October 2005
Volume 46, Issue 10
Free
Cornea  |   October 2005
Androgen Control of Gene Expression in the Mouse Meibomian Gland
Author Affiliations
  • Frank Schirra
    From the Schepens Eye Research Institute, and the
    Department of Ophthalmology, Harvard Medical School, Boston, Massachusetts; the
  • Tomo Suzuki
    From the Schepens Eye Research Institute, and the
    Department of Ophthalmology, Harvard Medical School, Boston, Massachusetts; the
  • Stephen M. Richards
    From the Schepens Eye Research Institute, and the
  • Roderick V. Jensen
    Department of Physics, University of Massachusetts, Boston, Massachusetts; and the
  • Meng Liu
    From the Schepens Eye Research Institute, and the
    Department of Ophthalmology, Harvard Medical School, Boston, Massachusetts; the
  • Michael J. Lombardi
    Department of Physics, University of Massachusetts, Boston, Massachusetts; and the
  • Patricia Rowley
    Department of Physics, University of Massachusetts, Boston, Massachusetts; and the
  • Nathaniel S. Treister
    From the Schepens Eye Research Institute, and the
    Department of Oral Medicine, Infection, and Immunity, Harvard School of Dental Medicine, Boston, Massachusetts.
  • David A. Sullivan
    From the Schepens Eye Research Institute, and the
    Department of Ophthalmology, Harvard Medical School, Boston, Massachusetts; the
Investigative Ophthalmology & Visual Science October 2005, Vol.46, 3666-3675. doi:10.1167/iovs.05-0426
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to Subscribers Only
      Sign In or Create an Account ×
    • Get Citation

      Frank Schirra, Tomo Suzuki, Stephen M. Richards, Roderick V. Jensen, Meng Liu, Michael J. Lombardi, Patricia Rowley, Nathaniel S. Treister, David A. Sullivan; Androgen Control of Gene Expression in the Mouse Meibomian Gland. Invest. Ophthalmol. Vis. Sci. 2005;46(10):3666-3675. doi: 10.1167/iovs.05-0426.

      Download citation file:


      © 2016 Association for Research in Vision and Ophthalmology.

      ×
  • Supplements
Abstract

purpose. In prior work, it has been found that the meibomian gland is an androgen target organ, that androgens modulate lipid production within this tissue, and that androgen deficiency is associated with glandular dysfunction and evaporative dry eye. This study’s purpose was to test the hypothesis that the androgen control of the meibomian gland involves the regulation of gene expression.

methods. Meibomian glands were obtained from orchiectomized mice that were treated with placebo or testosterone for 14 days. Tissues were processed for the analysis of differentially expressed mRNAs by using gene bioarrays, gene chips, and real-time PCR procedures. Bioarray data were analyzed with GeneSifter software (VizX Labs LLC, Seattle, WA).

results. The results show that testosterone influenced the expression of more than 1590 genes in the mouse meibomian gland. This hormone action involved a significant upregulation of 1080 genes (e.g., neuromedin B), and a significant downregulation of 518 genes (e.g., small proline-rich protein 2A). Some of the most significant androgen effects were directed toward stimulation of genes associated with lipid metabolism, sterol biosynthesis, fatty acid metabolism, protein transport, oxidoreductase activity, and peroxisomes.

conclusions. These findings demonstrate that testosterone regulates the expression of numerous genes in the mouse meibomian gland and that many of these genes are involved in lipid metabolic pathways.

Recently, researchers have demonstrated that androgens regulate the meibomian gland, 1 2 3 which is the primary tissue involved in maintaining tear film stability and preventing tear film evaporation. 4 5 6 Androgens modulate meibomian gland function, improve the quality and/or quantity of lipids produced by this tissue, and promote the formation of the tear film’s lipid layer. 1 7 8 Moreover, androgen deficiency, such as occurs during menopause, aging, Sjögren’s syndrome, complete androgen insensitivity syndrome, and the use of antiandrogen medications, 9 10 11 is associated with meibomian gland dysfunction, altered lipid profiles in meibomian gland secretions, tear film instability, and evaporative dry eye. 2 3 12 13 14 These findings are very significant, given that scant information exists concerning the physiological control of this tissue and that meibomian gland dysfunction is the major cause of evaporative dry eye syndromes throughout the world. 15  
However, the mechanism(s) underlying this androgen influence on meibomian gland lipogenesis and function is unknown. It is possible that the hormonal regulation of this tissue is analogous to that of sebaceous glands, given that the meibomian gland is a large sebaceous gland and that androgens control the development, differentiation, and lipid production of these glands throughout the body. 16 17 Androgen effects on sebaceous glands are mediated primarily through hormone binding to androgen receptors within acinar cell nuclei. 17 18 19 This receptor interaction leads to increased gene transcription and the elaboration of proteins that stimulate the synthesis and secretion of lipids. 17 18 19 20 In many sebaceous glands, androgen activity is also enhanced by, or dependent on, the presence of 5α-reductase, an enzyme that converts testosterone into the potent androgen, 5α-dihydrotestosterone. 17  
Consistent with this possibility are the findings that meibomian glands of males and females contain androgen receptor mRNA, androgen receptor protein within acinar epithelial cell nuclei, and the mRNAs for both types 1 and 2 5α-reductase. 21 22 Given these observations, we hypothesized that the androgen control of the meibomian gland, as with other sebaceous glands, involves the regulation of gene expression. The purpose of the present study was to test this hypothesis. 
Materials and Methods
Animals and Hormone Treatment
Young adult BALB/c mice (n = 5–22/group), which had been orchiectomized at 8 to 9 weeks of age by veterinary surgeons, were purchased from Taconic Laboratories (Germantown, NY). Animals were housed in constant-temperature rooms with fixed light–dark intervals of 12 hours. Mice were allowed to recover from surgery for at least 9 days, were anesthetized intraperitoneally with ketamine and xylazine, and received subcutaneous implants of placebo (cholesterol, methyl cellulose, lactose)- or testosterone (10 mg)-containing pellets in the subscapular region. These pellets were obtained from Innovative Research of America (Sarasota, FL) and were designed for the slow, but continual, release of vehicle or physiological amounts of hormone over a 21-day period. After 2 weeks of treatment, mice were killed by CO2 inhalation, and the upper- and lower-lid meibomian glands were removed under direct visualization with a biomicroscope and immediately frozen in liquid nitrogen. All studies with experimental animals were approved by the Institutional Animal Care and Use Committee of The Schepens Eye Research Institute and adhered to the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. 
Molecular Biological Procedures
To determine the effect of testosterone on meibomian gland gene expression, total RNA was isolated from tissues by using TRIzol reagent (Invitrogen Corp., Carlsbad, CA). When indicated, samples were also exposed to RNase-free DNase (Invitrogen), analyzed spectrophotometrically at 260 nm to determine concentration and examined on 6.7% formaldehyde/1.3% agarose (Gibco/BRL, Grand Island, NY) gels to verify RNA integrity. The RNA samples were then processed by utilizing several different technical approaches. 
The principle method to evaluate differential gene expression involved the use of CodeLink Uniset Mouse I Bioarrays (∼10,000 genes; Amersham, Piscataway, NJ). Before array studies, the integrity of glandular RNA preparations was further assessed with a RNA 6000 Nano LabChip with an Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA). The RNA samples were then processed for CodeLink Bioarray hybridization, as previously described. 23 Briefly, cDNA was synthesized from RNA (2 μg) with a CodeLink Expression Assay Reagent Kit (Amersham) and isolated with a QIAquick purification kit (Qiagen, Valencia, CA). After sample drying, cRNA was generated with a CodeLink Expression Assay Reagent Kit (Amersham), recovered with an RNeasy kit (Qiagen) and quantified with an UV spectrophotometer. Fragmented, biotin-labeled cRNA was incubated and agitated (300 rpm shaker) on a CodeLink Bioarray at 37°C for 18 hours. The Bioarray was then washed and exposed to streptavidin-Alexa 647. Bioarrays were scanned by using ScanArray Express software and a ScanArray Express HT scanner (Packard BioScience, Meriden, CT) with the laser set at 635 nm, laser power at 100%, and photomultiplier tube voltage at 60%. Scanned image files were examined by using CodeLink image and data analysis software (Amersham), which generated both raw and normalized hybridization signal intensities for each array spot. The ∼10,000 spot intensities on the microarray image were standardized to a median of 1. Normalized data, with signal intensities exceeding 0.50, were analyzed with GeneSifter software (VizX Labs LLC, Seattle, WA; vizxlabs.com). This program also produced gene ontology and z-score reports. These ontologies, which were organized according to the guidelines of the Gene Ontology Consortium (http://www.geneontology.org/GO.doc.html), 24 included biological processes, molecular functions and cellular components. Statistical analysis of individual gene expression data was conducted with Student’s t-test (two-tailed, unpaired). Data were evaluated with and without log transformation. 
The data from the individual Bioarrays (n = 6) are accessible for downloading through the National Center for Biotechnology Information’s Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov/geo) via series accession number GSE1582. The data will also be available for evaluation through GeneSifter (http://genesifter.net/datacenter/). 
Differentially expressed mRNAs were also analyzed by using GEM 1 (>8,000 genes) and GEM 2 (>9,500 genes) gene chips (Incyte Genomics, Inc., St. Louis, MO). Poly(A) mRNA was isolated from meibomian gland RNA samples by using the MicroPoly(A) Pure mRNA Isolation Kit (Ambion, Inc., Austin, TX). The mRNA concentration was determined with a RiboGreen RNA Quantitation Kit (Molecular Probes, Eugene, OR), according to Incyte’s protocol. After designating mRNA samples (800 ng) for use with either cy3 or cy5 probes, preparations were suspended in TE buffer, placed in siliconized RNase-Free Microfuge Tubes (Ambion) and shipped on dry ice to Incyte for hybridization. Microarray data were sent electronically to the Harvard Center for Genomic Research (Cambridge, MA) and results were downloaded into the Resolver Gene Expression Data Analysis System, version 3.1 (Rosetta Inpharmatics, Kirkland, WA). This system displayed the sequence identification and description of all chip nucleotides, the signal strength of the treatment (i.e., testosterone) and control (i.e., placebo) channels, the relationship between the two channels in terms of ratio and fold change, the comparative P-value and information concerning various quality control fields. In addition, this system determined the error-weighted average ratios for each chip, and normalized data across chips, thereby permitting the combination of GEM 1 and 2 microarray results to achieve a stronger analysis of gene expression. The error model applied by Rosetta Resolver on Incyte’s microarrays has been described in the addenda of recent literature reports. 25 26  
To verify the differential expression of selected mRNAs, quantitative real-time PCR (qPCR) was utilized. cDNAs were transcribed from mRNA samples by employing SuperScript II Reverse Transcriptase (Invitrogen) and oligo dT priming (Promega, Madison, WI). Primers were designed by using Primer Express Software, version 1.5 (Applied Biosystems, Inc., Foster City, CA). Specificity of the primers was verified by performing BLASTn searches on all relevant NCBI nucleotide databases. Particular focus was placed on identifying primers with a 16- to 40-bp length, 20% to 80% GC content, and a melting temperature between 58°C and 60°C, that would generate amplicons between 140 bp and 160 bp. The qPCR was performed by utilizing the specific primers at optimal concentrations (Table 1)and Applied Biosystems’ SYBR Green PCR Master Mix, MicroAmp Optical 96-Well Reaction Plate, ABI PRISM Optical Adhesive Covers and GeneAmp 5700 Sequence Detection System, according to the manufacturer’s protocol. The instrument’s dissociation protocol did not show any secondary PCR products in any of the amplifications. Gene expression was determined by using either the Relative Standard Curve Method or the Comparative CT Method 27 and standardizing levels to that of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) or tubulin, δ1 mRNA. 
Results
To determine the effect of testosterone on meibomian gland gene expression, tissues were obtained from placebo- and androgen-treated, orchiectomized mice (n = 7/group/experiment) and processed for analysis (CodeLink Uniset Mouse I Bioarrays, GE Healthcare; GeneSifter software, VizX Labs). 
Evaluation of non- and log-transformed data from three separate experiments demonstrated that testosterone influenced the expression of more than 1590 genes in the mouse meibomian gland. This hormonal action involved a significant upregulation of 1080 genes (e.g., neuromedin B) and a significant downregulation of 518 genes (e.g., small proline-rich protein 2A; Table 2 ). Of particular interest was the finding that androgen treatment increased the activity of genes encoding various steroid receptors (e.g., types of estrogen, progesterone, and retinoic acid-binding sites), steroidogenic enzymes (e.g., 17β-hydroxysteroid dehydrogenase 7), and endocrine factors (e.g., insulin-like growth factor 1; Table 3 ). Moreover, testosterone altered the expression of several immune-associated genes (e.g., caspase 7; Table 3 ). 
Overall, testosterone treatment had a considerable impact on a diverse array of biological processes, molecular functions, and cellular components in meibomian tissue. Androgen influence extended to such processes as cell growth, metabolism, communication and transport, binding, catalytic activity, signal transduction, and receptor activity (data not shown). Most notable were the effects of testosterone on genes related to lipid dynamics (e.g., monoglyceride lipase, stearoyl-coenzyme A desaturases), protein transport (e.g., adaptor protein complexes), and intracellular vesicles (e.g., peroxisomal biogenesis factors; Table 4 4 ). Indeed, as shown by z-score analyses, androgen exposure led to the up (↑)- and down (↓) regulation of numerous genes associated with lipid metabolism (46↑, 14↓), lipid transport (8↑, 1↓), sterol biosynthesis (5↑, 1↓), fatty acid metabolism (16↑, 4↓), intracellular protein transport (31↑, 10↓), oxidoreductase activity (69↑, 16↓), peroxisomes (15↑, 0↓), mitochondria (76↑, 13↓), and early endosomes (5↑, 0↓; Tables 4 4 5 ). For comparison, testosterone’s effects were least directed toward processes such as cell adhesion, actin binding, and cytoskeleton (Table 5)
In contrast, the meibomian gland gene ontologies with the highest z-scores in the placebo-treated group were those related to mRNA metabolism, cell growth, endonuclease activity, and the cytoskeleton. The lowest scores were associated with processes such as proteolysis, G protein signaling, transport, and mitochondrial activity (Table 5)
To verify in part the bioarray (CodeLink; GE Healthcare) results, additional meibomian gland mRNA samples (n = 22 mice/group/experiment) were processed for gene chip (GEM 1 and 2; Incyte Genomics, Inc.) analyses. The gene chips and bioarrays have 4717 sequences in common. This approach showed that 474 genes were up (n = 319)- or downregulated (n = 155) by testosterone on both the bioarrays (P < 0.05) and gene chips (androgen/placebo ratio = > or <0; data not shown). If comparisons were restricted to those gene-chip genes that had expression ratios >1.5 (↑ or ↓), then 83 genes were identified as being similarly influenced by androgen on both platforms (e.g., Table 6 ). 
For further partial verification of bioarray and gene chip results, selected genes were analyzed by qPCR. As shown in Table 7 , this method confirmed the androgen-induced differential expression of several meibomian gland genes, including those identified by both bioarrays and gene chips (i.e., 17β-hydroxysteroid dehydrogenase 7, Abcd3, elongation of very long chain fatty acids-like 3, fatty acid transport protein 4, insulin-like growth factor 1, and monoglyceride lipase) or by GEM chips alone (i.e., Abca1, fatty acid synthase, cyclin D1, and odorant-binding protein Ia). 
Discussion
Our results demonstrate that androgens regulate the expression of numerous genes in the mouse meibomian gland. Testosterone administration to orchiectomized mice led to a significant increase in the transcriptional products of 1080 genes, including those related to lipid metabolism, sterol biosynthesis, fatty acid metabolism, protein transport, oxidoreductase activity, and peroxisomes. Androgen exposure also suppressed the levels of 518 mRNAs in this glandular tissue. These findings support our hypothesis that the androgen control of the meibomian gland involves the regulation of gene expression. 
The mechanism by which testosterone influences meibomian gland gene expression undoubtedly involves an association with saturable, high-affinity, and steroid-specific receptors in acinar epithelial cell nuclei. Androgen receptors are members of the steroid/thyroid hormone/retinoic acid family of ligand-activated transcription factors and appear to mediate the classic actions of androgens throughout the body. 28 29 After androgen binds to the receptor, the monomeric, activated hormone–receptor complex invariably associates with an androgen response element in the regulatory region of specific target genes; typically dimerizes with another androgen-bound complex; and, in combination with appropriate coactivators and promoter elements, controls gene transcription. 28 29 In support of this hypothesis, it has been shown that androgen receptors exist in sebaceous gland epithelial cells 17 18 19 and androgen activity in these cells may be compromised by androgen receptor defects or antagonists. 30 31 32 Similarly, androgen receptors exist in meibomian gland epithelial cells, 21 22 and androgen receptor disruption or the use of antiandrogen medications is associated with significant meibomian gland dysfunction and striking alterations in the neutral and polar lipid profiles of meibomian gland secretions. 2 3 12 13 14 In addition, we have recently found that many androgen-regulated genes in the meibomian gland appear to depend on the presence of functional androgen receptors. 33  
It is important to note, though, that other processes may also be involved in, or mediate, androgen influence on meibomian gland gene expression. For example, the apparent androgen control of transcriptional activity may actually reflect hormone-induced alterations in mRNA stability, 34 a possibility that remains to be explored. Another possibility is that testosterone’s impact on the meibomian gland is not direct, but rather is mediated through estrogen activity. The meibomian gland contains the mRNA for aromatase cytochrome P-450 (Schirra F, Suzuki T, Dickinson DP, Townsend DJ, Gipson IK, Sullivan DA, manuscript submitted) an enzyme that transforms testosterone into 17β-estradiol. 35 Moreover, the meibomian gland harbors estrogen receptor mRNA and protein. 21 36 However, an estrogen mediation of androgen effects in the meibomian gland is highly unlikely. Recent research has shown that 17β-estradiol treatment of ovariectomized mice elicits a pattern of gene expression in meibomian tissue that is dissimilar from that induced by testosterone (Suzuki T, Schirra F, Jensen RV, Richards SM, Sullivan DA, manuscript submitted). 37 Furthermore, unlike androgens, estrogens appear to decrease sebaceous gland function, 32 38 and this effect has been proposed to be due to an antagonism of androgen action. 39 40  
Our finding that androgens modulate gene expression in the mouse meibomian gland is consistent with our earlier preliminary observations in rabbits. 41 Thus, by using RNA arbitrarily primed polymerase chain reactions, sequencing gels, and autoradiography, we were able to identify 58 differentially expressed mRNAs in the meibomian glands of orchiectomized rabbits treated topically with testosterone- or vehicle. However, analysis of 22 of the corresponding cDNA bands demonstrated that the majority had no significant homology to sequences in the GenBank database (http://www.ncbi.nlm.nih.gov/Genbank; provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD), presumably due to limited data for rabbit sequences. Consequently, to identify genes regulated by androgens in the meibomian gland, we selected mice as an experimental model because of the extensive genetic information available for this species. 
Considering that androgens modulate meibomian gland lipogenesis, the genes upregulated in this tissue by testosterone and the proteins they encode are particularly intriguing. Fatty acid synthase is a critical lipogenic enzyme that is known to be regulated by androgens in other tissues 42 43 and is expressed in meibomian gland epithelial cells (Richards SM, et al. IOVS 2002;43:ARVO E-Abstract 3150). Fatty acid transport protein 4 facilitates the cellular uptake and metabolism of long- and very-long-chain fatty acids, 44 whereas elongation of very-long-chain fatty acids-like 1 and 3 promote the tissue-specific synthesis of very-long-chain fatty acids and sphingolipids. 45 46 These proteins could be involved in the androgen-induced increase of long-chain fatty acids in the total lipid fraction of rabbit meibomian glands. 1 Monoglyceride lipase hydrolyzes tri- and monoglycerides to fatty acids and glycerol. 47 Abca1 and Abcd3, which are members of the adenosine triphosphate (ATP)-binding cassette family, transport various molecules across extra- and intracellular membranes. Abca1 functions as a cholesterol efflux pump in the lipid-removal pathway 48 and thereby serves as a key regulator of cholesterol distribution. 49 50 Abcd3 modulates the importation of fatty acids and/or fatty acyl-CoAs into peroxisomes. 51 3-Hydroxy-3-methylglutaryl-coenzyme A reductase is the rate-limiting enzyme of sterol biosynthesis. 46 Oxysterol binding protein-like 1A, sterol carrier protein 2, liver, lipocalin 3, and phosphatidylcholine transfer protein are involved in the binding and/or transfer of phospholipids. 46 However, whether these proteins play a definitive role in androgen-meibomian gland interactions has yet to be determined. 
Androgens also were shown to control a series of genes that may be very important in the endocrine regulation of the meibomian gland. Thus, testosterone increased the mRNA levels of 17β-hydroxysteroid dehydrogenase 7, a member of the enzyme family that regulates the interconversion of 17-ketosteroids with their corresponding 17β-hydroxysteroids. 52 This enzymatic activity is essential for the metabolism of all active androgens and estrogens in peripheral sites 52 and may mediate the local, intracrine synthesis of androgens from adrenal precursors in the meibomian gland. Testosterone also enhanced the mRNA content of insulin-like growth factor 1, a pleiotropic protein that stimulates DNA synthesis and differentiation in sebaceous cells. 53 Insulin-like growth factor 1 may also promote steroidogenesis 54 and has been shown to be regulated by androgens in other tissues. 55 Moreover, androgen treatment increased the expression of the gene encoding estrogen receptor 2 (β). This receptor, which is upregulated by androgen in the prostate, 56 may inhibit the activity of estrogen receptor 1 (α). 57 Testosterone also elevated the mRNA levels of 11β-hydroxysteroid dehydrogenase 1, an enzyme that catalyzes the conversion of cortisol to the inactive metabolite cortisone. 46 Of interest, testosterone downregulated the gene expression of aldehyde dehydrogenase family 1, subfamily A3 (also called retinaldehyde dehydrogenase 3), an enzyme that stimulates retinoic acid biosynthesis. 46  
In addition to these actions, androgens promoted the expression of genes involved in the sorting (e.g., adaptor protein complexes, RAB9), trafficking (e.g., ADP-ribosylation factor 5, sorting nexin 2), and hydrolysis (e.g., cathepsin B) of proteins in various cellular locations, including the endosome, Golgi apparatus, endoplasmic reticulum, lysosome, proteasome, nucleus, and mitochondrion. 46 Androgens also increased the mRNA levels of epimorphin (an extracellular protein that directs epithelial cell morphogenesis), neuromedin B (a bombesin-like peptide that stimulates epithelial cell proliferation), 58 and phospholipases C-β3 and -β4 (mediators of the production of the second-messenger molecules diacylglycerol and inositol 1,4,5-trisphosphate). 46 Testosterone decreased the mRNA amounts of Ia-associated invariant chain, which plays an essential role in major histocompatibility (MHC) class II antigen processing. 46  
In summary, our results show that testosterone regulates the expression of a number of genes in the mouse meibomian gland and that many of these genes are involved in the production, metabolism, transport, and release of lipids, as well as in steroidogenic pathways. We are currently attempting to determine the meibomian gland distribution of these genes (e.g., by in situ hybridization), in order to identify the cellular targets for androgen action. This procedure will also verify mRNA location within the gland, compared with the conjunctiva, given that very small parts of this latter tissue adhered to the meibomian gland during isolation. In concert with these studies, we are endeavoring to determine whether a variety of these hormone-regulated genes are translated (e.g., by immunohistochemistry and Western blot analysis). This combined information may help to explain, at least in part, the mechanism by which topical androgens reportedly stimulate the synthesis and secretion of meibomian gland lipids, prolong the tear film breakup time, and alleviate dry eye. 7 8  
 
Table 1.
 
Oligonucleotide Primers for Real-Time PCR Confirmation of Selected Genes
Table 1.
 
Oligonucleotide Primers for Real-Time PCR Confirmation of Selected Genes
Accession No. mRNA Orientation Nucleotide Sequence (5′→3′)
Y15733* 17β-hydroxysteroid dehydrogenase 7 Sense TTTGTAAATGCGCTCACTGTGA
Antisense TTTTGGCCCGTGACGTAATT
NM_013454 Abca1 Sense CCCTGCTTCCGTTATCCAACT
Antisense GGACCTTGTGCATGTCCTTAATG
NM_008991 Abcd3 Sense CAGTCGCCCCTTCCTAGATCT
Antisense TCACGCCCAGCCAAAACTATAC
S78355 Cyclin D1 Sense CTGACACCAATCTCCTCAACGA
Antisense CTCACAGACCTCCAGCATCCA
NM_007703 Elongation of very long chain fatty acids-like 3 Sense CTATGAAGGCTGCCAAACTGAAG
Antisense TTGTTGTGTGGCATCCTTTCTC
AF127033 Fatty acid synthase Sense TCCTGGAACGAGAACACGATCT
Antisense GAGACGTGTCACTCCTGGACTTG
AF072759 Fatty acid transport protein 4 Sense GGTGTTGAGGTGCCAGGAACT
Antisense GCAAGAAGCGCAGGAAGATG
BC049235 Glutathione peroxidase 3, † Sense GTTCCAAATGAGCCCAAAGG
Antisense TAGTGTGGGCATGTGGGAGAT
M32599 Glyceraldehyde-3-phosphate dehydrogenase Sense CATGGCCTTCCGTGTTCCTA
Antisense CTGGTCCTCAGTGTAGCCCAA
NM_010512 Insulin-like growth factor 1 Sense ACCTCAGACAGGCATTGTGGAT
Antisense TGAGTCTTGGGCATGTCAGTGT
NM_011844 Monoglyceride lipase Sense GCTCCCCTGAAGCAGTGAAAC
Antisense GGCCCTCCGTAAAGATAGAAGTG
BC028490 Neuromedin B Sense GGGACAGCACCCCCTAACA
Antisense TTTCTTTCGCAGGAGGATCCT
Y10971 Odorant-binding protein Ia Sense ACAATCACTGGGTATTTGCAAGAAG
Antisense TCAGCTCTGTCCACGTTCTCA
AF323080 Resistin, † Sense GCCACCCGTTCCTGTAGCT
Antisense GGATTCGCGCACGTGAGT
AK007928 Small proline-rich protein 2A Sense CATGCCCTCCTGTGCAATTT
Antisense CACTTCCCCTGTTCCTGATGA
NM_019756 Tubulin, δ1 Sense GGAACGGGTGAGGTCATTGT
Antisense TGAATGAGAAGGGCATCTGAAG
Table 2.
 
Androgen Influence on Gene Expression Ratios in the Mouse Meibomian Gland
Table 2.
 
Androgen Influence on Gene Expression Ratios in the Mouse Meibomian Gland
Accession Number Gene Ratio P Ontology
Testosterone > placebo
 NM_026523 Neuromedin B 3.2 0.0105 Signal transduction
 AF218416 Tocopherol (α) transfer protein 3.0 0.0024 Fat-soluble vitamin metabolism
 NM_010898 Neurofibromatosis 2 2.6 0.0013 Phosphate metabolism
 NM_008161 Glutathione peroxidase 3 2.5 0.0036 Response to biotic stimulus
 NM_007588 Calcitonin receptor 2.3 0.0063 Signal transduction
 NM_009998 Cytochrome P450, family 2, subfamily b, polypeptide 20 2.3 0.0001 Electron transport
 NM_010220 FK506-binding protein 5 2.3 0.0032 Protein metabolism
 NM_019501 Trans-prenyltransferase 2.2 0.0003 Isoprenoid biosynthesis
 NM_017370 Haptoglobin 2.2 0.0274 Response to biotic stimulus
 NM_013874 Neuronal d4 domain family member 2.1 0.0003 Transcription
 NM_009848 Ectonucleoside triphosphate diphosphohydrolase 1 2.1 0.0018 Ribonucleotide catabolism
 NM_009947 Copine VI 2.1 0.0106 Lipid metabolism
 NM_007884 Dermatan sulphate proteoglycan 3 2.1 0.0322 Extracellular space
 NM_008288 Hydroxysteroid 11-β dehydrogenase 1 2.1 0.0123 Steroid metabolism
 AK006085 Dipeptidase 3 2.1 0.0089 Protein catabolism
 NM_016870 SA rat hypertension-associated homolog 2.0 0.0030 Carboxylic acid metabolism
Placebo > testosterone
 NM_011468 Small proline-rich protein 2A 4.0 0.0418 Morphogenesis
 NM_011339 Chemokine (C-X-C motif) ligand 15 3.3 0.0094 Response to biotic stimulus
 NM_007894 Eosinophil-associated, ribonuclease A family, member 1 2.7 0.0148 Ribonuclease activity
 AK013634 Cyclin T2 2.4 0.0027 Transcription
 NM_022984 Resistin 2.4 0.0136 Receptor binding
 NM_011585 Cytotoxic granule–associated RNA binding protein 1 2.3 0.0468 Programmed cell death
 AF250135 Splicing factor, arginine/serine-rich 2 2.2 0.0066 RNA splicing, via transesterification reactions
 NM_011478 Small proline-rich protein 3 2.2 0.0263 Structural molecule activity
 NM_008476 Keratin complex 2, basic, gene 6a 2.1 0.0251 Cytoplasm organization and biogenesis
Table 3.
 
Testosterone Regulation of Various Endocrine- and Immune-Related Genes in the Meibomian Gland
Table 3.
 
Testosterone Regulation of Various Endocrine- and Immune-Related Genes in the Meibomian Gland
Upregulation Downregulation
Endocrine
 Estrogen receptor 2 (β)
 Membrane progestin receptor α
 Progesterone receptor membrane component 1
 Progesterone receptor membrane component 2
 Retinoic acid receptor, α
 Retinoid X receptor γ
 Insulin-like 6
 Insulin-like growth factor 1
 Insulin receptor
 Insulin-degrading enzyme
 Thyroid hormone receptor–associated protein 2
 Arginine vasopressin receptor 1B
 Arginine vasopressin receptor 2
 Cholecystokinin
 Cholecystokinin A receptor
 Hydroxysteroid (17-β) dehydrogenase 7
 Retinol dehydrogenase 11
 Retinol dehydrogenase 6
Immune
 IL-5 IL-1 receptor, type I
 IL-12b IL-4 receptor, α
 IL-21 IL-6 signal transducer
 IL-1 receptor-like 1 ligand IL-10 receptor, β
 Chemokine (C-C motif) receptor 4 IFN regulatory factor 1
 Chemokine-binding protein 2 IFN-γ receptor
Caspase 7
Chemokine (C-C motif) ligand 5
Chemokine (C-C motif) ligand 19
Chemokine (C-X3-C motif) ligand 1
Chemokine (C-X-C motif) ligand 16
Table 4.
 
Androgen Control of Meibomian Gland Genes Associated with Lipid Metabolism and Transport, Sterol Biosynthesis, Protein Activity, and Cellular Components
Table 4.
 
Androgen Control of Meibomian Gland Genes Associated with Lipid Metabolism and Transport, Sterol Biosynthesis, Protein Activity, and Cellular Components
Upregulation Downregulation
Lipid metabolism
 1-Acylglycerol-3-phosphate O-acyltransferase 3 3-hydroxy-3-methylglutaryl-coenzyme A synthase 2
 3-Hydroxy-3-methylglutaryl-coenzyme A reductase Acetyl-coenzyme A dehydrogenase, long chain
 Acetyl-coenzyme A dehydrogenase, medium chain Aldehyde dehydrogenase family 1, subfamily A3
 Acyl-CoA synthetase long-chain family member 4 Arachidonate 12-lipoxygenase, 12R type
 Acyl-CoA synthetase long-chain family member 5 Arachidonate 5-lipoxygenase-activating protein
 Acyl-coenzyme A oxidase 3, pristanoyl Copine III
 Adipose differentiation-related protein Fatty acid desaturase 2
 Alcohol dehydrogenase 5 (class III), χ polypeptide Glucosamine
 Cellular nucleic acid–binding protein 1 Glycerol phosphate dehydrogenase 2, mitochondrial
 Colipase, pancreatic GM2 ganglioside activator protein
 Cytochrome P450, 51 Peroxiredoxin 6
 Cytosolic acetyl-CoA hydrolase Protein kinase, cAMP dependent regulatory, type II beta
 Cytosolic acyl-CoA thioesterase 1 RIKEN cDNA 5133401H06 gene
 Elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1 Sortilin-related receptor, LDLR class A repeats-containing
Sphingosine phosphate lyase 1
 Elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 3
 Emopamil binding protein-like
 Hydroxysteroid 17-β dehydrogenase 7
 Hydroxysteroid 11-β dehydrogenase 1
 Gastric lipase
 Longevity assurance homolog 4 (S. cerevisiae)
 Membrane-interacting protein of RGS16
 Monoglyceride lipase
 NAD(P) dependent steroid dehydrogenase-like
 Oxysterol binding protein-like 1A
 Peroxisome proliferator activator receptor δ
 Phosphatidylserine synthase 2
 Phospholipase A2, group IIC
 Phospholipase A2, group IIE
 Phospholipase A2, group IIF
 Phospholipase A2, group XIIA
 Phospholipase C, β3
 Phospholipase C, β4
 Phytanoyl-CoA hydroxylase
 SA rat hypertension-associated homolog
 Sodium channel, voltage-gated, type XI, alpha polypeptide
 Sphingomyelin phosphodiesterase 1, acid lysosomal
 StAR-related lipid transfer (START) domain containing 5
 Stearoyl-coenzyme A desaturase 1
 Stearoyl-coenzyme A desaturase 2
 Stearoyl-coenzyme A desaturase 3
 Sterol carrier protein 2, liver
 Sterol-C4-methyl oxidase-like
 Sulfotransferase family 1A, phenol-preferring, member 1
 Triosephosphate isomerase 1
Lipid transport
 Adipose differentiation-related protein Sortilin-related receptor, LDLR class A repeats-containing
 Apolipoprotein A-V
 Apolipoprotein E
 Niemann pick type C1
 Oxysterol binding protein-like 1A
 Phosphatidylcholine transfer protein
 StAR-related lipid transfer (START) domain containing 5
 Sterol carrier protein 2, liver
Intracellular protein transport
 Adaptor protein complex AP-1, μ2 subunit A kinase (PRKA) anchor protein (gravin) 12
 Adaptor protein complex AP-1, σ1 CDNA sequence BC003281
 Adaptor-related protein complex 3, β1 subunit Ia-associated invariant chain
 Adaptor-related protein complex 3, μ1 subunit Nuclear factor of κ light chain gene enhancer in B-cells inhibitor, α
 Adaptor-related protein complex 3, σ2 subunit Nuclear RNA export factor 1 homolog (S. cerevisiae)
 Adaptor-related protein complex AP-4, σ1 Ras-GTPase-activating protein SH3-domain binding protein
 ADP-ribosylation factor 5 Secretory carrier membrane protein 3
 B-cell receptor-associated protein 29 Splicing factor, arginine/serine-rich 1 (ASF/SF2)
 Cathepsin B Transforming growth factor, β1
 Choroidermia Transforming, acidic coiled-coil containing protein 3
 Coatomer protein complex, subunit ε
 Epimorphin
 Histocompatibility 47
(continues)
Table 4A.
 
(Continued). Androgen Control of Meibomian Gland Genes Associated with Lipid Metabolism and Transport, Sterol Biosynthesis, Protein Activity, and Cellular Components
Table 4A.
 
(Continued). Androgen Control of Meibomian Gland Genes Associated with Lipid Metabolism and Transport, Sterol Biosynthesis, Protein Activity, and Cellular Components
Upregulation Downregulation
Intracellular protein transport (continued)
 Karyopherin (importin) β1
 PDZ domain containing 11
 Peroxisomal biogenesis factor 13
 RAB1B, member RAS oncogene family
 RAB2, member RAS oncogene family
 Rab38, member of RAS oncogene family
 RAB4B, member RAS oncogene family
 RAB9, member RAS oncogene family
 RIKEN cDNA 1110034E15 gene
 RIKEN cDNA 5830417C01 gene
 RIKEN cDNA A430019L02 gene
 Sec61 β subunit
 Signal recognition particle 54
 Sortilin-related VPS10 domain containing receptor 2
 Sorting nexin 2
 Translocase of inner mitochondrial membrane 8 homolog b (yeast)
 Translocase of outer mitochondrial membrane 20 homolog (yeast)
 Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, β pol
Peroxisome (also microbody)
 2-4-Dienoyl-coenzyme A reductase 2, peroxisomal
 Acyl-coenzyme A oxidase 3, pristanoyl
 ATP-binding cassette, sub-family D (ALD), member 3
 Catalase
 Mpv17 transgene, kidney disease mutant
 Peroxisomal biogenesis factor 13
 Peroxisomal membrane protein 3
 Peroxisomal membrane protein 4
 Peroxisomal membrane protein 4
 Peroxisome biogenesis factor 19
 Phytanoyl-CoA hydroxylase
 Polyamine oxidase
 Solute carrier family 25
 Sterol carrier protein 2, liver
Early endosome
 CD1d1 antigen
 RAB34, member of RAS oncogene family
 RAB5A, member RAS oncogene family
 Tumor protein D52-like 1
 Vesicle-associated membrane protein 8
Table 5.
 
High and Low Expression of Gene Ontologies in the Meibomian Glands of Placebo- or Testosterone-Treated Mice
Table 5.
 
High and Low Expression of Gene Ontologies in the Meibomian Glands of Placebo- or Testosterone-Treated Mice
Ontology Gene List T Genes ↑ P Genes ↑ Array Genes T z-Score P z-Score
Biological process
 Lipid metabolism 60 46 14 265 3.56 0.47
 Fatty acid metabolism 20 16 4 77 2.87 0.21
 Lipid transport 9 8 1 33 2.51 −0.45
 Morphogenesis 90 52 38 652 −2.4 1.45
 Cell adhesion 34 19 15 293 −2.4 0.36
 Protein modification 94 56 38 728 −2.81 0.72
 mRNA metabolism 24 9 15 95 −0.4 5.16
 Regulation of cell growth 11 3 8 38 −0.57 4.79
 Cell growth 12 3 9 46 −0.93 4.79
 Proteolysis and peptidolysis 49 43 6 344 1.09 −2.65
 G-protein-coupled receptor signaling pathway 52 47 5 337 1.96 −2.86
 Catabolism 75 66 9 495 1.95 −3.14
Molecular function
 Oxidoreductase activity 85 69 16 396 4.39 −0.82
 Lyase activity 21 16 5 79 2.73 0.59
 Carboxylic ester hydrolase activity 12 12 0 57 2.51 −1.72
 Binding 668 435 233 4340 −2.57 2.3
 Actin binding 11 3 8 118 −2.91 0.95
 Protein binding 214 125 89 1540 −3.8 1.81
S-adenosylmethionine-dependent methyltransferase activity 11 3 8 38 −0.57 4.62
 RNA binding 49 24 25 246 −0.52 3.89
 Endonuclease activity 12 5 7 41 0.29 3.62
 Rhodopsin-like receptor activity 30 29 1 178 2.4 −2.72
 Transporter activity 114 91 23 788 0.74 −2.73
 G-protein coupled receptor activity 36 34 2 228 2.05 −2.86
Cellular component
 Microbody 15 15 0 45 4.82 −1.5
 Peroxisome 15 15 0 45 4.82 −1.5
 Mitochondrion 89 76 13 485 3.44 −2.22
 Extracellular matrix 10 7 3 130 −2.06 −1.32
 Nucleus 273 166 107 1751 −2.31 3.12
 Cytoskeleton 56 24 32 340 −2.37 4.15
 Cytoskeleton 56 24 32 340 −2.37 4.15
 Intracellular 618 409 209 3744 −0.12 3.6
 Nucleus 273 166 107 1751 −2.31 3.12
 Extracellular space 250 185 65 1705 −0.17 −2.1
 Mitochondrion 89 76 13 485 3.44 −2.22
 Integral to membrane 322 240 82 2108 0.75 −2.23
Table 6.
 
GEM Chip Confirmation of Selected Bioarray Results
Table 6.
 
GEM Chip Confirmation of Selected Bioarray Results
Accession Number Gene Ontology
Testosterone > placebo
 NM_010476 Hydroxysteroid (17β) dehydrogenase 7 Steroid metabolism
 NM_008288 Hydroxysteroid 11β dehydrogenase 1 Steroid metabolism
 NM_013754 Insulin-like 6 Receptor binding
 NM_026058 Longevity assurance homolog 4 (S. cerevisiae) Sphingoid biosynthesis
 AK009450 Membrane progestin receptor α Signal transducer activity
 NM_010784 Midkine Cell cycle
 NM_010898 Neurofibromatosis 2 Phosphate metabolism
 NM_020573 Oxysterol binding protein-like 1A Lipid transport
 NM_026438 Pyrophosphatase Hydrolysis of diphosphate bonds
 NM_021557 Retinol dehydrogenase 11 Oxidoreductase activity
 M62361 Sterol carrier protein 2, liver Carboxylic acid metabolism
Placebo > testosterone
 NM_007606 Carbonic anhydrase 3 One-carbon compound metabolism
 K02782 Complement component 3 Vesicle-mediated transport
 NM_011469 Small proline-rich protein 2B Structural molecule activity
Table 7.
 
Verification of Selected Bioarray and Gene Chip Results
Table 7.
 
Verification of Selected Bioarray and Gene Chip Results
Gene CodeLink Ratio GEM Ratio qPCR Ratio
Testosterone > placebo
 17β-Hydroxysteroid dehydrogenase 7 1.77 2.80 2.21
 ATP-binding cassette, sub-family A, member 1 / 1.55 2.17
 ATP-binding cassette, sub-family D, member 3 1.41 1.82 2.19
 Elongation of very long chain fatty acids-like 3 1.40 1.91 1.65
 Fatty acid synthase / 2.10 2.08
 Fatty acid transport protein 4 1.25 2.20 1.57
 Glutathione peroxidase 3 2.52 2.09*
 Insulin-like growth factor 1 1.36 1.90 1.51†
 Monoglyceride lipase 1.39 2.09 2.07
 Neuromedin B 3.21 2.10
Placebo > testosterone
 Cyclin D1 2.49 1.57†
 Odorant-binding protein Ia 29.41 55.0
 Resistin 2.42 2.97*
 Small proline-rich protein 2A 3.96 3.41 4.30
The authors thank Christian B. Wade (Seattle, WA) for assistance with the GeneSifter software, and the Harvard Center for Genomic Research for help with processing the GEM 1 and 2 gene chip data. 
SullivanDA, SullivanBD, UllmanMD, et al. Androgen influence on the meibomian gland. Invest Ophthalmol Vis Sci. 2000;41:3732–3742. [PubMed]
KrenzerKL, DanaMR, UllmanMD, et al. Effect of androgen deficiency on the human meibomian gland and ocular surface. J Clin Endocrinol Metab. 2000;85:4874–4882. [PubMed]
SullivanBD, EvansJE, KrenzerKL, DanaMR, SullivanDA. Impact of antiandrogen treatment on the fatty acid profile of neutral lipids in human meibomian gland secretions. J Clin Endocrinol Metab. 2000;85:4866–4873. [PubMed]
DriverPJ, LempMA. Meibomian gland dysfunction. Surv Ophthalmol. 1996;40:343–367. [CrossRef] [PubMed]
McCulleyJP, ShineW. A compositional based model for the tear film lipid layer. Trans Am Ophthalmol Soc. 1997;95:79–88.discussion 88–93 [PubMed]
BronAJ, TiffanyJM, GouveiaSM, YokoiN, VoonLW. Functional aspects of the tear film lipid layer. Exp Eye Res. 2004;78:347–360. [CrossRef] [PubMed]
ZeligsM. Dehydroepiandrosterone therapy for the treatment of dry eye disorders. 1994;International patent application WO 94/04155
WordaC, NeppJ, HuberJC, SatorMO. Treatment of keratoconjunctivitis sicca with topical androgen. Maturitas. 2001;37:209–212. [CrossRef] [PubMed]
LabrieF, BelangerA, CusanL, GomezJL, CandasB. Marked decline in serum concentrations of adrenal C19 sex steroid precursors and conjugated androgen metabolites during aging. J Clin Endocrinol Metab. 1997;82:2396–2402. [CrossRef] [PubMed]
BrinkmannAO. Molecular basis of androgen insensitivity. Mol Cell Endocrinol. 2001;179:105–109. [CrossRef] [PubMed]
SullivanDA, BelangerA, CermakJM, et al. Are women with Sjögren’s syndrome androgen-deficient?. J Rheumatol. 2003;30:2413–2419. [PubMed]
SullivanBD, EvansJE, DanaMR, SullivanDA. Impact of androgen deficiency on the lipid profiles in human meibomian gland secretions. Adv Exp Med Biol. 2002;506:449–458. [PubMed]
CermakJM, KrenzerKL, SullivanRM, DanaMR, SullivanDA. Is complete androgen insensitivity syndrome associated with alterations in the meibomian gland and ocular surface?. Cornea. 2003;22:516–521. [CrossRef] [PubMed]
SullivanBD, EvansJE, CermakJM, KrenzerKL, DanaMR, SullivanDA. Complete androgen insensitivity syndrome: effect on human meibomian gland secretions. Arch Ophthalmol. 2002;120:1689–1699. [CrossRef] [PubMed]
ShimazakiJ, SakataM, TsubotaK. Ocular surface changes and discomfort in patients with meibomian gland dysfunction. Arch Ophthalmol. 1995;113:1266–1270. [CrossRef] [PubMed]
ThodyAJ, ShusterS. Control and function of sebaceous glands. Physiol Rev. 1989;69:383–416. [PubMed]
DeplewskiD, RosenfieldRL. Role of hormones in pilosebaceous unit development. Endocr Rev. 2000;21:363–392. [CrossRef] [PubMed]
MiyakeK, CilettiN, LiaoS, RosenfieldRL. Androgen receptor expression in the preputial gland and its sebocytes. J Invest Dermatol. 1994;103:721–725. [CrossRef] [PubMed]
LuderschmidtC, EiermannW, JawnyJ. Steroid hormone receptors and their relevance for sebum production in the sebaceous gland ear model of the Syrian hamster. Arch Dermatol Res. 1983;275:175–180. [CrossRef] [PubMed]
PuyLA, TurgeonC, GagneD, et al. Localization and regulation of expression of the FAR-17A gene in the hamster flank organs. J Invest Dermatol. 1996;107:44–50. [CrossRef] [PubMed]
WickhamLA, GaoJ, TodaI, RochaEM, OnoM, SullivanDA. Identification of androgen, estrogen and progesterone receptor mRNAs in the eye. Acta Ophthalmol Scand. 2000;78:146–153. [CrossRef] [PubMed]
RochaEM, WickhamLA, da SilveiraLA, et al. Identification of androgen receptor protein and 5alpha-reductase mRNA in human ocular tissues. Br J Ophthalmol. 2000;84:76–84. [CrossRef] [PubMed]
TreisterNS, RichardsSM, LombardiMJ, RowleyP, JensenRV, SullivanDA. Sex-related differences in gene expression in salivary glands of BALB/c mice. J Dent Res. 2005;84:160–165. [CrossRef] [PubMed]
AshburnerM, BallCA, BlakeJA, et al. Gene ontology: tool for the unification of biology. The Gene Ontology Consortium. Nat Genet. 2000;25:25–29. [CrossRef] [PubMed]
HughesTR, MartonMJ, JonesAR, et al. Functional discovery via a compendium of expression profiles. Cell. 2000;102:109–126. [CrossRef] [PubMed]
RobertsCJ, NelsonB, MartonMJ, et al. Signaling and circuitry of multiple MAPK pathways revealed by a matrix of global gene expression profiles. Science. 2000;287:873–880. [CrossRef] [PubMed]
User Bulletin #2: ABI Prism 7700 Sequence Detection System. October, 2001;Applied Biosystems, Inc. Foster City, CA.updated version
ClarkJH, SchraderWT, O’MalleyBW. Mechanisms of action of steroid hormones.WilsonJD FosterDW eds. Williams Textbook of Endocrinology. 1992;35–90.WB Saunders Philadelphia.
McPhaulMJ, YoungM. Complexities of androgen action. J Am Acad Dermatol. 2001;45:S87–S94. [CrossRef] [PubMed]
Imperato-McGinleyJ, GautierT, CaiLQ, YeeB, EpsteinJ, PochiP. The androgen control of sebum production: studies of subjects with dihydrotestosterone deficiency and complete androgen insensitivity. J Clin Endocrinol Metab. 1993;76:524–528. [PubMed]
SchroderHG, ZieglerM, NickischK, KaufmannJ, el EtrebyMF. Effects of topically applied antiandrogenic compounds on sebaceous glands of hamster ears and flank organs. J Invest Dermatol. 1989;92:769–773. [CrossRef] [PubMed]
WirthH, GloorM, KimmelW. Influence of cyproterone acetate and estradiol on cell kinetics in the sebaceous gland of the golden hamster ear. Arch Dermatol Res. 1980;268:277–281. [CrossRef] [PubMed]
YamagamiH, SchirraF, LiuM, RichardsSM, SullivanBD, SullivanDA. Androgen influence on gene expression in the meibomian gland. Adv Exp Med Biol. 2002;506:477–481. [PubMed]
YeapBB, KruegerRG, LeedmanPJ. Differential posttranscriptional regulation of androgen receptor gene expression by androgen in prostate and breast cancer cells. Endocrinology. 1999;140:3282–3291. [PubMed]
BulunSE, SimpsonER. Regulation of aromatase expression in human tissues. Breast Cancer Res Treat. 1994;30:19–29. [CrossRef] [PubMed]
EsmaeliB, HarveyJT, HewlettB. Immunohistochemical evidence for estrogen receptors in meibomian glands. Ophthalmology. 2000;107:180–184. [CrossRef] [PubMed]
SuzukiT, SchaumbergDA, SullivanBD, et al. Do estrogen and progesterone play a role in the dry eye of Sjögren’s syndrome?. Ann NY Acad Sci. 2002;966:223–225. [CrossRef] [PubMed]
PochiPE, StraussJS. Endocrinologic control of the development and activity of the human sebaceous gland. J Invest Dermatol. 1974;62:191–201. [CrossRef] [PubMed]
SchaferG, KrauseW. The effect of estradiol on the sebaceous gland of the hamster ear and its antagonism by tamoxifen. Arch Dermatol Res. 1985;277:230–234. [CrossRef] [PubMed]
Sansone-BazzanoG, ReisnerRM, BazzanoG. A possible mechanism of action of estrogen at the cellular level in a model sebaceous gland. J Invest Dermatol. 1972;59:299–304. [CrossRef] [PubMed]
SteagallRJ, YamagamiH, WickhamLA, SullivanDA. Androgen control of gene expression in the rabbit meibomian gland. Adv Exp Med Biol. 2002;506:465–476. [PubMed]
SwinnenJV, EsquenetM, GoossensK, HeynsW, VerhoevenG. Androgens stimulate fatty acid synthase in the human prostate cancer cell line LNCaP. Cancer Res. 1997;57:1086–1090. [PubMed]
SwinnenJV, VerhoevenG. Androgens and the control of lipid metabolism in human prostate cancer cells. J Steroid Biochem Mol Biol. 1998;65:191–198. [CrossRef] [PubMed]
HerrmannT, BuchkremerF, GoschI, HallAM, BernlohrDA, StremmelW. Mouse fatty acid transport protein 4 (FATP4): characterization of the gene and functional assessment as a very long chain acyl-CoA synthetase. Gene. 2001;270:31–40. [CrossRef] [PubMed]
TvrdikP, WesterbergR, SilveS, et al. Role of a new mammalian gene family in the biosynthesis of very long chain fatty acids and sphingolipids. J Cell Biol. 2000;149:707–718. [CrossRef] [PubMed]
Universal Protein Resource Knowledgebase. ;http://www.expasy.uniprot.org/index.shtml.
KarlssonM, ReueK, XiaYR, et al. Exon-intron organization and chromosomal localization of the mouse monoglyceride lipase gene. Gene. 2001;272:11–18. [CrossRef] [PubMed]
LawnRM, WadeDP, GarvinMR, et al. The Tangier disease gene product ABC1 controls the cellular apolipoprotein-mediated lipid removal pathway. J Clin Invest. 1999;104:R25–31. [CrossRef] [PubMed]
Santamarina-FojoS, RemaleyAT, NeufeldEB, BrewerHB, Jr. Regulation and intracellular trafficking of the ABCA1 transporter. J Lipid Res. 2001;42:1339–1345. [PubMed]
WangN, SilverDL, ThieleC, TallAR. ATP-binding cassette transporter A1 (ABCA1) functions as a cholesterol efflux regulatory protein. J Biol Chem. 2001;276:23742–23747. [CrossRef] [PubMed]
HettemaEH, TabakHF. Transport of fatty acids and metabolites across the peroxisomal membrane. Biochim Biophys Acta. 2000;1486:18–27. [CrossRef] [PubMed]
LabrieF, Luu-TheV, LinSX, et al. Intracrinology: role of the family of 17 beta-hydroxysteroid dehydrogenases in human physiology and disease. J Mol Endocrinol. 2000;25:1–16. [CrossRef] [PubMed]
DeplewskiD, RosenfieldRL. Growth hormone and insulin-like growth factors have different effects on sebaceous cell growth and differentiation. Endocrinology. 1999;140:4089–4094. [PubMed]
MesianoS, KatzSL, LeeJY, JaffeRB. Insulin-like growth factors augment steroid production and expression of steroidogenic enzymes in human fetal adrenal cortical cells: implications for adrenal androgen regulation. J Clin Endocrinol Metab. 1997;82:1390–1396. [PubMed]
GoriF, HofbauerLC, ConoverCA, KhoslaS. Effects of androgens on the insulin-like growth factor system in an androgen-responsive human osteoblastic cell line. Endocrinology. 1999;140:5579–5586. [CrossRef] [PubMed]
AsanoK, MaruyamaS, UsuiT, FujimotoN. Regulation of estrogen receptor alpha and beta expression by testosterone in the rat prostate gland. Endocr J. 2003;50:281–287. [CrossRef] [PubMed]
HallJM, McDonnellDP. The estrogen receptor beta-isoform (ERbeta) of the human estrogen receptor modulates ERalpha transcriptional activity and is a key regulator of the cellular response to estrogens and antiestrogens. Endocrinology. 1999;140:5566–5578. [PubMed]
MatusiakD, GloverS, NathanielR, MatkowskyjK, YangJ, BenyaRV. Neuromedin B and its receptor are mitogens in both normal and malignant epithelial cells lining the colon. Am J Physiol. 2005;288:G718–G728.
StearsRL, MartinskyT, SchenaM. Trends in microarray analysis. Nat Med. 2003;9:140–145. [CrossRef] [PubMed]
Table 1.
 
Oligonucleotide Primers for Real-Time PCR Confirmation of Selected Genes
Table 1.
 
Oligonucleotide Primers for Real-Time PCR Confirmation of Selected Genes
Accession No. mRNA Orientation Nucleotide Sequence (5′→3′)
Y15733* 17β-hydroxysteroid dehydrogenase 7 Sense TTTGTAAATGCGCTCACTGTGA
Antisense TTTTGGCCCGTGACGTAATT
NM_013454 Abca1 Sense CCCTGCTTCCGTTATCCAACT
Antisense GGACCTTGTGCATGTCCTTAATG
NM_008991 Abcd3 Sense CAGTCGCCCCTTCCTAGATCT
Antisense TCACGCCCAGCCAAAACTATAC
S78355 Cyclin D1 Sense CTGACACCAATCTCCTCAACGA
Antisense CTCACAGACCTCCAGCATCCA
NM_007703 Elongation of very long chain fatty acids-like 3 Sense CTATGAAGGCTGCCAAACTGAAG
Antisense TTGTTGTGTGGCATCCTTTCTC
AF127033 Fatty acid synthase Sense TCCTGGAACGAGAACACGATCT
Antisense GAGACGTGTCACTCCTGGACTTG
AF072759 Fatty acid transport protein 4 Sense GGTGTTGAGGTGCCAGGAACT
Antisense GCAAGAAGCGCAGGAAGATG
BC049235 Glutathione peroxidase 3, † Sense GTTCCAAATGAGCCCAAAGG
Antisense TAGTGTGGGCATGTGGGAGAT
M32599 Glyceraldehyde-3-phosphate dehydrogenase Sense CATGGCCTTCCGTGTTCCTA
Antisense CTGGTCCTCAGTGTAGCCCAA
NM_010512 Insulin-like growth factor 1 Sense ACCTCAGACAGGCATTGTGGAT
Antisense TGAGTCTTGGGCATGTCAGTGT
NM_011844 Monoglyceride lipase Sense GCTCCCCTGAAGCAGTGAAAC
Antisense GGCCCTCCGTAAAGATAGAAGTG
BC028490 Neuromedin B Sense GGGACAGCACCCCCTAACA
Antisense TTTCTTTCGCAGGAGGATCCT
Y10971 Odorant-binding protein Ia Sense ACAATCACTGGGTATTTGCAAGAAG
Antisense TCAGCTCTGTCCACGTTCTCA
AF323080 Resistin, † Sense GCCACCCGTTCCTGTAGCT
Antisense GGATTCGCGCACGTGAGT
AK007928 Small proline-rich protein 2A Sense CATGCCCTCCTGTGCAATTT
Antisense CACTTCCCCTGTTCCTGATGA
NM_019756 Tubulin, δ1 Sense GGAACGGGTGAGGTCATTGT
Antisense TGAATGAGAAGGGCATCTGAAG
Table 2.
 
Androgen Influence on Gene Expression Ratios in the Mouse Meibomian Gland
Table 2.
 
Androgen Influence on Gene Expression Ratios in the Mouse Meibomian Gland
Accession Number Gene Ratio P Ontology
Testosterone > placebo
 NM_026523 Neuromedin B 3.2 0.0105 Signal transduction
 AF218416 Tocopherol (α) transfer protein 3.0 0.0024 Fat-soluble vitamin metabolism
 NM_010898 Neurofibromatosis 2 2.6 0.0013 Phosphate metabolism
 NM_008161 Glutathione peroxidase 3 2.5 0.0036 Response to biotic stimulus
 NM_007588 Calcitonin receptor 2.3 0.0063 Signal transduction
 NM_009998 Cytochrome P450, family 2, subfamily b, polypeptide 20 2.3 0.0001 Electron transport
 NM_010220 FK506-binding protein 5 2.3 0.0032 Protein metabolism
 NM_019501 Trans-prenyltransferase 2.2 0.0003 Isoprenoid biosynthesis
 NM_017370 Haptoglobin 2.2 0.0274 Response to biotic stimulus
 NM_013874 Neuronal d4 domain family member 2.1 0.0003 Transcription
 NM_009848 Ectonucleoside triphosphate diphosphohydrolase 1 2.1 0.0018 Ribonucleotide catabolism
 NM_009947 Copine VI 2.1 0.0106 Lipid metabolism
 NM_007884 Dermatan sulphate proteoglycan 3 2.1 0.0322 Extracellular space
 NM_008288 Hydroxysteroid 11-β dehydrogenase 1 2.1 0.0123 Steroid metabolism
 AK006085 Dipeptidase 3 2.1 0.0089 Protein catabolism
 NM_016870 SA rat hypertension-associated homolog 2.0 0.0030 Carboxylic acid metabolism
Placebo > testosterone
 NM_011468 Small proline-rich protein 2A 4.0 0.0418 Morphogenesis
 NM_011339 Chemokine (C-X-C motif) ligand 15 3.3 0.0094 Response to biotic stimulus
 NM_007894 Eosinophil-associated, ribonuclease A family, member 1 2.7 0.0148 Ribonuclease activity
 AK013634 Cyclin T2 2.4 0.0027 Transcription
 NM_022984 Resistin 2.4 0.0136 Receptor binding
 NM_011585 Cytotoxic granule–associated RNA binding protein 1 2.3 0.0468 Programmed cell death
 AF250135 Splicing factor, arginine/serine-rich 2 2.2 0.0066 RNA splicing, via transesterification reactions
 NM_011478 Small proline-rich protein 3 2.2 0.0263 Structural molecule activity
 NM_008476 Keratin complex 2, basic, gene 6a 2.1 0.0251 Cytoplasm organization and biogenesis
Table 3.
 
Testosterone Regulation of Various Endocrine- and Immune-Related Genes in the Meibomian Gland
Table 3.
 
Testosterone Regulation of Various Endocrine- and Immune-Related Genes in the Meibomian Gland
Upregulation Downregulation
Endocrine
 Estrogen receptor 2 (β)
 Membrane progestin receptor α
 Progesterone receptor membrane component 1
 Progesterone receptor membrane component 2
 Retinoic acid receptor, α
 Retinoid X receptor γ
 Insulin-like 6
 Insulin-like growth factor 1
 Insulin receptor
 Insulin-degrading enzyme
 Thyroid hormone receptor–associated protein 2
 Arginine vasopressin receptor 1B
 Arginine vasopressin receptor 2
 Cholecystokinin
 Cholecystokinin A receptor
 Hydroxysteroid (17-β) dehydrogenase 7
 Retinol dehydrogenase 11
 Retinol dehydrogenase 6
Immune
 IL-5 IL-1 receptor, type I
 IL-12b IL-4 receptor, α
 IL-21 IL-6 signal transducer
 IL-1 receptor-like 1 ligand IL-10 receptor, β
 Chemokine (C-C motif) receptor 4 IFN regulatory factor 1
 Chemokine-binding protein 2 IFN-γ receptor
Caspase 7
Chemokine (C-C motif) ligand 5
Chemokine (C-C motif) ligand 19
Chemokine (C-X3-C motif) ligand 1
Chemokine (C-X-C motif) ligand 16
Table 4.
 
Androgen Control of Meibomian Gland Genes Associated with Lipid Metabolism and Transport, Sterol Biosynthesis, Protein Activity, and Cellular Components
Table 4.
 
Androgen Control of Meibomian Gland Genes Associated with Lipid Metabolism and Transport, Sterol Biosynthesis, Protein Activity, and Cellular Components
Upregulation Downregulation
Lipid metabolism
 1-Acylglycerol-3-phosphate O-acyltransferase 3 3-hydroxy-3-methylglutaryl-coenzyme A synthase 2
 3-Hydroxy-3-methylglutaryl-coenzyme A reductase Acetyl-coenzyme A dehydrogenase, long chain
 Acetyl-coenzyme A dehydrogenase, medium chain Aldehyde dehydrogenase family 1, subfamily A3
 Acyl-CoA synthetase long-chain family member 4 Arachidonate 12-lipoxygenase, 12R type
 Acyl-CoA synthetase long-chain family member 5 Arachidonate 5-lipoxygenase-activating protein
 Acyl-coenzyme A oxidase 3, pristanoyl Copine III
 Adipose differentiation-related protein Fatty acid desaturase 2
 Alcohol dehydrogenase 5 (class III), χ polypeptide Glucosamine
 Cellular nucleic acid–binding protein 1 Glycerol phosphate dehydrogenase 2, mitochondrial
 Colipase, pancreatic GM2 ganglioside activator protein
 Cytochrome P450, 51 Peroxiredoxin 6
 Cytosolic acetyl-CoA hydrolase Protein kinase, cAMP dependent regulatory, type II beta
 Cytosolic acyl-CoA thioesterase 1 RIKEN cDNA 5133401H06 gene
 Elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1 Sortilin-related receptor, LDLR class A repeats-containing
Sphingosine phosphate lyase 1
 Elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 3
 Emopamil binding protein-like
 Hydroxysteroid 17-β dehydrogenase 7
 Hydroxysteroid 11-β dehydrogenase 1
 Gastric lipase
 Longevity assurance homolog 4 (S. cerevisiae)
 Membrane-interacting protein of RGS16
 Monoglyceride lipase
 NAD(P) dependent steroid dehydrogenase-like
 Oxysterol binding protein-like 1A
 Peroxisome proliferator activator receptor δ
 Phosphatidylserine synthase 2
 Phospholipase A2, group IIC
 Phospholipase A2, group IIE
 Phospholipase A2, group IIF
 Phospholipase A2, group XIIA
 Phospholipase C, β3
 Phospholipase C, β4
 Phytanoyl-CoA hydroxylase
 SA rat hypertension-associated homolog
 Sodium channel, voltage-gated, type XI, alpha polypeptide
 Sphingomyelin phosphodiesterase 1, acid lysosomal
 StAR-related lipid transfer (START) domain containing 5
 Stearoyl-coenzyme A desaturase 1
 Stearoyl-coenzyme A desaturase 2
 Stearoyl-coenzyme A desaturase 3
 Sterol carrier protein 2, liver
 Sterol-C4-methyl oxidase-like
 Sulfotransferase family 1A, phenol-preferring, member 1
 Triosephosphate isomerase 1
Lipid transport
 Adipose differentiation-related protein Sortilin-related receptor, LDLR class A repeats-containing
 Apolipoprotein A-V
 Apolipoprotein E
 Niemann pick type C1
 Oxysterol binding protein-like 1A
 Phosphatidylcholine transfer protein
 StAR-related lipid transfer (START) domain containing 5
 Sterol carrier protein 2, liver
Intracellular protein transport
 Adaptor protein complex AP-1, μ2 subunit A kinase (PRKA) anchor protein (gravin) 12
 Adaptor protein complex AP-1, σ1 CDNA sequence BC003281
 Adaptor-related protein complex 3, β1 subunit Ia-associated invariant chain
 Adaptor-related protein complex 3, μ1 subunit Nuclear factor of κ light chain gene enhancer in B-cells inhibitor, α
 Adaptor-related protein complex 3, σ2 subunit Nuclear RNA export factor 1 homolog (S. cerevisiae)
 Adaptor-related protein complex AP-4, σ1 Ras-GTPase-activating protein SH3-domain binding protein
 ADP-ribosylation factor 5 Secretory carrier membrane protein 3
 B-cell receptor-associated protein 29 Splicing factor, arginine/serine-rich 1 (ASF/SF2)
 Cathepsin B Transforming growth factor, β1
 Choroidermia Transforming, acidic coiled-coil containing protein 3
 Coatomer protein complex, subunit ε
 Epimorphin
 Histocompatibility 47
(continues)
Table 4A.
 
(Continued). Androgen Control of Meibomian Gland Genes Associated with Lipid Metabolism and Transport, Sterol Biosynthesis, Protein Activity, and Cellular Components
Table 4A.
 
(Continued). Androgen Control of Meibomian Gland Genes Associated with Lipid Metabolism and Transport, Sterol Biosynthesis, Protein Activity, and Cellular Components
Upregulation Downregulation
Intracellular protein transport (continued)
 Karyopherin (importin) β1
 PDZ domain containing 11
 Peroxisomal biogenesis factor 13
 RAB1B, member RAS oncogene family
 RAB2, member RAS oncogene family
 Rab38, member of RAS oncogene family
 RAB4B, member RAS oncogene family
 RAB9, member RAS oncogene family
 RIKEN cDNA 1110034E15 gene
 RIKEN cDNA 5830417C01 gene
 RIKEN cDNA A430019L02 gene
 Sec61 β subunit
 Signal recognition particle 54
 Sortilin-related VPS10 domain containing receptor 2
 Sorting nexin 2
 Translocase of inner mitochondrial membrane 8 homolog b (yeast)
 Translocase of outer mitochondrial membrane 20 homolog (yeast)
 Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, β pol
Peroxisome (also microbody)
 2-4-Dienoyl-coenzyme A reductase 2, peroxisomal
 Acyl-coenzyme A oxidase 3, pristanoyl
 ATP-binding cassette, sub-family D (ALD), member 3
 Catalase
 Mpv17 transgene, kidney disease mutant
 Peroxisomal biogenesis factor 13
 Peroxisomal membrane protein 3
 Peroxisomal membrane protein 4
 Peroxisomal membrane protein 4
 Peroxisome biogenesis factor 19
 Phytanoyl-CoA hydroxylase
 Polyamine oxidase
 Solute carrier family 25
 Sterol carrier protein 2, liver
Early endosome
 CD1d1 antigen
 RAB34, member of RAS oncogene family
 RAB5A, member RAS oncogene family
 Tumor protein D52-like 1
 Vesicle-associated membrane protein 8
Table 5.
 
High and Low Expression of Gene Ontologies in the Meibomian Glands of Placebo- or Testosterone-Treated Mice
Table 5.
 
High and Low Expression of Gene Ontologies in the Meibomian Glands of Placebo- or Testosterone-Treated Mice
Ontology Gene List T Genes ↑ P Genes ↑ Array Genes T z-Score P z-Score
Biological process
 Lipid metabolism 60 46 14 265 3.56 0.47
 Fatty acid metabolism 20 16 4 77 2.87 0.21
 Lipid transport 9 8 1 33 2.51 −0.45
 Morphogenesis 90 52 38 652 −2.4 1.45
 Cell adhesion 34 19 15 293 −2.4 0.36
 Protein modification 94 56 38 728 −2.81 0.72
 mRNA metabolism 24 9 15 95 −0.4 5.16
 Regulation of cell growth 11 3 8 38 −0.57 4.79
 Cell growth 12 3 9 46 −0.93 4.79
 Proteolysis and peptidolysis 49 43 6 344 1.09 −2.65
 G-protein-coupled receptor signaling pathway 52 47 5 337 1.96 −2.86
 Catabolism 75 66 9 495 1.95 −3.14
Molecular function
 Oxidoreductase activity 85 69 16 396 4.39 −0.82
 Lyase activity 21 16 5 79 2.73 0.59
 Carboxylic ester hydrolase activity 12 12 0 57 2.51 −1.72
 Binding 668 435 233 4340 −2.57 2.3
 Actin binding 11 3 8 118 −2.91 0.95
 Protein binding 214 125 89 1540 −3.8 1.81
S-adenosylmethionine-dependent methyltransferase activity 11 3 8 38 −0.57 4.62
 RNA binding 49 24 25 246 −0.52 3.89
 Endonuclease activity 12 5 7 41 0.29 3.62
 Rhodopsin-like receptor activity 30 29 1 178 2.4 −2.72
 Transporter activity 114 91 23 788 0.74 −2.73
 G-protein coupled receptor activity 36 34 2 228 2.05 −2.86
Cellular component
 Microbody 15 15 0 45 4.82 −1.5
 Peroxisome 15 15 0 45 4.82 −1.5
 Mitochondrion 89 76 13 485 3.44 −2.22
 Extracellular matrix 10 7 3 130 −2.06 −1.32
 Nucleus 273 166 107 1751 −2.31 3.12
 Cytoskeleton 56 24 32 340 −2.37 4.15
 Cytoskeleton 56 24 32 340 −2.37 4.15
 Intracellular 618 409 209 3744 −0.12 3.6
 Nucleus 273 166 107 1751 −2.31 3.12
 Extracellular space 250 185 65 1705 −0.17 −2.1
 Mitochondrion 89 76 13 485 3.44 −2.22
 Integral to membrane 322 240 82 2108 0.75 −2.23
Table 6.
 
GEM Chip Confirmation of Selected Bioarray Results
Table 6.
 
GEM Chip Confirmation of Selected Bioarray Results
Accession Number Gene Ontology
Testosterone > placebo
 NM_010476 Hydroxysteroid (17β) dehydrogenase 7 Steroid metabolism
 NM_008288 Hydroxysteroid 11β dehydrogenase 1 Steroid metabolism
 NM_013754 Insulin-like 6 Receptor binding
 NM_026058 Longevity assurance homolog 4 (S. cerevisiae) Sphingoid biosynthesis
 AK009450 Membrane progestin receptor α Signal transducer activity
 NM_010784 Midkine Cell cycle
 NM_010898 Neurofibromatosis 2 Phosphate metabolism
 NM_020573 Oxysterol binding protein-like 1A Lipid transport
 NM_026438 Pyrophosphatase Hydrolysis of diphosphate bonds
 NM_021557 Retinol dehydrogenase 11 Oxidoreductase activity
 M62361 Sterol carrier protein 2, liver Carboxylic acid metabolism
Placebo > testosterone
 NM_007606 Carbonic anhydrase 3 One-carbon compound metabolism
 K02782 Complement component 3 Vesicle-mediated transport
 NM_011469 Small proline-rich protein 2B Structural molecule activity
Table 7.
 
Verification of Selected Bioarray and Gene Chip Results
Table 7.
 
Verification of Selected Bioarray and Gene Chip Results
Gene CodeLink Ratio GEM Ratio qPCR Ratio
Testosterone > placebo
 17β-Hydroxysteroid dehydrogenase 7 1.77 2.80 2.21
 ATP-binding cassette, sub-family A, member 1 / 1.55 2.17
 ATP-binding cassette, sub-family D, member 3 1.41 1.82 2.19
 Elongation of very long chain fatty acids-like 3 1.40 1.91 1.65
 Fatty acid synthase / 2.10 2.08
 Fatty acid transport protein 4 1.25 2.20 1.57
 Glutathione peroxidase 3 2.52 2.09*
 Insulin-like growth factor 1 1.36 1.90 1.51†
 Monoglyceride lipase 1.39 2.09 2.07
 Neuromedin B 3.21 2.10
Placebo > testosterone
 Cyclin D1 2.49 1.57†
 Odorant-binding protein Ia 29.41 55.0
 Resistin 2.42 2.97*
 Small proline-rich protein 2A 3.96 3.41 4.30
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×