March 2006
Volume 47, Issue 3
Free
Anatomy and Pathology/Oncology  |   March 2006
Biochemical and Morphological Analysis of Basement Membrane Component Expression in Corneoscleral and Cribriform Human Trabecular Meshwork Cells
Author Affiliations
  • Rudolf Fuchshofer
    From the Department of Human Anatomy, University Regensburg, Regensburg, Germany; the
  • Ulrich Welge-Lüssen
    Department of Ophthalmology, Maximilians-University, Munich, Germany; and the
  • Elke Lütjen-Drecoll
    Department of Anatomy II, Friedrich Alexander University, Erlangen, Germany.
  • Marco Birke
    Department of Anatomy II, Friedrich Alexander University, Erlangen, Germany.
Investigative Ophthalmology & Visual Science March 2006, Vol.47, 794-801. doi:10.1167/iovs.05-0292
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Rudolf Fuchshofer, Ulrich Welge-Lüssen, Elke Lütjen-Drecoll, Marco Birke; Biochemical and Morphological Analysis of Basement Membrane Component Expression in Corneoscleral and Cribriform Human Trabecular Meshwork Cells. Invest. Ophthalmol. Vis. Sci. 2006;47(3):794-801. doi: 10.1167/iovs.05-0292.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

purpose. To determine whether cells of the cribriform trabecular meshwork (TM) express basement membrane (BM) components similar to corneoscleral TM cells and to determine whether cribriform cells are connected to the elastic tendon net of the TM.

methods. TM cells of the corneoscleral and the cribriform regions were cultured from 10 eyes of 10 donors, aged 20 to 87 years. Cell types were classified by α-smooth muscle actin (smA), desmin, and αB-crystallin staining. Expression of collagen type IV (ColIV) chains α1 to 6; collagen type VIII (ColVIII) α1; laminin subunits α1 to 5, β1 to 3, and γ1 to 3; and nidogen 1 and 2 was tested in both cell types by semiquantitative RT-PCR (sqPCR). Expression of ColIVα2, ColVIIIα1, laminin β2, and nidogen 1 was quantified by Northern blot analysis. The response to transforming growth factor (TGF)-β2 treatment was investigated. Serial tangential and sagittal TM sections of 16 eyes from 10 donors (aged 12–90 years) were used for electron- and immunoelectron microscopy.

results. Both TM cell types expressed ColIV chains α1, α2, α4, α5, and α6; ColVIII α1; laminin subunits α3, α4, β1, β2, β3, γ1, and γ2; and nidogen 1, as determined by Northern blot analysis and sqPCR. ColIV α3; laminin subunits α1, α2, and γ3; and nidogen 2 were not detectable by PCR. Responses to TGF-β2 treatment did not differ between cell types. In vivo, all cribriform cells were in contact with ColIV containing BM material and were found to connect to the cribriform elastic network.

conclusions. Cribriform and corneoscleral TM cells show no differences in expression of BM components and response to TGF-β2. The direct connection of cribriform cells to the elastic tendon network suggests that they are under mechanical tension. This could explain previous findings of αB-crystallin expression in the cribriform region.

The trabecular meshwork (TM) of primate eyes consists of two distinct portions that differ in morphology and function. The inner TM is formed by connective tissue lamellae, which are completely covered by trabecular cells. These cells produce a continuous basement membrane (BM) around the central lamellae. Abutting this region lies the cribriform or juxtacanalicular meshwork, formed by star-shaped cribriform cells embedded in extracellular matrix (ECM). These cells are connected to each other and also to the inner wall of Schlemm’s canal (SC). 1 Experimental and comparative physiological studies indicate that approximately 90% of the aqueous humor (AH) outflow resistance of the TM is located within the cribriform region. 2 The aqueous passages through the corneoscleral lamellae are too large to account for outflow resistance; instead, this region serves as a biological filter. 3 4  
Trabecular cells in the corneoscleral and cribriform regions may have functional differences. Cells cultured from both regions stain for α-smooth muscle actin (α-smA) and vimentin, but only cribriform cells stain for the stress protein αB-crystallin. 5 This difference led us to conduct studies with cribriform and corneoscleral cells separately, a laborious process. Of interest, however, we found that the expression pattern of corneoscleral and cribriform cells was similar for the ECM components metalloproteinases and their inhibitors, as well as the cells’ reaction to some exogenous factors like transforming growth factor (TGF) β or dexamethasone (DEX). 6 7 8 Why the two trabecular cell types have similar expression patterns for many molecules, but not αB-crystallin, is unknown. In intact TM, morphologic differences between cribriform and corneoscleral cells exist in their shape, location, and BM. Understanding the in situ milieu of the cells may explain their different molecular characteristics. 
To investigate the potential similarity or difference of these cells, we compared BM production in cultured cribriform and corneoscleral cells. In addition, we used electron microscopy to determine whether BM material is morphologically associated with cribriform cells. We also examined their potential connection to the cribriform elastic network. 
Material and Methods
Tissue Culture
TM cell cultures were prepared from eyes of 10 human donors and grown as described previously. 5 6 The age of the donors ranged from 20 to 87 years. Cells derived from the cribriform and outer corneoscleral meshwork were termed cribriform cells, cells derived from the inner lamellar and uveal portion were termed corneoscleral TM cells. Both TM cell types were distinguished from each other and adjacent scleral spur or ciliary muscle cells by their morphology and immunohistochemical staining, as described previously. 6 In brief, third-passage cells were kept confluent for 7 days and stained with antibodies against α-smA, desmin, and αB-crystallin (dilutions and suppliers are given in Table 1 ). For desmin and α-smA staining, cells were fixed with methanol; for αB-crystallin staining, cells were fixed with 4% paraformaldehyde (PFA) for 15 minutes at room temperature (RT). After two washes with phosphate-buffered saline (PBS; pH 7.2/0.1% vol/vol) Triton X-100, antibodies were added in PBS and 2% (wt/vol) bovine serum albumin (BSA) at specific dilutions (see Table 1 ) and incubated overnight at 4°C. After they were washed for 5 minutes in PBS, the cells were incubated with cognate Alexa488-conjugated secondary antibodies (Table 1)for 1 hour at RT. Slides were mounted in Kaiser’s jelly and viewed and photographed with a microscope (Aristoplan; Leitz, Wetzlar, Germany). Methods of securing human tissue were humane, included proper consent and approval, and complied with the Declaration of Helsinki. 
TGF-β2 Treatment
Third-passage corneoscleral and cribriform TM cells were kept confluent for 7 days. Before treatment, cells were preincubated in serum-free medium for 24 hours. TGF-β2 (1 ng/mL, active form; Roche, Basel, Switzerland) was then added for 24 hours. This concentration was chosen as it resembles the mean average of TGF-β2 levels measured in the AH of patients with POAG. Corresponding control cells were treated equally, but did not receive TGF-β2. Cell viability was tested before and at the end of treatment and did not reveal any signs of increased cell death in TGF-β2-treated cells. 
RNA Isolation and Polymerase Chain Reaction
TM cells were harvested from 35-mm Petri dishes, and total RNA was extracted with an RNA isolation kit (Stratagene, Heidelberg, Germany). Structural integrity of the total RNA samples was confirmed by electrophoresis in 1% (wt/vol) agarose gels. RNA yield and purity were determined photometrically. First-strand complementary DNA (cDNA) for PCR was prepared from total RNA by using Moloney murine leukemia virus (M-MuLV) reverse transcriptase and oligo[dT]-17 primer. The PCR was performed with the temperature profile as follows: 36 cycles of 1 minute melting at 94 °C, 1 minute of annealing, and 2 minutes’ extension at 72°C followed by an end extension step for 10 minutes at 72°C after the last cycle. All PCR primers were purchased from Invitrogen (Darmstadt, Germany) and span exon–intron boundaries. Primer sequences, positions, annealing temperatures, and PCR product sizes are given in Table 2 . Functionality of primer pairs was tested before to exclude false-negative results. Sizes of the PCR products were estimated from the migration of a DNA size marker run concurrently (100-bp DNA ladder; Promega, Madison, WI). RNA that was not reverse transcribed served as the negative control for PCR and showed no amplified products. To allow semiquantification, PCRs for the housekeeping-gene glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) were performed on the cDNAs of corneoscleral and cribriform TM cells to estimate the amount of cDNA used for the subsequent BM component PCRs. Band intensities were quantified (BioDocAnalyze image analysis software; Whatman-Biometra, Göttingen, Germany) and differences in GAPDH were considered. Mean averages of corneoscleral TM cells are set to 100%, and values of cribriform cells are given as mean average (MA) ± SD percentage of corneoscleral expression. 
Northern Blot Analysis
Total RNA (15 μg) was size fractionated by gel electrophoresis in 1% (wt/vol) agarose gels with 2.2 M formaldehyde, subsequently transferred onto a nylon membrane (Roche, Basel, Switzerland) by vacuum blotting, and cross-linked at 1600 μJ (Stratalinker; Stratagene). Membranes were prehybridized in solution (Dig Easy Hyb; Roche Diagnostics, Indianapolis, IN) for 1 hour at 68°C. Hybridizations were performed at 68°C overnight in the hybridization solution (Dig Easy Hyb; Roche) containing 50 ng/mL of a specific antisense probe. Riboprobe synthesis has been described previously. 9 After hybridization, the membranes were washed twice in 2× SSC and 0.1% (vol/vol) sodium dodecyl sulfate (SDS) for 10 minutes at RT, then either twice in 0.1% SDS for 10 minutes at RT or 15 minutes at 68°C and once for 5 minutes in washing buffer (100 mM maleic acid, 150 mM NaCl [pH 7.5], and 0.3% [vol/vol] Tween-20). Membranes were then blocked in blocking solution (100 mM maleic acid, 150 mM NaCl [pH 7.5], 1% [vol/vol]) blocking reagent [Roche]). Alkaline-phosphatase-conjugated anti-digoxygenin antibody (α-DIG-AP; Roche Diagnostics) was added at a dilution of 1:10000 in blocking solution and allowed to react for 30 minutes at RT. After incubation, the membranes were washed four times for 15 minutes each in washing buffer at RT and equilibrated in detection buffer (100 mM Tris-HCl, 100 mM NaCl [pH 9.5]) for 10 minutes at RT. For chemiluminescence detection, membranes were incubated for 5 minutes with chemiluminescent substrate (CDP-Star; Roche Diagnostics) diluted 1:100 in detection buffer at RT. Chemiluminescence was detected (Lumi-Imager workstation; Roche Diagnostics, Mannheim, Germany), with exposure times ranging between 2 minutes and 1 hour. Amount and quality of the RNA for quantification was tested afterward by methylene blue staining of the 28S and 18S rRNA bands. Quantification was performed on the workstation (LumiAnalyst Imaging software; Roche Diagnostics). 
Histologic Processing
Sixteen eyes of 10 donors with no history of ocular disease were studied. The age of these donors ranged from 12 to 90 years. The eyes were bisected at the equator and fixed by immersion in a mixture of glutaraldehyde-formaldehyde. Mean postmortem time until fixation was 15 ± 3 hours. Anterior segments of the eyes were cut into quadrants, and wedges of 2-mm width were dissected from each quadrant, containing the TM and adjacent cornea, sclera, and ciliary body. Specimens were rinsed in cacodylate buffer, postfixed in 1% osmium tetroxide (OsO4), dehydrated in an ascending series of alcohol, and embedded in Epon according to standard methods. Sagittal and serial tangential ultrathin sections parallel to the inner wall of SC from the chamber angle were cut and mounted on coated slotted grids (Pioloform; Plano, Marburg, Germany). Sections were stained with uranyl acetate and lead citrate and viewed by electron microscope (EM902; Carl Zeiss Meditec, Inc., Oberkochen, Germany). 
Immunoelectron Microscopy
Specimens of the chamber angle were prepared as just described and fixed in 4% (vol/vol) PFA and 0.1% (vol/vol) glutaraldehyde in PBS for 2 hours at 4°C. To prepare frozen sections, we soaked pieces of fixed tissues in 4% (wt/vol) sucrose in PBS for at least 24 hours and froze them in liquid nitrogen. For pre-embedding immunocytochemistry, 25-μm cryostat sections were cut and mounted on coverslips (Thermanox; Nunc, Wiesbaden, Germany). Cryosections were blocked in dry milk solution (Blotto; Santa Cruz Biotechnology, Santa Cruz, CA) for 30 minutes. Anti-ColIV or i-ColVI antibodies were applied in PBS and 0.2% (wt/vol) BSA to the sections and incubated overnight at 4°C (for dilutions and suppliers, see Table 1 ). After six rinses in PBS and 2% (wt/vol) BSA, sections were incubated overnight at 4°C with ultrasmall gold–conjugated anti-rabbit or ant-mouse F(ab′)2 in PBS and 0.2% (wt/vol) BSA. Sections were then rinsed five times in PBS and 2% (wt/vol) BSA and two times in PBS and fixed with 2.5% (vol/vol) glutaraldehyde in PBS for 2 hours at 4°C. Silver enhancement was then performed (R-Gent SE-EM; Aurion, Wageningen, The Netherlands) for 1.5 hours in darkness. Sections were postfixed with 0.5% (wt/vol) OsO4 in PBS and embedded in Epon. Ultrathin sections of the specimens were cut and examined by electron microscope (EM 902; Carl Zeiss Meditec, Inc.). Controls sections were treated the same way but without primary antibodies. No control sections showed labeling with gold particles. 
Results
Classification of Cultured Cribriform and Corneoscleral TM Cells
All 10 monolayers of the cells from the cribriform and corneoscleral TM consisted of small, elongated cells that were almost all positive for α-smA staining (Figs. 1A 1D) . None of the cells stained for desmin, a typical marker for contamination with ciliary muscle cells (Figs. 1B 1E) . The cribriform TM cells showed intense staining for α-B crystallin (Fig. 1F) , whereas the corneoscleral TM cells did not stain, or only faintly stained, for that small stress protein (Fig. 1C)
In Vitro Expression Analysis of BM Components in Corneoscleral and Cribriform TM Cells
BM component expression was assessed in all 10 cribriform and corneoscleral cell lines. Type IV and VIII collagens, laminins, nidogens, and their subunits were analyzed with sqRT-PCR. The results of all 10 corneoscleral TM cells were identical. We obtained specific products of the ColIV chains α1, α2, α4, α5, and α6 (Fig. 2A) , whereas the α3 chain was not detectable (not shown). Type VIII collagen was also studied, as it is a component of Descemet’s membrane, and the BM of the inner TM lamellae appears to be the continuation of Descemet’s membrane under electron microscopy. ColVIII showed a specific signal for the α1 chain (Fig. 2A) . Analysis of laminin subunits revealed positive signals for laminin α3, α4, β1, β2, β3, γ1, and γ2 (Fig. 2A) , but not for the subunits α1, α2, and γ3 (not shown). Nidogen 1 (Fig. 2A) , but not nidogen 2 (not shown), expression was detectable. The expression patterns of all 10 cribriform TM cell lines was identical with the corneoscleral cells, even for the expression of type VIII collagen. Figure 2Ashows a single representative experiment. Semiquantification of PCR band signal intensities showed no differences in the expression levels of the BM components (Fig. 2B) . Mean averages of signal intensities obtained from corneoscleral cells are set to 100%, and the values of cribriform cells are given as MA percentage ± SD (n = 10). 
To assess slight quantitative differences in the expression of the BM components between the cell lines, Northern blot analysis, as a more sensitive method, was conducted. As we were limited by the amount of RNA we could extract from the single cultures, we examined only one member of each BM component group that gave an explicit positive signal in the PCR (Fig. 3A) . The quantification of the Northern blot data did not reveal any differences in the mRNA amounts of ColIVα2, ColVIIIα1, laminin β2, and nidogen 1 between the two cell lines. Signal intensities were quantified by adjustment to the signals of the 28S and 18S rRNA bands. Mean averages of the corneoscleral TM cells are set to one, and the expression in cribriform cells is given as x-fold (MA ± SD; n = 3; Fig. 3C , Table 3 ). 
Response to TGF-β2
TGF-β2 did not alter expression levels of nidogen 1 (Figs. 3B 3C) , ColIVα2, ColVIIIα1, and laminin β2 (Fig. 3C)for either corneoscleral or cribriform cells (Figs. 3B 3C) . For quantification, values of the untreated corneoscleral cells are set to one, and signal intensities of TGF-β2-treated corneoscleral and cribriform TM cells are given as x-fold (MA ± SD; n = 3). Signals of the 28S and 18S rRNAs served as the control for equal loading and were considered for quantification (Figs. 3B 3C ; Table 3 ). 
Electron Microscopy
Serial sagittal and especially tangential sections through the cribriform region revealed BM-like material adjacent to all cribriform cells. Fine fibrils branching off the sheath of the cribriform elastic fiber network inserted into this BM material (Fig. 4A) . The distribution of the material varied in amount and localization among different cells. Some single cells had almost half of the circumference of the cell surface in contact with BM-like material, whereas other cells had the material only in small regions of the cell surface (Fig. 4B) . These differences in amount of BM-like material were dependent on the position of the cell within the TM and its environment. In places where a cribriform cell bordered optically empty pathways, the cell surface was completely free of BM-like material (Fig. 4B) . In contrast, those parts of the cell surface facing fibrils of extracellular material showed a clearly distinguishable line of BM material (Fig. 4A) . In these places, connecting fibrils originating from the cribriform elastic network were in direct contact with the BM-material. The connecting fibrils showed a typical cross-banding where they branched off the sheath of the elastic fibers. Toward the cribriform cells this cross-banding was no longer visible, and the connecting fibrils split into bundles of fine fibrils that attached to the BM-like material of the cribriform cells (Fig. 4A) . In these areas, the cell membrane of the cribriform cells showed densifications and small extensions toward the region of attachment. The cell membrane undulated in the attachment areas. Existence of BM material at the cribriform cells was independent of the functional state of the cells. Both cribriform cells filled with phagolysosomes, and cells containing numerous Golgi membranes and rough endoplasmic reticulum, but without phagosomes, showed BM material at their surface (Fig. 4B)
Collagen type IV specific immunogold labeling confirmed that the BM-like material adjacent to the trabecular cells of the lamellae contained this collagen (Fig. 5A) . A similar staining was present within the BM-like material of the cribriform cells (Fig. 5B) . Labeling for collagen type VI was found at the fine fibrils splitting off the cross-banded connecting fibrils and inserting into the BM-like material. The cross-banded fibrils themselves were not labeled (Fig. 5C) . Collagen type IV (not shown) and type VI (Fig. 5D)staining control sections did not show labeling within the BM-like material. 
Discussion
In the present work we studied whether two cell types in the TM, cribriform and corneoscleral cells, can be distinguished by differences in the expression of BM components. To answer this, we focused on three distinct questions: (1) which BM components are expressed by TM cells, (2) what are the differences in the expression profiles between corneoscleral and cribriform TM cells, and (3) do these two cell types respond differently to TGF-β2? We examined four components of BM: collagen IV, laminin, nidogen, and collagen VIII. Collagen type IV chains α1 and α2 are ubiquitous BM components forming a cross-linked scaffold in mature basal laminae. 10 11 12 In contrast, the incorporation of α3, α4, α5, or α6 chains is variable and apparently linked to functional features of specialized BMs. 11 12 13 14 Mutations in the genes coding for these chains correlate with genetic diseases like Alport syndrome, Goodpasture syndrome, and leiomyomatosis, causing severe organ- or tissue-specific dysfunction. 11 15 16 17 18 19 20 21 Pathogenic mutations in just one of these genes may lead to the absence of the other isoforms within the BM, suggesting dependency of expression among them. 16 17 In contrast, however, in the α3 knockout mouse, expression of the α4, α5, and α6 chains was detectable, which contradicts a coupled expression mechanism. 13 20 In our study, cribriform and corneoscleral TM cells expressed the α1, α2, α4, α5, and α6 chains but not the α3 chain, supporting the knockout mouse data. The functional relevance of the α3 chain, however, is not known. In the anterior eye segment, α3 expression and deposition was shown in the specialized BMs of Descemet’s membrane and the lens capsule. 15 19 Of interest, at the transition from cornea to TM, α3 expression ends, and the tissue loses its transparency. 
Laminins are the most abundant linking proteins in BMs. 14 22 23 We found expression of laminin subunits α3, α4, β1, β2, β3, γ1, and γ2 but not of α1, α2, and γ3 in cribriform and in corneoscleral TM cells. Laminins are heterotrimers of one α, β, and γ chain, whereas the α chains seem to be crucial for specific function and tissue distribution. 14 22 23 Laminin α1 expression was described only in early stages of epithelial cell BM development, 23 and α2 seems to be restricted to skeletal and cardiac muscle cells and the peripheral nervous system. 14 22 23 The α3 chain is typically found in stratified epithelium, like in skin, which is of ectodermal origin, and α4 is characteristic for mesenchyme-derived cells. 14 22 23 Because both the α3 and α4 chain are expressed in corneoscleral and cribriform cells, this finding does not help to clarify the question of whether the TM is of neuroectodermal origin or invades the eye with the vasculature, and would thus be of mesenchymal origin. The absence of the γ3-chain was not surprising, as this chain is not BM associated and is found in apical epithelial surfaces and the peripheral nervous system. 24 Nidogens function as bridging proteins between collagens and laminins. 14 22 23 We detected expression of nidogen-1 in both trabecular cell types, whereas nidogen-2 was not detectable. Nidogen-2 is not essential for BM formation as shown in the knock-out (/) mouse, 25 and therefore expression of one nidogen seems to be sufficient for correct BM formation. 
The fourth BM component we investigated, type VIII collagen, is predominantly synthesized by endothelial cells such as vascular endothelium cells. 26 27 It is the major component of the wide-spaced collagen of Descemet’s membrane. 28 29 30 31 32 In Descemet’s membrane, type VIII collagen may stabilize the cornea against IOP and outside influences. 26 32 The peripheral regions of Descemet’s membrane are the regions where the elastic fibers of the TM as well as the tendons of the ciliary muscle insert. 33 34 Shuttleworth 26 noted that type VIII collagen is associated with microfibrils of elastic tissues. Based on this, ColVIII expression in the TM cells could contribute to stability against fluctuations of IOP and the mechanical tension of the ciliary body tendons, which insert to the elastic network of fibers in the TM. This network connects to the BM by connecting fibrils. 
The second question we investigated was the difference in expression profiles of BM components between corneoscleral and cribriform cells. To our surprise, despite the initially described morphologic differences, 4 5 35 our biochemical investigations showed that the selected BM components were expressed qualitatively and quantitatively equally. The answer to the third question, response to TGF-β2, also revealed similar expression profiles for both cell types. Of note, we did not find any changes in collagen type IV expression after treatment with TGF-β2 in concentrations that resembled those found in the aqueous of patients with POAG. In contrast, astrocytes of the optic nerve head respond to TGF-B2 with an increase in collagen type IV expression. 36 In keeping with this, increased amounts of BM material under the inner wall of SC are not found in the TM of patients with POAG, whereas in the lamina cribrosa region of the optic nerve, type IV collagen is significantly increased. 37  
Our ultrastructural investigations show that all cells of the cribriform region have adjacent BM-like material and that this BM-like material is connected to the elastic cribriform network. The cribriform cells are thus indirectly connected to the elastic tendons of the ciliary muscle. In regions of “optically empty” spaces, no BM was visible. “Optically empty” in this context does not necessarily mean that there is no ECM in these regions; however, this material is probably lost during the embedding procedure. 38 At places where the elastic fibers were attached to the BM-like material of the cribriform TM cells, the cell membrane was undulated and thickened, whereas the corneoscleral TM cells had a smooth cell membrane. This finding could indicate that the cribriform cells are exposed to a higher mechanical tension than the cells of the corneoscleral region. In the corneoscleral region, ciliary muscle tendons insert into the connective tissue core of the lamellae and not to the BM of the cells. This difference in mechanical tension caused by different tendon insertions could explain why cribriform cells show increased expression of the stress protein αB-crystallin. This protein is the only differentiating factor we have found between the two cell types. 5  
 
Table 1.
 
Antibodies Used for Immunohistochemistry and Immunoelectron Microscopy
Table 1.
 
Antibodies Used for Immunohistochemistry and Immunoelectron Microscopy
Antibody Abbreviation Dilution Vendor
Mouse-anti-human α-SM actin m-α-h-αsmA 1:150 Dako, Glostrup, Denmark
Mouse-anti-human desmin m-α-h-desmin 1:10 Dako
Alexa488 conjugated goat-anti-mouse g-α-m-Alexa488 1:2000 Mobitec, Göttingen, Germany
Rabbit-anti-αB-crystallin rb-α-h-αB-crystallin 1:500 Stressgen, Victoria, Canada
Alexa488 conjugated goat-anti-rabbit g-α-rb-Alexa488 1:2000 Mobitec
Mouse-anti-human collagen type IV m-α-h ColIV 1:250 Sigma-Aldrich, Seelze, Germany
Rabbit-anti-human collagen type VI rb-α-h ColVI 1:150 Rockland, Gilbertsville, MD
Goat-anti-rabbit F(ab′)2 ultra-small g-α-r F(ab′) 2 us 1:100 Aurion, Wageningen, The Netherlands
Goat-anti-mouse F(ab′)2 ultra-small g-α-m F(ab′)2 us 1:100 Aurion
Table 2.
 
Primers Used for PCR Amplification and Semiquantitative RT-PCR
Table 2.
 
Primers Used for PCR Amplification and Semiquantitative RT-PCR
Gene Primer Sequence (5′–3′) nt Position Annealing Temp. (°C) Product Size (bp)
ColIVα1 Fw: agagatggtgttgcaggagtgc 1378-1984 60.9 607
Rev: tgtctccaggtaagccgtcaac
ColIVα2 Fw: tactgcaaccctggtgatgtctgc 883-1662 60.9 780
Rev: cgaagtggttagctgtgccttcag
ColIVα3 Fw: gtgaaacacttcagcctgaggg 1783-2543 60.0 761
Rev: tggatctcctcgtggtccatcaag
ColIVα4 Fw: cctgattctgctccaggaaaacc 1490-2325 59.9 836
Rev: ttatgcccatctgaaccactcag
ColIVα5 Fw: caacggatgcaccacaatgc 1670-2153 56.9 484
Rev: tcgatgaagggagctgaacg
ColIVα6 Fw: aaaggagtcaagggggatgttg 788-1288 58.6 501
Rev: taatgctggcaatccagggacacc
Lamininα1 Fw: taactggtggcaaagtcccagc 364-1278 57.1 915
Rev: cggcaaggctcatcctcataag
Lamininα2 Fw: aaggctgcgatgagtgtttctg 1426-2023 56.7 598
Rev: ggataggagacagcggattcaag
Lamininα3 Fw: gctctgactgatgcagataactcgg 2182-3087 55.8 906
Rev: tctatccacggtggtctgaattg
Lamininα4 Fw: atgaacgggctggtacagaagg 2006-2930 57.1 925
Rev: agtccaggggaatctccacatc
Lamininα5 Fw: tcgccttctacagcaatgcc 1385-2501 62.6 1117
Rev: tcggtcacctgcaactgcaagtag
Lamininβ1 Fw: tgcctcagtacacctcctctgatag 2168-2986 58.7 819
Rev: cgtcacatctggaaccaatgtatcc
Lamininβ2 Fw: tgcgagcagtgtcaggatttc 885-1845 60.5 961
Rev: tcagttccaactctgcccattg
Lamininβ3 Fw: aaatggggggaaggtccaact 663-1179 60.1 547
Rev: ccggttccggaaatagtgca
Lamininγ1 Fw: ttgacaatagccctgtgctgc 960-1840 56.7 881
Rev: acgccacccatcctcatcaatc
Lamininγ2 Fw: ccagtgcaaagcaggctacttc 587-1167 58.1 581
Rev: aggcaggaatgttagtgtttccc
Lamininγ3 Fw: ctccgaggaatgcacgtttga 1093-1614 61.1 522
Rev: tggtggaaatcgctgaggatg
Nidogen1 Fw: tccaggcagttttggcatctg 2964-3559 58.1 596
Rev: tgagctgggggaacatccatt
Nidogen2 Fw: cctggagggaaataccatgagg 545-1316 58.7 772
Rev: tcacagcaaaaggatactggagc
ColVIIIα1 Fw: tcgccatgggcaaggagatg 205-720 59.8 515
Rev: tttaggaccccgaaggcctt
GAPDH Fw: gaaggtgaaggtcggagtc 58-315 57.0 257
Rev: gaagatggtgatgggatttc
Figure 1.
 
Immunohistochemical staining of corneoscleral and cribriform TM cell monolayers. Monolayer cultures of corneoscleral and cribriform TM cells of the third passage were kept confluent for 7 days. All 10 cultures of each TM cell type showed the same staining pattern. Corneoscleral TM cells stained positive for α-smA (A), negative for α-desmin (B), and very weak for αB-crystallin (C). Cribriform TM cells were also positive for α-smA (D) and negative for α-desmin (E), but were positive for αB-crystallin (F). Magnification, ×200.
Figure 1.
 
Immunohistochemical staining of corneoscleral and cribriform TM cell monolayers. Monolayer cultures of corneoscleral and cribriform TM cells of the third passage were kept confluent for 7 days. All 10 cultures of each TM cell type showed the same staining pattern. Corneoscleral TM cells stained positive for α-smA (A), negative for α-desmin (B), and very weak for αB-crystallin (C). Cribriform TM cells were also positive for α-smA (D) and negative for α-desmin (E), but were positive for αB-crystallin (F). Magnification, ×200.
Figure 2.
 
Expression of different BM component subunits in corneoscleral and cribriform TM cells. (A) Representative semiquantitative RT-PCR experiment. Corneoscleral (cc) and cribriform (cr) TM cells qualitatively expressed the same BM components. (B) Quantification of signal intensities did not show differences in expression levels. MAs of corneoscleral cells are set to 100%, and levels in cribriform cells are given as MA percentage ± SD (n = 10).
Figure 2.
 
Expression of different BM component subunits in corneoscleral and cribriform TM cells. (A) Representative semiquantitative RT-PCR experiment. Corneoscleral (cc) and cribriform (cr) TM cells qualitatively expressed the same BM components. (B) Quantification of signal intensities did not show differences in expression levels. MAs of corneoscleral cells are set to 100%, and levels in cribriform cells are given as MA percentage ± SD (n = 10).
Figure 3.
 
Northern blot analysis of ColIVα2, ColVIIIα1, Laminin β2, and nidogen 1 expression in corneoscleral and cribriform TM cells and TGF-β2 response. (A) ColIVα2, ColVIIIα1, laminin β1, and nidogen-1 were equally expressed in corneoscleral (cc) and cribriform (cr) human TM cells. (B) Treatment with 1 ng/mL TGF-β2 had no effect on the expression of these genes, and both cell types responded identically, shown exemplarily for nidogen-1. (C) Quantification plot of the Northern blot data. Values are normalized to untreated corneoscleral TM cells and given as MA x-fold expression ± SD (n = 3).
Figure 3.
 
Northern blot analysis of ColIVα2, ColVIIIα1, Laminin β2, and nidogen 1 expression in corneoscleral and cribriform TM cells and TGF-β2 response. (A) ColIVα2, ColVIIIα1, laminin β1, and nidogen-1 were equally expressed in corneoscleral (cc) and cribriform (cr) human TM cells. (B) Treatment with 1 ng/mL TGF-β2 had no effect on the expression of these genes, and both cell types responded identically, shown exemplarily for nidogen-1. (C) Quantification plot of the Northern blot data. Values are normalized to untreated corneoscleral TM cells and given as MA x-fold expression ± SD (n = 3).
Table 3.
 
Quantitative Evaluation of BM Component Expression in Untreated and 24-Hour TGF-β2-Treated Corneoscleral and Cribriform TM Cells
Table 3.
 
Quantitative Evaluation of BM Component Expression in Untreated and 24-Hour TGF-β2-Treated Corneoscleral and Cribriform TM Cells
CC CR CC+TGF-β2 CR+TGF-β2
ColIVα2 1.0 1.0 ± 0.2 1.1 ± 0.1 1.0 ± 0.1
ColVIIIα1 1.0 0.9 ± 0.1 1.0 ± 0.2 0.9 ± 0.2
Lamininβ2 1.0 0.8 ± 0.3 0.9 ± 0.2 1.0 ± 0.1
Nidogen1 1.0 1.1 ± 0.2 1.0 ± 0.3 1.2 ± 0.3
Figure 4.
 
Electron micrographs of tangential sections through the cribriform TM region. (A) The cribriform cell (CR) was attached to BM-like material (BM) at places where the cribriform elastic fibers (EL) were connected to the cell by cross-banded connecting fibrils (CFs; arrows). The cell membrane was undulated and thick-ened at these positions. At that part of the circumference where the cell faces optically empty spaces (OE), no BM-like material was visible. (B) The phagolysosome containing cribriform cells (CR) was mainly surrounded by optically empty spaces (OE). BM-like material was only visible at the small cytoplasmic extensions where the cell is in contact with fibrillar material (arrows). Magnification: (A) ×5100; (B) ×3600.
Figure 4.
 
Electron micrographs of tangential sections through the cribriform TM region. (A) The cribriform cell (CR) was attached to BM-like material (BM) at places where the cribriform elastic fibers (EL) were connected to the cell by cross-banded connecting fibrils (CFs; arrows). The cell membrane was undulated and thick-ened at these positions. At that part of the circumference where the cell faces optically empty spaces (OE), no BM-like material was visible. (B) The phagolysosome containing cribriform cells (CR) was mainly surrounded by optically empty spaces (OE). BM-like material was only visible at the small cytoplasmic extensions where the cell is in contact with fibrillar material (arrows). Magnification: (A) ×5100; (B) ×3600.
Figure 5.
 
Electron micrographs of silver-enhanced collagen type IV and VI immunogold-stained sections through the lamellar meshwork and the cribriform region. (A) In this sagittal section, through a corneoscleral trabecular lamellae, type IV collagen immunoreactivity (gold particles, arrows) was present in the basement membrane-like material (BM) within the lamellae. TE, trabecular cell. (B) Sagittal section through the cribriform region stained for type IV collagen. Immunoreactivity (gold particles, arrows) was present in the BM-like material adjacent to the cell where connecting fibrils (CF) attached. TE, trabecular cell; EL, elastic fibers. (C) In this oblique section through the cribriform region, collagen type VI reactivity (gold particles, arrows) was present at connecting fibrils (CF), which diverged from the sheaths of the elastic fibers (EL) and were connected to the BM-like material of the cribriform TM cell (CR). (D) Collagen type VI staining control.
Figure 5.
 
Electron micrographs of silver-enhanced collagen type IV and VI immunogold-stained sections through the lamellar meshwork and the cribriform region. (A) In this sagittal section, through a corneoscleral trabecular lamellae, type IV collagen immunoreactivity (gold particles, arrows) was present in the basement membrane-like material (BM) within the lamellae. TE, trabecular cell. (B) Sagittal section through the cribriform region stained for type IV collagen. Immunoreactivity (gold particles, arrows) was present in the BM-like material adjacent to the cell where connecting fibrils (CF) attached. TE, trabecular cell; EL, elastic fibers. (C) In this oblique section through the cribriform region, collagen type VI reactivity (gold particles, arrows) was present at connecting fibrils (CF), which diverged from the sheaths of the elastic fibers (EL) and were connected to the BM-like material of the cribriform TM cell (CR). (D) Collagen type VI staining control.
The authors thank Julia Mausolf, Heide Wiederschein, and Marco Gösswein for expert technical assistance. 
Lütjen-DrecollE, FutaR, RohenJW. Ultrahistochemical studies on tangential sections of the trabecular meshwork in normal and glaucomatous eyes. Invest Ophthalmol Vis Sci. 1981;21:563–573. [PubMed]
MaepeaO, BillA. Pressures in the juxtacanalicular tissue and Schlemm’s canal in monkeys. Exp Eye Res. 1992;54:879–883. [CrossRef] [PubMed]
RohenJW, van der ZypenE. The phagocytic activity of the trabecular meshwork endothelium: an electron-microscopic study of the vervet (Cercopithecus aethiops). Albrecht Von Graefes Arch Klin Exp Ophthalmol. 1968;175:143–160. [CrossRef] [PubMed]
RohenJW, Lütjen-DrecollE. Biology of the Trabecular Meshwork. 1982;Schattauer Verlag New York.
SiegnerA, MayCA, Welge-LussenUW, BloemendalH, Lütjen-DrecollE. Alpha B-crystallin in the primate ciliary muscle and trabecular meshwork. Eur J Cell Biol. 1996;71:165–169. [PubMed]
Welge-LussenU, EichhornM, BloemendalH, Lütjen-DrecollE. Classification of human scleral spur cells in monolayer culture. Eur J Cell Biol. 1998;75:78–84. [CrossRef] [PubMed]
Welge-LussenU, MayCA, Lütjen-DrecollE. Induction of tissue transglutaminase in the trabecular meshwork by TGF-beta1 and TGF-beta2. Invest Ophthalmol Vis Sci. 2000;41:2229–2238. [PubMed]
FuchshoferR, Welge-LussenU, Lütjen-DrecollE. The effect of TGF-beta2 on human trabecular meshwork extracellular proteolytic system. Exp Eye Res. 2003;77:757–765. [CrossRef] [PubMed]
Welge-LussenU, MayCA, EichhornM, BloemendalH, Lütjen-DrecollE. αB-crystallin in the trabecular meshwork is inducible by transforming growth factor-beta. Invest Ophthalmol Vis Sci. 1999;40:2235–2241. [PubMed]
AumailleyM, TimplR. Attachment of cells to basement membrane collagen type IV. J Cell Biol. 1986;103:1569–1575. [CrossRef] [PubMed]
KalluriR, CosgroveD. Assembly of type IV collagen: insights from alpha3(IV) collagen-deficient mice. J Biol Chem. 2000;275:12719–12724. [CrossRef] [PubMed]
KuhnK. Basement membrane (type IV) collagen. Matrix Biol. 1995;14:439–445. [CrossRef] [PubMed]
KleppelM, FanW, CheongH, MichaelA. Evidence for separate networks of classical and novel basement membrane collagen: characterization of alpha 3(IV)-alport antigen heterodimer. J Biol Chem. 1992;267:4137–4142. [PubMed]
YurchencoPD, AmentaPS, PattonBL. Basement membrane assembly, stability and activities observed through a developmental lens. Matrix Biol. 2004;22:521–538. [CrossRef] [PubMed]
ColvilleDJ, SavigeJ. Alport syndrome: a review of the ocular manifestations. Ophthalmic Genet. 1997;18:161–173. [CrossRef] [PubMed]
GunwarS, BallesterF, NoelkenME, SadoY, NinomiyaY, HudsonBG. Glomerular basement membrane: identification of a novel disulfide cross-linked network of alpha 3, alpha 4, and alpha 5 chains of type IV collagen and its implications for the pathogenesis of alport syndrome. J Biol Chem. 1998;273:8767–8775. [CrossRef] [PubMed]
KahsaiTZ, EndersGC, GunwarS, et al. Seminiferous tubule basement membrane: composition and organization of type IV collagen chains, and the linkage of alpha 3(IV) and alpha 5(IV) chains. J Biol Chem. 1997;272:17023–17032. [CrossRef] [PubMed]
KashtanCE. Clinical and molecular diagnosis of Alport syndrome. Proc Assoc Am Physicians. 1995;107:306–313. [PubMed]
KashtanCE. Alport syndrome: an inherited disorder of renal, ocular, and cochlear basement membranes. Medicine (Baltimore). 1999;78:338–360. [CrossRef] [PubMed]
KashtanCE. Animal models of Alport syndrome. Nephrol Dial Transplant. 2002;17:1359–1362. [CrossRef] [PubMed]
GregoryMC. Alport syndrome and thin basement membrane nephropathy: Unraveling the tangled strands of type IV collagen. Kidney Int. 2004;65:1109–1110. [CrossRef] [PubMed]
SasakiT, FasslerR, HohenesterE. Laminin: the crux of basement membrane assembly. J Cell Biol. 2004;164:959–963. [CrossRef] [PubMed]
EkblomP, LonaiP, TaltsJF. Expression and biological role of laminin-1. Matrix Biol. 2003;22:35–47. [CrossRef] [PubMed]
KochM, OlsonPF, AlbusA, et al. Characterization and expression of the laminin gamma3 chain: a novel, non-basement membrane-associated, laminin chain. J Cell Biol. 1999;145:605–618. [CrossRef] [PubMed]
SchymeinskyJ, NedbalS, MiosgeN, et al. Gene structure and functional analysis of the mouse nidogen-2 gene: nidogen-2 is not essential for basement membrane formation in mice. Mol Cell Biol. 2002;22:6820–6830. [CrossRef] [PubMed]
ShuttleworthCA. Type VIII collagen. Int J Biochem Cell Biol. 1997;29:1145–1148. [CrossRef] [PubMed]
SageH, TruebB, BornsteinP. Biosynthetic and structural properties of endothelial cell type VIII collagen. J Biol Chem. 1983;258:13391–13401. [PubMed]
JakusMA. Studies on the cornea. II. The fine structure of Descemet’s membrane. J Biophys Biochem Cytol. 1956;2:243–252. [CrossRef] [PubMed]
LevySG, McCartneyAC, SawadaH, Dopping-HepenstalPJ, AlexanderRA, MossJ. Descemet’s membrane in the iridocorneal-endothelial syndrome: morphology and composition. Exp Eye Res. 1995;61:323–333. [CrossRef] [PubMed]
LevySG, MossJ, SawadaH, Dopping-HepenstalPJ, McCartneyAC. The composition of wide-spaced collagen in normal and diseased Descemet’s membrane. Curr Eye Res. 1996;15:45–52. [CrossRef] [PubMed]
SawadaH. The fine structure of the bovine Descemet’s membrane with special reference to biochemical nature. Cell Tissue Res. 1982;226:241–255. [PubMed]
SawadaH, KonomiH, HirosawaK. Characterization of the collagen in the hexagonal lattice of Descemet’s membrane: its relation to type VIII collagen. J Cell Biol. 1990;110:219–227. [CrossRef] [PubMed]
RohenJW, LutjenE, BaranyE. The relation between the ciliary muscle and the trabecular meshwork and its importance for the effect of miotics on aqueous outflow resistance: a study in two contrasting monkey species, Macaca irus and Cercopithecus aethiops. [in German]Albrecht Von Graefes Arch Klin Exp Ophthalmol. 1967;172:23–47. [CrossRef] [PubMed]
LütjenE. Histometric studies on the ciliary muscle in primates. [in German]Albrecht Von Graefes Arch Klin Exp Ophthalmol. 1966;171:121–133. [CrossRef] [PubMed]
FlügelC, TammE, Lütjen-DrecollE. Different cell populations in bovine trabecular meshwork: an ultrastructural and immunocytochemical study. Exp Eye Res. 1991;52:681–690. [CrossRef] [PubMed]
FuchshoferR, BirkeM, Welge-LussenU, KookD, Lütjen-DrecollE. Transforming growth factor-β2 modulated extracellular matrix component expression in cultured human optic nerve head astrocytes. Invest Ophthalmol Vis Sci. 2005;46:568–578. [CrossRef] [PubMed]
HernandezMR, YeH, RoyS. Collagen Type IV Gene expression in human optic nerve heads with primary open angle glaucoma. Exp Eye Res. 1994;59:41–52. [CrossRef] [PubMed]
Lütjen-DrecollE. Functional morphology of the trabecular meshwork in primate eyes. Prog Retinal Eye Res. 1999;18:91–119. [CrossRef]
Figure 1.
 
Immunohistochemical staining of corneoscleral and cribriform TM cell monolayers. Monolayer cultures of corneoscleral and cribriform TM cells of the third passage were kept confluent for 7 days. All 10 cultures of each TM cell type showed the same staining pattern. Corneoscleral TM cells stained positive for α-smA (A), negative for α-desmin (B), and very weak for αB-crystallin (C). Cribriform TM cells were also positive for α-smA (D) and negative for α-desmin (E), but were positive for αB-crystallin (F). Magnification, ×200.
Figure 1.
 
Immunohistochemical staining of corneoscleral and cribriform TM cell monolayers. Monolayer cultures of corneoscleral and cribriform TM cells of the third passage were kept confluent for 7 days. All 10 cultures of each TM cell type showed the same staining pattern. Corneoscleral TM cells stained positive for α-smA (A), negative for α-desmin (B), and very weak for αB-crystallin (C). Cribriform TM cells were also positive for α-smA (D) and negative for α-desmin (E), but were positive for αB-crystallin (F). Magnification, ×200.
Figure 2.
 
Expression of different BM component subunits in corneoscleral and cribriform TM cells. (A) Representative semiquantitative RT-PCR experiment. Corneoscleral (cc) and cribriform (cr) TM cells qualitatively expressed the same BM components. (B) Quantification of signal intensities did not show differences in expression levels. MAs of corneoscleral cells are set to 100%, and levels in cribriform cells are given as MA percentage ± SD (n = 10).
Figure 2.
 
Expression of different BM component subunits in corneoscleral and cribriform TM cells. (A) Representative semiquantitative RT-PCR experiment. Corneoscleral (cc) and cribriform (cr) TM cells qualitatively expressed the same BM components. (B) Quantification of signal intensities did not show differences in expression levels. MAs of corneoscleral cells are set to 100%, and levels in cribriform cells are given as MA percentage ± SD (n = 10).
Figure 3.
 
Northern blot analysis of ColIVα2, ColVIIIα1, Laminin β2, and nidogen 1 expression in corneoscleral and cribriform TM cells and TGF-β2 response. (A) ColIVα2, ColVIIIα1, laminin β1, and nidogen-1 were equally expressed in corneoscleral (cc) and cribriform (cr) human TM cells. (B) Treatment with 1 ng/mL TGF-β2 had no effect on the expression of these genes, and both cell types responded identically, shown exemplarily for nidogen-1. (C) Quantification plot of the Northern blot data. Values are normalized to untreated corneoscleral TM cells and given as MA x-fold expression ± SD (n = 3).
Figure 3.
 
Northern blot analysis of ColIVα2, ColVIIIα1, Laminin β2, and nidogen 1 expression in corneoscleral and cribriform TM cells and TGF-β2 response. (A) ColIVα2, ColVIIIα1, laminin β1, and nidogen-1 were equally expressed in corneoscleral (cc) and cribriform (cr) human TM cells. (B) Treatment with 1 ng/mL TGF-β2 had no effect on the expression of these genes, and both cell types responded identically, shown exemplarily for nidogen-1. (C) Quantification plot of the Northern blot data. Values are normalized to untreated corneoscleral TM cells and given as MA x-fold expression ± SD (n = 3).
Figure 4.
 
Electron micrographs of tangential sections through the cribriform TM region. (A) The cribriform cell (CR) was attached to BM-like material (BM) at places where the cribriform elastic fibers (EL) were connected to the cell by cross-banded connecting fibrils (CFs; arrows). The cell membrane was undulated and thick-ened at these positions. At that part of the circumference where the cell faces optically empty spaces (OE), no BM-like material was visible. (B) The phagolysosome containing cribriform cells (CR) was mainly surrounded by optically empty spaces (OE). BM-like material was only visible at the small cytoplasmic extensions where the cell is in contact with fibrillar material (arrows). Magnification: (A) ×5100; (B) ×3600.
Figure 4.
 
Electron micrographs of tangential sections through the cribriform TM region. (A) The cribriform cell (CR) was attached to BM-like material (BM) at places where the cribriform elastic fibers (EL) were connected to the cell by cross-banded connecting fibrils (CFs; arrows). The cell membrane was undulated and thick-ened at these positions. At that part of the circumference where the cell faces optically empty spaces (OE), no BM-like material was visible. (B) The phagolysosome containing cribriform cells (CR) was mainly surrounded by optically empty spaces (OE). BM-like material was only visible at the small cytoplasmic extensions where the cell is in contact with fibrillar material (arrows). Magnification: (A) ×5100; (B) ×3600.
Figure 5.
 
Electron micrographs of silver-enhanced collagen type IV and VI immunogold-stained sections through the lamellar meshwork and the cribriform region. (A) In this sagittal section, through a corneoscleral trabecular lamellae, type IV collagen immunoreactivity (gold particles, arrows) was present in the basement membrane-like material (BM) within the lamellae. TE, trabecular cell. (B) Sagittal section through the cribriform region stained for type IV collagen. Immunoreactivity (gold particles, arrows) was present in the BM-like material adjacent to the cell where connecting fibrils (CF) attached. TE, trabecular cell; EL, elastic fibers. (C) In this oblique section through the cribriform region, collagen type VI reactivity (gold particles, arrows) was present at connecting fibrils (CF), which diverged from the sheaths of the elastic fibers (EL) and were connected to the BM-like material of the cribriform TM cell (CR). (D) Collagen type VI staining control.
Figure 5.
 
Electron micrographs of silver-enhanced collagen type IV and VI immunogold-stained sections through the lamellar meshwork and the cribriform region. (A) In this sagittal section, through a corneoscleral trabecular lamellae, type IV collagen immunoreactivity (gold particles, arrows) was present in the basement membrane-like material (BM) within the lamellae. TE, trabecular cell. (B) Sagittal section through the cribriform region stained for type IV collagen. Immunoreactivity (gold particles, arrows) was present in the BM-like material adjacent to the cell where connecting fibrils (CF) attached. TE, trabecular cell; EL, elastic fibers. (C) In this oblique section through the cribriform region, collagen type VI reactivity (gold particles, arrows) was present at connecting fibrils (CF), which diverged from the sheaths of the elastic fibers (EL) and were connected to the BM-like material of the cribriform TM cell (CR). (D) Collagen type VI staining control.
Table 1.
 
Antibodies Used for Immunohistochemistry and Immunoelectron Microscopy
Table 1.
 
Antibodies Used for Immunohistochemistry and Immunoelectron Microscopy
Antibody Abbreviation Dilution Vendor
Mouse-anti-human α-SM actin m-α-h-αsmA 1:150 Dako, Glostrup, Denmark
Mouse-anti-human desmin m-α-h-desmin 1:10 Dako
Alexa488 conjugated goat-anti-mouse g-α-m-Alexa488 1:2000 Mobitec, Göttingen, Germany
Rabbit-anti-αB-crystallin rb-α-h-αB-crystallin 1:500 Stressgen, Victoria, Canada
Alexa488 conjugated goat-anti-rabbit g-α-rb-Alexa488 1:2000 Mobitec
Mouse-anti-human collagen type IV m-α-h ColIV 1:250 Sigma-Aldrich, Seelze, Germany
Rabbit-anti-human collagen type VI rb-α-h ColVI 1:150 Rockland, Gilbertsville, MD
Goat-anti-rabbit F(ab′)2 ultra-small g-α-r F(ab′) 2 us 1:100 Aurion, Wageningen, The Netherlands
Goat-anti-mouse F(ab′)2 ultra-small g-α-m F(ab′)2 us 1:100 Aurion
Table 2.
 
Primers Used for PCR Amplification and Semiquantitative RT-PCR
Table 2.
 
Primers Used for PCR Amplification and Semiquantitative RT-PCR
Gene Primer Sequence (5′–3′) nt Position Annealing Temp. (°C) Product Size (bp)
ColIVα1 Fw: agagatggtgttgcaggagtgc 1378-1984 60.9 607
Rev: tgtctccaggtaagccgtcaac
ColIVα2 Fw: tactgcaaccctggtgatgtctgc 883-1662 60.9 780
Rev: cgaagtggttagctgtgccttcag
ColIVα3 Fw: gtgaaacacttcagcctgaggg 1783-2543 60.0 761
Rev: tggatctcctcgtggtccatcaag
ColIVα4 Fw: cctgattctgctccaggaaaacc 1490-2325 59.9 836
Rev: ttatgcccatctgaaccactcag
ColIVα5 Fw: caacggatgcaccacaatgc 1670-2153 56.9 484
Rev: tcgatgaagggagctgaacg
ColIVα6 Fw: aaaggagtcaagggggatgttg 788-1288 58.6 501
Rev: taatgctggcaatccagggacacc
Lamininα1 Fw: taactggtggcaaagtcccagc 364-1278 57.1 915
Rev: cggcaaggctcatcctcataag
Lamininα2 Fw: aaggctgcgatgagtgtttctg 1426-2023 56.7 598
Rev: ggataggagacagcggattcaag
Lamininα3 Fw: gctctgactgatgcagataactcgg 2182-3087 55.8 906
Rev: tctatccacggtggtctgaattg
Lamininα4 Fw: atgaacgggctggtacagaagg 2006-2930 57.1 925
Rev: agtccaggggaatctccacatc
Lamininα5 Fw: tcgccttctacagcaatgcc 1385-2501 62.6 1117
Rev: tcggtcacctgcaactgcaagtag
Lamininβ1 Fw: tgcctcagtacacctcctctgatag 2168-2986 58.7 819
Rev: cgtcacatctggaaccaatgtatcc
Lamininβ2 Fw: tgcgagcagtgtcaggatttc 885-1845 60.5 961
Rev: tcagttccaactctgcccattg
Lamininβ3 Fw: aaatggggggaaggtccaact 663-1179 60.1 547
Rev: ccggttccggaaatagtgca
Lamininγ1 Fw: ttgacaatagccctgtgctgc 960-1840 56.7 881
Rev: acgccacccatcctcatcaatc
Lamininγ2 Fw: ccagtgcaaagcaggctacttc 587-1167 58.1 581
Rev: aggcaggaatgttagtgtttccc
Lamininγ3 Fw: ctccgaggaatgcacgtttga 1093-1614 61.1 522
Rev: tggtggaaatcgctgaggatg
Nidogen1 Fw: tccaggcagttttggcatctg 2964-3559 58.1 596
Rev: tgagctgggggaacatccatt
Nidogen2 Fw: cctggagggaaataccatgagg 545-1316 58.7 772
Rev: tcacagcaaaaggatactggagc
ColVIIIα1 Fw: tcgccatgggcaaggagatg 205-720 59.8 515
Rev: tttaggaccccgaaggcctt
GAPDH Fw: gaaggtgaaggtcggagtc 58-315 57.0 257
Rev: gaagatggtgatgggatttc
Table 3.
 
Quantitative Evaluation of BM Component Expression in Untreated and 24-Hour TGF-β2-Treated Corneoscleral and Cribriform TM Cells
Table 3.
 
Quantitative Evaluation of BM Component Expression in Untreated and 24-Hour TGF-β2-Treated Corneoscleral and Cribriform TM Cells
CC CR CC+TGF-β2 CR+TGF-β2
ColIVα2 1.0 1.0 ± 0.2 1.1 ± 0.1 1.0 ± 0.1
ColVIIIα1 1.0 0.9 ± 0.1 1.0 ± 0.2 0.9 ± 0.2
Lamininβ2 1.0 0.8 ± 0.3 0.9 ± 0.2 1.0 ± 0.1
Nidogen1 1.0 1.1 ± 0.2 1.0 ± 0.3 1.2 ± 0.3
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×