September 2012
Volume 53, Issue 10
Free
Erratum  |   September 2012
Erratum
Investigative Ophthalmology & Visual Science September 2012, Vol.53, 6667. doi:10.1167/iovs.08-3149a
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Erratum. Invest. Ophthalmol. Vis. Sci. 2012;53(10):6667. doi: 10.1167/iovs.08-3149a.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Erratum in : “Comprehensive Mutational Screening in a Cohort of Danish Families with Hereditary Congenital Cataract” by Lars Hansen, Annemette Mikkelsen, Peter Nürnberg, Gudrun Nürnberg, Iram Anjum, Hans Eiberg, and Thomas Rosenberg (Invest Ophthalmol Vis Sci. 2009;50:3291-3303) doi:10.1167/iovs.08-3149  
In a letter in this journal 1 Kumar and Santhiya have drawn attention to some errors in our aforementioned study on congenital cataract. In family CC00133, we reported a presumed pathogenic allele in CRYBB2 carrying three non-synonymous DNA variations c.(433C_T; 440A_G;449C_T); p.(Arg145Trp;Gln147Arg;Thr150Met). The three variations (NCBI dbSNP135: rs2330991, rs2330992, rs4049504) were shown to be caused by erroneous amplification of the CRYBB2 gene and the CRYBB2P1 pseudogene. A 20 Kb segmental duplication (chr22:25622857-25643059 and chr22:25850716-25867764, UCSC hg19) covers CRYBB2 and the pseudogene CRYBB2P1 making design of PCR primers for CRYBB2 complex. 
We re-analyzed the family using the original PCR primers and two other primers pairs suggested by Kumar and Santhiya, 1 and were able to confirm that the three mutations in cis, in fact, are PCR sequencing artefacts due to mis-priming. Therefore, the gene conversion events reported for family CC00133 in the original article are incorrect and hereby withdrawn. 
In addition, some errors were introduced in the list of PCR primers (Supplementary Table S1). The errors have been corrected in the Table below. 
Citation: Hansen L, Mikkelsen A, Nürnberg P, Nürnberg G, Anjum I, Eiberg H, Rosenberg T. Erratum in: Comprehensive mutational screening in a cohort of Danish families with hereditary congenital cataract. Invest Ophthalmol Vis Sci. 2009;50:3291–3303. doi:10.1167/iovs.08-3149a
Corrected Supplementary Table S1. 
 
The Following Primer Sequences or Primer Names Have Been Changed
Corrected Supplementary Table S1. 
 
The Following Primer Sequences or Primer Names Have Been Changed
Gene Exon Forward Reverse Length
CRYAB Ex1 GTCTCCATGAACTGCTGGTG* AGGCACTAGCAACCTCCTCA* 498
Ex2 GGATGAATTACCCGGACAGA* ATCCCGACTGTTATGGCTTG* 352
CRYBB1 Ex1 TGTGTGTGCTGGTCTCACAA* TCCCTCCCTTTCTTCCTCTC* 382
Ex2 GCTGGGAAGTAGGGATGAAA* GCCAAGAAAAAGGAGGAGAAA* 493
Ex3 CAGTAAAGAATTGGGGGATGG* CGAGCCTCAGTTTCCTCATC* 483
Ex4 CTTGCCCATAGTCACACAGC* ATCCACGGTCCTTTGACAAC* 462
Ex5 TCCAGACTAGACAGCAGTGGTC* GCCATGGCCTTCTCTAGG* 400
CRYBB2 Ex2† GACCTCGTTTTTCCCTCCTC CTGGGGAGGGACTTTCAGTA 479
Ex3† CCATTTTACAGACGGGGAGA CTGCCAGACCCCAAAACTT 470
Ex4† GTGGGTAAAGGCAGCATAGC GGCAGAGAGAGGGAGTAGGG 378
Ex5† GTGTGCAAGTGTGGTGTGC* GAAGCCAGAGGTCAGCAGAG 669
Ex6† GAGGCTTCACCCTTCCTAGTG TCTCATTTCTCTCTCGCTGTCA* 493
CRYBB3 Ex3 GGCTGGAGAGATGCAGAAAG TTACAGATGCGGAAAACGA* 371
HSF4 Ex3† TCCACTCCACTCCACACATC TTCTCTGAATGGCCAAATCC 468
Ex4-5† AGGCCTGGACCCAAGAGT AGCACCCCTCCTCCTCTTT 492
Ex6-7† CACGTCGAGTTCCAGCAC GTGGAATGGGGTGTCGAG 674
Ex7-8† CAGCCTCGCCATTCTGTG CAGGGGGAGGAATGAGGAT 496
Ex9-10† TAGCAACAGGCCTCAGCTCT TGGCACTGACTTCTCCCTCT 694
Ex11† AGGCTCTGCTTTCCACAGAA GCTTTCTCCCTCCAGTGATG 515
Ex12-13† CTTGATGCATCTGGGTTC GACCAGAGGGCTTGACTCAG 404
Ex13-14† CAGAGCTCTCCTCAGGTGCT* AACTCAGGATTTCCCTGCAA* 431
Ex15† TGGATGTTTTATCCTAACTGAGCA AGGGATAGTCGGGGTAGTGG 395
MAF ex1.1† GAGCGAGGGAGCACATTG* CCGGTTCCTTTTTCACTTCA* 352
ex1.2† AACTGGCAATGAGCAACTCC* GTGGTGGTGGTGGTGGTGGT* 511
ex1.3† AACAGCCACCAGCTCCAG* CTGGTTCTTCTCCGACTCCA* 609
ex1.4† AGCTGGTGACCATGTCTGTG* AGAACTAGCAAGCCCACACC* 407
ex2† AAATCCTGAGTAAGTGCCATTCA* GTTGCATTCCGGGAAACTT* 575
PITX3 Ex2† GCCAGGGAATTTACGAGGA CGAGGCCTTTTCTGAGTCTG* 411
Ex3† GCGAGTGGCTTAGGAGGTC GGTCCGAGTAGTAGGGAGCA 484
References
Kumar KD Kumar GS Santhiya ST. Nonspecific PCR amplification of CRYBB2-pseudogene leads to misconception of natural variation as mutation. Invest Ophthalmol Vis Sci . 2012;53:5770. [CrossRef] [PubMed]
Corrected Supplementary Table S1. 
 
The Following Primer Sequences or Primer Names Have Been Changed
Corrected Supplementary Table S1. 
 
The Following Primer Sequences or Primer Names Have Been Changed
Gene Exon Forward Reverse Length
CRYAB Ex1 GTCTCCATGAACTGCTGGTG* AGGCACTAGCAACCTCCTCA* 498
Ex2 GGATGAATTACCCGGACAGA* ATCCCGACTGTTATGGCTTG* 352
CRYBB1 Ex1 TGTGTGTGCTGGTCTCACAA* TCCCTCCCTTTCTTCCTCTC* 382
Ex2 GCTGGGAAGTAGGGATGAAA* GCCAAGAAAAAGGAGGAGAAA* 493
Ex3 CAGTAAAGAATTGGGGGATGG* CGAGCCTCAGTTTCCTCATC* 483
Ex4 CTTGCCCATAGTCACACAGC* ATCCACGGTCCTTTGACAAC* 462
Ex5 TCCAGACTAGACAGCAGTGGTC* GCCATGGCCTTCTCTAGG* 400
CRYBB2 Ex2† GACCTCGTTTTTCCCTCCTC CTGGGGAGGGACTTTCAGTA 479
Ex3† CCATTTTACAGACGGGGAGA CTGCCAGACCCCAAAACTT 470
Ex4† GTGGGTAAAGGCAGCATAGC GGCAGAGAGAGGGAGTAGGG 378
Ex5† GTGTGCAAGTGTGGTGTGC* GAAGCCAGAGGTCAGCAGAG 669
Ex6† GAGGCTTCACCCTTCCTAGTG TCTCATTTCTCTCTCGCTGTCA* 493
CRYBB3 Ex3 GGCTGGAGAGATGCAGAAAG TTACAGATGCGGAAAACGA* 371
HSF4 Ex3† TCCACTCCACTCCACACATC TTCTCTGAATGGCCAAATCC 468
Ex4-5† AGGCCTGGACCCAAGAGT AGCACCCCTCCTCCTCTTT 492
Ex6-7† CACGTCGAGTTCCAGCAC GTGGAATGGGGTGTCGAG 674
Ex7-8† CAGCCTCGCCATTCTGTG CAGGGGGAGGAATGAGGAT 496
Ex9-10† TAGCAACAGGCCTCAGCTCT TGGCACTGACTTCTCCCTCT 694
Ex11† AGGCTCTGCTTTCCACAGAA GCTTTCTCCCTCCAGTGATG 515
Ex12-13† CTTGATGCATCTGGGTTC GACCAGAGGGCTTGACTCAG 404
Ex13-14† CAGAGCTCTCCTCAGGTGCT* AACTCAGGATTTCCCTGCAA* 431
Ex15† TGGATGTTTTATCCTAACTGAGCA AGGGATAGTCGGGGTAGTGG 395
MAF ex1.1† GAGCGAGGGAGCACATTG* CCGGTTCCTTTTTCACTTCA* 352
ex1.2† AACTGGCAATGAGCAACTCC* GTGGTGGTGGTGGTGGTGGT* 511
ex1.3† AACAGCCACCAGCTCCAG* CTGGTTCTTCTCCGACTCCA* 609
ex1.4† AGCTGGTGACCATGTCTGTG* AGAACTAGCAAGCCCACACC* 407
ex2† AAATCCTGAGTAAGTGCCATTCA* GTTGCATTCCGGGAAACTT* 575
PITX3 Ex2† GCCAGGGAATTTACGAGGA CGAGGCCTTTTCTGAGTCTG* 411
Ex3† GCGAGTGGCTTAGGAGGTC GGTCCGAGTAGTAGGGAGCA 484
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×