February 2009
Volume 50, Issue 2
Free
Biochemistry and Molecular Biology  |   February 2009
Analysis of Rare Variants in the Complement Component 2 (C2) and Factor B (BF) Genes Refine Association for Age-Related Macular Degeneration (AMD)
Author Affiliations
  • Andrea J. Richardson
    From the Centre for Eye Research Australia, University of Melbourne, East Melbourne, Victoria, Australia; and the
  • F. M. Amirul Islam
    From the Centre for Eye Research Australia, University of Melbourne, East Melbourne, Victoria, Australia; and the
  • Robyn H. Guymer
    From the Centre for Eye Research Australia, University of Melbourne, East Melbourne, Victoria, Australia; and the
    Royal Victorian Eye and Ear Hospital, East Melbourne, Victoria, Australia.
  • Paul N. Baird
    From the Centre for Eye Research Australia, University of Melbourne, East Melbourne, Victoria, Australia; and the
Investigative Ophthalmology & Visual Science February 2009, Vol.50, 540-543. doi:10.1167/iovs.08-2423
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to Subscribers Only
      Sign In or Create an Account ×
    • Get Citation

      Andrea J. Richardson, F. M. Amirul Islam, Robyn H. Guymer, Paul N. Baird; Analysis of Rare Variants in the Complement Component 2 (C2) and Factor B (BF) Genes Refine Association for Age-Related Macular Degeneration (AMD). Invest. Ophthalmol. Vis. Sci. 2009;50(2):540-543. doi: 10.1167/iovs.08-2423.

      Download citation file:


      © 2016 Association for Research in Vision and Ophthalmology.

      ×
  • Supplements
Abstract

purpose. Several single-nucleotide polymorphisms (SNPs) in the C2 and BF genes have been associated with age-related macular degeneration (AMD) in Caucasian populations from the United States. The study was conducted to evaluate whether these SNPs are also associated with AMD in persons of Anglo-Celtic ethnicity in an Australian population.

methods. Included in the study were 565 persons with AMD and 204 ethnically matched control subjects. All participants completed a standard health questionnaire, were given a fundus examination, and provided a blood sample for DNA extraction. Alleles were determined by a matrix-assisted desorption ionization–time of flight (MALDI-TOF)–based approach followed by statistical analysis.

results. The C2 and BF genes indicated significant association with AMD of only two SNPs; rs547154 (IVS10) in the C2 gene (P = 9.1 × 10−5) and rs641153 (R32Q) in the BF gene (P = 7.0 × 10−5). No association with AMD was found for SNP rs9332739 (E318D) in the C2 gene or for rs4151667 (L9H), rs1048709 (R150R), rs4151659 (K565E), or rs2072633 (IVS17) in the BF gene. A protective haplotype of variants IVS10 and R32Q was associated with AMD (OR 0.29, 95% CI 0.20–0.42).

conclusions. In this study, the association of the IVS10 and R32Q variants in the C2 and BF genes in AMD was replicated. Haplotype analysis indicated association of these variants with AMD in an Australian population. Both IVS10 and R32Q variants were in strong linkage disequilibrium with each other (r 2 = 0.96). Although the E318D and L9H variants have shown association with AMD in previous studies, the findings were not in agreement. This demonstrates a refined pattern of association of these rare variants with AMD.

Age-related macular degeneration (AMD) (ARMD1; MIM 603075) is the leading cause of uncorrectable vision loss and blindness in developed countries, and in Australia it contributes to up to 50% of all blindness (presenting visual acuity < 6/60). 1 A genetic predisposition to this disease has clearly been shown with several genes having now been identified, of which several are inflammatory genes, including the complement factor H gene and the C3 gene of the alternative pathway. 2 3 4 5 6 Additional support for the involvement of an inflammatory involvement in AMD comes from the association of the two paralogous genes complement component 2 (C2; MIM 217000) and factor B (BF; MIM 138470), located within the gene-rich class III region of the HLA complex on chromosome 6. 7 8 9 Moreover, BF and C2 are involved in the initiation of the alternative complement cascade and the activation of the classic component pathway, respectively. 
In three previous studies based on American case control cohorts, with one including a family study, 9 the association of the C2 and BF genes with AMD has been examined. 7 8 9 In two of these studies, the AMD subtypes of early geographic atrophy (GA) and choroidal neovascular (CNV) AMD were investigated. 7 9 The third study was performed to investigate only late-stage AMD. 8 These reports consistently showed involvement of several single-nucleotide polymorphisms (SNPs), including E318D and IVS10 of the C2 gene and L9H and R32Q of the BF gene, with AMD. Each study held the consensus view that each of these SNPs is involved in protection against AMD. 
The purpose of our study was to undertake a replication of work on previously identified SNPs in the C2 and BF genes in an Australian AMD case–control cohort, to investigate the SNPs’ involvement in AMD. 
Methods
Subjects
All individuals in this study were a part of our AMD Inheritance Study (AMDIS). All individuals with AMD were identified through either outpatient clinics at the Royal Victorian Eye and Ear Hospital (RVEEH) or private ophthalmology practices in Melbourne and had an Anglo-Celtic ethnic background. Individuals with AMD were included if they had drusen > 125 μm. Control subjects were obtained from the same community as part of a large population-based epidemiologic eye study, the Melbourne Visual Impairment Project (VIP) or through aged-care nursing homes. Control individuals were included if they presented with a normal fundus (<10 hard drusen <63 μm in size) and no altered macular pigmentation. At the time of ascertainment a clinical examination was performed, a fundus photograph obtained, and a blood sample collected for DNA analysis. In addition, all participants completed a standard risk factor and disease history questionnaire. Smoking was assessed by asking whether individuals were current or past smokers or had never smoked. All participants in our study were unrelated. 
Written informed consent was obtained from all individuals, and ethics approval for the project was provided by the Human Research and Ethics Committee of the Royal Victorian Eye and Ear Hospital, Melbourne. The study was conducted in accordance with the Declaration of Helsinki and according to the National Health and Medical Research Council of Australia’s statement on ethical conduct in research involving humans, revised in 1999. 
Genotyping
We chose to genotype SNPs that had been previously investigated, 7 and included rs9332739 (E318D) and rs547154 (IVS10) in the C2 gene, and rs4151667 (L9H), rs641153 (R32Q), rs1048709 (R150R), rs4151659 (K565E), and rs2072633 (IVS17) in the BF gene. 
Genotyping of all SNPs was performed as previously described 10 using a genetic analysis system (MassARRAY platform; Sequenom, San Diego, CA) through the Australian Genome Research Facility (AGRF; Brisbane, Australia). The polymerase chain reaction (PCR) primers and primers (MassExtend; Sequenom) used in our study are listed in Table 1
Statistical Analysis
Study characteristics including sex and age at ascertainment or diagnosis of the participants with and without AMD were compared by using the χ2 test or independent sample t-test. Hardy-Weinberg equilibrium (HWE) was undertaken to assess whether genotypes fell within a standard distribution with the software program JLIN: a Java-based linkage disequilibrium (LD) plotter. 11 Deviations of genotype frequencies in controls and cases from those expected under Hardy Weinberg were assessed by χ2 tests. Allelic associations with AMD were investigated with the UNPHASED software, 12 and results were presented as odds ratio (OR; 95% [confidence interval] CI). Genotype frequencies were compared between total AMD cases and controls and also between AMD subtypes and controls by χ2. We applied the additive model as the best-fit model to determine genotype distributions. Haplotype analysis was performed by using the same UNPHASED software. 12 Participants’ characteristics and genotype associations were performed with commercial software (SPSS; ver. 14.0; SPSS Inc., Chicago, IL). 
Results
A total of 769 individuals were included in this study. Of these, 565 (73%) individuals presented with AMD with a mean age of diagnosis of 73.4 years. In addition, 204 (27%) unaffected individuals with a similar mean age of 72.4 years were also recruited (P = 0.1; Table 2 ). There were significantly more females with AMD than there were males, and a higher percentage of females overall compared with males (P < 0.02; Table 2 ). 
There was no evidence of departure from HWE for any of the SNPs analyzed in our study (P > 0.05; data not shown). Allelic association, after adjustment for smoking, was evident for AMD for the variant IVS10 of the C2 gene, with an OR of 2.28 (95% CI, 1.52–3.40) and for the variant R32Q of the BF gene with an OR of 2.31 (95% CI, 1.55–3.45; Table 3 ). We did not detect any significant allelic association for the variant E318D in the C2 gene, nor for the variants L9H, R150R, K565E, and IVS17 in the BF gene (Table 3)
The genotype distribution in total AMD and control for all SNPs was compared by using χ2 statistics. In genotype associations, only IVS10 and R32Q were significantly associated with AMD, as was observed in allelic associations (Table 3) . After Bonferroni correction for multiple testing, both IVS10 and R32Q variants remained significant in AMD cases compared with controls (P ≤ 0.001; Table 3 ). 
AMD subtype association analysis was not undertaken, as none of the subtypes was significantly different than the total AMD group in their observed genotype frequencies. 
Haplotype analysis revealed only one haplotype (haplotype 2) as being significantly associated with protection against AMD with an odds ratio of 0.29 (Table 4) . No other haplotype combinations were found to be significant in our analysis (Table 4)
Discussion
This is the first non-U.S. Caucasian study in which the association of SNP variants in the C2 and BF genes in AMD was examined. In the present study we confirmed previous significant findings for the two SNPs, IVS10 in the C2 gene and R32Q in the BF gene, in association with AMD. 
The IVS10 and R32Q variants appear to be in complete LD (r 2 = 0.96) in our AMD cohort (Fig. 1) . These findings agree with previous studies that showed these two variants to be in strong LD. 7 8 9 However, R32Q was not in LD with any of the other SNPs tested in this study. Previous studies also implicated the E318D and L9H variants in the C2 and BF genes, respectively, as being associated with AMD as well as being in high LD with each other. 7 8 9 Although we did find them to be in high LD (r 2 = 0.97), our findings do not support their association with AMD. A previous report also indicated no significant association of the E318D and L9H variants in the family arm of their study or when smoking was included as a covariant in their case–control model. 9 Overall, these findings suggest that the protective effect of the C2 and BF genes resides within the LD block identified by the IVS10 and R32Q variants. 
The protective alleles (T at IVS10 and A at R32Q) present as uncommon variants in our study with a frequency of 0.117 and 0.118, respectively, in our control subjects. This was similar to the MAF reported in HapMap of 0.109 for IVS10 and 0.117 for R32Q (HapMap). However, these frequencies were approximately double those of 0.055 (IVS10) and 0.054 (R32Q) in our cases. This doubling in observed minor allele frequency (MAF) for IVS10 and R32Q between controls and cases has been reported in prior studies. 7 8 9 As a consequence, we were only able to detect a TT genotype for IVS10 or an AA genotype for R32Q in 3/204 (1.5%) of controls and 2/565 (0.3%) cases of AMD. 
The level of association in the IVS10 and R32Q variants is highlighted by our haplotype analysis. Haplotype 2 showed the protective effect of the changes at both these variants. This finding is in agreement with the original paper by Gold et al., 7 outlining the association of the C2 and BF genes with AMD. 
One of the main challenges in identifying genetic variants in complex diseases using genome-wide association studies (GWAS) is to identify not only common but also rare variants that have small but important roles in disease etiology. 13 The evidence presented herein suggests that the variants in the C2/BF genes associated with AMD clearly fall into this rare variant category. It is, therefore, likely that other rare genetic variants exist that also play a role in AMD, and these are as yet to be identified either through linkage or GWAS. 
In summary, our data further refine the causative variant for AMD to the LD block identified by either IVS10 in the C2 gene or the R32Q in the BF gene. This observation, along with previous reports that have narrowed the variants to be either E318D or IVS10 in the C2 gene and L9H or R32Q in the BF gene, indicates that IVS10 and R32Q have remained candidate variants associated with AMD throughout all the studies conducted to date. However, our inability to replicate the E318D- or L9H-associated variants identified in the U.S. studies indicates one of the key challenges faced by the Human Variome Project 14 in establishing the role of rare variants in what appear to be similar but subtly different in Caucasian populations in the United States and Australia. 
 
Table 1.
 
Primer Details for Genotyping of SNPs from the C2 and BF Genes
Table 1.
 
Primer Details for Genotyping of SNPs from the C2 and BF Genes
SNP ID PCR 1st Primer PCR 2nd Primer Amplicon Length (bp) Extension Sequence Primer
rs9332739 ACGTTGGATGTGTCTGTCCTGAACGACAAC ACGTTGGATGCCCGTACCTTTATAGTTGGC 99 GCATTTTCCAGGCTGCTGATCAC
rs547154 ACGTTGGATGAGTGAGCTTTGCCCTCCTTG ACGTTGGATGAAGTGAGGGGCACTGTGTC 109 GGGGCACTGTGTCCAGGTTCCCAA
rs4151667 ACGTTGGATGCAAGAGGCCCAAGATAAAGG ACGTTGGATGCTTCTCTCCTGCCTTCCAAC 100 CAATCTCAGCCCCCAAC
rs641153 ACGTTGGATGCCTTTCTCTTCAGGTGTGAC ACGTTGGATGTTGATCTCTACCCCCTCCAG 103 CAGAGAGCAGGATCCCTGGGGC
rs1048709 ACGTTGGATGCGTTGTCACAGATCGCTGTC ACGTTGGATGTCTTTCCACTGCTATGACGG 120 TGCCAAGTGAATGGCCG
rs4151659 ACGTTGGATGGAAGTAGTCCTATTTCACCC ACGTTGGATGATCAGGGCAACGTCATAGTC 109 TTCAGGAATTCCTGCTTCTT
rs2072633 ACGTTGGATGTCAAGAACGAGGCTGAGCTG ACGTTGGATGTAATCCTGGAAGCATGGCTG 106 AAGCATGGCTGTTCCTGCTTG
Table 2.
 
Characteristics of AMD, Its Clinical Subtypes, and Controls
Table 2.
 
Characteristics of AMD, Its Clinical Subtypes, and Controls
Characteristics Control (%) Any AMD (%) P * Early (%) P * CNV (%) P * GA (%) P *
Total (N = 769) 204 (26) 565 (73) 43 (7.6) 421 (74.5) 101 (17.8)
Male, n (%) 84 (41.2) 183 (32.4) 0.02, † 8 (18.6) 0.005, † 135 (32.1) 0.03, † 40 (39.6) 0.79
Female, n (%) 120 (58.8) 382 (67.6) 35 (81.4) 286 (67.9) 61 (60.4)
Age, mean (SD) 72.4 (6.2) 73.4 (7.8) 0.10 71.9 (5.7) 0.65 73.8 (7.7) 0.03, † 72.4 (8.7) 0.99
Table 3.
 
SNP Identity, Location, Nucleotide Position and Allele Association with AMD for the C2 and BF Genes
Table 3.
 
SNP Identity, Location, Nucleotide Position and Allele Association with AMD for the C2 and BF Genes
SNP Information Genotype Information and Allele Associations with AMD
SNP Name SNP Position Nucleotide Position* Allele/Genotype Allele/Genotype Frequency Allele Association
Case Control P , † OR (95% CI), ‡
C2 gene
 s9332739 E318D 32,011,783 C allele 23 (2.2) 11 (3.5) 0.24 1.00
G allele 1011 (97.8) 303 (96.5) 1.50 (0.76–2.94)
CC 0 (0.0) 0 (0.0) 0.20
CG 23 (4.4) 11 (7.0)
GG 494 (95.6) 146 (93.0)
 rs547154 IVS10 32,018,917 T allele 58 (5.5) 47 (11.7) 9.1 × 10−5 1.00
G allele 992 (94.5) 353 (88.3) 2.28 (1.52–3.40)
TT 2 (0.4) 3 (1.5) <0.001
GT 54 (10.2) 41 (20.5)
GG 469 (89.5) 156 (78.0)
BF gene
 rs4151667 L9H 32,022,003 A allele 23 (2.2) 12 (3.7) 0.17 1.00
T allele 1017 (9897.8) 324 (96.3) 1.59 (0.82–3.09)
AA 0 (0.0) 0 (0.0) 0.19
AT 23 (4.4) 12 (7.4)
TT 497 (95.6) 150 (92.6)
 rs641153 R32Q 32,022,159 A allele 58 (5.5) 47 (11.8) 7.0 × 10−5 1.00
G allele 1000 (94.5) 351 (88.2) 2.31 (1.55–3.45)
AA 2 (0.4) 3 (1.5) <0.001
GA 54 (10.2) 41 (20.6)
GG 473 (89.4) 155 (77.9)
 rs1048709 R150R 32,022,914 A allele 215 (20.2) 64 (20.4) 0.64 1.00
G allele 847 (79.8) 250 (79.6) 1.07 (0.80–1.43)
AA 19 (3.6) 4 (2.5) 0.74
GA 177 (33.3) 56 (35.7)
GG 335 (63.1) 97 (61.8)
 rs4151659 K565E 32,026,443 A allele 1005 (98.3) 312 (99.4) 0.35 1.00
G allele 17 (1.7) 2 (0.06) 1.64 (0.54–4.93)
AA 494 (96.7) 155 (98.7) 0.14
GA 17 (3.3) 2 (1.3)
GG 0 (0.0) 0 (0.0)
 rs2072633 IVS17 32,027,557 A allele 478 (45.9) 135 (43.0) 0.37 1.00
G allele 564 (54.1) 179 (57.0) 1.12 (0.87–1.44)
AA 117 (22.5) 33 (20.9) 0.27
GA 244 (46.8) 69 (43.3)
GG 160 (30.7) 55 (34.8)
Table 4.
 
Haplotype Analysis of Six SNPs in the C2 and BF Genes in the Total AMD Group
Table 4.
 
Haplotype Analysis of Six SNPs in the C2 and BF Genes in the Total AMD Group
Haplotype rs332739 rs547154 rs4151667 rs641153 rs1048709 rs2072633 Case Frequency Control Frequency OR 95% CI P
1 G G T G G A 0.21 0.14 1.00 N/A 0.0017
2 G T T A G A 0.05 0.12 0.29 0.20–0.42 0.0052
3 G G T G A G 0.005 0.008 0.39 0.08–1.8 0.4362
4 G G T G A A 0.197 0.199 0.67 0.45–0.99 0.9075
5 G G T G G G 0.512 0.494 0.71 0.49–0.99 0.5298
6 C G A G G G 0.024 0.035 0.47 0.32–0.67 0.5098
Figure 1.
 
Haploview pair-wise LD diagram showing the haplotype blocks across the C2 and BF genes and the relative position of seven SNPs. The numbers inside the diamonds refer to r 2 values and show the amount of LD between two markers. Black, gray, and white diamonds: indicate high, medium, and low levels of LD, respectively. The position of each SNP is indicated in brackets. Vertical line on the white bar: location of the SNP in relation to the gene.
Figure 1.
 
Haploview pair-wise LD diagram showing the haplotype blocks across the C2 and BF genes and the relative position of seven SNPs. The numbers inside the diamonds refer to r 2 values and show the amount of LD between two markers. Black, gray, and white diamonds: indicate high, medium, and low levels of LD, respectively. The position of each SNP is indicated in brackets. Vertical line on the white bar: location of the SNP in relation to the gene.
The authors thank Melinda Cain for assistance in recruiting the patients and collecting blood samples. 
TaylorHR, KeeffeJE, VuHT, et al. Vision loss in Australia. Med J Aust. 2005;182(11)565–568. [PubMed]
EdwardsAO, RitterR, AbelKJ, ManningA, PanhuysenC, FarrerLA. Complement factor H polymorphism and age-related macular degeneration. Science. 2005;308:421–424. [CrossRef] [PubMed]
HainesJL, HauserMA, SchmidtS, et al. A complement factor H variant increases the risk of age-related macular degeneration. Science. 2005;308:419–421. [CrossRef] [PubMed]
KleinRJ, ZeissC, ChewEY, et al. Complement Factor H polymorphism in age-related macular degeneration. Science. 2005;308:385–389. [CrossRef] [PubMed]
HagemanGS, AndersonDH, JohnsonLV, et al. A common haplotype in the complement regulatory gene factor H (HF1/CFH) predisposes individuals to age-related macular degeneration. Proc Natl Acad Sci USA. 2005;102(20)7227–7232. [CrossRef] [PubMed]
YatesJRW, SeppT, MatharuBK, et al. Complement C3 variant and the risk of age-related macular degeneration. N Engl J Med. 2007;357:19–27. [CrossRef]
GoldB, MerriamJE, ZernantJ, et al. and the AMD Genetics Study Group. Variation in factor B (BF) and complement component 2 (C2) genes is associated with age-related macular degeneration. Nat Genet. 2006;38(4)458–462. [CrossRef] [PubMed]
MallerJ, GeorgeS, PurcellS, et al. Common variation in three genes, including a noncoding variant in CFH, strongly influences risk of age-related macular degeneration. Nat Genet. 2006;38(9)1055–1059. [CrossRef] [PubMed]
SpencerKL, HauserMA, OlsonLM, et al. Protective effect of complement factor B and complement component 2 variants in age-related macular degeneration. Hum Mol Gen. 2007;16(16)1986–1992. [CrossRef] [PubMed]
BairdPN, IslamFMA, RichardsonAJ, CainM, HuntN, GuymerR. Analysis of the Y402H variant of the complement factor H gene in age-related macular degeneration (AMD). Invest Ophthalmol Vis Sci. 2006;47(10)4194–4198. [CrossRef] [PubMed]
CarterKW, McCaskiePA, PalmerLJ. JLIN: A Java based linkage disequilibrium plotter (2004). ;Available at: http://www.genepi.com.au/projects/jlin/. Accessed October 20, 2006.
DudbridgeF. Pedigree disequilibrium tests for multilocus haplotypes. Genet Epidemiol. 2003;25(2)115–121. [CrossRef] [PubMed]
KruglyakL. The road to genome-wide association studies. Nature. 2008;9:314–318.
Cotton RGH and participants of the 2006 Human Variome Project Meeting. Recommendations of the 2006 Human Variome Project Meeting. Nat Genet. 2006;39(4)433–436.
Figure 1.
 
Haploview pair-wise LD diagram showing the haplotype blocks across the C2 and BF genes and the relative position of seven SNPs. The numbers inside the diamonds refer to r 2 values and show the amount of LD between two markers. Black, gray, and white diamonds: indicate high, medium, and low levels of LD, respectively. The position of each SNP is indicated in brackets. Vertical line on the white bar: location of the SNP in relation to the gene.
Figure 1.
 
Haploview pair-wise LD diagram showing the haplotype blocks across the C2 and BF genes and the relative position of seven SNPs. The numbers inside the diamonds refer to r 2 values and show the amount of LD between two markers. Black, gray, and white diamonds: indicate high, medium, and low levels of LD, respectively. The position of each SNP is indicated in brackets. Vertical line on the white bar: location of the SNP in relation to the gene.
Table 1.
 
Primer Details for Genotyping of SNPs from the C2 and BF Genes
Table 1.
 
Primer Details for Genotyping of SNPs from the C2 and BF Genes
SNP ID PCR 1st Primer PCR 2nd Primer Amplicon Length (bp) Extension Sequence Primer
rs9332739 ACGTTGGATGTGTCTGTCCTGAACGACAAC ACGTTGGATGCCCGTACCTTTATAGTTGGC 99 GCATTTTCCAGGCTGCTGATCAC
rs547154 ACGTTGGATGAGTGAGCTTTGCCCTCCTTG ACGTTGGATGAAGTGAGGGGCACTGTGTC 109 GGGGCACTGTGTCCAGGTTCCCAA
rs4151667 ACGTTGGATGCAAGAGGCCCAAGATAAAGG ACGTTGGATGCTTCTCTCCTGCCTTCCAAC 100 CAATCTCAGCCCCCAAC
rs641153 ACGTTGGATGCCTTTCTCTTCAGGTGTGAC ACGTTGGATGTTGATCTCTACCCCCTCCAG 103 CAGAGAGCAGGATCCCTGGGGC
rs1048709 ACGTTGGATGCGTTGTCACAGATCGCTGTC ACGTTGGATGTCTTTCCACTGCTATGACGG 120 TGCCAAGTGAATGGCCG
rs4151659 ACGTTGGATGGAAGTAGTCCTATTTCACCC ACGTTGGATGATCAGGGCAACGTCATAGTC 109 TTCAGGAATTCCTGCTTCTT
rs2072633 ACGTTGGATGTCAAGAACGAGGCTGAGCTG ACGTTGGATGTAATCCTGGAAGCATGGCTG 106 AAGCATGGCTGTTCCTGCTTG
Table 2.
 
Characteristics of AMD, Its Clinical Subtypes, and Controls
Table 2.
 
Characteristics of AMD, Its Clinical Subtypes, and Controls
Characteristics Control (%) Any AMD (%) P * Early (%) P * CNV (%) P * GA (%) P *
Total (N = 769) 204 (26) 565 (73) 43 (7.6) 421 (74.5) 101 (17.8)
Male, n (%) 84 (41.2) 183 (32.4) 0.02, † 8 (18.6) 0.005, † 135 (32.1) 0.03, † 40 (39.6) 0.79
Female, n (%) 120 (58.8) 382 (67.6) 35 (81.4) 286 (67.9) 61 (60.4)
Age, mean (SD) 72.4 (6.2) 73.4 (7.8) 0.10 71.9 (5.7) 0.65 73.8 (7.7) 0.03, † 72.4 (8.7) 0.99
Table 3.
 
SNP Identity, Location, Nucleotide Position and Allele Association with AMD for the C2 and BF Genes
Table 3.
 
SNP Identity, Location, Nucleotide Position and Allele Association with AMD for the C2 and BF Genes
SNP Information Genotype Information and Allele Associations with AMD
SNP Name SNP Position Nucleotide Position* Allele/Genotype Allele/Genotype Frequency Allele Association
Case Control P , † OR (95% CI), ‡
C2 gene
 s9332739 E318D 32,011,783 C allele 23 (2.2) 11 (3.5) 0.24 1.00
G allele 1011 (97.8) 303 (96.5) 1.50 (0.76–2.94)
CC 0 (0.0) 0 (0.0) 0.20
CG 23 (4.4) 11 (7.0)
GG 494 (95.6) 146 (93.0)
 rs547154 IVS10 32,018,917 T allele 58 (5.5) 47 (11.7) 9.1 × 10−5 1.00
G allele 992 (94.5) 353 (88.3) 2.28 (1.52–3.40)
TT 2 (0.4) 3 (1.5) <0.001
GT 54 (10.2) 41 (20.5)
GG 469 (89.5) 156 (78.0)
BF gene
 rs4151667 L9H 32,022,003 A allele 23 (2.2) 12 (3.7) 0.17 1.00
T allele 1017 (9897.8) 324 (96.3) 1.59 (0.82–3.09)
AA 0 (0.0) 0 (0.0) 0.19
AT 23 (4.4) 12 (7.4)
TT 497 (95.6) 150 (92.6)
 rs641153 R32Q 32,022,159 A allele 58 (5.5) 47 (11.8) 7.0 × 10−5 1.00
G allele 1000 (94.5) 351 (88.2) 2.31 (1.55–3.45)
AA 2 (0.4) 3 (1.5) <0.001
GA 54 (10.2) 41 (20.6)
GG 473 (89.4) 155 (77.9)
 rs1048709 R150R 32,022,914 A allele 215 (20.2) 64 (20.4) 0.64 1.00
G allele 847 (79.8) 250 (79.6) 1.07 (0.80–1.43)
AA 19 (3.6) 4 (2.5) 0.74
GA 177 (33.3) 56 (35.7)
GG 335 (63.1) 97 (61.8)
 rs4151659 K565E 32,026,443 A allele 1005 (98.3) 312 (99.4) 0.35 1.00
G allele 17 (1.7) 2 (0.06) 1.64 (0.54–4.93)
AA 494 (96.7) 155 (98.7) 0.14
GA 17 (3.3) 2 (1.3)
GG 0 (0.0) 0 (0.0)
 rs2072633 IVS17 32,027,557 A allele 478 (45.9) 135 (43.0) 0.37 1.00
G allele 564 (54.1) 179 (57.0) 1.12 (0.87–1.44)
AA 117 (22.5) 33 (20.9) 0.27
GA 244 (46.8) 69 (43.3)
GG 160 (30.7) 55 (34.8)
Table 4.
 
Haplotype Analysis of Six SNPs in the C2 and BF Genes in the Total AMD Group
Table 4.
 
Haplotype Analysis of Six SNPs in the C2 and BF Genes in the Total AMD Group
Haplotype rs332739 rs547154 rs4151667 rs641153 rs1048709 rs2072633 Case Frequency Control Frequency OR 95% CI P
1 G G T G G A 0.21 0.14 1.00 N/A 0.0017
2 G T T A G A 0.05 0.12 0.29 0.20–0.42 0.0052
3 G G T G A G 0.005 0.008 0.39 0.08–1.8 0.4362
4 G G T G A A 0.197 0.199 0.67 0.45–0.99 0.9075
5 G G T G G G 0.512 0.494 0.71 0.49–0.99 0.5298
6 C G A G G G 0.024 0.035 0.47 0.32–0.67 0.5098
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×