control; black bar: gene expressions after MG132 treatment.
Figure 4.
 
HTRA1 and VEGFA expression analysis in stress-induced human fetal RPE cells. (A) Gene expression levels of HTRA1, VEGFA, PEDF, and β-ACTIN were analyzed by semiquantitative PCR. The HTRA1 (solid line) and VEGFA (dotted line) expressions showed a dose-dependent increase in (B) 0.5–10 μg/mL tunicamycin and (C) 0.1–2 mM DTT treatments. (D) HTRA1 and VEGFA expressions were reduced in the cells treated with 10 μM MG132. White bar: gene expressions in control; black bar: gene expressions after MG132 treatment.
Figure 4.
 
HTRA1 and VEGFA expression analysis in stress-induced human fetal RPE cells. (A) Gene expression levels of HTRA1, VEGFA, PEDF, and β-ACTIN were analyzed by semiquantitative PCR. The HTRA1 (solid line) and VEGFA (dotted line) expressions showed a dose-dependent increase in (B) 0.5–10 μg/mL tunicamycin and (C) 0.1–2 mM DTT treatments. (D) HTRA1 and VEGFA expressions were reduced in the cells treated with 10 μM MG132. White bar: gene expressions in control; black bar: gene expressions after MG132 treatment.
Figure 5.
 
Gene expression study of HtrA1-transfected and VEGF-treated human fetal RPE cells. Human fetal RPE cells were transfected with pHis/myc-HtrA1 or treated with 10 ng/mL recombinant human VEGF for 24 hours. Total RNA was collected and reverse-transcribed. The expressions of HTRA1, VEGFA, PEDF, and β-ACTIN were analyzed by semiquantitative PCR. HtrA1-transfected cells showed sevenfold elevated HTRA1 expression, but similar VEGFA and PEDF expressions, compared to the empty vector control (A, B). The expressions of HTRA1, VEGFA, and PEDF in VEGF-treated cells were not different from that in untreated control (C, D). (B, D) White bar: gene expressions for empty vector control or untreated control; black bar: gene expressions for HtrA1-transfected or VEGF-treated cells.
Figure 5.
 
Gene expression study of HtrA1-transfected and VEGF-treated human fetal RPE cells. Human fetal RPE cells were transfected with pHis/myc-HtrA1 or treated with 10 ng/mL recombinant human VEGF for 24 hours. Total RNA was collected and reverse-transcribed. The expressions of HTRA1, VEGFA, PEDF, and β-ACTIN were analyzed by semiquantitative PCR. HtrA1-transfected cells showed sevenfold elevated HTRA1 expression, but similar VEGFA and PEDF expressions, compared to the empty vector control (A, B). The expressions of HTRA1, VEGFA, and PEDF in VEGF-treated cells were not different from that in untreated control (C, D). (B, D) White bar: gene expressions for empty vector control or untreated control; black bar: gene expressions for HtrA1-transfected or VEGF-treated cells.
Discussion
We speculated that expression of HTRA1, an AMD-associated gene, 16 18 could be associated with that of VEGF, which is the main factor of ocular angiogenesis. We have detected, for the first time, an association of HtrA1 and VEGF levels in human vitreous humor (Fig. 1), suggesting that they have correlated biological functions, especially in ocular diseases. 
The association of HtrA1 and VEGF vitreous levels in retinal detachment (Fig. 2) might be related to inflammatory and stress responses. 37 39 HtrA1 is associated with geographic atrophy 29 and drusen, 30,31 and is upregulated in response to estrogen-induced oxidative stress. 40 We also found that human fetal RPE cells responded to chemical-induced stress by simultaneous upregulations of HTRA1 and VEGFA after treatments with tunicamycin and DTT (Figs. 4B and 4C). Although HtrA1 and VEGF might not be directly regulated by each other (Fig. 5), cellular stress could be a common and indirect regulatory pathway for HtrA1 and VEGF, substantiating the proposition that cellular stress could be a pathologic condition in AMD. 41,42  
Notably, in the presence of another stress inducer, MG132, 43,44 HTRA1 and VEGFA were both downregulated (Fig. 4D). This suggested that MG132 might override the effect of cellular stress to regulate HtrA1 and VEGF. Proteasome is the direct inhibitory target of MG132, 45 which in turn inhibits a wide range of signaling pathways, including NFκB. We therefore propose that HtrA1, together with VEGF, could be regulated by the NFκB-dependent pathway, because human papillomavirus–type 16 E7 protein enhances NFκB activity 46 and transcriptionally upregulates HTRA1. 47 Moreover, TGFβ2-induced VEGF expression is completely abrogated by the inhibitor of NFκB. 48 In addition, NFκB induces the expression of genes involved in chronic and acute inflammatory responses, 49 which concurred with the association of both HtrA1 and VEGF with inflammation. 38,50 Further studies should be conducted to validate this hypothesis. 
Unlike the previous studies, 16,17 we found no association between vitreous HtrA1 levels and rs11200638 genotypes (Table 4). It is likely that other factors regulating HtrA1 expression might counteract with the effect of rs11200638 genotype on HtrA1 expression. Indeed, HTRA1 levels had been reported not having an association with rs11200638 genotypes. 51,52  
HtrA1 negatively regulates the availability of TGFβ family through binding to its family members 32,53 and inhibits TGFβ-induced matrix synthesis in chondrocytes. 54 However, the direct role of HtrA1 in angiogenic or inflammatory conditions is unclear. It is possible that HtrA1 regulates the complement pathway and amyloid deposition by cleaving the RPE-secreted proteins. 55 In addition, the fragmented fibronectin product of the potential HtrA1 extracellular matrix substrate would induce the release of cytokines. 56 Nevertheless, the results of this study showed a reduction of HtrA1 and VEGF expressions induced by MG132, suggesting a possible therapeutic strategy against inflammatory diseases, such as AMD. 45  
In summary, our results reveal an association between HtrA1 and VEGF in human vitreous humors and RPE cells. They are both related to stress and inflammatory conditions. 
Footnotes
 Supported in part by a block grant of the University Grants Committee Hong Kong and the Endowment Fund for Lim Por-Yen Eye Genetics Research Centre, Hong Kong.
Footnotes
 Disclosure: T.K. Ng, None; G.H.F. Yam, None; W.Q. Chen, None; V.Y.W. Lee, None; H. Chen, None; L.J. Chen, None; K.W. Choy, None; Z. Yang, None; C.P. Pang, None
The authors thank all participants in the study, Chi Lai Li for the assistance in the collection of vitreous humor samples at PWH, Jing He for assistance in the VEGF experiments, and Yuqian Zheng and Weitao Lin for sample and data collection in Shantou. 
References
Wegewitz U Gohring I Spranger J . Novel approaches in the treatment of angiogenic eye disease. Curr Pharm Des. 2005;11:2311–2330. [CrossRef] [PubMed]
Ferrara N . Role of vascular endothelial growth factor in physiologic and pathologic angiogenesis: therapeutic implications. Semin Oncol. 2002;29:10–14. [CrossRef] [PubMed]
Keck PJ Hauser SD Krivi G . Vascular permeability factor, an endothelial cell mitogen related to PDGF. Science. 1989;246:1309–1312. [CrossRef] [PubMed]
Nishijima K Ng YS Zhong L . Vascular endothelial growth factor-A is a survival factor for retinal neurons and a critical neuroprotectant during the adaptive response to ischemic injury. Am J Pathol. 2007;171:53–67. [CrossRef] [PubMed]
Baffi J Byrnes G Chan CC Csaky KG . Choroidal neovascularization in the rat induced by adenovirus mediated expression of vascular endothelial growth factor. Invest Ophthalmol Vis Sci. 2000;41:3582–3589. [PubMed]
Spilsbury K Garrett KL Shen WY Constable IJ Rakoczy PE . Overexpression of vascular endothelial growth factor (VEGF) in the retinal pigment epithelium leads to the development of choroidal neovascularization. Am J Pathol. 2000;157:135–144. [CrossRef] [PubMed]
Eyetech Study Group. Anti-vascular endothelial growth factor therapy for subfoveal choroidal neovascularization secondary to age-related macular degeneration: phase II study results. Ophthalmology. 2003;110:979–986. [CrossRef] [PubMed]
Chan WM Lai TY Chan KP . Changes in aqeous vascular endothelial growth factor and pigment epithelial-derived factor levels following intravitreal bevacizumab injections for choroidal neovascularization secondary to age-related macular degeneration or pathologic myopia. Retina. 2008;28:1308–1313. [CrossRef] [PubMed]
Tong JP Chan WM Liu DT . Aqueous humor levels of vascular endothelial growth factor and pigment epithelium-derived factor in polypoidal choroidal vasculopathy and choroidal neovascularization. Am J Ophthalmol. 2006;141:456–462. [CrossRef] [PubMed]
Wang X Wang G Wang Y . Intravitreous vascular endothelial growth factor and hypoxia-inducible factor 1a in patients with proliferative diabetic retinopathy. Am J Ophthalmol. 2009;148:883–889. [CrossRef] [PubMed]
Folkman J . Angiogenesis in cancer, vascular, rheumatoid, and other diseases. Nat Med. 1995;1:27–31. [CrossRef] [PubMed]
Ohno-Matsui K Morita I Tombran-Tink J . Novel mechanism for age-related macular degeneration: an equilibrium shift between the angiogenesis factors VEGF and PEDF. J Cell Physiol. 2001;189:323–333. [CrossRef] [PubMed]
Zhang SX Wang JJ Gao G Parke K Ma JX . Pigment epithelium-derived factor downregulates vascular endothelial growth factor (VEGF) expression and inhibits VEGF-VEGF receptor 2 binding in diabetic retinopathy. J Mol Endocrinol. 2006;37:1–12. [CrossRef] [PubMed]
Tong JP Lam DS Chan WM Choy KW Chan KP Pang CP . Effects of triamcinolone on the expression of VEGF and PEDF in human retinal pigment epithelial and human umbilical vein endothelial cells. Mol Vis. 2006;12:1490–1495. [PubMed]
Klein R Peto T Bird A Vannewkirk MR . The epidemiology of age-related macular degeneration. Am J Ophthalmol. 2004;137:486–495. [CrossRef] [PubMed]
Dewan A Liu M Hartman S . HTRA1 promoter polymorphism in wet age-related macular degeneration. Science. 2006;314:989–992. [CrossRef] [PubMed]
Yang Z Camp NJ Sun H . A variant of the HTRA1 gene increases susceptibility to age-related macular degeneration. Science. 2006;314:992–993. [CrossRef] [PubMed]
Tam PO Ng TK Liu DT . HTRA1 variants in exudative age-related macular degeneration and interactions with smoking and CFH. Invest Ophthalmol Vis Sci. 2008;49:2357–2365. [CrossRef] [PubMed]
Spiess C Beil A Ehrmann M . A temperature-dependent switch from chaperone to protease in a widely conserved heat shock protein. Cell. 1999;97:229–347. [CrossRef]
Clausen T Southan C Ehrmann M . The HtrA family of proteases. Implication for protein composition and cell fate. Mol Cell. 2002;10:443–455. [CrossRef] [PubMed]
Zumbrunn J Trueb B . Primary structure of a putative serine protease specific for IGF-binding proteins. FEBS Lett. 1996;398:187–192. [CrossRef] [PubMed]
Hu SI Carozza M Klein M Nantermet P Luk D Crowl RM . Human HtrA, an evolutionary conserved serine protease identified as a differentially expressed gene product in osteoarthritic cartilage. J Biol Chem. 1998;273:34406–34412. [CrossRef] [PubMed]
Baldi A De Luca A Morini M . The HtrA1 serine protease is down-regulated during human melanoma progression and represses growth of metastatic melanoma cells. Oncogene. 2002;21:6684–6688. [CrossRef] [PubMed]
Chien J Staub J Hu SI . A candidate tumor suppressor HtrA1 is downregulated in ovarian cancer. Oncogene. 2004;23:1636–1644. [CrossRef] [PubMed]
De Luca A De Falco M Fedele V . The serine protease HtrA1 is upregulated in the human placenta during pregnancy. J Histochem Cytochem. 2004;52:885–892. [CrossRef] [PubMed]
Grau S Richards PJ Kerr B . The role of human HtrA1 in arthritic disease. J Biol Chem. 2006;281:6124–6129. [CrossRef] [PubMed]
Grau S Baldi A Bussani R . Implications of the serine protease HtrA1 in amyloid precursor protein processing. Proc Natl Acad Sci U S A. 2005;102:6021–6026. [CrossRef] [PubMed]
Bakay M Zhao P Chen J Hoffman EP . A web-accessible complete transcriptome of normal human and DMD muscle. Neuromuscul Disord. 2002;12:S125–141. [CrossRef] [PubMed]
Cameron DJ Yang Z Gibbs D . HTRA1 variant confers similar risks to geographic atrophy and neovascular age-related macular degeneration. Cell Cycle. 2007;6:1122–1125. [CrossRef] [PubMed]
Chan CC Shen D Zhou M . Human HtrA1 in the archived eyes with age-related macular degeneration. Trans Am Ophthalmol Soc. 2007;105:92–97. [PubMed]
Tuo J Ross RJ Reed GF . The HtrA1 promoter polymorphism, smoking, and age-related macular degeneration in multiple case-control samples. Ophthalmology. 2008;115:1891–1898. [CrossRef] [PubMed]
Oka C Tsujimoto R Kajikawa M . HtrA1 serine protease inhibits signaling mediated by Tgfbeta family proteins. Development. 2004;131:1041–1053. [CrossRef] [PubMed]
Launay S Maubert E Lebeurrier N . HtrA1-dependent proteolysis of TGF-beta controls both neuronal maturation and developmental survival. Cell Death Differ. 2008;15:1408–1416. [CrossRef] [PubMed]
Choy KW Wang CC Ogura A . Genomic annotation of 15,809 ESTs identified from pooled early gestation human eyes. Physiol Genomics. 2006;25:9–15. [CrossRef] [PubMed]
Gong B Zhang LY Lam DS Pang CP Yam GH . Sodium 4-phenylbutyrate ameliorates the effects of cataract-causing mutant gammaD-crystallin in cultured cells. Mol Vis. 2010;16:997–1003. [PubMed]
De Luca A De Falco M Severino A . Distribution of the serine protease HtrA1 in normal human tissues. J Histochem Cytochem. 2003;51:1279–1284. [CrossRef] [PubMed]
Anderson DH Mullins RF Hageman GS Johnson LV . A role for local inflammation in the formation of drusen in the aging eye. Am J Ophthalmol. 2002;134:411–431. [CrossRef] [PubMed]
Hollborn M Francke M Iandiev I . Early activation of inflammation- and immune response-related genes after experimental detachment of the porcine retina. Invest Ophthalmol Vis Sci. 2008;49:1262–1273. [CrossRef] [PubMed]
Zacks DN Han Y Zeng Y Swaroop A . Activation of signaling pathways and stress-response genes in an experimental model of retinal detachment. Invest Ophthalmol Vis Sci. 2006;47:1691–1695. [CrossRef] [PubMed]
Zurawa-Janicka D Kobiela J Stefaniak T . Changes in expression of serine proteases HtrA1 and HtrA2 during estrogen-induced oxidative stress and nephrocarciogenesis in male Syrian hamster. Acta Biochim Pol. 2008;55:9–19. [PubMed]
Libby RT Gould DB . Endoplasmic reticulum stress as a primary pathogenic mechanism leading to age-related macular degeneration. Adv Exp Med Biol. 2010;664:403–409. [PubMed]
Sauer T Patel M Chan CC Tuo J . Unfolding the therapeutic potential of chemical chaperones for age-related macular degeneration. Expert Rev Ophthalmol. 2008;3:29–42. [CrossRef] [PubMed]
Lee AH Iwakoshi NN Anderson KC Glimcher LH . Proteasome inhibitors disrupt the unfolded protein response in myeloma cells. Proc Natl Acad Sci U S A. 2003;100:9946–9951. [CrossRef] [PubMed]
Sridevi P Alexander H Laviad EL . Stress-induced ER to Golgi translocation of ceramide synthase 1 is dependent on proteasomal processing. Exp Cell Res. 2010;316:78–91. [CrossRef] [PubMed]
Lee DH Goldberg AL . Proteasome inhibitors: valuable new tools for cell biologists. Trends Cell Biol. 1998;8:397–403. [CrossRef] [PubMed]
Eichten A Rud DS Grace M Piboonniyom S Zacny V Munger K . Molecular pathways executing the trophic sentinel response in HPV-16 E7-expressing normal human diploid fibroblasts upon growth factor deprivation. Virology. 2004;319:81–93. [CrossRef] [PubMed]
Clawson GA Bui V Xin P Wang N Pan W . Intracellular localization of the tumor suppressor HtrA1/Prss11 and its association with HPV16 E6 and E7 proteins. J Cell Biochem. 2008;105:81–88. [CrossRef] [PubMed]
Bian ZM Elner SG Elner VM . Regulation of VEGF mRNA expression and protein secretion by TGF-beta2 in human retinal pigment epithelial cells. Exp Eye Res. 2007;84:812–822. [CrossRef] [PubMed]
Barnes PJ Karin M . Nuclear factor-κB: a pivotal transcription factor in chronic inflammatory diseases. N Engl J Med. 1997;336:1066–1071. [CrossRef] [PubMed]
Bressler SB . Introduction: understanding the role of angiogenesis and antiangiogenic agents in age-related macular degeneration. Ophthalmology. 2009;116:S1–7. [CrossRef] [PubMed]
Chowers I Meir T Lederman M . Sequence variants in HTRA1 and LOC387715/ARMS2 and phenotype and response to photodynamic therapy in neovascular age-related macular degeneration in populations from Israel. Mol Vis. 2008;14:2263–2271. [PubMed]
Kanda A Stambolian D Chen W Curcio CA Abecasis GR Swaroop A . Age-related macular degeneration-associated variants at chromosome 10q26 do not significantly alter ARMS2 and HTRA1 transcript levels in the human retina. Mol Vis. 2010;16:1317–1323. [PubMed]
Tsuchiya A Yano M Tocharus J . Expression of mouse HtrA1 serine protease in normal bone and cartilage and its upregulation in joint cartilage damaged by experimental arthritis. Bone. 2005;37:323–336. [CrossRef] [PubMed]
Wu J Liu W Bemis A . Comparative proteomic characterization of articular cartilage tissue from normal donors andpatients with osteoarthritis. Arthritis Rheum. 2007;56:3675–3684. [CrossRef] [PubMed]
An E Sen S Park SK Gordiah-Dressman H Hathout Y . Identification of novel substrates for the serine protease HTRA1 in the human RPE secretome. Invest Ophthalmol Vis Sci. 2010;51:3379–3386. [CrossRef] [PubMed]
Austin BA Liu B Li Z Nussenblatt RB . Biologically active fibronectin fragments stimulate release of MCP-1 and catabolic cytokines from murine retinal pigment epithelium. Invest Ophthalmol Vis Sci. 2009;50:2896–2902. [CrossRef] [PubMed]
Figure 1.
 
Immunoblotting analysis of the vitreous levels of HtrA1, VEGF, and PEDF. Denatured vitreous humor samples, all with 10 μg total protein, were analyzed by immunoblotting with sequential probing of monoclonal antibodies against VEGF, HtrA1, and PEDF in the same blot. The signals were detected by enhanced chemiluminescence and quantified (Quantity One Image Analysis software; BioRad). (A) HtrA1, VEGF, and PEDF expressions were detected in vitreous humor at different intensities (+, weak; ++, moderate; +++, strong). (B) Significant association existed between vitreous levels of HtrA1 and VEGF (Pearson's correlation coefficient test, r = 0.650, P = 7.91 × 10−8). (C) PEDF was not associated with VEGF (r = 0.023, P = 0.865). (D) PEDF was also not associated with HtrA1 (r = 0.077, P = 0.575).
Figure 1.
 
Immunoblotting analysis of the vitreous levels of HtrA1, VEGF, and PEDF. Denatured vitreous humor samples, all with 10 μg total protein, were analyzed by immunoblotting with sequential probing of monoclonal antibodies against VEGF, HtrA1, and PEDF in the same blot. The signals were detected by enhanced chemiluminescence and quantified (Quantity One Image Analysis software; BioRad). (A) HtrA1, VEGF, and PEDF expressions were detected in vitreous humor at different intensities (+, weak; ++, moderate; +++, strong). (B) Significant association existed between vitreous levels of HtrA1 and VEGF (Pearson's correlation coefficient test, r = 0.650, P = 7.91 × 10−8). (C) PEDF was not associated with VEGF (r = 0.023, P = 0.865). (D) PEDF was also not associated with HtrA1 (r = 0.077, P = 0.575).
Figure 2.
 
Correlation of the vitreous HtrA1 and VEGF levels in patients of different clinical diagnosis. The clinical diagnosis was categorized into five groups: vascular diseases, retinal detachment, idiopathic macular hole, and traumatic injury. The samples from patients with unclear diagnosis, ERM and IOL-RO, were excluded. Vitreous HtrA1 levels were associated with vitreous VEGF levels (A) significantly in retinal detachment (Pearson's correlation coefficient test, r = 0.835, P = 2.14 × 10−7) and (B) mildly in vascular diseases (r = 0.778, P = 0.003). No association was observed in (C) macular hole (r = −0.390, P = 0.340) and (D) traumatic injuries (r = 0.706, P = 0.077).
Figure 2.
 
Correlation of the vitreous HtrA1 and VEGF levels in patients of different clinical diagnosis. The clinical diagnosis was categorized into five groups: vascular diseases, retinal detachment, idiopathic macular hole, and traumatic injury. The samples from patients with unclear diagnosis, ERM and IOL-RO, were excluded. Vitreous HtrA1 levels were associated with vitreous VEGF levels (A) significantly in retinal detachment (Pearson's correlation coefficient test, r = 0.835, P = 2.14 × 10−7) and (B) mildly in vascular diseases (r = 0.778, P = 0.003). No association was observed in (C) macular hole (r = −0.390, P = 0.340) and (D) traumatic injuries (r = 0.706, P = 0.077).
Figure 3.
 
SOD and IL6 expression analysis in stress-induced human fetal RPE cells. Confluent human fetal RPE cells were treated with tunicamycin (0.5, 5, and 10 μg/mL), DTT (0.1, 1, and 2 mM), or MG132 (10 μM) for 18 hours. Total RNA was collected and reverse-transcribed. (A) The gene expression levels of SOD, IL6, and β-ACTIN were analyzed by semiquantitative PCR. (B) Both SOD (solid line) and IL6 (dotted line) were upregulated in 10 μg/mL tunicamycin. (C) Both SOD and IL6 were upregulated in 2 mM DTT. (D) Only SOD was regulated in MG132. White bar: gene expressions in control; black bar: gene expressions after MG132 treatment.
Figure 3.
 
SOD and IL6 expression analysis in stress-induced human fetal RPE cells. Confluent human fetal RPE cells were treated with tunicamycin (0.5, 5, and 10 μg/mL), DTT (0.1, 1, and 2 mM), or MG132 (10 μM) for 18 hours. Total RNA was collected and reverse-transcribed. (A) The gene expression levels of SOD, IL6, and β-ACTIN were analyzed by semiquantitative PCR. (B) Both SOD (solid line) and IL6 (dotted line) were upregulated in 10 μg/mL tunicamycin. (C) Both SOD and IL6 were upregulated in 2 mM DTT. (D) Only SOD was regulated in MG132. White bar: gene expressions in control; black bar: gene expressions after MG132 treatment.
Figure 4.
 
HTRA1 and VEGFA expression analysis in stress-induced human fetal RPE cells. (A) Gene expression levels of HTRA1, VEGFA, PEDF, and β-ACTIN were analyzed by semiquantitative PCR. The HTRA1 (solid line) and VEGFA (dotted line) expressions showed a dose-dependent increase in (B) 0.5–10 μg/mL tunicamycin and (C) 0.1–2 mM DTT treatments. (D) HTRA1 and VEGFA expressions were reduced in the cells treated with 10 μM MG132. White bar: gene expressions in control; black bar: gene expressions after MG132 treatment.
Figure 4.
 
HTRA1 and VEGFA expression analysis in stress-induced human fetal RPE cells. (A) Gene expression levels of HTRA1, VEGFA, PEDF, and β-ACTIN were analyzed by semiquantitative PCR. The HTRA1 (solid line) and VEGFA (dotted line) expressions showed a dose-dependent increase in (B) 0.5–10 μg/mL tunicamycin and (C) 0.1–2 mM DTT treatments. (D) HTRA1 and VEGFA expressions were reduced in the cells treated with 10 μM MG132. White bar: gene expressions in control; black bar: gene expressions after MG132 treatment.
Figure 5.
 
Gene expression study of HtrA1-transfected and VEGF-treated human fetal RPE cells. Human fetal RPE cells were transfected with pHis/myc-HtrA1 or treated with 10 ng/mL recombinant human VEGF for 24 hours. Total RNA was collected and reverse-transcribed. The expressions of HTRA1, VEGFA, PEDF, and β-ACTIN were analyzed by semiquantitative PCR. HtrA1-transfected cells showed sevenfold elevated HTRA1 expression, but similar VEGFA and PEDF expressions, compared to the empty vector control (A, B). The expressions of HTRA1, VEGFA, and PEDF in VEGF-treated cells were not different from that in untreated control (C, D). (B, D) White bar: gene expressions for empty vector control or untreated control; black bar: gene expressions for HtrA1-transfected or VEGF-treated cells.
Figure 5.
 
Gene expression study of HtrA1-transfected and VEGF-treated human fetal RPE cells. Human fetal RPE cells were transfected with pHis/myc-HtrA1 or treated with 10 ng/mL recombinant human VEGF for 24 hours. Total RNA was collected and reverse-transcribed. The expressions of HTRA1, VEGFA, PEDF, and β-ACTIN were analyzed by semiquantitative PCR. HtrA1-transfected cells showed sevenfold elevated HTRA1 expression, but similar VEGFA and PEDF expressions, compared to the empty vector control (A, B). The expressions of HTRA1, VEGFA, and PEDF in VEGF-treated cells were not different from that in untreated control (C, D). (B, D) White bar: gene expressions for empty vector control or untreated control; black bar: gene expressions for HtrA1-transfected or VEGF-treated cells.
Table 1.
 
A Summary of Clinical Diagnosis, Gender, and Age of All 55 Unrelated Han Chinese Patients
Table 1.
 
A Summary of Clinical Diagnosis, Gender, and Age of All 55 Unrelated Han Chinese Patients
Patients Number (Percent of Total)
Total 55
Sex
    Male 33 (60.0%)
    Female 22 (40.0%)
Clinical diagnosis*
    Ocular vascular diseases 12 (21.8%)
    Retinal detachment 25 (45.5%)
    Macular hole 8 (14.5%)
    Trauma 7 (12.7%)
    IOL-RO 2 (3.6%)
    ERM 1 (1.8%)
Age in years; mean ± SD 50.8 ± 17
Table 2.
 
Primers Used for Gene Expression Analysis
Table 2.
 
Primers Used for Gene Expression Analysis
Gene Abbreviation Primer Sequence Tm (°C) Cycles
HTRA1 F: CAAAGCCAAAGAGCTGAAGG 60 28
R: ACCATGTTCAGGGTGCTTTC
VEGFA F: GAGCCTTGCCTTGCTGCTCTA 60 28
R: CACCAGGGTCTCGATTGGAT
PEDF F: CAGTGTGCAGGCTTAGAGGGACTA 60 31
R: AGGGTTCTGGCAGCTGCTGT
β-ACTIN F: CAACGGCTCCGGATGTGC 60 21
R: CTCTTGCTCTGGGCCTCG
Table 3.
 
Correlation of Vitreous HtrA1 Levels with Vitreous VEGF Levels in All Patients
Table 3.
 
Correlation of Vitreous HtrA1 Levels with Vitreous VEGF Levels in All Patients
Grouped HtrA1 Level* Grouped VEGF Level* n (Percent of Total Patients)
+ ++ +++
+ 9 (16.4%) 3 (5.5%) 1 (1.8%)
++ 4 (7.3%) 23 (41.8%) 1 (1.8%)
+++ 1 (1.8%) 2 (3.6%) 11 (20.0%)
Table 4.
 
Correlation of Vitreous HtrA1 Levels with HTRA1 rs11200638 Genotypes
Table 4.
 
Correlation of Vitreous HtrA1 Levels with HTRA1 rs11200638 Genotypes
Grouped HtrA1 Level* rs11200638 Genotype n (Percent of Total Patients)
GG GA AA
+ 4 (7.8%) 8 (15.7%) 1 (2.0%)
++ 4 (7.8%) 14 (27.5%) 8 (15.8%)
+++ 3 (5.9%) 6 (11.8%) 3 (5.9%)
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×