Free
Retinal Cell Biology  |   March 2013
Differential Gene Expression Profiling after Conditional Müller-Cell Ablation in a Novel Transgenic Model
Author Affiliations & Notes
  • Sook Hyun Chung
    From the Macular Research Group, Department of Clinical Ophthalmology and Eye Health, Save Sight Institute, The University of Sydney, Sydney, Australia; the
  • Weiyong Shen
    From the Macular Research Group, Department of Clinical Ophthalmology and Eye Health, Save Sight Institute, The University of Sydney, Sydney, Australia; the
  • Kaushala Jayawardana
    School of Mathematics and Statistics, The University of Sydney, Sydney, Australia; and the
  • Penghao Wang
    School of Mathematics and Statistics, The University of Sydney, Sydney, Australia; and the
  • Jean Yang
    School of Mathematics and Statistics, The University of Sydney, Sydney, Australia; and the
  • Nick Shackel
    Centenary Institute, The University of Sydney, Sydney, Australia.
  • Mark C. Gillies
    From the Macular Research Group, Department of Clinical Ophthalmology and Eye Health, Save Sight Institute, The University of Sydney, Sydney, Australia; the
  • Corresponding author: Sook Hyun Chung, Macular Research Group, Department of Clinical Ophthalmology, Save Sight Institute, The University of Sydney, 8 Macquarie Street, Sydney, NSW 2000, Australia; sook.chung@sydney.edu.au
Investigative Ophthalmology & Visual Science March 2013, Vol.54, 2142-2152. doi:10.1167/iovs.12-11559
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Sook Hyun Chung, Weiyong Shen, Kaushala Jayawardana, Penghao Wang, Jean Yang, Nick Shackel, Mark C. Gillies; Differential Gene Expression Profiling after Conditional Müller-Cell Ablation in a Novel Transgenic Model. Invest. Ophthalmol. Vis. Sci. 2013;54(3):2142-2152. doi: 10.1167/iovs.12-11559.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

Purpose.: Müller cells, the principal glial cells in the mammalian retina, play an important role in the maintenance of retinal homeostasis. Recent reports suggest that Müller-cell dysfunction may contribute to the pathogenesis of retinal diseases such as idiopathic macular telangiectasia type 2. In the present study, we used microarray to compare retinae isolated from transgenic mice in which the Müller cells of adult mice retinae can be selectively ablated with control mice.

Methods.: Retinae were isolated 1 week, 1 month, and 3 months after tamoxifen-induced selective Müller-cell ablation and microarray were performed with Affymatrix microarrays. Differentially expressed (DE) genes, temporal trends of DE genes, and pathway analysis were conducted. Quantitative real-time polymerase chain reaction (qRT-PCR) was performed to validate the results.

Results.: Strong upregulation of mRNA of proteins involved in gliosis, apoptosis, and neurotrophism was found 1 week after ablation and their related pathways such as the apoptotic and Jak/Stat pathways were identified. Three months after induced Müller-cell ablation, Müller-cell metabolic pathways and vasculopathy-related pathways such as genes involved in glycolysis and tight junctions were downregulated. qRT-PCR analysis showed consistent expression trends of selected genes.

Conclusions.: The results were generally consistent with the previous morphologic findings in this model, in which photoreceptor degeneration soon after Müller-cell ablation, accompanied by blood–retinal barrier breakdown and subsequent retinal neovascularization were reported. These results are consistent with a significant contribution of Müller-cell dysfunction on retinal neuronal injury and vascular pathology at the mRNA level.

Introduction
Müller cells are the principal glial cells of the mammalian retina. They provide metabolic support and nutrition to neurons, 1 release neuroactive substances through neurotransmitter recycling systems, 2 release vasoactive substances such as vascular endothelial growth factor (VEGF) and pigment epithelium derived factor (PEDF), 3,4 maintain the blood–retina barrier (BRB), 5 and regulate ion and water content and pH of the retina. 6 Since these functions are essential for retinal homeostasis, dysfunction of Müller cells may play a role in the pathogenesis of retinal diseases. 
Abnormality of Müller cells has been linked to some retinal diseases such as idiopathic macular telangiectasia type 2 (MacTel Type 2). 7,8 Histopathologic observations on postmortem tissue donated by an affected patient revealed reduced immunoreactivity of Müller-cell markers such as vimentin, retinaldehyde binding protein 1 (RLBP1), and glutamine synthetase (GS) in the central macula. 7 Also, proteomic analysis of the fellow eye found that Müller-cell–associated proteins such as glial fibrillary acidic protein (GFAP), vimentin, and GS were reduced in the diseased macula region. 8 Interestingly, proteins involved in the glycolytic pathway, one of the most important components of Müller-cell metabolism, 911 were also downregulated in the macula of the diseased retina. 8  
To investigate the potential role of Müller-cell dysfunction in the pathogenesis of retinal diseases, we have recently generated an inducible transgenic model using a portion of the regulatory region of the retinaldehyde binding protein 1 (Rlbp1) gene as Müller-cell–specific promoter along with a Cre/Lox-P approach for Müller-cell–specific gene targeting. 12 In this model, crossing the resultant Rlbp1-Cre Estrogen Receptor (ER) transgenic mice with a transgenic line carrying an attenuated form of the diphtheria toxin fragment A (DTA176) gene (Rosa-DTA176 mice), produced selective, patchy ablation of Müller cells after treatment with tamoxifen (TMX) (Rlbp-CreER-DTA176 mice). 12 The patchy loss of Müller cells began from 1 day after TMX induction and became relatively stable at 14 days after TMX injection. 12 The transgenic model developed distinctive morphologic changes including photoreceptor apoptosis, BRB breakdown, and, later, deep retinal neovascularization, which did not occur in the control group (Rlbp1-CreER-LacZ mice). 12 This transgenic model provides a unique opportunity to study the effect of Müller-cell dysfunction on retinal neuronal damage and vascular pathology. Thus, the aim of the present study was to profile genomic changes after selective Müller-cell ablation, to examine differentially expressed genes and novel pathways that may lead to retinal neuronal damage and vascular pathology at different times after Müller-cell ablation. 
Materials and Methods
Transgenic Mice with Conditional Müller-Cell Ablation
We used the regulatory region of the retinaldehyde binding protein 1 (Rlbp1) gene as a Müller-cell–specific promoter along with the Cre/Lox-P system to produce transgenic mice for Müller-cell–specific gene targeting. 12,13 Rlbp1-CreER mice were crossed with Rosa-DTA176 mice, which resulted in Rlbp-CreER-DTA176 transgenic mice that were suitable for conditional Müller-cell ablation. 12 Those crossed with Rosa-LacZ reporter mice (Rlbp-CreER-LacZ) 14 were used as controls in this study. DTA176 gene expression was induced by daily intraperitoneal injection of TMX (3 mg in 0.2 mL sunflower oil) for 4 consecutive days at around 6 to 8 weeks of age. 
Tissue Collection
All animal experiments adhered to the Association of Research in Vision and Ophthalmology Statement for the Use of Animals in Ophthalmic and Vision Research. The project was approved by the Animal Ethics Committee of the University of Sydney. All animals were kept in 12-hour dark and light cycles and fed with standard chow and water. Twenty-four Rlbp-CreER-DTA176 mice and 24 Rlbp-CreER-LacZ mice were used. Mice were euthanized with carbon dioxide followed by cervical dislocation at 1 week, 1 month, and 3 months after TMX induction (n = 8/group/time point). Their retinas were isolated, snap-frozen in liquid nitrogen immediately, and stored at −80°C until use. Four retinae from Rlbp-CreER-DTA176 mice were of insufficient quality for analysis. Thus, a total of 44 retinae were analyzed: 20 Rlbp-CreER-DTA176 mice and 24 Rlbp-CreER-LacZ mice. 
RNA Extraction and cDNA Preparation
Retinae were thawed in RLT buffer and homogenized with a pellet pestle (Z359971; Sigma-Aldrich; St. Louis, MO). RNA extraction was performed with a commercial kit (RNeasy Mini Kit [catalog 74104]; Qiagen Sciences, Inc., Germantown, MD) according to the manufacturer's instructions. RNA extract (50 μL) was eluted in RNase-free water. The quality and quantity of RNA were assessed with a bioanalyzer (Agilent 2100 Bioanalyzer; Agilent Technologies, Santa Clara, CA) and 200 ng of total RNA was amplified (Applause WT-Amp ST RNA Amplification System [catalog 5500‐24]; NuGEN Technologies, San Carlos, CA) according to the manufacturer's instructions. cDNA was purified with a reaction clean-up kit (MiniElute Reaction Clean-Up Kit [catalog 28204]; Qiagen Sciences), and fragmentation and labeling were performed (Encore Biotin Module [4200‐12]; NuGEN Technologies) according to the manufacturer's instructions. 
Microarray and Data Analysis
DNA microarrays were performed with semiconductor manufacturing techniques (GeneChip Operating System [GCOS]; Affymetrix, Santa Clara, CA). Fragmented and biotin-labeled cDNA samples were mixed with a hybridization master mix (AFX-900454; Affymetrix) and 90 μL of sample and hybridization master mix mixture were injected into gene chips (Genechip Mouse Gene 1.0 ST array [AFX-901169]; Affymetrix) and hybridized for 18 hours at 45°C. Samples were removed from the chips after hybridization, and the chips were washed at a GCOS fluidics station (Affymetrix). With 100 μL of array holding buffer, chips were scanned with GCOS fluidics software. The scanned data were collected for analysis. For quality control analysis, a probe level model (PLM) and a robust multichip average (RMA) were used. Differential expression (DE) probes were selected using a least-squares approach applied by a linear model for microarray data (limma) package. A Bonferroni adjustment of P values was used for a stringent analysis of DE (P < 0.05). Gene set enrichment was used based on the approaches in the package topGO, 15 and GST from limma to identify differentially expressed gene ontology terms. R package “goTools” was also used to identify DE genes involved in each GO term and pathways identified by KEGG (http://www.genome.jp/kegg/pathway.html). 
Ratio to ratio (RR) statistics were used to estimate differential temporal profiles between Rlbp-CreER-DTA176 and Rlbp-CreER-LacZ groups. This value, which can be thought of as the ratio of the ratio between two factors (time and strain), is produced by RR = (Rlbp1-CreER-DTA176/Rlbp1-CreER-LacZ at 3 months)/(Rlbp1-CreER-DTA176/Rlbp-CreER-LacZ at 1 week). In a log-scale, this equates to the difference of the difference between expression values. This is not the same as examining temporal differences between 3 months and 1 week, but we adjusted the values to the expression levels with Rlbp-CreER-LacZ control mice for each time point. 
Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)
qRT-PCR was performed to validate microarray results. We chose those highly differentially expressed genes and the genes that may have accounted for the retinal neuronal damage and vascular pathology that we had observed in this transgenic model. 9 The primer sequences of these genes are listed in Table 1. Reverse transcription was performed using a cDNA synthesis kit (SuperScript VILO synthesis kit [catalog 11754050]; Invitrogen Corp., Carlsbad, CA) according to the manufacturer's instructions. Diluted cDNA (4 μL) (50 ng cDNA) and 6 μL of primer and supermix mixture (EXPRESS SYBR GreenER qPCR Supermix Universal [catalog A10314]; Invitrogen Corp.) were used in each PCR reaction. A free-download, stand-alone software tool (Relative Expression Software Tool [REST] 2009; M. Pfaffl software; Technical University Munich, Munich, Germany) was used for data analysis. 16 Expression values were normalized with three reference genes: 18SrRNA, β-actin, and β-tubulin. 
Table 1. 
 
Information on Primers Used for qRT-PCR Analysis
Table 1. 
 
Information on Primers Used for qRT-PCR Analysis
Gene Symbol Primer Sequence (5′→3′) Amplicon Size
CXCL13 Forward TTGTGTAATGGGCTTCCAGA 110
Reverse AGGTTGAACTCCACCTCCAG
CXCL10 Forward CCAAGTGCTGCCGTCATTTTC 133
Reverse TCCCTATGGCCCTCATTCTCA
EDN2 Forward AGACCTCCTCCGAAAGCTG 64
Reverse CTGGCTGTAGCTGGCAAAG
A2M Forward AGATGGTGAGATTTCGTGTTGTC 220
Reverse ACGGTCCTGCCTGATTCTGTA
FGF2 Forward TGTGTCTATCAAGGGAGTGTGTGC 158
Reverse ACCAACTGGAGTATTTCCGTGACCG
KLK22 Forward GTGTGTGTCCATCAAGCTCCATCC 131
Reverse GGCCTCCTGAGTCTCCCTTACAA
LIF Forward AATGCCACCTGTGCCATACG 216
Reverse CAACTTGGTCTTCTCTGTCCCG
STAT1 Forward TCACAGTGGTTCGAGCTTCAG 155
Reverse GCAAACGAGACATCATAGGCA
STAT3 Forward TGCGGAGAAGCATTGTGAGTG 159
Reverse TTTTCCAGACGGTCCAGGCAGATG
GFAP Forward TCCTTCCAAGGTTGTCCATC 198
Reverse CCAATCAGCCTCAGAGAAGG
GAPDH Forward AAGATGGTGATGGGCTTCCCG 156
Reverse TGGCAAAGTGGAGATTGTTGCC
PGM2 Forward CCGCTTCTACATGACCGAGG 121
Reverse GATGATGCAAGATACGGCAGG
ENO1 Forward GCTGCCTCCGAGTTCTACAG 325
Reverse GCAGGGATTCGGTCACAGAG
ENO2 Forward ATCAGCTCAGGTATCTCCGTG 167
Reverse TGGCGATAGAGGGGCAAGT
LDHa Forward TGTCTCCAGCAAAGACTACTGT 155
Reverse GACTGTACTTGACAATGTTGGGA
LDHb Forward AGATCACTGTAGTGGGCGTTG 164
Reverse TTTCGGAGTCTGGAGGAACAA
Claudin5 Forward GCAAGGTGTATGAATCTGTGCT 109
Reverse GTCAAGGTAACAAAGAGTGCCA
ZO-1 Forward GCCGCTAAGAGCACAGCAA 172
Reverse GCCCTCCTTTTAACACATCAGA
VE-cad Forward AGGACAGCAACTTCACCCTCA 70
Reverse AACTGCCCATACTTGACCGTG
Occludin Forward TTGAAAGTCCACCTCCTTACAGA 129
Reverse CCGGATAAAAAGAGTACGCTGG
β-Actin Forward GGCTGTATTCCCCTCCATCG 154
Reverse CCAGTTGGTAACAATGCCATGT
β-Tubulin Forward GATCGGTGCTAAGTTCTGGGA 154
Reverse AGGGACATACTTGCCACCTGT
18S rRNA Forward GCAATTATTCCCCATGAACG 139
Reverse GGGACTTAATCAACGCAAGC
Western Blot
Proteins were extracted with RIPA buffer (R0278; Sigma-Aldrich) with Complete Mini proteinase inhibitor (11836153001; Roche Applied Science, Basel, Switzerland). Protein quantification was performed with a commercial assay kit (QuantiPro BCA Assay Kit [QPBCA]; Sigma-Aldrich) and a microplate reader (Tecan Group Ltd., Männedorf, Switzerland) was used for analysis of protein concentration. Equal amounts of proteins were loaded into Bis-Tris gels (NuPage, NP0323BOX; Life Technologies, Carlsbad, CA) and transferred to a polyvinylidene difluoride (PVDF) membrane with a dry transfer system (iBlot, BI1001; Invitrogen). Membranes were blocked with 5% BSA in TBST and incubated with primary antibodies overnight at 4°C. Primary antibodies used in the experiment were Enolase 1 (catalog 3810; Cell Signaling Technology, Inc., Danvers, MA), lactate dehydrogenase a (catalog 2012; Cell Signaling Technology, Inc.), and GFAP (NeoMarkers MS-280-P; Thermo Fisher Scientific, Hampton, NH). Horseradish peroxidase conjugated secondary antibodies were used and protein bands were visualized (G:Box BioImaging system). The bands were normalized with α/β tubulin (catalog 2148s; Cell Signaling Technology, Inc.), which served as loading control. GeneTool image scanning and analysis package was used for densitometry and t-test with P < 0.05 were accepted as statistically significant data. 
Results
Summary of Differential Gene Expression, Gene Ontology, and Pathways Analysis at Different Time Points after Selective Müller-Cell Ablation
DE genes were identified at 1 week, 1 month, and 3 months after TMX-induced Müller-cell ablation. We investigated all DE genes and chose for further analysis both highly differentially expressed genes as well as those that were potentially associated with retinal neuronal damage and vascular pathology (Table 2). An overrepresentation test based on gene ontology was performed to provide a survey of various functional categories among the DE genes. The gene ontology analysis with three different GO terms (BP, biological process; MF, molecular function; and CC, cellular component) is listed in Supplementary Table S1 (see Supplementary Material and Supplementary Table S1). Also, the R package “goTool”17 was used to examine the percentage of the DE genes involved in specific GO terms in each time point (see Supplementary Material and Supplementary Figs. S1S3). A series of GeneSetTest (GST, implemented in limma) analysis was performed for pathway analysis. We focused on a number of pathways that were closely related to retinal pathology such as glial dysfunction, photoreceptor damage, and the BRB breakdown occurring after Müller-cell ablation (Table 3). In short, we found increased transcription of genes responsible for neuronal apoptosis, neurotrophic factors, and their related pathways in the early stage of ablation, whereas the glycolytic and tight junction pathways were downregulated later. 
Table 2. 
 
Short List of Differentially Expressed Genes 1 Week, 1 Month, and 3 Months after Tamoxifen-Induced Müller-Cell Ablation
Table 2. 
 
Short List of Differentially Expressed Genes 1 Week, 1 Month, and 3 Months after Tamoxifen-Induced Müller-Cell Ablation
Gene Symbol Fold Change, log2 Gene Name NCBI Reference Sequence
1 wk after tamoxifen-induced Müller-cell ablation
CXCL10 4.21 Chemokine (C–X–C motif) ligand 10 NM_021274
KLK1B22 4.05 Kallikrein 1-related peptidase b22 NM_010114
LCN2 4.02 Lipocalin 2 NM_008491
SERPINa3n 3.98 Serine (or cysteine) peptidase inhibitor, clade A, member 3N NM_009252
EDN2 3.06 Endothelin 2 NM_007902
CXCL13 2.95 Chemokine (C–X–C motif) ligand 13 NM_018866
A2M 2.72 Alpha-2-macroglobulin NM_175628
FGF2 2.33 Fibroblast growth factor 2 NM_008006
GFAP 1.74 Glial fibrillary acidic protein NM_001131020; NM_010277
KLK1B21 1.2 Kallikrein 1-related peptidase b21 NM_010642
ICAM1 1.18 Intercellular adhesion molecule 1 NM_010493
STAT3 1.17 Signal transducer and activator of transcription 3 NM_011486; NM_213659; NM_213660
CHL1 1.01 Cell adhesion molecule with homology to L1CAM NM_007697
STAT1 0.89 Signal transducer and activator of transcription 1 NM_009283
VCAM1 0.84 Vascular cell adhesion molecule 1 NM_011693
LIF 0.82 Leukemia inhibitory factor NM_001039537; NM_008501
CD44 0.78 CD44 antigen NM_001039150; NM_001039151; NM_009851
SOCS3 0.64 Suppressor of cytokine signaling 3 NM_007707
KCNG4 0.47 Potassium voltage-gated channel, subfamily G, member 4 NM_025734
PIK3AP1 0.46 Phosphoinositide-3-kinase adaptor protein 1 NM_031376
AQP1 −0.44 Aquaporin 1 NM_007472
PGM2 −0.62 Phosphoglucomutase 2 NM_028132
1 mo after tamoxifen-induced Müller-cell ablation
KLK1B22 5 Kallikrein 1-related peptidase b22 NM_010114
CXCL13 1.85 Chemokine (C–X–C motif) ligand 13 NM_018866
KLK1B21 1.71 Kallikrein 1-related peptidase b21 NM_010642
EDN2 1.61 Endothelin 2 NM_007902
FGF2 1.49 Fibroblast growth factor 2 NM_008006
GAPDHS −0.63 Glyceraldehyde-3-phosphate dehydrogenase, spermatogenic NM_008085
PGM2 −0.74 Phosphoglucomutase 2 NM_028132
AVEN −0.56 Apoptosis, caspase activation inhibitor NM_001165935; NM_028844
3 mo after tamoxfen-induced Müller-cell ablation
KLK1b22 4.34 Kallikrein 1-related peptidase b22 NM_010114
KLK1b21 1.56 Kallikrein 1-related peptidase b21 NM_010642
EDN2 1.42 Endothelin 2 NM_007902
KCNH5 0.27 Potassium voltage-gated channel, subfamily H (eag-related), member 5 NM_172805
KCNJ10 −0.46 Potassium inwardly-rectifying channel, subfamily J, member 10 NM_001039484
KCNB1 −0.49 Potassium voltage-gated channel, Shab-related subfamily, member 1 NM_008420
PGM2 −0.87 Phosphoglucomutase 2 NM_028132
Table 3. 
 
Pathway Analysis Using GeneSetTest 1 Week, 1 Month, and 3 Months after Tamoxifen-Induced Müller-Cell Ablation
Table 3. 
 
Pathway Analysis Using GeneSetTest 1 Week, 1 Month, and 3 Months after Tamoxifen-Induced Müller-Cell Ablation
Pathways Gene Set Trend
GeneSetTest (GST) pathway analysis 1 wk after Müller cell ablation
 MAPK signaling pathway Up
 Chemokine signaling pathway Up
 Apoptosis Up
 Wnt signaling pathway Up
 TGF-beta signaling pathway Up
 Cell adhesion molecules (CAMs) Up
 Adherence junction Up
 Jak-Stat signaling pathway Up
 T cell receptor signaling pathway Up
 B cell receptor signaling pathway Up
 Insulin signaling pathway Up
 Phototransduction Down
GeneSetTest (GST) pathway analysis 1 mo after Müller cell ablation
 Glycolysis/Gluconeogenesis Down
 Citrate cycle (TCA cycle) Down
d-glutamine and d-glutamate metabolism Down
 Jak-Stat signaling pathway Up
 Cell adhesion molecules (CAMs) Up
 Tight junction Down
GeneSetTest (GST) pathway analysis 3 mo after Müller cell ablation
 Glycolysis/Gluconeogenesis Down
 Citrate cycle (TCA cycle) Down
 MAPK signaling pathway Down
 Wnt signaling pathway Down
 Cell adhesion molecules (CAMs) Up
 Adherens junction Down
 Tight junction Down
 mTOR pathway Down
One Week after Müller-Cell Ablation.
In all, 395 genes (309 up; 86 down) were identified 1 week after induced Müller-cell ablation by DE gene analysis. Of these, those related to neurotrophism, including endothelin 2 (EDN2), fibroblast growth factor 2 (FGF2), signal transducer and activator of transcription 1 (STAT1), STAT3, and leukemia inhibitory factor (LIF), were highly upregulated (Table 2). The gliosis marker, GFAP, was also upregulated. Inflammation and cell-adhesion–related genes such as chemokine (C–X–C motif) ligand 10 (CXCL10) and alpha-2-macroglobulin (A2M), intercellular adhesion molecule 1 (ICAM1), vascular cell adhesion molecule 1 (VCAM1), and CD44 were also found. Consistent with individual DE gene analysis, gene ontology analysis revealed that DE genes were mostly related to inflammation (BP), host defense mechanism (BP), cytokine and chemokine receptor interactions (MF), G-protein–coupled receptor binding (MF), protein binding (MF), cell surface (CC), and host cell cytoplasm part (CC) (see Supplementary Material and Supplementary Table S2). Pathway analysis identified upregulation of 77 pathways and 4 downregulated pathways. Among these pathways, inflammation-, apoptosis-, and neuroprotection-related pathways such as Jak/Stat pathway were upregulated, whereas phototransduction was downregulated (Table 3). 
One Month after Müller-Cell Ablation.
DE gene analysis identified 126 genes (58 up; 68 down). Strong upregulation of EDN2-, FGF2-, and KLK-related genes (KLK1B21 and KLK1B22) was observed, whereas a number of genes related to the glycolytic pathway, including spermatogenic glyceraldehyde-3-phosphate dehydrogenase (GAPDHs), glycogen synthase 1 (GYS1), and phosphoglucomutase 2 (PGM2), were downregulated (Table 2). Gene ontology analysis revealed that the DE genes were mostly associated with metabolic process (BP), regulation of mitochondrion organization (BP), mitochondrial outer membrane activity (CC), regulation of neurotransmitter level (BP), synaptic vesicle (CC), and regulation of cell division (BP) (see Supplementary Material and Supplementary Table S2). We also found 15 upregulated and 57 downregulated pathways 1 month after Müller-cell ablation. In particular, pathways likely to be associated with Müller-cell metabolism, such as glycolysis, d-glutamine, and d-glutamate metabolism and TCA cycle, were downregulated along with tight junction molecules, whereas inflammation-related pathways such as cell adhesion molecules were upregulated (Table 3). 
A significant downregulation of Müller-cell metabolism was suggested by this analysis 1 month after induced Müller-cell ablation. Two main functions of Müller cells are (1) providing energy substrate, lactate, to high energy demanding neurons for their own oxidative metabolism (glycolysis); and (2) regulation of neurotransmitters in which converting toxic glutamate to glutamine (d-glutamine and d-glutamate metabolism). The relationship between these two functions was demonstrated by Poitry et al. 18 who reported that glutamate levels were linked to lactate production by Müller cells. The reduced expression of genes involved in anerobic metabolism that we found in the present study is likely to reflect loss of Müller cells, whereas the reduction in genes involved in oxidative phosphorylation is likely due to loss of photoreceptors. 
Three Months after Müller-Cell Ablation.
In all, 123 genes (46 up; 77 down) were identified by DE analysis 3 months after Müller-cell ablation. EDN2, KLK1b22, and KLK1b21 were upregulated, whereas the glycolysis-related gene, PGM2, was dowregulated (Table 2). Ion channel–, especially potassium channel–, associated genes were differentially expressed 3 months after Müller-cell ablation, with slightly increased transcription of gene encoding potassium voltage-gated channel subfamily H (eag-related) member 5 (KCNB5), and decreased expression of potassium inwardly rectifying channel subfamily J member 10 (KCNJ10) and potassium voltage-gated channel Shab-related subfamily member 1 (KCNH1) (Table 2). Gene ontology analysis revealed that DE genes at 3 months were strongly related to ion channel activity (BP), cellular metabolic process (BP), mitochondrial function (BP), potassium channel activity (MF), mitochondrial activity (CC), and cellular membranes (CC) (see Supplementary Material and Supplementary Table S2). Fifteen pathways were upregulated and 85 were downregulated 3 months after Müller-cell ablation. Pathways associated with glycolysis, TCA cycle, mTOR signaling, Wnt signaling, and tight junction formation were all downregulated, whereas pathways related to cell adhesion were upregulated (Table 3). 
Consistent with our previous morphologic study in which immunostaining revealed deep retinal neovascularization and vascular telangiectasis, 12 microarray analysis revealed ion channel and blood vessel–related pathways were downregulated 3 months after Müller-cell ablation. Genes associated with the glycolytic pathway remained downregulated. 
Differential Temporal Profile of DE Genes
We related DE genes and their temporal trends to retinal pathology using RR analysis, to understand how Müller-cell disruption may contribute to the progression of retinal diseases. Results were interpreted as follows: RR values > 1 indicate more changes at 3 month, whereas the RR values < 1 indicate more changes at 1 week. RR analysis identified 79 DE genes, of which 75 genes had RR values > 1 and only 4 genes had values < 1. Gene ontology from the Database for Annotation, Visualization, and Integration Discovery (DAVID; http://david.abcc.ncifcrf.gov/; Bioinformatics Resources Microarray Analysis) was applied to the group the genes identified by RR analysis. 19,20 They were grouped into eight different annotation clusters, but mainly associated with chemotaxis (BP), apoptosis (BP), regulation of cellular biosynthetic process (BP), GTP binding (MF), and immune response (BP) (see Supplementary Material and Supplementary Table S3). 
GST analysis identified 118 pathways; those potentially associated with retinal pathology following Müller-cell ablation are listed in Table 4. Changes in pathways associated with chemokine signaling, apoptosis, and TGF-β signaling were found 1 week after Müller-cell ablation, whereas glycolysis, citrate cycle (TCA cycle), vascular endothelial growth factor (VEGF), tight junction, gap junction, and mTOR pathways were altered significantly 3 months after Müller-cell ablation. Changes in mitogen-activated protein kinase (MAPK) signaling, Wnt signaling, and cell adhesion molecule pathways were found both 1 week and 3 months after Müller-cell ablation. 
Table 4. 
 
Differential Temporal Profile (Ratio-to-Ratio Statistics) of DE Genes and Their Involvement at Different Time Points after Müller-Cell Ablation
Table 4. 
 
Differential Temporal Profile (Ratio-to-Ratio Statistics) of DE Genes and Their Involvement at Different Time Points after Müller-Cell Ablation
GST Pathway Analysis on RR DE Genes Time Point
Chemokine signaling pathway 1 wk
Apoptosis 1 wk
TGF-β signaling pathway 1 wk
Glycolysis/gluconeogenesis 3 mo
Citrate cycle (TCA cycle) 3 mo
Tight junction molecules 3 mo
mTOR pathway 3 mo
VEGF signaling pathway 3 mo
Cell adhesion molecules (CAMs) 1 and 3 mo
Wnt signaling pathway 1 and 3 mo
MAPK signaling pathway 1 and 3 mo
qRT-PCR
qRT-PCR was performed to validate microarray results (Fig. 1). We chose the genes that were highly differentially expressed or potentially had a significant functional relationship with retinal pathology. These genes are summarized in Table 5. As mentioned earlier, we excluded four samples that showed poor hybridization in the Rlbp-CreER-DTA176 group. To conduct the qRT-PCR with consistent sample sizes in each group, we chose six samples in each group with the highest RNA quality (highest RNA integrity number from the bioanalyzer). We also generated a heat map with those DE genes for a better comparison of expression levels between transgenic and control mice at each time point (Fig. 2). Expression levels of the chosen genes revealed by PCR analysis were consistent with our microarray results. 
Figure 1
 
qRT-PCR validation of DE genes of interest revealed by microarray analysis. A ratio > 1 indicates upregulation, whereas a ratio < 1 indicates downregulation in Rlbp1-CreER-DTA176 mice compared with Rlbp1-CreER-LacZ controls. (A) qRT-PCR analysis 1 week after TMX-induced Müller ablation. (B) qRT-PCR analysis 1 month after TMX induction. (C) qRT-PCR analysis 3 months after TMX induction. P < 0.001; Rlbp1-CreER-DTA176 versus Rlbp1-CreER-LacZ; n = 6 in each group.
Figure 1
 
qRT-PCR validation of DE genes of interest revealed by microarray analysis. A ratio > 1 indicates upregulation, whereas a ratio < 1 indicates downregulation in Rlbp1-CreER-DTA176 mice compared with Rlbp1-CreER-LacZ controls. (A) qRT-PCR analysis 1 week after TMX-induced Müller ablation. (B) qRT-PCR analysis 1 month after TMX induction. (C) qRT-PCR analysis 3 months after TMX induction. P < 0.001; Rlbp1-CreER-DTA176 versus Rlbp1-CreER-LacZ; n = 6 in each group.
Figure 2
 
Heat map illustration of the genes with significant biological functions listed in Table 5. LacZ-7, ‐30, and ‐90 represent Rlbp-CreER-LacZ control mice at 1 week, 1 month, and 3 months after TMX-induced Müller-cell ablation. DTA-7, ‐30, and ‐90 represent Rlbp-CreER-DTA176 transgenic mice at 1 week, 1 month, and 3 months after Müller-cell ablation. Genes associated with reactive neuroprotection and gliosis were significantly upregulated in Rlbp-CreER-DTA176 groups, whereas Pgm2, a gene involved in glycolysis, was dowregulated through all three time points in Rlbp-CreER-DTA176 groups (n = 6–8/group/time point). (Fgf2, fibroblast growth factor 2; A2M, alpha-2-macroglubulin; CXCL13, chemokine (C–X–C motif) ligand 13; Edn2, endothelin 2; Gfap, glial fibrillary acidic protein; Pgm2, phosphoglucomutase 2; Stat1, signal transducer and activator of transcription 1; Stat3, signal transducer and activator of transcription 3; Klk1b22, kallikrein 1-related peptidase b22; Lif, leukemia inhibitory factor).
Figure 2
 
Heat map illustration of the genes with significant biological functions listed in Table 5. LacZ-7, ‐30, and ‐90 represent Rlbp-CreER-LacZ control mice at 1 week, 1 month, and 3 months after TMX-induced Müller-cell ablation. DTA-7, ‐30, and ‐90 represent Rlbp-CreER-DTA176 transgenic mice at 1 week, 1 month, and 3 months after Müller-cell ablation. Genes associated with reactive neuroprotection and gliosis were significantly upregulated in Rlbp-CreER-DTA176 groups, whereas Pgm2, a gene involved in glycolysis, was dowregulated through all three time points in Rlbp-CreER-DTA176 groups (n = 6–8/group/time point). (Fgf2, fibroblast growth factor 2; A2M, alpha-2-macroglubulin; CXCL13, chemokine (C–X–C motif) ligand 13; Edn2, endothelin 2; Gfap, glial fibrillary acidic protein; Pgm2, phosphoglucomutase 2; Stat1, signal transducer and activator of transcription 1; Stat3, signal transducer and activator of transcription 3; Klk1b22, kallikrein 1-related peptidase b22; Lif, leukemia inhibitory factor).
Table 5. 
 
List of Genes That Are Differentially Expressed or Potentially Have a Significant Functional Relationship with Retinal Pathology after Conditional Müller-Cell Ablation That Have Been Associated with Retinal Pathology
Table 5. 
 
List of Genes That Are Differentially Expressed or Potentially Have a Significant Functional Relationship with Retinal Pathology after Conditional Müller-Cell Ablation That Have Been Associated with Retinal Pathology
Gene Name Gene Symbol Biological Functions Reference
Chemokine (C–X–C motif) ligand 13 CXCL13 Inflammation process/B cell recruitment 42
Kallikrein 1-related peptidase b22 KLK1B22 Angiogenesis/proteolysis 43
Endothelin 2 EDN2 Stress response/ neuroprotection 29
Alpha 2 macroglobulin α2M Inflammation process 44
Fibroblast growth factor 2 FGF2 Neuroprotection/angiogenesis 45
Leukemia inhibitory factor LIF Neuroprotection 46
Signal transducer and activator of transcription 1 STAT 1 Apoptosis 47
Signal transducer and activator of transcription 3 STAT 3 Neuroprotection/anti-apoptosis 46
Phosphoglucomutase 2 PGM2 Glycolysis 48
Glycolytic Pathway Analysis with qRT-PCR and Western Blot
We also performed qRT-PCR analysis of genes involved in glycolysis to further investigate changes in Müller-cell metabolism in the later stages after ablation (1 month and 3 months). We selected the genes based on review of the current literature, which identified that GADPH, Enolase 1 (ENO1), ENO2, and lactate dehydrogenase-a and -b (LDHa and LDHb) are considered major components of the glycolytic pathway that may be affected in retinal diseases. 8,21 The expression of the majority of the genes encoding these proteins was suppressed, although ENO2 and lactate dehydrogenase-b (LDHb) at 1 month and GAPDH and ENO1 at 3 months after Müller-cell ablation were not significantly differentially expressed compared with the Rlbp-CreER-LacZ control group (Fig. 3). To validate changes in molecules involved in glycolysis at the protein level, we further performed Western blot analysis using antibodies against ENO1 and LDHa along with an antibody against GFAP, a marker for reactive gliosis. Protein was extracted from samples collected 3 months after TMX induction. Densitometric analysis revealed that both ENO1 and LDHa were significantly downregulated in Rlbp-CreER-DTA176 mice compared with Rlbp-CreER-LacZ controls, whereas GFAP was significantly upregulated (Fig. 4). 
Figure 3
 
qRT-PCR analysis of changes in genes involved in the glycolytic pathway 1 and 3 months after selective Müller-cell ablation. *P < 0.01, †P < 0.05; Rlbp1-DTA176 versus Rlbp1-LacZ; n = 6 in each group.
Figure 3
 
qRT-PCR analysis of changes in genes involved in the glycolytic pathway 1 and 3 months after selective Müller-cell ablation. *P < 0.01, †P < 0.05; Rlbp1-DTA176 versus Rlbp1-LacZ; n = 6 in each group.
Figure 4
 
Western blot analysis of molecules involved in glycolysis 3 months after TMX-induced Müller-cell ablation. DTA 176 represents Rlbp-CreER-DTA176 group and LacZ represents Rlbp-CreER-LacZ control group. (A), Western blot gel images showing reduced expression of ENO1 and LDHa and increased expression of GFAP. (BD) Analysis of densitometry revealed that ENO1 and LDHa were significantly downregulated, whereas GFAP was significantly upregulated in Rlbp-CreER-DTA176 mice compared with Rlbp-CreER-LacZ controls. *P < 0.05, †P < 0.01; error bars: SEM; n = 6 in each group.
Figure 4
 
Western blot analysis of molecules involved in glycolysis 3 months after TMX-induced Müller-cell ablation. DTA 176 represents Rlbp-CreER-DTA176 group and LacZ represents Rlbp-CreER-LacZ control group. (A), Western blot gel images showing reduced expression of ENO1 and LDHa and increased expression of GFAP. (BD) Analysis of densitometry revealed that ENO1 and LDHa were significantly downregulated, whereas GFAP was significantly upregulated in Rlbp-CreER-DTA176 mice compared with Rlbp-CreER-LacZ controls. *P < 0.05, †P < 0.01; error bars: SEM; n = 6 in each group.
Discussion
In this study we found that induced ablation of Müller cells in adult mice resulted in changes in gene expression that were consistent with the morphologic features we have reported in this model. In short, we found upregulation of neuroprotective and apoptotic genes soon after Müller-cell ablation and downregulation of the glycolysis and pathways related to vascular integrity later. These processes are likely to be involved in the photoreceptor degeneration, vascular leakage, and neovascularization that we observed in this mouse and that are also common features of many retinal diseases such as MacTel Type 2. Thus, the present study provides genomic information that may be useful in understanding the contribution of Müller-cell dysfunction to retinal diseases. 
We believe that the downregulation of transcription of genes encoding proteins of the glycolytic pathway that we found in the later stages after Müller-cell ablation is particularly significant. In the healthy retina, Müller cells continuously provide lactate to high energy demanding photoreceptors through glycolysis. 1,9 This lactate can be metabolized further into pyruvate by LDH, 22 which eventually serves as a substrate for oxidative metabolism by photoreceptors. 10,18 The importance of glycolysis in the retina has been emphasized previously. Inhibition of glycolysis by iodoacetate resulted in a dose-dependent loss of all retinal cells, including retinal neurones, in an in vitro study. 23 When glycolysis was blocked with the same drug in another in vitro study, the ATP and lactate levels in human Müller cells declined to a very low level. 11 Proteomic analysis of a human MacTel Type 2 postmortem sample showed marked downregulation of glycolytic pathway–related proteins as well as Müller-cell–associated proteins in the diseased macula compared with peripheral retina of the same eye and a control eye. 8  
We also found reduced activity of GS-related pathways (downregulation of d-glutamine and d-glutamate metabolism) 1 month after Müller-cell ablation, indicating compromised Müller-cell function. GS, a major enzyme that converts the neurotoxic neurotransmitter glutamate to glutamine, 24 is exclusively expressed in Müller cells in the neural retina and its activity is essential for the normal function of excitatory synapses and reduction of neurotoxicity. 25,26 We found significant reduction of GS immunoreactivity in our morphologic analysis of these mice. 12 Interestingly, GS uses ATP generated from glycolysis in Müller cells. 18 Thus, impairment of glycolysis secondary to Müller-cell dysfunction not only fails to provide enough lactate to neurones, it may also affect neurotransmitter metabolism in the retina. 
Induced Müller-cell ablation in this model results in patches of loss alternating with patches of surviving Müller cells that were activated, as reflected by their strong expression of GFAP. 12 We also found upregulation of GFAP gene, a marker of gliosis, in these transgenic mice 1 week after Müller-cell ablation, 12 consistent with present analysis. Activated Müller cells expressing GFAP release neurotrophic factors such as ciliary neurotrophic factor, basic FGF, brain-derived neurotrophic factor, LIF, neurotrophin 3 and 4, and nerve growth factor to protect photoreceptors in many retinal diseases. 27 Consistent with this, we found in the present study a significant upregulation of mRNA encoding GFAP, STAT1, neurotrophic factors (FGF2, EDN2, STAT3, and LIF), and their related pathways (apoptosis and the Jak-Stat signaling pathway) soon after Müller-cell ablation. Upregulation of GFAP has also been reported in other retinal diseases such as retinitis pigmentosa in which Roesch et al. 28 performed single-cell microarray analysis. 28 We found strong upregulation of EDN2, a stress response molecule produced by stressed photoreceptors, at all time points after Müller-cell ablation. EDN2 binds to its receptors on Müller cells, causing them to become gliotic and produce neurotrophic factors such as FGF2 and LIF. 29,30 Jak/Stat pathway related genes such as STAT1 and STAT3, which are pro-apoptotic 31 and anti-apoptotic, 32,33 respectively, were also upregulated soon after Müller-cell ablation. In our previous publication, we observed apoptotic cells in the inner nuclear layer (INL) with TUNEL staining in Müller cell bodies soon after Müller-cell ablation. TUNEL-positive cells were then found in the outer nuclear layer a few days later. 12 Thus, it appears that patchy loss of Müller cells in this model causes photoreceptor degeneration and death in the affected area, whereas remaining Müller cells mount a protective response. Further studies on DE genes and their encoded proteins in areas of Müller-cell ablation compared with regions with reactive gliosis are warranted to test the hypothesis that stressed photoreceptors in the Müller-cell–ablated areas produce EDN2, whereas remaining Müller cells become gliotic and produce neurotrophic factors in an attempt to prevent photoreceptor death. 
This analysis was generally consistent with the previous morphologic study. Soon after Müller-cell ablation, we found apoptotic cells in the INL with TUNEL staining in Müller cell bodies. TUNEL-positive cells were then found in the outer nuclear layer a few days later. 12 We also found upregulation of GFAP, a marker of gliosis, in these transgenic mice 1 week after Müller-cell ablation, 12 consistent with present analysis. 
We have described vascular changes in the later stages after Müller-cell ablation in this model, in which vascular leakage started soon after Müller-cell ablation, whereas severe BRB breakdown and angiogenesis developed later. 12 Consistent with this, we found that tight junction pathways were downregulated in the later stages after Müller-cell ablation. Tight junctions are critical components of the BRB, which controls the flux of a variety of chemokines, cytokines, and amino acids across the vascular endothelium. 34 Müller cells play an important role in supporting the endothelial cells of the inner BRB, which is mainly responsible for supplying nutrients to the neural retina. 35 The relationship between Müller cells and vascular changes has been reported both in vitro and in vivo. Coculturing Müller cells and primary bovine endothelial cell monolayers improved barrier function in normoxic conditions but led to barrier breakdown under hypoxic conditions. 36 Inducing breakdown of BRB breakdown in rats by disrupting Müller cells with subretinal injection of DL-alpha-AAA 37 resulted in vascular changes in association with reduced expression of claudin 5 that were observed predominantly in areas of Müller-cell disruption. 37 These observations, along with downregulation of tight junction pathways found in the present study support the concept that Müller-cell deficiency disturbs retinal vascular interendothelial tight junctions. 
We found that potassium (K+) channel–related genes were suppressed 3 months after selective Müller-cell ablation. Maintenance of retinal K+ homeostasis is one of the most important functions of Müller cells. Müller cells take up K+ that is released by neurons into the extracellular space by an inwardly rectifying K+ channel 38 and release it into extraretinal spaces such as blood and vitreous. 6 The osmotic force of the retinal extracellular space increases when K+ homeostasis is disturbed, thereby causing retinal edema, 39 and, subsequently, BRB breakdown. 40 K+ conductance dysregulation and Kir4 channel mislocation with Müller-cell gliosis have been described in some retinal diseases such as diabetic retinopathy. 41 Thus, we propose that selective Müller-cell ablation causes alterations in K+ channel–related genes, which results in dysregulation of osmosis, retinal edema, and BRB breakdown. 
We also analyzed the temporal trend of DE genes over time after induced Müller-cell ablation. RR analysis was consistent with the retinal pathology that developed after Müller-cell ablation: apoptosis and neuronal changes were found 1 week after Müller-cell ablation followed by genes associated with BRB breakdown and the development of intraretinal neovascularization later. Since these features are seen in many retinal diseases, particularly in MacTel Type 2 in which recent clinicopathologic reports have implicated Müller-cell dysfunction, this study may provide insights into the pathologic mechanisms underlying MacTel Type 2, which are currently poorly understood. 
The patchy nature of Müller-cell ablation that occurs in this model means that areas of Müller cell loss alternate with areas of surviving Müller cells, which tend to become gliotic. Since we used whole retinae for this genomic analysis, we are unable to say where the DE genes were expressed. Further research is warranted to perform genomic analysis on Müller-cell ablated areas and on those with reactive Müller-cell gliosis. Also, findings from this animal model should be extrapolated to clinical conditions with care since, unlike humans, mice do not have maculae. 
This global genomic analysis of mouse retinae after induced selective Müller-cell ablation, found genomic changes consistent with photoreceptor degeneration and retinal vasculopathy that have been described in these mice. Increased transcription of genes responsible for neuronal apoptosis, neurotrophic factors, and their related pathways were found early, whereas the glycolytic and tight junction pathways were downregulated later. Since photoreceptor degeneration and vasculopathy are common features of many retinal diseases, further studies in humans and animal models are warranted to identify the specific roles of Müller-cell dysfunction in common conditions such as diabetic retinopathy. Further investigation of the pathways involved in retinal neuronal damage and vasculopathy after selective Müller-cell ablation may lead to novel therapies for retinal diseases that may be associated with Müller-cell dysfunction. 
Supplementary Materials
Acknowledgments
The authors thank Donna Lai and Ling Zhu for qRT-PCR training and Victoria Wen for microarray technique support. 
References
Poitry-Yamate CL Poitry S Tsacopoulos M. Lactate released by Müller glial cells is metabolized by photoreceptors from mammalian retina. J Neurosci . 1995; 15: 5179–5191. [PubMed]
Matsui K Hosoi N Tachibana M. Active role of glutamate uptake in the synaptic transmission from retinal nonspiking neurons. J Neurosci . 1999; 19: 6755–6766. [PubMed]
Pierce EA Avery RL Foley ED Aiello LP Smith LE. Vascular endothelial growth factor/vascular permeability factor expression in a mouse model of retinal neovascularization. Proc Natl Acad Sci U S A . 1995; 92: 905–909. [CrossRef] [PubMed]
Eichler W Yafai Y Keller T Wiedemann P Reichenbach A. PEDF derived from glial Muller cells: a possible regulator of retinal angiogenesis. Exp Cell Res . 2004; 299: 68–78. [CrossRef] [PubMed]
Tout S Chan-Ling T Hollander H Stone J. The role of Muller cells in the formation of the blood-retinal barrier. Neuroscience . 1993; 55: 291–301. [CrossRef] [PubMed]
Newman E Reichenbach A. The Muller cell: a functional element of the retina. Trends Neurosci . 1996; 19: 307–312. [CrossRef] [PubMed]
Powner MB Gillies MC Tretiach M Perifoveal Müller cell depletion in a case of macular telangiectasia type 2. Ophthalmology . 2010; 117: 2407–2416. [CrossRef] [PubMed]
Len AC Powner MB Zhu L Pilot application of iTRAQ to the retinal disease macular telangiectasia. J Proteome Res . 2012; 11: 537–553. [CrossRef] [PubMed]
Bringmann A Pannicke T Grosche J Muller cells in the healthy and diseased retina. Prog Retin Eye Res . 2006; 25: 397–424. [CrossRef] [PubMed]
Tsacopoulos M Veuthey AL Saravelos SG Perrottet P Tsoupras G. Glial cells transform glucose to alanine, which fuels the neurons in the honeybee retina. J Neurosci . 1994; 14: 1339–1351. [PubMed]
Winkler BS Arnold MJ Brassell MA Puro DG. Energy metabolism in human retinal Müller cells. Invest Ophthalmol Vis Sci . 2000; 41: 3183–3190. [PubMed]
Shen W Fruttiger M Zhu L Conditional Müller cell ablation causes independent neuronal and vascular pathologies in a novel transgenic model. J Neurosci . 2012; 32: 15715–15727. [CrossRef] [PubMed]
Vazquez-Chona FR Clark AM Levine EM. Rlbp1 promoter drives robust Müller glial GFP expression in transgenic mice. Invest Ophthalmol Vis Sci . 2009; 50: 3996–4003. [CrossRef] [PubMed]
Maxwell F Maxwell IH Glode LM. Cloning, sequence determination, and expression in transfected cells of the coding sequence for the tox 176 attenuated diphtheria toxin A chain. Mol Cell Biol . 1987; 7: 1576–1579. [PubMed]
Alexa A Rahnenfuhrer J. topGO: Enrichment Analysis for Gene Ontology. Documentation for Package “topGO” Version 1.10.1 . University of California, Santa Cruz: Bioconductor Tutorial. 2012.
Pfaffl MW Horgan GW Dempfle L. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res . 2002; 30: e36. [CrossRef] [PubMed]
Yang Y Paquet A. goTools: Functions for Gene Ontology Database. R package version 1.32.0. 2009.
Poitry S Poitry-Yamate C Ueberfeld J MacLeish PR Tsacopoulos M. Mechanisms of glutamate metabolic signaling in retinal glial (Müller) cells. J Neurosci . 2000; 20: 1809–1821. [PubMed]
Huang da W Sherman BT Lempicki RA. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc . 2009; 4: 44–57. [CrossRef] [PubMed]
Huang da W Sherman BT Lempicki RA. Bioinformatics enrichment tools: paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Res . 2009; 37: 1–13. [CrossRef] [PubMed]
Kanwar M Kowluru RA. Role of glyceraldehyde 3-phosphate dehydrogenase in the development and progression of diabetic retinopathy. Diabetes . 2009; 58: 227–234. [CrossRef] [PubMed]
Tsacopoulos M Poitry-Yamate CL MacLeish PR Poitry S. Trafficking of molecules and metabolic signals in the retina. Prog Retin Eye Res . 1998; 17: 429–442. [CrossRef] [PubMed]
Wood JP Chidlow G Graham M Osborne NN. Energy substrate requirements for survival of rat retinal cells in culture: the importance of glucose and monocarboxylates. J Neurochem . 2005; 93: 686–697. [CrossRef] [PubMed]
Pow DV Crook DK. Direct immunocytochemical evidence for the transfer of glutamine from glial cells to neurons: use of specific antibodies directed against the d-stereoisomers of glutamate and glutamine. Neuroscience . 1996; 70: 295–302. [CrossRef] [PubMed]
Barnett NL Pow DV. Antisense knockdown of GLAST, a glial glutamate transporter, compromises retinal function. Invest Ophthalmol Vis Sci . 2000; 41: 585–591. [PubMed]
Riepe RE Norenburg MD. Muller cell localisation of glutamine synthetase in rat retina. Nature . 1977; 268: 654–655. [CrossRef] [PubMed]
Bringmann A Iandiev I Pannicke T Cellular signaling and factors involved in Müller cell gliosis: neuroprotective and detrimental effects. Prog Retin Eye Res . 2009; 28: 423–451. [CrossRef] [PubMed]
Roesch K Stadler MB Cepko CL. Gene expression changes within Muller glial cells in retinitis pigmentosa. Mol Vis . 2012; 18: 1197–1214. [PubMed]
Rattner A Nathans J. The genomic response to retinal disease and injury: evidence for endothelin signaling from photoreceptors to glia. J Neurosci . 2005; 25: 4540–4549. [CrossRef] [PubMed]
Joly S Lange C Thiersch M Samardzija M Grimm C. Leukemia inhibitory factor extends the lifespan of injured photoreceptors in vivo. J Neurosci . 2008; 28: 13765–13774. [CrossRef] [PubMed]
Calo V Migliavacca M Bazan V STAT proteins: from normal control of cellular events to tumorigenesis. J Cell Physiol . 2003; 197: 157–168. [CrossRef] [PubMed]
Battle TE Frank DA. The role of STATs in apoptosis. Curr Mol Med . 2002; 2: 381–392. [CrossRef] [PubMed]
Samardzija M Wenzel A Aufenberg S Thiersch M Reme C Grimm C. Differential role of Jak-STAT signaling in retinal degenerations. FASEB J . 2006; 20: 2411–2413. [CrossRef] [PubMed]
Erickson KK Sundstrom JM Antonetti DA. Vascular permeability in ocular disease and the role of tight junctions. Angiogenesis . 2007; 10: 103–117. [CrossRef] [PubMed]
Hosoya K Tomi M. Advances in the cell biology of transport via the inner blood-retinal barrier: establishment of cell lines and transport functions. Biol Pharm Bull . 2005; 28: 1–8. [CrossRef] [PubMed]
Tretiach M Madigan MC Wen L Gillies MC. Effect of Muller cell co-culture on in vitro permeability of bovine retinal vascular endothelium in normoxic and hypoxic conditions. Neurosci Lett . 2005; 378: 160–165. [CrossRef] [PubMed]
Shen W Li S Chung SH Gillies MC. Retinal vascular changes after glial disruption in rats. J Neurosci Res . 2010; 88: 1485–1499. [CrossRef] [PubMed]
Reichenbach A Henke A Eberhardt W Reichelt W Dettmer D. K+ ion regulation in retina. Can J Physiol Pharmacol . 1992; 70 (suppl): S239–S247. [CrossRef] [PubMed]
Reichenbach A Wurm A Pannicke T Iandiev I Wiedemann P Bringmann A. Muller cells as players in retinal degeneration and edema. Graefes Arch Clin Exp Ophthalmol . 2007; 245: 627–636. [CrossRef] [PubMed]
Cunha-Vaz JG Travassos A. Breakdown of the blood-retinal barriers and cystoid macular edema. Surv Ophthalmol . 1984; 28 (suppl): 485–492. [CrossRef] [PubMed]
Pannicke T Iandiev I Wurm A Diabetes alters osmotic swelling characteristics and membrane conductance of glial cells in rat retina. Diabetes . 2006; 55: 633–639. [CrossRef] [PubMed]
Falkenhagen KM Braziel RM Fraunfelder FW Smith JR. B-Cells in ocular adnexal lymphoproliferative lesions express B-cell attracting chemokine 1 (CXCL13). Am J Ophthalmol . 2005; 140: 335–337. [CrossRef] [PubMed]
Gao G Shao C Zhang SX Dudley A Fant J Ma JX. Kallikrein-binding protein inhibits retinal neovascularization and decreases vascular leakage. Diabetologia . 2003; 46: 689–698. [PubMed]
Fabrizi C Colasanti M Persichini T Businaro R Starace G Lauro GM. Interferon gamma up-regulates alpha 2 macroglobulin expression in human astrocytoma cells. J Neuroimmunol . 1994; 53: 31–37. [CrossRef] [PubMed]
Rose K Litterscheid S Klumpp S Krieglstein J. Fibroblast growth factor 2 requires complex formation with ATP for neuroprotective activity. Neuroscience . 2009; 164: 1695–1700. [CrossRef] [PubMed]
Ueki Y Wang J Chollangi S Ash JD. STAT3 activation in photoreceptors by leukemia inhibitory factor is associated with protection from light damage. J Neurochem . 2008; 105: 784–796. [CrossRef] [PubMed]
Stephanou A. Role of STAT-1 and STAT-3 in ischaemia/reperfusion injury. J Cell Mol Med . 2004; 8: 519–525. [CrossRef] [PubMed]
Maliekal P Sokolova T Vertommen D Veiga-da-Cunha M Van Schaftingen E. Molecular identification of mammalian phosphopentomutase and glucose-1,6-bisphosphate synthase, two members of the alpha-D-phosphohexomutase family. J Biol Chem . 2007; 282: 31844–31851. [CrossRef] [PubMed]
Footnotes
 Supported by a Lowy Medical Research Institute grant, National Health and Medical Research Council (NHMRC, Australia) Grant APP1028393, an Ophthalmic Research Institute of Australia grant, and a Rebecca L. Cooper Medical Research Foundation and University of Sydney Bridging grant. Mark Gillies is a fellow of Sydney Medical School Foundation and supported by an NHMRC Practitioner Fellowship.
Footnotes
 Disclosure: S.H. Chung, None; W. Shen, None; K. Jayawardana, None; P. Wang, None; J. Yang, None; N. Shackel, None; M.C. Gillies, None
Figure 1
 
qRT-PCR validation of DE genes of interest revealed by microarray analysis. A ratio > 1 indicates upregulation, whereas a ratio < 1 indicates downregulation in Rlbp1-CreER-DTA176 mice compared with Rlbp1-CreER-LacZ controls. (A) qRT-PCR analysis 1 week after TMX-induced Müller ablation. (B) qRT-PCR analysis 1 month after TMX induction. (C) qRT-PCR analysis 3 months after TMX induction. P < 0.001; Rlbp1-CreER-DTA176 versus Rlbp1-CreER-LacZ; n = 6 in each group.
Figure 1
 
qRT-PCR validation of DE genes of interest revealed by microarray analysis. A ratio > 1 indicates upregulation, whereas a ratio < 1 indicates downregulation in Rlbp1-CreER-DTA176 mice compared with Rlbp1-CreER-LacZ controls. (A) qRT-PCR analysis 1 week after TMX-induced Müller ablation. (B) qRT-PCR analysis 1 month after TMX induction. (C) qRT-PCR analysis 3 months after TMX induction. P < 0.001; Rlbp1-CreER-DTA176 versus Rlbp1-CreER-LacZ; n = 6 in each group.
Figure 2
 
Heat map illustration of the genes with significant biological functions listed in Table 5. LacZ-7, ‐30, and ‐90 represent Rlbp-CreER-LacZ control mice at 1 week, 1 month, and 3 months after TMX-induced Müller-cell ablation. DTA-7, ‐30, and ‐90 represent Rlbp-CreER-DTA176 transgenic mice at 1 week, 1 month, and 3 months after Müller-cell ablation. Genes associated with reactive neuroprotection and gliosis were significantly upregulated in Rlbp-CreER-DTA176 groups, whereas Pgm2, a gene involved in glycolysis, was dowregulated through all three time points in Rlbp-CreER-DTA176 groups (n = 6–8/group/time point). (Fgf2, fibroblast growth factor 2; A2M, alpha-2-macroglubulin; CXCL13, chemokine (C–X–C motif) ligand 13; Edn2, endothelin 2; Gfap, glial fibrillary acidic protein; Pgm2, phosphoglucomutase 2; Stat1, signal transducer and activator of transcription 1; Stat3, signal transducer and activator of transcription 3; Klk1b22, kallikrein 1-related peptidase b22; Lif, leukemia inhibitory factor).
Figure 2
 
Heat map illustration of the genes with significant biological functions listed in Table 5. LacZ-7, ‐30, and ‐90 represent Rlbp-CreER-LacZ control mice at 1 week, 1 month, and 3 months after TMX-induced Müller-cell ablation. DTA-7, ‐30, and ‐90 represent Rlbp-CreER-DTA176 transgenic mice at 1 week, 1 month, and 3 months after Müller-cell ablation. Genes associated with reactive neuroprotection and gliosis were significantly upregulated in Rlbp-CreER-DTA176 groups, whereas Pgm2, a gene involved in glycolysis, was dowregulated through all three time points in Rlbp-CreER-DTA176 groups (n = 6–8/group/time point). (Fgf2, fibroblast growth factor 2; A2M, alpha-2-macroglubulin; CXCL13, chemokine (C–X–C motif) ligand 13; Edn2, endothelin 2; Gfap, glial fibrillary acidic protein; Pgm2, phosphoglucomutase 2; Stat1, signal transducer and activator of transcription 1; Stat3, signal transducer and activator of transcription 3; Klk1b22, kallikrein 1-related peptidase b22; Lif, leukemia inhibitory factor).
Figure 3
 
qRT-PCR analysis of changes in genes involved in the glycolytic pathway 1 and 3 months after selective Müller-cell ablation. *P < 0.01, †P < 0.05; Rlbp1-DTA176 versus Rlbp1-LacZ; n = 6 in each group.
Figure 3
 
qRT-PCR analysis of changes in genes involved in the glycolytic pathway 1 and 3 months after selective Müller-cell ablation. *P < 0.01, †P < 0.05; Rlbp1-DTA176 versus Rlbp1-LacZ; n = 6 in each group.
Figure 4
 
Western blot analysis of molecules involved in glycolysis 3 months after TMX-induced Müller-cell ablation. DTA 176 represents Rlbp-CreER-DTA176 group and LacZ represents Rlbp-CreER-LacZ control group. (A), Western blot gel images showing reduced expression of ENO1 and LDHa and increased expression of GFAP. (BD) Analysis of densitometry revealed that ENO1 and LDHa were significantly downregulated, whereas GFAP was significantly upregulated in Rlbp-CreER-DTA176 mice compared with Rlbp-CreER-LacZ controls. *P < 0.05, †P < 0.01; error bars: SEM; n = 6 in each group.
Figure 4
 
Western blot analysis of molecules involved in glycolysis 3 months after TMX-induced Müller-cell ablation. DTA 176 represents Rlbp-CreER-DTA176 group and LacZ represents Rlbp-CreER-LacZ control group. (A), Western blot gel images showing reduced expression of ENO1 and LDHa and increased expression of GFAP. (BD) Analysis of densitometry revealed that ENO1 and LDHa were significantly downregulated, whereas GFAP was significantly upregulated in Rlbp-CreER-DTA176 mice compared with Rlbp-CreER-LacZ controls. *P < 0.05, †P < 0.01; error bars: SEM; n = 6 in each group.
Table 1. 
 
Information on Primers Used for qRT-PCR Analysis
Table 1. 
 
Information on Primers Used for qRT-PCR Analysis
Gene Symbol Primer Sequence (5′→3′) Amplicon Size
CXCL13 Forward TTGTGTAATGGGCTTCCAGA 110
Reverse AGGTTGAACTCCACCTCCAG
CXCL10 Forward CCAAGTGCTGCCGTCATTTTC 133
Reverse TCCCTATGGCCCTCATTCTCA
EDN2 Forward AGACCTCCTCCGAAAGCTG 64
Reverse CTGGCTGTAGCTGGCAAAG
A2M Forward AGATGGTGAGATTTCGTGTTGTC 220
Reverse ACGGTCCTGCCTGATTCTGTA
FGF2 Forward TGTGTCTATCAAGGGAGTGTGTGC 158
Reverse ACCAACTGGAGTATTTCCGTGACCG
KLK22 Forward GTGTGTGTCCATCAAGCTCCATCC 131
Reverse GGCCTCCTGAGTCTCCCTTACAA
LIF Forward AATGCCACCTGTGCCATACG 216
Reverse CAACTTGGTCTTCTCTGTCCCG
STAT1 Forward TCACAGTGGTTCGAGCTTCAG 155
Reverse GCAAACGAGACATCATAGGCA
STAT3 Forward TGCGGAGAAGCATTGTGAGTG 159
Reverse TTTTCCAGACGGTCCAGGCAGATG
GFAP Forward TCCTTCCAAGGTTGTCCATC 198
Reverse CCAATCAGCCTCAGAGAAGG
GAPDH Forward AAGATGGTGATGGGCTTCCCG 156
Reverse TGGCAAAGTGGAGATTGTTGCC
PGM2 Forward CCGCTTCTACATGACCGAGG 121
Reverse GATGATGCAAGATACGGCAGG
ENO1 Forward GCTGCCTCCGAGTTCTACAG 325
Reverse GCAGGGATTCGGTCACAGAG
ENO2 Forward ATCAGCTCAGGTATCTCCGTG 167
Reverse TGGCGATAGAGGGGCAAGT
LDHa Forward TGTCTCCAGCAAAGACTACTGT 155
Reverse GACTGTACTTGACAATGTTGGGA
LDHb Forward AGATCACTGTAGTGGGCGTTG 164
Reverse TTTCGGAGTCTGGAGGAACAA
Claudin5 Forward GCAAGGTGTATGAATCTGTGCT 109
Reverse GTCAAGGTAACAAAGAGTGCCA
ZO-1 Forward GCCGCTAAGAGCACAGCAA 172
Reverse GCCCTCCTTTTAACACATCAGA
VE-cad Forward AGGACAGCAACTTCACCCTCA 70
Reverse AACTGCCCATACTTGACCGTG
Occludin Forward TTGAAAGTCCACCTCCTTACAGA 129
Reverse CCGGATAAAAAGAGTACGCTGG
β-Actin Forward GGCTGTATTCCCCTCCATCG 154
Reverse CCAGTTGGTAACAATGCCATGT
β-Tubulin Forward GATCGGTGCTAAGTTCTGGGA 154
Reverse AGGGACATACTTGCCACCTGT
18S rRNA Forward GCAATTATTCCCCATGAACG 139
Reverse GGGACTTAATCAACGCAAGC
Table 2. 
 
Short List of Differentially Expressed Genes 1 Week, 1 Month, and 3 Months after Tamoxifen-Induced Müller-Cell Ablation
Table 2. 
 
Short List of Differentially Expressed Genes 1 Week, 1 Month, and 3 Months after Tamoxifen-Induced Müller-Cell Ablation
Gene Symbol Fold Change, log2 Gene Name NCBI Reference Sequence
1 wk after tamoxifen-induced Müller-cell ablation
CXCL10 4.21 Chemokine (C–X–C motif) ligand 10 NM_021274
KLK1B22 4.05 Kallikrein 1-related peptidase b22 NM_010114
LCN2 4.02 Lipocalin 2 NM_008491
SERPINa3n 3.98 Serine (or cysteine) peptidase inhibitor, clade A, member 3N NM_009252
EDN2 3.06 Endothelin 2 NM_007902
CXCL13 2.95 Chemokine (C–X–C motif) ligand 13 NM_018866
A2M 2.72 Alpha-2-macroglobulin NM_175628
FGF2 2.33 Fibroblast growth factor 2 NM_008006
GFAP 1.74 Glial fibrillary acidic protein NM_001131020; NM_010277
KLK1B21 1.2 Kallikrein 1-related peptidase b21 NM_010642
ICAM1 1.18 Intercellular adhesion molecule 1 NM_010493
STAT3 1.17 Signal transducer and activator of transcription 3 NM_011486; NM_213659; NM_213660
CHL1 1.01 Cell adhesion molecule with homology to L1CAM NM_007697
STAT1 0.89 Signal transducer and activator of transcription 1 NM_009283
VCAM1 0.84 Vascular cell adhesion molecule 1 NM_011693
LIF 0.82 Leukemia inhibitory factor NM_001039537; NM_008501
CD44 0.78 CD44 antigen NM_001039150; NM_001039151; NM_009851
SOCS3 0.64 Suppressor of cytokine signaling 3 NM_007707
KCNG4 0.47 Potassium voltage-gated channel, subfamily G, member 4 NM_025734
PIK3AP1 0.46 Phosphoinositide-3-kinase adaptor protein 1 NM_031376
AQP1 −0.44 Aquaporin 1 NM_007472
PGM2 −0.62 Phosphoglucomutase 2 NM_028132
1 mo after tamoxifen-induced Müller-cell ablation
KLK1B22 5 Kallikrein 1-related peptidase b22 NM_010114
CXCL13 1.85 Chemokine (C–X–C motif) ligand 13 NM_018866
KLK1B21 1.71 Kallikrein 1-related peptidase b21 NM_010642
EDN2 1.61 Endothelin 2 NM_007902
FGF2 1.49 Fibroblast growth factor 2 NM_008006
GAPDHS −0.63 Glyceraldehyde-3-phosphate dehydrogenase, spermatogenic NM_008085
PGM2 −0.74 Phosphoglucomutase 2 NM_028132
AVEN −0.56 Apoptosis, caspase activation inhibitor NM_001165935; NM_028844
3 mo after tamoxfen-induced Müller-cell ablation
KLK1b22 4.34 Kallikrein 1-related peptidase b22 NM_010114
KLK1b21 1.56 Kallikrein 1-related peptidase b21 NM_010642
EDN2 1.42 Endothelin 2 NM_007902
KCNH5 0.27 Potassium voltage-gated channel, subfamily H (eag-related), member 5 NM_172805
KCNJ10 −0.46 Potassium inwardly-rectifying channel, subfamily J, member 10 NM_001039484
KCNB1 −0.49 Potassium voltage-gated channel, Shab-related subfamily, member 1 NM_008420
PGM2 −0.87 Phosphoglucomutase 2 NM_028132
Table 3. 
 
Pathway Analysis Using GeneSetTest 1 Week, 1 Month, and 3 Months after Tamoxifen-Induced Müller-Cell Ablation
Table 3. 
 
Pathway Analysis Using GeneSetTest 1 Week, 1 Month, and 3 Months after Tamoxifen-Induced Müller-Cell Ablation
Pathways Gene Set Trend
GeneSetTest (GST) pathway analysis 1 wk after Müller cell ablation
 MAPK signaling pathway Up
 Chemokine signaling pathway Up
 Apoptosis Up
 Wnt signaling pathway Up
 TGF-beta signaling pathway Up
 Cell adhesion molecules (CAMs) Up
 Adherence junction Up
 Jak-Stat signaling pathway Up
 T cell receptor signaling pathway Up
 B cell receptor signaling pathway Up
 Insulin signaling pathway Up
 Phototransduction Down
GeneSetTest (GST) pathway analysis 1 mo after Müller cell ablation
 Glycolysis/Gluconeogenesis Down
 Citrate cycle (TCA cycle) Down
d-glutamine and d-glutamate metabolism Down
 Jak-Stat signaling pathway Up
 Cell adhesion molecules (CAMs) Up
 Tight junction Down
GeneSetTest (GST) pathway analysis 3 mo after Müller cell ablation
 Glycolysis/Gluconeogenesis Down
 Citrate cycle (TCA cycle) Down
 MAPK signaling pathway Down
 Wnt signaling pathway Down
 Cell adhesion molecules (CAMs) Up
 Adherens junction Down
 Tight junction Down
 mTOR pathway Down
Table 4. 
 
Differential Temporal Profile (Ratio-to-Ratio Statistics) of DE Genes and Their Involvement at Different Time Points after Müller-Cell Ablation
Table 4. 
 
Differential Temporal Profile (Ratio-to-Ratio Statistics) of DE Genes and Their Involvement at Different Time Points after Müller-Cell Ablation
GST Pathway Analysis on RR DE Genes Time Point
Chemokine signaling pathway 1 wk
Apoptosis 1 wk
TGF-β signaling pathway 1 wk
Glycolysis/gluconeogenesis 3 mo
Citrate cycle (TCA cycle) 3 mo
Tight junction molecules 3 mo
mTOR pathway 3 mo
VEGF signaling pathway 3 mo
Cell adhesion molecules (CAMs) 1 and 3 mo
Wnt signaling pathway 1 and 3 mo
MAPK signaling pathway 1 and 3 mo
Table 5. 
 
List of Genes That Are Differentially Expressed or Potentially Have a Significant Functional Relationship with Retinal Pathology after Conditional Müller-Cell Ablation That Have Been Associated with Retinal Pathology
Table 5. 
 
List of Genes That Are Differentially Expressed or Potentially Have a Significant Functional Relationship with Retinal Pathology after Conditional Müller-Cell Ablation That Have Been Associated with Retinal Pathology
Gene Name Gene Symbol Biological Functions Reference
Chemokine (C–X–C motif) ligand 13 CXCL13 Inflammation process/B cell recruitment 42
Kallikrein 1-related peptidase b22 KLK1B22 Angiogenesis/proteolysis 43
Endothelin 2 EDN2 Stress response/ neuroprotection 29
Alpha 2 macroglobulin α2M Inflammation process 44
Fibroblast growth factor 2 FGF2 Neuroprotection/angiogenesis 45
Leukemia inhibitory factor LIF Neuroprotection 46
Signal transducer and activator of transcription 1 STAT 1 Apoptosis 47
Signal transducer and activator of transcription 3 STAT 3 Neuroprotection/anti-apoptosis 46
Phosphoglucomutase 2 PGM2 Glycolysis 48
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×