March 2006
Volume 47, Issue 3
Free
Glaucoma  |   March 2006
Analysis of Expression of Matrix Metalloproteinases and Tissue Inhibitors of Metalloproteinases in Human Ciliary Body after Latanoprost
Author Affiliations
  • Dong-Jin Oh
    From the Laboratory for Molecular Ophthalmology, Wills Eye Hospital, Philadelphia, Pennsylvania; the
    Department of Ophthalmology, Massachusetts Eye and Ear Infirmary, Boston, Massachusetts; the
  • Jonathan L. Martin
    From the Laboratory for Molecular Ophthalmology, Wills Eye Hospital, Philadelphia, Pennsylvania; the
  • Adrienne J. Williams
    From the Laboratory for Molecular Ophthalmology, Wills Eye Hospital, Philadelphia, Pennsylvania; the
  • Rachel E. Peck
    From the Laboratory for Molecular Ophthalmology, Wills Eye Hospital, Philadelphia, Pennsylvania; the
  • Corinna Pokorny
    From the Laboratory for Molecular Ophthalmology, Wills Eye Hospital, Philadelphia, Pennsylvania; the
  • Paul Russell
    Section on Aging and Ocular Disease, National Eye Institute, National Institutes of Health, Bethesda, Maryland; and the
  • David E. Birk
    Department of Pathology, Anatomy and Cell Biology, Thomas Jefferson University, Philadelphia, Pennsylvania.
  • Douglas J. Rhee
    From the Laboratory for Molecular Ophthalmology, Wills Eye Hospital, Philadelphia, Pennsylvania; the
    Department of Ophthalmology, Massachusetts Eye and Ear Infirmary, Boston, Massachusetts; the
    Department of Pathology, Anatomy and Cell Biology, Thomas Jefferson University, Philadelphia, Pennsylvania.
Investigative Ophthalmology & Visual Science March 2006, Vol.47, 953-963. doi:10.1167/iovs.05-0516
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to Subscribers Only
      Sign In or Create an Account ×
    • Get Citation

      Dong-Jin Oh, Jonathan L. Martin, Adrienne J. Williams, Rachel E. Peck, Corinna Pokorny, Paul Russell, David E. Birk, Douglas J. Rhee; Analysis of Expression of Matrix Metalloproteinases and Tissue Inhibitors of Metalloproteinases in Human Ciliary Body after Latanoprost. Invest. Ophthalmol. Vis. Sci. 2006;47(3):953-963. doi: 10.1167/iovs.05-0516.

      Download citation file:


      © 2016 Association for Research in Vision and Ophthalmology.

      ×
  • Supplements
Abstract

purpose. To determine the effect of latanoprost on the expression of human matrix metalloproteinases (MMPs) and tissue inhibitors of metalloproteinases (TIMPs) in the ciliary body.

methods. Total RNA was isolated, and qualitative RT-PCR was performed to detect the mRNA of MMPs and TIMPs in human ciliary body tissue and explant cultures of ciliary body smooth muscle (CBSM) cells. CBSM cell cultures were treated with vehicle control or latanoprost acid for 24 hours. Quantitative RT-PCR of cell cultures from five different donors was performed to determine relative changes in expression. GAPDH served as an endogenous control.

results. The mRNA of MMP-1, -2, -3, -11, -12, -14, -15, -16, -17, -19, and -24 as well as TIMP-1 to -4 were found in ciliary body tissue and CBSM cells. MMP-9 was present after latanoprost treatment. In control CBSM cells, the relative expression of MMP mRNA was MMP-2 and -14 > MMP-24 > MMP-1, -11, -15, -16, and -19 > MMP-3 and 17, > MMP-12. The relative expression of TIMP mRNA was TIMP-2 > TIMP-1 > TIMP-3 > TIMP-4. Latanoprost increased MMP-3 (in three of five cultures), MMP-17 (in four of five cultures), and TIMP-3 (in all five cultures); MMP-1, -2, -12, -14, -15, and -16 and TIMP-4 were downregulated.

conclusions. The transcription of the genes for MMP-3 and -17 is increased by latanoprost treatment. MMP-9 is present after latanoprost treatment and may also mediate ECM changes. TIMP-3 is upregulated and may compensate for the increase in MMPs. These coordinated changes could be expected to mediate the latanoprost-induced alteration of ECM in the ciliary body.

In the United States, glaucoma is the second leading cause of irreversible visual impairment. 1 2 3 The only rigorously validated treatment in humans is the lowering of intraocular pressure (IOP). 4 5 6 7 8 9 Latanoprost is a most effective topical IOP-lowering medication. 10 11 12  
Latanoprost lowers IOP by increasing uveoscleral outflow up to 60%. 13 14 15 16 17 The increased facility of outflow is believed to be the result of increased space around ciliary body smooth muscle (CBSM) cells caused by a PGF analogue–mediated alteration of the extracellular matrix (ECM) after 4 to 8 days of treatment. 18 19 The increased ECM turnover in the ciliary body (CB) is thought to be the result of increased expression and release of matrix metalloproteinases (MMPs) by CBSM cells. 
MMPs are zinc-dependent endopeptidases that are collectively capable of degrading many ECM components. 20 To date, there are at least 21 unique MMPs divided into five subfamilies in humans: collagenases, stromelysins, gelatinases, membrane-type (MT)-MMPs, and miscellaneous others. 21 Although there is significant substrate overlap, the subfamilies of MMPs are defined by the their ability to degrade certain ECM components. Five MMPs (i.e., MMP-1, -2, -3, -9, and -14) and three tissue inhibitors of matrix metalloproteinases (TIMPs; i.e., TIMP-1, -2, and -3) have been described in the CB, whereas only four MMPs (i.e., MMPs -1, -2, -3, and -9) and two TIMPs (i.e., TIMP-1 and -2) have been studied with regard to their response to latanoprost. 22 23 24 25 26 MMPs can be regulated at transcription, translation, and activation and through inhibition at the active site by TIMPs. For most MMPs, with the notable exception of MMP-2, transcriptional regulation and kinetic inhibition by TIMPs predominate. 20  
TIMPs are kinetic inhibitors of MMP enzymatic activity and, in some cases, are involved in the activation of MMPs from their inactive zymogen form to their active form. TIMP-2, 3, and -4 can bind pro-MMP-2, whereas TIMP-1 and -3 can bind pro-MMP-9. 27 Four mammalian TIMPs have been described. All four bind all known activated MMPs, although TIMP-1 poorly inhibits MMP-14, -15, -16, -19, and -24. 27 28  
In many tissues, the ratio of MMPs to TIMPs ultimately determines the rate of ECM turnover. 29 30 31 32 33 34 35 36 37 Our long-term goal is to determine the MMP-to-TIMP ratios that are associated with the observed increased uveoscleral outflow. In this investigation, we determined the presence of transcripts of MMPs and TIMPs expressed at baseline and determined the relative changes in transcription after incubation with latanoprost in human CBSM cells, to ascertain which MMPs and TIMPs are critical in regulating outflow resistance. 
Materials and Methods
Tissue and Explant Culture
All ciliary bodies were dissected from human donor corneoscleral buttons harvested within 12 hours after death. The corneoscleral buttons were removed by the Lyons Eye Bank of Delaware Valley (Philadelphia, PA) and stored (Optisol-GS; Bausch & Lomb Surgical, Irvine, CA) in accordance with the guidelines set forth in the Declaration of Helsinki. We have shown the suitability of corneoscleral buttons for molecular biological studies. 38 The CB tissue was dissected from the anterior segment and placed in −80°C for no longer than 2 weeks before isolation of RNA. We isolated CB tissue from 23 separate individuals ages, 23 to 84 years. Ages of the donors of the CB tissue samples to determinate the presence of MMPs and TIMPs were 26, 46, 49, 50, 51, 52, 54, 59, 60, 64, 66, 69, and 84 years. Explant cultures of CBSM cells from the CBs of separate donors, ages 23, 40, 43, 44, 46, 54, 60, 63, 64, 65, and 69, were used to determine the presence of transcripts of MMPs and TIMPs, and cultures from donors aged 23, 40, 52, 54, 56, 64, and 65 years were used for quantitative reverse transcription-polymerase chain reaction (qRT-PCR). 
CBSM cells were cultured according to a previously published protocol. 39 The cultures were maintained in Dulbecco’s modified Eagle’s medium (DMEM; BioWhittaker; Walkersville, MD) containing 20% fetal bovine serum, 1% l-glutamine (2 mM), and gentamicin (0.1 mg/mL; all from Gibco-Invitrogen, Carlsbad, CA) at 37°C in 10% CO2. Cell identity-confirmatory immunohistochemistry, labeling with anti-desmin and anti-smooth muscle actin antibodies, of our cultured cells was consistent with CBSM cells. 39 All the cells used were from passage-4 cultures. 
Latanoprost Incubation
Stock solutions of 10 mM latanoprost free acid (Cayman Chemical, Ann Arbor, MI) were prepared in ethanol and diluted to experimental concentrations with serum-free medium. CBSM cells (1 × 106) were plated into T-75 flasks and allowed to grow to confluence. Once confluent, the cultures were maintained for 1 week. The cells were then incubated with serum-free medium for 48 hours and then exposed to ethanol (0.06%, the vehicle control), 0.03, 0.3, and 30 μg/mL of latanoprost free acid for 24 hours. In studies of human uveal and cutaneous melanoma cell lines, concentrations of 10 μg/mL reliably showed changes in tyrosinase and cyclic AMP levels. We chose 30 μg/mL in the event that no trend was observed at 0.03 or 0.3 μg/mL, to see the trend at a dose far in excess of the pharmacological one. 40 In practice, latanoprost is given as a 0.005% (50 μg/mL) topical solution, resulting in a peak aqueous concentration of latanoprost free acid of 78 nM (0.028 μg/mL, 28 ng/mL) 1 to 2 hours after administration (the half-life in aqueous humor is 2 to 3 hours). 41 The cells were then scraped for RNA extraction. 
RNA Isolation
RNA was extracted (RNAqueous-4PCR kit; Ambion, Austin, TX) in accordance with the manufacturer’s protocol. Briefly, the tissue (or cell pellet) was lysed with a guanidinium thiocyanate-containing buffer to inactivate RNase and then homogenized. Total RNA was isolated using a spin column (i.e., a silica-gel membrane). The RNA was then treated with DNase I for 25 minutes in a 37°C water bath, to remove DNA contaminants. Purity and concentration of the RNA was tested by spectrophotometry (BioMate 5 Spectrophotometer; Thermo Spectronic, Madison, WI). 
RT-PCR and Sequencing of PCR Product
To determine the presence of MMPs and TIMPs, qualitative RT-PCR was performed on total RNA isolated from CB tissue and untreated explant cultures of CBSM cells (SuperScript One-Step RT-PCR with the Platinum Taq System; Invitrogen) in accordance with the manufacturer’s protocol. RT-PCR was initially performed with oligonucleotide primers previously published in the literature (Table 1)specific to the mRNA of the MMP or TIMP of interest. Two tubes were run in parallel, with the second tube containing only polymerase (Platinum Taq; Invitrogen), to assure that the source of the RT-PCR product was mRNA. For each reaction, 100 ng of template RNA was used (200 μM dNTP, 1.2 mM Mg, each primer 0.2 μM). Amplification was performed on a thermocycler (model 2700; Applied Biosystems, Inc. [ABI], Foster City, CA). The parameters were as follows: cDNA synthesis 50°C for 25 minutes, denaturation at 94°C for 2 minutes, amplification for 40 cycles of 94°C for 15 seconds, annealing for 20 seconds, and extension at 72°C for 45 seconds. A final extension of 72°C for 10 minutes was run after the 40 cycles. The mRNA concentration for MMPs in CB tissue is low, and so reamplification was performed with a PCR Reagent System (Invitrogen). 
Ten percent of the RT-PCR product was used as the DNA template for the PCR reaction. PCR conditions were as follows: incubation at 94°C for 2 minutes, followed by amplification at 94°C for 30 seconds, annealing for 30 seconds, and extension at 72°C for 30 seconds for 35 cycles. A final extension was run at 72°C for 7 minutes. This reamplification was not necessary for cultures of CBSM cells. Gel electrophoresis of the PCR products was performed on a 2% agarose gel (E-gel; Invitrogen). 
When the single correct band size was located, the bands were cut from the gel and purified (Gel Extraction Kit; Qiagen, Valencia, CA). DNA sequencing was then performed at the core facility of Thomas Jefferson University to confirm that the product obtained was representative of the specific MMP or TIMP. Results from the sequencing were analyzed with the BLAST program (http://www.ncbi.nlm.nih.gov/BLAST/ provided in the public domain by National Center for Biotechnology Information [NCBI], Bethesda, MD). If a band was not present, then RT-PCR was attempted with at least three to four primer sets designed by an online primer design program (e.g., Primer3: http://www.genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi). 
qRT-PCR: Primer-Probe Design
For the gene of interest, the DNA sequence (GenBank; NCBI, Bethesda, MD) was used to create a primer–probe combination (Primer Express; ABI, Foster City, CA; Table 2 ). RT-PCR was performed with these primers, as described in the prior section. The PCR products (between 75 and 150 bp in length) were run on a 4% agarose gel (E-gel; Invitrogen) with a 25-bp DNA ladder (Invitrogen). DNA sequencing of the amplicons verified the specificity of the primers, as described earlier. This served as a second confirmation as to the presence of mRNA of the MMP or TIMP of interest. 
Quantitative RT-PCR was performed (Prism 7000; ABI) with mastermix (TaqMan One Step RT-PCR; ABI) with GAPDH as an endogenous control (ABI). The thermocycling conditions were performed in three stages: one was cDNA synthesis of 48°C for 30 minutes; two was denaturation at 95°C for 10 minutes; and three was 40 cycles of 95°C for 15 seconds followed by annealing at 60°C for 1 minute. Results were then quantified (Prism 7000 SDS Software; ABI). We used 20 or 30 ng of total RNA to compare expression levels of MMPs and TIMPs. 
Relative Quantitation
For relative quantitation normalized to GAPDH, an endogenous control, standard curves were prepared for both MMPs and GAPDHs and TIMPs and GAPDHs. Standard curves for MMP-1, -2, -14, -15, -16, -19, and -24 and their counterpart GAPDHs were constructed using a serial dilution of total RNA with a range of 0.2, 0.5, 1, 2, 5, 10, and 20 ng (Fig. 1A) . Standard curves for MMP-3, -11, and -17 and their counterpart GAPDHs were constructed with a serial dilution of total RNA with a range of 0.1, 0.2, 0.5, 1, 2, 5, 10, and 20 ng (Fig. 1B) . Standard curves for MMP-12 and its counterpart GAPDH were constructed with a serial dilution of total RNA of the cultured CBSM cells, using a range of 5, 10, 20, 40, and 80 ng (Fig. 1C) . Standard curves for TIMPs and their counterpart GAPDHs were constructed with a serial dilution of total RNA of the cultured trabecular meshwork endothelial cells, with a range of 0.2, 0.5, 1, 2, 5, 10, and 20 ng for TIMP-1, -2, and -3 and with a range of 2.5, 5, 10, 20, 40, and 80 ng for TIMP-4 (Fig. 1D) . Using three CT levels (i.e., threshold cycle, defined as the fractional cycle number at which the amount of amplified target reaches a fixed threshold) for each input amount of dilution, standard curve equations for MMPs, TIMPs, and their counterpart GAPDHs were generated (Table 3) . The comparative ΔCT method was used for relative quantitation of those genes whose absolute value of the slope of log input versus ΔCT was less than 0.1 (Table 3) . The relative standard curve method was used for genes that did not satisfy the criteria. The coefficient of variation (CV) was used for data reproducibility. Reproducibility of standard curves of GAPDHs obtained from those cell lines used for different genes was as follows: 4.45 to 5.57 of CV (%) for HT-1080, 2.27 to 3.61 of CV (%) for CCF-STTG1, and 0.98 to 2.38 of CV (%) for cultured TM endothelial cells. All triplicates of CTs used for the experiment showed much less than 1% CV (Table 3) . According to the manufacturer’s protocol, triplicates showing less than 2% CV are accepted for this assay (ABI). 
Results
mRNA Expression of MMPs and TIMPs
Eleven of 21 MMPs were expressed in the CB tissue and the cultures of CBSM cells (Table 4)as determined by qualitative RT-PCR and subsequent DNA sequence confirmation (Fig. 2) . MMP-9 was not detected, but a very small amount was observed when CBSM cells were treated with latanoprost in quantitative RT-PCR. All four TIMPs were expressed by qualitative RT-PCR, and their subsequent DNA sequences were confirmed. 
In the cultured CBSM cells, the relative level of expression of the 11 MMPs and four TIMPs was determined by the CT values in the control group. MMP-2 and -14 had very high expression levels with CTs of 24 to 26 at 20 ng of total RNA (MMP-2 ≥ MMP-14); MMP-24 had high expression levels with a CT of 26 to 29; and MMP-1, -11, -15, -16, and -19 had intermediate expression levels, with CTs of 29 to 32. MMP-3 and -17 had low expression levels, MMP-3 with a CT of 34 to 35 and MMP-17 with a CT of 33, and MMP-12 had a very low expression level with a CT of 39. The CTs of GAPDH were 21 to 22 at the same total RNA concentration (20 ng). 
TIMP-2 appeared to be expressed at a higher level than the other TIMPs. At 20 ng of total RNA, TIMP-2 had a CT of 26 to 27. TIMP-1 also had a high expression level, showing a CT of 27 to 28, and TIMP-3 had an intermediate expression level with a CT of 29 to 30. TIMP-4 had a low expression level showing a CT of 32 to 36. The CT of GAPDH was 22 to 23 at the same total RNA concentration. 
Changes in mRNA Expression of MMPs by Latanoprost Acid
Cultures of CBSM cells derived from five to six eyes of different donors were exposed to vehicle control (0.06% ethanol), 0.03, 0.3, or 30 μg/mL of latanoprost free acid. 
A change of more than 10% in expression between the control and experimental levels was defined as an alteration of expression. Relative efficiencies of target and reference genes were considered equal if the absolute value of the slope of log input versus ΔCT was less than 0.1. Thus, the relative quantitation method classified 10% variability as unchanged, according to the manufacturer’s instructions. There was substantial individual variability among the donors tested, which had been encountered in previous studies of MMP and TIMP expression with latanoprost in CB. 49 Therefore, the ultimate determination of the effect of latanoprost on expression of an individual MMP or TIMP was determined by the trend of the majority (>60%) of the samples at a concentration of 0.03 μg/mL (Table 4) . The trend at the other latanoprost concentrations was determined in the same way (Fig. 1)
Collagenases.
Of the three known collagenases, collagenase-1 (MMP-1) was the only detected enzyme in this subfamily. At a pharmacologic level (0.03 μg/mL) of latanoprost, the expression of MMP-1 decreased an average of 18% in all five donors. As the concentration of latanoprost increased to suprapharmacologic doses, two of five donors showed a further dose-dependent decrease in expression (Fig. 3A)
Gelatinases.
Of the two gelatinases, only gelatinase A (MMP-2) was detected. The expression of MMP-2 in three donors decreased an average of 16% in response to 0.03 μg/mL of latanoprost, and as the concentration of latanoprost increased, a tendency toward decreased expression was observed (Fig. 3B) . The other two donors showed no changes in expression at 0.03 μg/mL. 
Stromelysins.
Of the three known stromelysins, stromelysin-1 and -3 (MMP-3 and -11, respectively) mRNAs were detected. At 0.03 μg/mL of latanoprost, three of five donors showed approximately 30% more MMP-3 mRNA expression, which further increased at 0.3 μg/mL; 30 μg/mL of latanoprost decreased the expression below baseline levels in two of these three donors. In the two other donors, the relative expression was within 10% of control in one, and there was a consistent decrease in expression at all concentrations in the other (Fig. 3C)
MMP-11 expression was not observed to change in three donors at 0.03 μg/mL of latanoprost, but as the concentration of latanoprost increased, there was a decrease in expression (Fig. 3C) . One donor showed an increase and the other a decrease of expression at all doses leading us to conclude that the expression of MMP-11 is unchanged by latanoprost. 
Membrane-Type Matrix Metalloproteinases.
At 0.03 μg/mL, the expression of MT1-MMP (MMP-14) was consistently decreased in three donors an average of 20%, whereas the two other donors had a consistent increase. Higher doses tended not to change the trends observed at 0.03 μg/mL (Fig. 3E)
At 0.03 μg/mL, the expression of MT2-MMP (MMP-15) decreased in three donors an average of 35%. The decreased expression in these four donors continued at higher concentrations of latanoprost. The other donor showed a dose-dependent increase in expression (Fig. 3E)
The expression of MT3-MMP (MMP-16) decreased an average of 20%, in three donors at all concentrations of latanoprost. In the remaining two donors, MMP-16 expression increased in one and remained unchanged in the other at 0.03 μg/mL. At higher concentrations of latanoprost, the expression of MMP-16 was less than 10% different from baseline in the remaining two (Fig. 3G)
Only MT4-MMP (MMP-17) showed a consistent dose-dependent increase in expression in response to latanoprost in four of five donors and was unchanged in the remaining one (Fig. 3G) . At 0.03 μg/mL, the average increase was 23%. 
At 0.03 μg/mL, the expression of MT5-MMP (MMP-24) in two donors decreased. The expression in one donor was unchanged, and in the remaining two donors expression increased, leading us to conclude that the expression of MMP-24 is unchanged. As the concentration of latanoprost increased, no trends were elucidated (Fig. 3F)
Miscellaneous MMPs.
Metalloelastase (MMP-12) had an average decrease of 24% in expression in four of five donors at 0.03 μg/mL. The expression in the remaining donor increased at 0.03 μg/mL of latanoprost (Fig. 3D) . The cultures from five donors were tested and MMP-12 was detected at a level too low to provide useful data for the quantitative RT-PCR assay in two of these donors; therefore, CBSM cell cultures from two additional donors were tested. At higher concentrations, MMP-12 showed a trend toward a dose-dependent decline. 
At 0.03 μg/mL, the expression of RASI-1 (MMP-19) decreased in two donors, was unchanged in two, and increased in the remaining donor. Higher concentrations of latanoprost did not change the trend at 0.03 μg/mL (Fig. 3D)leading us to conclude that MMP-19 expression was unchanged by latanoprost. 
In summary, MMP-3 and MMP-17 tended to have an increase in mRNA expression in response to latanoprost, whereas MMP-1, -2, -12, -14, -15, and -16 decreased. There was high variability in the responses of mRNA expression of MMPs to latanoprost among donors. 
Tissue Inhibitors of Matrix Metalloproteinases.
The expression of TIMP-1 did not change in three of the five donors (Fig. 3H)at 0.03 μg/mL. In the remaining two, levels were elevated in one and decreased in the other. At higher concentrations of latanoprost, no trend was observed. 
At 0.03 μg/mL, TIMP-2 expression was unchanged in two of the five donors. The expression in two other donors increased (Fig. 3I)and expression decreased in the remaining one. As the concentration of latanoprost increased, no trend was detectable. 
TIMP-3 expression increased an average of 32% in all five donors at 0.03 μg/mL. The increase in expression continued in four of five donors at 0.3 μg/mL (Fig. 3J) . At 30 μg/mL, TIMP-3 was downregulated. 
The expression of TIMP-4 did not change in three of the five donors at 0.03 μg/mL, but decreased in the remaining two (Fig. 3K) . At 0.3 μg/mL, TIMP-4 expression decreased in four of the five donors and in all five donors at 30 μg/mL. 
In response to pharmacologic doses of latanoprost, TIMP-3 transcription increased, whereas the transcription of TIMPs-1, -2, and -4 was not observed to change. 
Discussion
mRNA Expression of MMPs and TIMPs
To date, this is the most comprehensive analysis of MMP and TIMP mRNA expression in human CB. The presence of mRNA and protein of MMP-1, -2, -3, and -9 have been described in human CB. 22 23 24 25 49 50 51 TIMP-1 and -2 have been described at the mRNA and protein levels, whereas TIMP-3 and -4 proteins have been found in the CB. 24 26 51 We found the mRNA of eight other MMPs and TIMP-4. To assure the validity of our expression pattern of MMPs and TIMPs, we used oligonucleotide primers previously validated in the literature and confirmed the DNA sequence of the PCR products. We tested both tissues and explant cultures of CBSM cells. A second set of primers (those for the quantitative RT-PCR) also confirmed the expression of these genes in the CBSM cells. 
The presence of nearly all known MT-MMPs points to their importance in the functioning of CBSM cells and uveoscleral outflow. All MT-MMPs can degrade ECM components and can be competitively inhibited by TIMPs. 52 MT1-MMP, along with TIMP-2, is involved in the activation of MMP-2 (gelatinase A) and MMP-13. 52 53 54 55 56  
We could not detect expression of MMP-9, gelatinase B, in untreated or control samples, but it was induced by latanoprost at a very low level. In immunolabeling studies of human CBSM cell cultures and monkey CB tissue treated with control or latanoprost, Ocklind 23 was unable to find MMP-9. However, expression of MMP-9 in CB has been described at both the RNA 42 and protein 22 24 51 levels. Weinreb and Lindsey 49 found the mRNA of MMP-9 in control samples of CBSM cells. The protein of MMP-9 has been described at low levels in other studies. Using an immunohistochemical study to map the distribution of MMP-1, -2, -3, and -9 and the four TIMPs in the anterior uvea, Lan et al., 51 described MMP-9 as having moderate staining in the CB. El Shabrawi et al., 24 using CB explant organ cultures, reported that MMP-9 was barely detectable in the medium of their control cultures, and was undetectable in dexamethasone-treated cultures. In their immunohistochemical studies, they found diffuse staining throughout the CB, but much less than that found for MMP-2 and -3. 24 In the zymogram in the study by Weinreb et al., 22 MMP-9 activity was barely above background. In their Western blot analysis, a band at approximately 95 kDa was present, but was clearly weaker than the bands for the other three MMPs studied. The predominance of the band at 95 rather than 82 kDa indicated that the protein is primarily inactive. 22 If MMP-9 is expressed, it is probably expressed at extremely low levels with low activity and could vary from one individual to another. However, it appeared to be inducible with latanoprost in our studies. 
Changes in MMPs and TIMPs to Latanoprost
Most of the MMPs are either downregulated or unchanged in response to latanoprost at pharmacologic concentrations. Based on the consistent increase in mRNA expression of MMP-3 (stromelysin-1) and MMP-17 (MT4-MMP), it seems that these two enzymes are important for the latanoprost-induced increase in ECM degradation. Both of these are expressed at low amounts in control samples. In trabecular meshwork, MMP-3 is involved in the ECM-mediated decrease in outflow resistance to both tert-butylhydroquinone and argon laser. 57 58 MMP-3 may have a similar role as an effector of ECM degradation in CB after latanoprost treatment. Little is known about MMP-17. Through association with syndecan-1 on the cell surface, MMP-17 activates aggrecanase-1 (ADAMTS4), the active form of which associates with syndecan-1 through chondroitin sulfate and heparin sulfate. 59 60 61 MMP-17 can activate TNF-α. 62 63 64 It is unclear whether MMP-17 can activate MMP-2 (pro-gelatinase A). 62 63 Aggrecanase-1 degrades glycosaminoglycans, and its upregulation is associated with increased ECM degradation. 59 60 61 It is possible that by activating aggrecanase-1, MMP-17 helps further ECM turnover in CB in response to latanoprost. 
A consistent increase in TIMP-3 mRNA expression in response to latanoprost was found. TIMP-3 is the only TIMP that is sequestered in ECM to heparin-sulfate containing proteoglycans and possibly chondroitin-sulfate containing proteoglycans. 65 66 67 TIMP-3 is unique in its ability to inhibit TNF-α-converting enzyme (TACE) and its ability to inhibit strongly not only MMPs but several ADAMs (a disintegrin and metalloproteinase) and ADAMTS (ADAM with thrombospondin motifs). 66 67 68 69 70 TIMP-3 has also been hypothesized to function in a tissue-specific fashion as part of an acute response to remodeling stimuli and regulating ECM remodeling during the folding of epithelia. 71 72 73 TIMP-3 is an excellent inhibitor of MT1-MMP and MT2-MMP. 37 74 Mutations in TIMP-3 causes Sorsby’s fundus dystrophy. 75 Although TIMP-3 overexpression can cause apoptosis in some cancer cell lines, there has been no evidence that apoptosis occurs in CB in response to latanoprost treatment. 76 77 78 Because TIMP-3’s functions are primarily believed to be inhibitory, the upregulation of TIMP-3 may be part of a regulatory reaction to balance the latanoprost-induced increase in MMPs. However, it is also possible that its increase facilitates activation of the MMP zymogens, since TIMP-3 can bind pro-MMP-9. 27  
MMP-2 and -14 were the most highly expressed MMPs in the CBSM, and both were downregulated in response to latanoprost. Thus, our results do not support that these enzymes are primarily responsible for latanoprost-mediated ECM turnover. However, further study comparing the relative levels of zymogen (i.e., pro-MMP-2) versus active MMP-2 and -14 are needed to determine the importance of MMP-2, since it is primarily regulated at activation. 
We observed variability in the response to latanoprost among cultures from different donors similar to other studies of MMP-1, -2, -3, and -9 transcription after latanoprost incubation. 49 The source of this variation is unknown, but it could represent normal human variations of a mRNA that is present in very low amounts under normal conditions, donor medication history, variability inherent in the analysis methods, and normal genetic variation in response to latanoprost. 79 Clinically, there are some patients whose IOPs do not lower in response to latanoprost treatment. 80 In our study, latanoprost altered at least some of the MMPs and TIMPs in all cell lines. There was no apparent age-dependent pattern of response. The absence of a nonresponder may simply reflect our small sample size or indicate that the cause of clinical nonresponse is at a level beyond transcription in the CB. 
Weinreb and Lindsey 49 found MMP-1 increased (in all five donors at 6 hours, but decreased at 24 hours), MMP-2 decreased (in three of five donors), MMP-3 increased (in three of five donors), and MMP-9 increased (in four of five donors) in response to latanoprost. Our results are consistent with regards to MMP-1, -2 and -3 at 24 hours. 
In the other study examining the transcriptional activity of TIMP-1 and -2 after latanoprost, Anthony et al. 26 found that TIMP-1 was upregulated at 24 hours, which we did not find. They also found that TIMP-2 was mildly elevated at 6 hours and was unchanged at 24 hours, which agrees with our results. At 6 hours, the elevation was 6% to 11%, which would have been interpreted as unchanged with our criteria. 26 At the protein level, El Shabawri et al. 24 found no change in either TIMP-1 or -2 after latanoprost or dexamethasone treatment. 
Our results indicated that MMP-3, -9, and -17 may be responsible for the alteration in the ECM with latanoprost treatment. TIMP-3 was the only TIMP consistently altered by latanoprost. Examination of MMP/TIMP mRNA expression at only one time point is a limitation of this study. In addition, latanoprost-mediated changes in MMP and TIMP activity may be regulated by posttranscriptional events during biosynthesis and by extracellular activation, kinetic inhibition, and degradation. However, in the CB, latanoprost appears to shift the balance of MMPs and TIMPs toward greater levels of MMPs, resulting in the observed changes in the ECM. 
 
Table 1.
 
Primer Sequences and Expected PCR Products Sizes of Human MMPs and TIMPs
Table 1.
 
Primer Sequences and Expected PCR Products Sizes of Human MMPs and TIMPs
Name Protease Primers Expected PCR Product Size (bp) Ref.
Forward (5′–3′) Reverse (5′–3′)
MMP-1 Collagenase-1 TTTGATGGACCTGGAGGAAATC AATTGTTGGTCCACCTTTCATCTT 100
MMP-2 Gelatinase A ACTGTGACGCCACGTGAACAA CGTATACCGCATCAATCTTTTCC 88
MMP-3 Stromelysin-1 CCTTTGATGCTGTCAGCACTCT GCAATTCAGGTTCAAGCTTCCT 96
MMP-9 Gelatinase B AACTGTCCCTGCCCGAGACCGGTGAGCTGGATAGCG AGTCTCTCGCTGGGGCAGAAGCCAAACCGGTCGTCG 597 57
MMP-11 Stromelysin-3 TAAAGGTATGGAGCGATGTGAC TGGGTAGCGAAAGGTGTAGAAG 326 42
MMP-12 Metalloelastase TTCCCCTGAACAGCTCTACAAGCCTGGAAA GATCCAGGTCCAAAAGCATGGGCTAGGATT 517 42
MMP-14 MT1-MMP GCGCCCCCGATGTGGTGTTC TGCCCCGGCGGTCATCATC 569 43
MMP-15 MT2-MMP GCCCCCACACCGCTCTATTC CCGACGTCCTCCCACCAA 429 43
MMP-16 MT3-MMP TATTCGCCGTGCCTTTGATGT TGGGGGCACTGTCGGTAGAG 463 43
MMP-17 MT4-MMP CACCAAGTGGAACAAGAGGAACCT TGGTAGTACGGCCGCATGATGGAGTGTGCA 420 44
MMP-19 RASI CAGGCTCTCTATGGCAAGAA GAGCTGCATCCAGGTTAGGT 397 45
MMP-24 MT5-MMP CAGTACATGGAGACGCACAA ATGGTCACCATGATGTCCAC 866 46
TIMP-1 CTGTTGTTGCTGTGGCTGATAG CAGGAGGTTCCGAGACTTTTC 507 47
TIMP-2 TCTGGAAACGACATTTATGG GGGTATTCGTCCGGAGGTTG 501 47
TIMP-3 GGTCTGTGGCATTGATGA GTGCAACTTCGTGGAGAG 281 48
TIMP-4 CCAGAGGTCAGGTGGTAA ACAGCCAGAAGCAGTATC 446 48
Table 2.
 
Sequences of the Primers and of Human MMPs and TIMPs for Quantitative RT-PCR and Their PCR Product Sizes
Table 2.
 
Sequences of the Primers and of Human MMPs and TIMPs for Quantitative RT-PCR and Their PCR Product Sizes
Name Protease Primers Expected PCR Product Size (bp)
Forward (5′-3′) Reverse (5′-3′)
MMP-1 Collagenase-1 TTTGATGGACCTGGAGGAAATC AATTGTTGGTCCACCTTTCATCTT 100
MMP-2 Gelatinase A ACTGTGACGCCACGTGAACAA CGTATACCGCATCAATCTTTTCC 88
MMP-3 Stromelysin-1 CCTTTGATGCTGTCAGCACTCT GCAATTCAGGTTCAAGCTTCCT 96
MMP-11 Stromelysin-3 GGTGGCAGCCCATGAATTT AAGGTGTAGAAGGCGGACATCA 84
MMP-12 Metalloelastase GGTTCTTCTGGCTGAAGGTTTCT AGATGGCAAGGTTGGCCATA 80
MMP-14 MT1-MMP GAAAACTCAGAGAGGGTCTTCGTT AGTGGCTCAGGCTCCTTCCT 104
MMP-15 MT2-MMP TACTCTTTGCCTCTGGCTTCCA AATAGGCGTGGGCCAGAAA 75
MMP-16 MT3-MMP AGTATTTCAATGTGGAGGTTTGGTT ACTTTTCCTGTCATGTTAATGCCATA 148
MMP-17 MT4-MMP GGGTATCCTTCCTTCCTCTACGTTATTGTC AGCGACCACAAGATCGTCTTCT 77
MMP-19 RASI AGCAATGTGGCTCCCTTGAC GACTCTCCCAGGCCCATCA 120
MMP-24 MT5-MMP CTGGCGTCTGCGCAATAAC ATCTCCCATCGGCCCTTTC 136
TIMP-1 GCTTCACCAAGACCTACACTGTTG CTGGTCCGTCCACAAGCAA 107
TIMP-2 AAACGACATTTATGGCAACCCTAT GGGCCGTGTAGATAAACTCTATATCC 104
TIMP-3 TGCTCTCTGTCTCTTTTTTCAGCTT CTACAGTGTGTTGTCTGCTGCTTTT 142
TIMP-4 CACCTGCCTCTCAGGAAGGA GGCTTGATCTTCAGGACTCTTGA 94
Figure 1.
 
Relative standard curves of MMPs and relative efficiency plots of TIMPs for relative quantitation. To evaluate validation of the comparative ΔCT method in PCR, (A) standard curves for MMP-1, -2, -12, -14, -15, -16, -19, and -24 and GAPDH were generated with total RNA from HT-1080 cells (human fibrosarcoma cell line; ATCC, Manassas, VA), (B) standard curves for MMP-3, -11, and -17 and GAPDH were generated with total RNA from CCF STTG1 cells (human astrocytoma; ATCC), (C) standard curves for MMP-12 and GAPDH and their ΔCT plots were generated with total RNA from hCBSM cells and (D) relative efficiency plots for TIMPs were generated with total RNA from human trabecular meshwork endothelial cells. The mRNA expression level of MMPs and TIMPs in the control and latanoprost-treated cultures was calculated with the comparative ΔCT method, in which the absolute value of the slope of log input versus ΔCT is < 0.1. However, the relative standard curve method was used for genes that did not satisfy the criteria. Each point in a linear line is the average of triplicate results.
Figure 1.
 
Relative standard curves of MMPs and relative efficiency plots of TIMPs for relative quantitation. To evaluate validation of the comparative ΔCT method in PCR, (A) standard curves for MMP-1, -2, -12, -14, -15, -16, -19, and -24 and GAPDH were generated with total RNA from HT-1080 cells (human fibrosarcoma cell line; ATCC, Manassas, VA), (B) standard curves for MMP-3, -11, and -17 and GAPDH were generated with total RNA from CCF STTG1 cells (human astrocytoma; ATCC), (C) standard curves for MMP-12 and GAPDH and their ΔCT plots were generated with total RNA from hCBSM cells and (D) relative efficiency plots for TIMPs were generated with total RNA from human trabecular meshwork endothelial cells. The mRNA expression level of MMPs and TIMPs in the control and latanoprost-treated cultures was calculated with the comparative ΔCT method, in which the absolute value of the slope of log input versus ΔCT is < 0.1. However, the relative standard curve method was used for genes that did not satisfy the criteria. Each point in a linear line is the average of triplicate results.
Table 3.
 
Equations for Standard Curves and ΔCT of MMPs and TIMPs
Table 3.
 
Equations for Standard Curves and ΔCT of MMPs and TIMPs
Cell Lines Names Standard Curve Equations ΔCT Equations
MMPs/TIMPs R 2 GAPDH R 2 MMPs/TIMPs R 2
HT-1080 MMP-1 y = −3.555x+ 33.882 0.986 y = −3.551x+ 24.019 0.996 y = −0.003x+ 9.863 0.001
MMP-2 y = −3.596x+ 33.143 0.987 y = −3.542x+ 26.551 0.993 y = −0.078x+ 6.610 0.224
MMP-14 y = −3.390x+ 29.133 0.973 y = −3.542x+ 26.551 0.993 y = 0.128x+ 2.601 0.114
MMP-15 y = −3.623x+ 37.022 0.970 y = −3.542x+ 26.551 0.993 y = 0.073x+ 10.301 0.015
MMP-16 y = −3.736x+ 35.768 0.973 y = −3.600x+ 26.650 0.988 y = −0.136x+ 9.118 0.109
MMP-19 y = −3.934x+ 38.438 0.973 y = −4.140x+ 26.003 0.995 y = 0.123x+ 12.546 0.043
MMP-24 y = −3.648x+ 34.081 0.971 y = −3.551x+ 24.019 0.996 y = −0.096x+ 10.062 0.106
CCF-STTG1 MMP-3 y =−4.427x+ 36.209 0.988 y =−4.110x+ 28.477 0.993 y = 0.111x+ 7.354 0.020
MMP-11 y =−3.761x+ 31.549 0.976 y =−3.509x+ 26.476 0.971 y = 0.085x+ 2.075 0.080
MMP-17 y =−3.790x+ 37.334 0.966 y =−3.509x+ 26.476 0.971 y = 0.136x+ 7.749 0.091
Cultured hCBSM MMP-12 y =−3.495x+ 36.347 0.992 y =−3.509x+ 26.474 0.996 y = 0.015x+ 9.871 0.020
Cultured TM cells TIMP-1 y =−4.455x+ 28.975 0.996 y =−4.423x+ 26.704 0.994 y =−0.079x+ 2.328 0.196
TIMP-2 y =−4.189x+ 30.062 0.993 y =−4.423x+ 26.704 0.994 y =−0.087x+ 3.493 0.252
TIMP-3 y =−4.013x+ 32.303 0.992 y =−4.356x+ 26.739 0.996 y =−0.103x+ 5.580 0.108
TIMP-4 y =−3.393x+ 37.358 0.991 y =−3.491x+ 26.480 0.995 y =−0.095x+ 10.883 0.042
Table 4.
 
The Relative the mRNA Expression Levels of MMPs and TIMPs in Cultures of Human CBSM Cells and the Effect of Latanoprost Acid on Their Expression at the Pharmacologic Concentration of 0.03 μg/mL
Table 4.
 
The Relative the mRNA Expression Levels of MMPs and TIMPs in Cultures of Human CBSM Cells and the Effect of Latanoprost Acid on Their Expression at the Pharmacologic Concentration of 0.03 μg/mL
Name Protease Expression Level* Effect of Latanoprost Acid, †
Collagenases
 MMP-1 Collagenase-1 +++ 5 DOWN
Gelatinases
 MMP-2 Gelatinase A +++++ 2 NO, 3 DOWN
 MMP-9 Gelatinase B +/− Extremely low expression
Stromelysins
 MMP-3 Stromelysin-1 ++ 3 UP, 1 NO, 1 DOWN
 MMP-11 Stromelysin-3 +++ 1 UP, 3 NO, 1 DOWN
MT-MMPs
 MMP-14 MT1-MMP +++++ 2 UP, 3 DOWN
 MMP-15 MT2-MMP +++ 1 UP, 4 DOWN
 MMP-16 MT3-MMP +++ 1 UP, 1 NO, 3 DOWN
 MMP-17 MT4-MMP ++ 4 UP, 1 NO
 MMP-24 MT5-MMP ++++ 2 UP, 1 NO, 2 DOWN
Other MMPs
 MMP-12 Metalloelastase + 1 UP, 4 DOWN
 MMP-19 RASI +++ 1 UP, 2 NO, 2 DOWN
TIMPs
 TIMP-1 ++++ 1 UP, 3 NO, 1 DOWN
 TIMP-2 ++++ 2 UP, 2 NO, 1 DOWN
 TIMP-3 +++ 5 UP
 TIMP-4 ++ 3 NO, 2 DOWN
Figure 2.
 
Qualitative RT-PCR results with primers developed by Primer Express (ABI). DNA ladders were run concurrently to verify DNA size. The gel was imaged, and the expected band sizes for the corresponding MMPs and TIMPs were recorded (Table 2) . (A) Qualitative RT-PCR for MMPs in CBSM cells cultured from a 40-year-old donor. Odd-numbered lanes correspond to the no-template control. Lane 2: MMP-1; lane 4: MMP-2; lane 6: MMP-3; lane 8: MMP-11; lane 10: MMP-12; lane 12: MMP-14; lane 14: MMP-15; lane 16: MMP-16; lane 18: MMP-17; lane 20: MMP-19; and lane 22: MMP-24. All PCR DNA products were sequenced. (B) Qualitative RT-PCR for TIMPs in CBSM cells cultured from a 40-year-old donor. Odd-numbered lanes correspond to the no-template control. Lane 2: TIMP-1; lane 4: TIMP-2; lane 6: TIMP-3; and lane 8: TIMP-4. (A, B) Unnumbered left column: 25-bp DNA ladder.
Figure 2.
 
Qualitative RT-PCR results with primers developed by Primer Express (ABI). DNA ladders were run concurrently to verify DNA size. The gel was imaged, and the expected band sizes for the corresponding MMPs and TIMPs were recorded (Table 2) . (A) Qualitative RT-PCR for MMPs in CBSM cells cultured from a 40-year-old donor. Odd-numbered lanes correspond to the no-template control. Lane 2: MMP-1; lane 4: MMP-2; lane 6: MMP-3; lane 8: MMP-11; lane 10: MMP-12; lane 12: MMP-14; lane 14: MMP-15; lane 16: MMP-16; lane 18: MMP-17; lane 20: MMP-19; and lane 22: MMP-24. All PCR DNA products were sequenced. (B) Qualitative RT-PCR for TIMPs in CBSM cells cultured from a 40-year-old donor. Odd-numbered lanes correspond to the no-template control. Lane 2: TIMP-1; lane 4: TIMP-2; lane 6: TIMP-3; and lane 8: TIMP-4. (A, B) Unnumbered left column: 25-bp DNA ladder.
Figure 3.
 
Changes in mRNA expressions of (AD) MMPs, (EG) MT-MMPs, and (HK) TIMPs in hCBSM cells treated with latanoprost. In response to latanoprost at the therapeutic level (0.03 μg/mL), in cultures of hCBSM cells, MMP-3, MMP-17, and TIMP-3 were upregulated, whereas MMP-1, -2, -12, -14, -15, and -16 and TIMP-4 were downregulated. Fifteen to 50 ng total RNA was used, according to the expression levels of the MMPs.
Figure 3.
 
Changes in mRNA expressions of (AD) MMPs, (EG) MT-MMPs, and (HK) TIMPs in hCBSM cells treated with latanoprost. In response to latanoprost at the therapeutic level (0.03 μg/mL), in cultures of hCBSM cells, MMP-3, MMP-17, and TIMP-3 were upregulated, whereas MMP-1, -2, -12, -14, -15, and -16 and TIMP-4 were downregulated. Fifteen to 50 ng total RNA was used, according to the expression levels of the MMPs.
SommerA, TielschJM, KatzJ, et al. Racial differences in the cause-specific prevalence of blindness in east Baltimore. N Engl J Med. 1991;325:1412–1417. [CrossRef] [PubMed]
TielscheJM, SommerA, WittK, KatzJ, RoyallRM. Blindness and visual impairment in an American urban population: the Baltimore Eye Survey. Arch Ophthalmol. 1990;108:286–290. [CrossRef] [PubMed]
MartinMJU, SommerA, GoldEB, DiamondEL. Race and primary open-angle glaucoma. Am J Ophthalmol. 1985;99:383–387. [CrossRef] [PubMed]
The AGIS Investigators. The Advanced Glaucoma Intervention Study (AGIS): 7. The relationship between control of intraocular pressure and visual field deterioration. Am J Ophthalmol. 2000;130:429–440. [CrossRef] [PubMed]
BergeaB, BodinL, SvedberghB. Impact of intraocular pressure regulation on visual fields in open-angle glaucoma. Ophthalmology. 1999;106:997–1005. [CrossRef] [PubMed]
Collaborative Normal-Tension Glaucoma Study Group. Comparison of glaucomatous progression between untreated patients with normal-tension glaucoma and patients with therapeutically reduced intraocular pressures. Am J Ophthalmol. 1998;126:487–497. [CrossRef] [PubMed]
MaoLK, StewardWC, ShieldMB. Correlation between intraocular pressure control and progressive glaucomatous damage in primary open-angle glaucoma. Am J Ophthalmol. 1991;111:51–55. [CrossRef] [PubMed]
HeijlA, LeskeMC, BengtssonB, HymanL, BengtssonB, HusseinM, for the Early Manifest Glaucoma Trial Group. Reduction of intraocular pressure and glaucoma progression. Arch Ophthalmol. 2002;120:1268–1279. [CrossRef] [PubMed]
KassMA, GordonMO, HoffMR, et al. Topical timolol administration reduces the incidence of glaucomatous damage in ocular hypertensive individuals. Arch Ophthalmol. 1989;107:1590–1598. [CrossRef] [PubMed]
AlmA, StjernschantzJ, the Scandinavian Latanoprost Study Group. Effects on intraocular pressure and side-effects of 0.005% latanoprost applied once daily, evening or morning: A comparison with timolol. Ophthalmology. 1995;102:1743–1752. [CrossRef] [PubMed]
CamrasCB, the United States Latanoprost Study Group. Comparison of latanoprost and timolol in patients with ocular hypertension and glaucoma: a six-month, masked, multicenter trial in the United States. Ophthalmology. 1996;103:138–147. [CrossRef] [PubMed]
WatsonP, StjernschantzJ, the Latanoprost Study Group. A six-month, randomized, double-masked study comparing latanoprost and timolol in primary open-angle glaucoma and ocular hypertension: a 12 week study. Arch Ophthalmol. 1996;114:929–932. [CrossRef] [PubMed]
NilssonSFE, SamuelssonM, BillA, StjernschantzJ. Increased uveoscleral outflow as a possible mechanism of ocular hypotension caused by prostaglandin F-1-isopropylester in the cynomolgus monkey. Exp Eye Res. 1989;48:707–716. [CrossRef] [PubMed]
StjernschantzJ, SelenG, OcklindA, ResulB. Effects of latanoprost and related prostaglandin analogues.AlmA WeinrebRN eds. Uveoscleral Outflow. Biology and Clinical Aspects. 1998;57–72.Mosby-Wolfe Medical Communications London.
StjernschantzJ, SelenG, SjoquistB, ResulB. Preclinical pharmacology of latanoprost, a phenyl-substituted PGF2a analogue. Adv Prostaglandin Thromboxane Leukot Res. 1995;23:513–518. [PubMed]
LeeP, PodosSM, SeverinC. Effect of prostaglandin F2a on aqueous humor dynamics of rabbit, cat, and monkey. Invest Ophthalmol Vis Sci. 1984;25:1087–1093. [PubMed]
CamrasCB, PodosSM, RosenthalJS, LeeP, SeverinCH. Multiple dosing of prostaglandin F or epinephrine on cynomolgus monkey eyes. I. Aqueous humor dynamics. Invest Ophthalmol Vis Sci. 1987;28:463–469. [PubMed]
Lütjen-DrecollE, TammE. Morphological study of the anterior segment of cynomolgus monkey eyes following treatment with prostaglandin F. Exp Eye Res. 1988;47:761–769. [CrossRef] [PubMed]
Lütjen-DrecollE, TammE. The effects of ocular hypotensive doses of PGF F2a-1-isopropylester on anterior segment morphology.BitoLZ StjernschantzJ eds. The Ocular Effects of Prostaglandins and Other Eicosanoids. 1989;737–776.Allan R. Liss Inc. New York.
NagaseH, WoessnerJF. Matrix metalloproteinases. J Biol Chem. 1999;274:21491–21494. [CrossRef] [PubMed]
YeS. Polymorphism in matrix metalloproteinase gene promoters: implication in regulation of gene expression and susceptibility of various diseases. Matrix Biol. 2000;19:623–629. [CrossRef] [PubMed]
WeinrebRN, KashiwagiK, KashiwagiF, TuskaharaS, LindseyJD. Prostaglandins increase matrix metalloproteinase release from human ciliary smooth muscle cells. Invest Ophthalmol Vis Sci. 1997;38:2772–2780. [PubMed]
OcklindA. Effect of latanoprost on the extracellular matrix of the ciliary muscle. A study on cultured cells and tissue sections. Exp Eye Res. 1998;67:179–191. [CrossRef] [PubMed]
El-ShabrawiY, EckhardtM, BergholdA, et al. Synthesis pattern of matrix metalloproteinases (MMPs) and inhibitors (TIMPs) in human explant organ cultures after treatment with latanoprost and dexamethasone. Eye. 2000;14:375–383. [CrossRef] [PubMed]
LindseyJD, KashiwagiK, BoyleD, KashiwagiF, FiresteinGS, WeinrebRN. Prostaglandins increase proMMP-1 and proMMP-3 secretion by human ciliary smooth muscle cells. Curr Eye Res. 1996;15:869–875. [CrossRef] [PubMed]
AnthonyTL, LindseyJD, WeinrebRN. Latanoprost’s effects on TIMP-1 and TIMP-2 expression in human ciliary muscle cells. Invest Ophthalmol Vis Sci. 2002;43:3705–3711. [PubMed]
BakerAH, Edwards, MurphyG. Metalloproteinase inhibitors: biological actions and therapeutic opportunities. J Cell Sci. 2002;115:3719–3727. [CrossRef] [PubMed]
LambertE, DassaE, HayeB, PetitfrereE. TIMPs as multifunctional proteins. Crit Rev Oncol Hematol. 2004;49:187–198. [CrossRef] [PubMed]
KhasigovPZ, PodobedOV, GrachevaTS, SalbievKD, GrachevSV, BerezovTT. Role of matrix metalloproteinases and their inhibitors in tumor invasion and metastasis. Biochemistry (Mosc). 2003;68:711–717. [CrossRef] [PubMed]
CurranS, DundasSR, BuxtonJ, LeemanMF, RamsayR, MurrayGI. Matrix metalloproteinase/tissue inhibitors of matrix metalloproteinase phenotype identifies poor prognosis colorectal cancers. Clin Cancer Res. 2004;10:8229–8234. [CrossRef] [PubMed]
ZhouX, HovellCJ, PawleyS, et al. Expression of matrix metalloproteinase-2 and -14 persists during early resolution of experimental liver fibrosis and might contribute to fibrinolysis. Liver Int. 2004;24:492–501. [CrossRef] [PubMed]
MaataM, TervahartialaT, HarjuM, AiraksinenJ, Autio-HarmainenH, SorsaT. Matrix metalloproteinases and their tissue inhibitors in aqueous humor of patients with primary open-angle glaucoma, exfoliation syndrome, and exfoliation glaucoma. J Glaucoma. 2005;14:64–69. [CrossRef] [PubMed]
SteinmetzEF, BuckleyC, ShamesML, et al. Treatment with simvastatin suppresses the development of experimental abdominal aortic aneurysms in normal and hypercholesterolemic mice. Ann Surg. 2005;241:92–101. [PubMed]
AhmedZ, DentRG, LeadbeaterWE, SmithC, BerryM, LoganA. Matrix metalloproteinases: degradation of the inhibitory environment of the transected optic nerve and the scar by regenerating axons. Mol Cell Neurosci. 2005;28:64–78. [CrossRef] [PubMed]
PauschingerM, ChandrasekharanK, SchultheissJP. Myocardial remodeling in viral heart disease: possible interactions between inflammatory mediators and MMP-TIMP system. Heart Fail Rev. 2004;9:21–31. [CrossRef] [PubMed]
ButlerGS, ButlerMJ, AtkinsonSJ, et al. The TIMP2 membrane type 1 metalloproteinase “receptor” regulates the concentration and efficient activation of progelatinase A: a kinetic study. J Biol Chem. 1998;273:871–880. [CrossRef] [PubMed]
ButlerGS, WillH, AtkinsonSJ, MurphyG. Membrane-type-2 matrix metalloproteinase can initiate the processing of progelatinase A and is regulated by the tissue inhibitors of metalloproteinases. Eur J Biochem. 1997;244:653–657. [CrossRef] [PubMed]
RheeDJ, TammER, RussellP. Donor corneoscleral buttons: a new source of trabecular meshwork for research. Exp Eye Res. 2003;2003:749–756.
WeinrebRN, KimD-M, LindseyJD. Propagation of ciliary smooth muscle cells in vitro and effects of prostaglandin F on calcium efflux. Invest Ophthalmol Vis Sci. 1992;33:2679–2686. [PubMed]
DutkiewiczR, AlbertDM, LevinLA. Effects of latanoprost on tyrosinase activity and mitotic index of cultured melanoma lines. Exp Eye Res. 2000;70:563–569. [CrossRef] [PubMed]
SjoquistB, StjernschantzJ. Ocular and systemic pharmacokinetics of latanoprost in humans. Surv Ophthalmol. 2002;47(suppl 1)S6–S12. [CrossRef] [PubMed]
GiambernardiAM, GrantGM, TaylorGP, et al. Overview of matrix metalloproteinase expression in cultured human cells. Matrix Biol. 1998;16:483–496. [CrossRef] [PubMed]
MartinJ, EynstoneL, DaviesM, SteadmanR. Induction of metalloproteinases by glomerular mesangial cells stimulated by proteins of the extracellular matrix. J Am Soc Nephrol. 2001;12:88–96. [PubMed]
GrantGM, GiambernardiAM, GrantAM, KlebeRJ. Overview of expression of matrix metalloproteinases (MMP-17, MMP-18, and MMP-20) in cultured human cells. Matrix Biology. 1999;18:145–148. [CrossRef] [PubMed]
KonttinenYT, AinolaM, VallealaH, et al. Analysis of 16 different matrix metalloproteinases (MMP-1 to MMP-20) in the synovial membrane: different profiles in trauma and rheumatoid arthritis. Ann Rheumatol Dis. 1999;58:691–697. [CrossRef]
FortunatoSJ, MenonR. Screening of novel matrix matalloproteinases (MMPs) in human fetal membranes. J Assist Reprod Genet. 2002;19:483–486. [CrossRef] [PubMed]
SaghizadehM, BrownDJ, CastellonR, et al. Overexpression of matrix metalloproteinase-10 and matrix metalloproteinase-3 in human diabetic corneas: a possible mechanism of basement membrane and integrin alterations. Am J Pathol. 2001;158:723–734. [CrossRef] [PubMed]
FortunatoSJ, MenonR, LombardiSJ. Presence of four tissue inhibitors of matrix metalloproteinases (TIMP-1, -2, -3, and -4) in human fetal membranes. Am J Reprod Immunol. 1998;40:395–400. [CrossRef] [PubMed]
WeinrebRN, LindseyJD. Metalloproteinase gene transcription in human ciliary muscle cells with latanoprost. Invest Ophthalmol Vis Sci. 2002;43:716–722. [PubMed]
GatonDD, SagaraT, LindseyJD, WeinrebRN. Matrix metalloproteinase-1 localization in the normal human uveoscleral outflow pathway. Invest Ophthalmol Vis Sci. 1999;40:363–369. [PubMed]
LanJ, KumarRK, Di GirolamoN, McCluskeyP, WakefieldD. Expression and distribution of matrix metalloproteinases and their inhibitors in the human iris and ciliary body. Br J Ophthalmol. 2003;87:208–211. [CrossRef] [PubMed]
Hernandez-BarrantesS, BernardoM, TothM, FriedmanR. Regulation of membrane type-matrix metalloproteinases. Semin Cancer Biol. 2002;12:131–138. [CrossRef] [PubMed]
StronginAY, CollierI, BannikovG, MarmerBL, GrantGA, GoldbergGI. Mechanism of cell surface activation of 72-kDa type IV collagenase. J Biol Chem. 1995;1995270:5331–5338.
DeryuginaEI, BourdonMA, JungwirthK, SmithJW, StronginAY. Functional activation of integrin αVβ3 in tumor cells expressing membrane-type 1 matrix metalloproteinase. Int J Cancer. 2000;86:15–23. [CrossRef] [PubMed]
NagaseH. Cell surface activation of progelatinase A (proMMP-2) and cell migration. Cell Res. 1998;8:179–186. [CrossRef] [PubMed]
KnauperV, WillH, Lopez-OtinC, et al. Cellular mechanisms for human procollagenase-3 (MMP-13) activation: evidence that MT1-MMP (MMP-14) and gelatinase A (MMP-2) are able to generate active enzyme. J Biol Chem. ;271:17124–17131. [CrossRef] [PubMed]
ParshleyDE, BradleyJMB, SamplesJR, Van BuskirkEM, AcottTS. Early changes in matrix metalloproteinases and inhibitors after in vitro laser treatment to the trabecular meshwork. Curr Eye Res. 1995;14:537–544. [CrossRef] [PubMed]
PangHH, FleenorDL, HellbergPE, StropkiK, McCartneyMD, ClarkAF. Aqueous outflow-enhancing effect of tert-butylhydroquinone: involvement of AP-1 activation and MMP-3 expression. Invest Ophthalmol Vis Sci. 2003;44:3502–3510. [CrossRef] [PubMed]
IshiguroN, KojimaT. Role of aggrecanase and MMP in cartilage degradation. Clin Calcium. 2004;14:38–44.
AraiM, AndersonD, KurdiY, et al. Effect of adenovirus-mediated over expression of bovine ADAMTS-4 and human ADAMTS-5 in primary bovine articular chondrocyte pellet culture system. Osteoarthritis Cartilage. 2004;12:599–613. [CrossRef] [PubMed]
FlanneryCR, ZengW, CorcoranC, et al. Autocataltic cleavage of ADAMTS-4 (aggrecanase-1) reveals multiple glycosaminoglycan-binding sites. J Biol Chem. 2002;277:42775–42780. [CrossRef] [PubMed]
EnglishWR, PuenteXS, FreijeJM, et al. Membrane type 4 matrix metalloproteinase (MMP17) has tumor necrosis factor-alpha convertase activity but does not activate pro-MMP2. J Biol Chem. 2000;275:14046–14055. [CrossRef] [PubMed]
WangY, JohnsonAR, YeQZ, DyerRD. Catalytic activities and substrate specificity of the human membrane type 4 matrix metalloproteinase catalytic domain. J Biol Chem. 1999;274:33043–33049. [CrossRef] [PubMed]
GauthierMC, RacineC, FerlandC, et al. Expression of membrane type-4 matrix metalloproteinase (metalloproteinase-17) by human eosinophils. Int J Biochem Cell Biol. 2003;35:1667–1673. [CrossRef] [PubMed]
YuWH, YuS, MengQ, BrewK, WoessnerJF, Jr. TIMP-3 binds to sulphated glycosaminoglycans of the extracellular matrix. J Biol Chem. 2000;275:31226–31232. [CrossRef] [PubMed]
PavloffN, StaskusPW, KishnaniNS, HawkesSP. A new inhibitor of metalloproteinases from chicken: ChIMP-3—a third member of the TIMP family. J Biol Chem. 1992;267:17321–17326. [PubMed]
YangTT, HawkesSP. Role of the 21-kDa protein TIMP-3 in oncogenic transformation of culture chicken embryo fibroblasts. Proc Natl Acad Sci USA. 1992;89:10676–10680. [CrossRef] [PubMed]
KashiwagiM, TortorellaM, NagaseH, BrewK. TIMP-3 is a potent inhibitor of aggrecanase 1 (ADAM-TS4) and aggrecanase 2 (ADAM-TS5). J Biol Chem. 2001;276:12501–12504. [CrossRef] [PubMed]
NagaseH, BrewK. Designing TIMP (tissue inhibitor of metalloproteinases) variants that are selective metalloproteinase inhibitors. Biochem Soc Symp. 2003;70:201–212. [PubMed]
AmourA, SlocombePM, WebsterA, et al. TNF-alpha converting enzyme (TACE) is inhibited by TIMP-3. FEBS Lett. 1998;435:39–44. [CrossRef] [PubMed]
LecoKJ, KhokhaR, PavloffN, HawkesSP, EdwardsDR. Tissue inhibitor of metalloproteinase-3 (TIMP-3) is an extracellular matrix-associated protein with a distinctive pattern of expression in mouse cells and tissues. J Biol Chem. 1994;269:9352–9360. [PubMed]
ApteSS, HayashiK, SeldinMF, MatteiMG, HayashiM, OlsenBR. Gene encoding a novel murine tissue inhibitor of metalloproteinases TIMP), TIMP-3, is expressed in developing mouse epithelia, cartilage, and muscle, and is located on mouse chromosome 10. Dev Dyn. 1994;200:177–197. [CrossRef] [PubMed]
SlawomirM, Wojtowicz-Praga, DicksonRB, HawkinsMJ. Matrix metalloproteinase inhibitors. Investig New Drugs. 1997;15:61–75. [CrossRef]
WillH, AtkinsonSJ, ButlerGS, SmithB, MurphyG. The soluble catalytic domain of membrane type 1 matrix metalloproteinase cleaves the propeptide of progelatinase A and initiates autoproteolytic activation. Regulation by TIMP-2 and TIMP-3. J Biol Chem. 1996;271:17119–17123. [CrossRef] [PubMed]
TabataY, IsashickiY, KamimuraK, NakaoK, OhbaN. A novel splice site mutation in the tissue inhibitor of the metalloproteinases-3 gene in Sorsby’s fundus dystrophy with unusual clinical feathers. Hum Genet. 1998;103:179–182. [PubMed]
BondM, MurphyG, BennettMR, NewbyAC, BakerAH. Tissue inhibitor of metalloproteinase-3 induces a Fas-associated death domain-dependent type II apoptotic pathway. J Biol Chem. 2002;277:13787–13795. [CrossRef] [PubMed]
BakerAH, GeorgeSJ, ZaltsmanAB, MurphyG, NewbyAC. Inhibition of invasion and induction of apoptotic cell death in cancer cell lines by over expression of TIMP-3. Br J Cancer. 1999;79:1347–1355. [CrossRef] [PubMed]
AhonenM, BakerAH, KahariVM. Adenovirus-mediated gene delivery of tissue inhibitor of metalloproteinase-3 inhibits invasion and induces apoptosis in melanoma cells. Cancer Res. 1998;58:2310–2315. [PubMed]
WeinrebRN, LindseyJD, MarchenkoG, MarchenkoN, AngertM, StronginA. Prostaglandin FP agonists alter metalloproteinase gene expression in sclera. Invest Ophthalmol Vis Sci. 2004;45:4368–4377. [CrossRef] [PubMed]
CamrasCB, HedmanK, US Latanoprost Study Group. Rate of response to latanoprost or timolol in patients with ocular hypertension or glaucoma. J Glaucoma. 2003;12:466–469. [CrossRef] [PubMed]
Figure 1.
 
Relative standard curves of MMPs and relative efficiency plots of TIMPs for relative quantitation. To evaluate validation of the comparative ΔCT method in PCR, (A) standard curves for MMP-1, -2, -12, -14, -15, -16, -19, and -24 and GAPDH were generated with total RNA from HT-1080 cells (human fibrosarcoma cell line; ATCC, Manassas, VA), (B) standard curves for MMP-3, -11, and -17 and GAPDH were generated with total RNA from CCF STTG1 cells (human astrocytoma; ATCC), (C) standard curves for MMP-12 and GAPDH and their ΔCT plots were generated with total RNA from hCBSM cells and (D) relative efficiency plots for TIMPs were generated with total RNA from human trabecular meshwork endothelial cells. The mRNA expression level of MMPs and TIMPs in the control and latanoprost-treated cultures was calculated with the comparative ΔCT method, in which the absolute value of the slope of log input versus ΔCT is < 0.1. However, the relative standard curve method was used for genes that did not satisfy the criteria. Each point in a linear line is the average of triplicate results.
Figure 1.
 
Relative standard curves of MMPs and relative efficiency plots of TIMPs for relative quantitation. To evaluate validation of the comparative ΔCT method in PCR, (A) standard curves for MMP-1, -2, -12, -14, -15, -16, -19, and -24 and GAPDH were generated with total RNA from HT-1080 cells (human fibrosarcoma cell line; ATCC, Manassas, VA), (B) standard curves for MMP-3, -11, and -17 and GAPDH were generated with total RNA from CCF STTG1 cells (human astrocytoma; ATCC), (C) standard curves for MMP-12 and GAPDH and their ΔCT plots were generated with total RNA from hCBSM cells and (D) relative efficiency plots for TIMPs were generated with total RNA from human trabecular meshwork endothelial cells. The mRNA expression level of MMPs and TIMPs in the control and latanoprost-treated cultures was calculated with the comparative ΔCT method, in which the absolute value of the slope of log input versus ΔCT is < 0.1. However, the relative standard curve method was used for genes that did not satisfy the criteria. Each point in a linear line is the average of triplicate results.
Figure 2.
 
Qualitative RT-PCR results with primers developed by Primer Express (ABI). DNA ladders were run concurrently to verify DNA size. The gel was imaged, and the expected band sizes for the corresponding MMPs and TIMPs were recorded (Table 2) . (A) Qualitative RT-PCR for MMPs in CBSM cells cultured from a 40-year-old donor. Odd-numbered lanes correspond to the no-template control. Lane 2: MMP-1; lane 4: MMP-2; lane 6: MMP-3; lane 8: MMP-11; lane 10: MMP-12; lane 12: MMP-14; lane 14: MMP-15; lane 16: MMP-16; lane 18: MMP-17; lane 20: MMP-19; and lane 22: MMP-24. All PCR DNA products were sequenced. (B) Qualitative RT-PCR for TIMPs in CBSM cells cultured from a 40-year-old donor. Odd-numbered lanes correspond to the no-template control. Lane 2: TIMP-1; lane 4: TIMP-2; lane 6: TIMP-3; and lane 8: TIMP-4. (A, B) Unnumbered left column: 25-bp DNA ladder.
Figure 2.
 
Qualitative RT-PCR results with primers developed by Primer Express (ABI). DNA ladders were run concurrently to verify DNA size. The gel was imaged, and the expected band sizes for the corresponding MMPs and TIMPs were recorded (Table 2) . (A) Qualitative RT-PCR for MMPs in CBSM cells cultured from a 40-year-old donor. Odd-numbered lanes correspond to the no-template control. Lane 2: MMP-1; lane 4: MMP-2; lane 6: MMP-3; lane 8: MMP-11; lane 10: MMP-12; lane 12: MMP-14; lane 14: MMP-15; lane 16: MMP-16; lane 18: MMP-17; lane 20: MMP-19; and lane 22: MMP-24. All PCR DNA products were sequenced. (B) Qualitative RT-PCR for TIMPs in CBSM cells cultured from a 40-year-old donor. Odd-numbered lanes correspond to the no-template control. Lane 2: TIMP-1; lane 4: TIMP-2; lane 6: TIMP-3; and lane 8: TIMP-4. (A, B) Unnumbered left column: 25-bp DNA ladder.
Figure 3.
 
Changes in mRNA expressions of (AD) MMPs, (EG) MT-MMPs, and (HK) TIMPs in hCBSM cells treated with latanoprost. In response to latanoprost at the therapeutic level (0.03 μg/mL), in cultures of hCBSM cells, MMP-3, MMP-17, and TIMP-3 were upregulated, whereas MMP-1, -2, -12, -14, -15, and -16 and TIMP-4 were downregulated. Fifteen to 50 ng total RNA was used, according to the expression levels of the MMPs.
Figure 3.
 
Changes in mRNA expressions of (AD) MMPs, (EG) MT-MMPs, and (HK) TIMPs in hCBSM cells treated with latanoprost. In response to latanoprost at the therapeutic level (0.03 μg/mL), in cultures of hCBSM cells, MMP-3, MMP-17, and TIMP-3 were upregulated, whereas MMP-1, -2, -12, -14, -15, and -16 and TIMP-4 were downregulated. Fifteen to 50 ng total RNA was used, according to the expression levels of the MMPs.
Table 1.
 
Primer Sequences and Expected PCR Products Sizes of Human MMPs and TIMPs
Table 1.
 
Primer Sequences and Expected PCR Products Sizes of Human MMPs and TIMPs
Name Protease Primers Expected PCR Product Size (bp) Ref.
Forward (5′–3′) Reverse (5′–3′)
MMP-1 Collagenase-1 TTTGATGGACCTGGAGGAAATC AATTGTTGGTCCACCTTTCATCTT 100
MMP-2 Gelatinase A ACTGTGACGCCACGTGAACAA CGTATACCGCATCAATCTTTTCC 88
MMP-3 Stromelysin-1 CCTTTGATGCTGTCAGCACTCT GCAATTCAGGTTCAAGCTTCCT 96
MMP-9 Gelatinase B AACTGTCCCTGCCCGAGACCGGTGAGCTGGATAGCG AGTCTCTCGCTGGGGCAGAAGCCAAACCGGTCGTCG 597 57
MMP-11 Stromelysin-3 TAAAGGTATGGAGCGATGTGAC TGGGTAGCGAAAGGTGTAGAAG 326 42
MMP-12 Metalloelastase TTCCCCTGAACAGCTCTACAAGCCTGGAAA GATCCAGGTCCAAAAGCATGGGCTAGGATT 517 42
MMP-14 MT1-MMP GCGCCCCCGATGTGGTGTTC TGCCCCGGCGGTCATCATC 569 43
MMP-15 MT2-MMP GCCCCCACACCGCTCTATTC CCGACGTCCTCCCACCAA 429 43
MMP-16 MT3-MMP TATTCGCCGTGCCTTTGATGT TGGGGGCACTGTCGGTAGAG 463 43
MMP-17 MT4-MMP CACCAAGTGGAACAAGAGGAACCT TGGTAGTACGGCCGCATGATGGAGTGTGCA 420 44
MMP-19 RASI CAGGCTCTCTATGGCAAGAA GAGCTGCATCCAGGTTAGGT 397 45
MMP-24 MT5-MMP CAGTACATGGAGACGCACAA ATGGTCACCATGATGTCCAC 866 46
TIMP-1 CTGTTGTTGCTGTGGCTGATAG CAGGAGGTTCCGAGACTTTTC 507 47
TIMP-2 TCTGGAAACGACATTTATGG GGGTATTCGTCCGGAGGTTG 501 47
TIMP-3 GGTCTGTGGCATTGATGA GTGCAACTTCGTGGAGAG 281 48
TIMP-4 CCAGAGGTCAGGTGGTAA ACAGCCAGAAGCAGTATC 446 48
Table 2.
 
Sequences of the Primers and of Human MMPs and TIMPs for Quantitative RT-PCR and Their PCR Product Sizes
Table 2.
 
Sequences of the Primers and of Human MMPs and TIMPs for Quantitative RT-PCR and Their PCR Product Sizes
Name Protease Primers Expected PCR Product Size (bp)
Forward (5′-3′) Reverse (5′-3′)
MMP-1 Collagenase-1 TTTGATGGACCTGGAGGAAATC AATTGTTGGTCCACCTTTCATCTT 100
MMP-2 Gelatinase A ACTGTGACGCCACGTGAACAA CGTATACCGCATCAATCTTTTCC 88
MMP-3 Stromelysin-1 CCTTTGATGCTGTCAGCACTCT GCAATTCAGGTTCAAGCTTCCT 96
MMP-11 Stromelysin-3 GGTGGCAGCCCATGAATTT AAGGTGTAGAAGGCGGACATCA 84
MMP-12 Metalloelastase GGTTCTTCTGGCTGAAGGTTTCT AGATGGCAAGGTTGGCCATA 80
MMP-14 MT1-MMP GAAAACTCAGAGAGGGTCTTCGTT AGTGGCTCAGGCTCCTTCCT 104
MMP-15 MT2-MMP TACTCTTTGCCTCTGGCTTCCA AATAGGCGTGGGCCAGAAA 75
MMP-16 MT3-MMP AGTATTTCAATGTGGAGGTTTGGTT ACTTTTCCTGTCATGTTAATGCCATA 148
MMP-17 MT4-MMP GGGTATCCTTCCTTCCTCTACGTTATTGTC AGCGACCACAAGATCGTCTTCT 77
MMP-19 RASI AGCAATGTGGCTCCCTTGAC GACTCTCCCAGGCCCATCA 120
MMP-24 MT5-MMP CTGGCGTCTGCGCAATAAC ATCTCCCATCGGCCCTTTC 136
TIMP-1 GCTTCACCAAGACCTACACTGTTG CTGGTCCGTCCACAAGCAA 107
TIMP-2 AAACGACATTTATGGCAACCCTAT GGGCCGTGTAGATAAACTCTATATCC 104
TIMP-3 TGCTCTCTGTCTCTTTTTTCAGCTT CTACAGTGTGTTGTCTGCTGCTTTT 142
TIMP-4 CACCTGCCTCTCAGGAAGGA GGCTTGATCTTCAGGACTCTTGA 94
Table 3.
 
Equations for Standard Curves and ΔCT of MMPs and TIMPs
Table 3.
 
Equations for Standard Curves and ΔCT of MMPs and TIMPs
Cell Lines Names Standard Curve Equations ΔCT Equations
MMPs/TIMPs R 2 GAPDH R 2 MMPs/TIMPs R 2
HT-1080 MMP-1 y = −3.555x+ 33.882 0.986 y = −3.551x+ 24.019 0.996 y = −0.003x+ 9.863 0.001
MMP-2 y = −3.596x+ 33.143 0.987 y = −3.542x+ 26.551 0.993 y = −0.078x+ 6.610 0.224
MMP-14 y = −3.390x+ 29.133 0.973 y = −3.542x+ 26.551 0.993 y = 0.128x+ 2.601 0.114
MMP-15 y = −3.623x+ 37.022 0.970 y = −3.542x+ 26.551 0.993 y = 0.073x+ 10.301 0.015
MMP-16 y = −3.736x+ 35.768 0.973 y = −3.600x+ 26.650 0.988 y = −0.136x+ 9.118 0.109
MMP-19 y = −3.934x+ 38.438 0.973 y = −4.140x+ 26.003 0.995 y = 0.123x+ 12.546 0.043
MMP-24 y = −3.648x+ 34.081 0.971 y = −3.551x+ 24.019 0.996 y = −0.096x+ 10.062 0.106
CCF-STTG1 MMP-3 y =−4.427x+ 36.209 0.988 y =−4.110x+ 28.477 0.993 y = 0.111x+ 7.354 0.020
MMP-11 y =−3.761x+ 31.549 0.976 y =−3.509x+ 26.476 0.971 y = 0.085x+ 2.075 0.080
MMP-17 y =−3.790x+ 37.334 0.966 y =−3.509x+ 26.476 0.971 y = 0.136x+ 7.749 0.091
Cultured hCBSM MMP-12 y =−3.495x+ 36.347 0.992 y =−3.509x+ 26.474 0.996 y = 0.015x+ 9.871 0.020
Cultured TM cells TIMP-1 y =−4.455x+ 28.975 0.996 y =−4.423x+ 26.704 0.994 y =−0.079x+ 2.328 0.196
TIMP-2 y =−4.189x+ 30.062 0.993 y =−4.423x+ 26.704 0.994 y =−0.087x+ 3.493 0.252
TIMP-3 y =−4.013x+ 32.303 0.992 y =−4.356x+ 26.739 0.996 y =−0.103x+ 5.580 0.108
TIMP-4 y =−3.393x+ 37.358 0.991 y =−3.491x+ 26.480 0.995 y =−0.095x+ 10.883 0.042
Table 4.
 
The Relative the mRNA Expression Levels of MMPs and TIMPs in Cultures of Human CBSM Cells and the Effect of Latanoprost Acid on Their Expression at the Pharmacologic Concentration of 0.03 μg/mL
Table 4.
 
The Relative the mRNA Expression Levels of MMPs and TIMPs in Cultures of Human CBSM Cells and the Effect of Latanoprost Acid on Their Expression at the Pharmacologic Concentration of 0.03 μg/mL
Name Protease Expression Level* Effect of Latanoprost Acid, †
Collagenases
 MMP-1 Collagenase-1 +++ 5 DOWN
Gelatinases
 MMP-2 Gelatinase A +++++ 2 NO, 3 DOWN
 MMP-9 Gelatinase B +/− Extremely low expression
Stromelysins
 MMP-3 Stromelysin-1 ++ 3 UP, 1 NO, 1 DOWN
 MMP-11 Stromelysin-3 +++ 1 UP, 3 NO, 1 DOWN
MT-MMPs
 MMP-14 MT1-MMP +++++ 2 UP, 3 DOWN
 MMP-15 MT2-MMP +++ 1 UP, 4 DOWN
 MMP-16 MT3-MMP +++ 1 UP, 1 NO, 3 DOWN
 MMP-17 MT4-MMP ++ 4 UP, 1 NO
 MMP-24 MT5-MMP ++++ 2 UP, 1 NO, 2 DOWN
Other MMPs
 MMP-12 Metalloelastase + 1 UP, 4 DOWN
 MMP-19 RASI +++ 1 UP, 2 NO, 2 DOWN
TIMPs
 TIMP-1 ++++ 1 UP, 3 NO, 1 DOWN
 TIMP-2 ++++ 2 UP, 2 NO, 1 DOWN
 TIMP-3 +++ 5 UP
 TIMP-4 ++ 3 NO, 2 DOWN
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×