December 2009
Volume 50, Issue 12
Free
Lens  |   December 2009
A Mutant Connexin50 with Enhanced Hemichannel Function Leads to Cell Death
Author Affiliations & Notes
  • Peter J. Minogue
    From the Department of Pediatrics, Section of Hematology/Oncology, University of Chicago, Chicago, Illinois;
  • Jun-Jie Tong
    the Department of Physiology and Biophysics, Rosalind Franklin School of Medicine and Science, North Chicago, Illinois;
  • Anita Arora
    UCL Institute of Ophthalmology, London, United Kingdom;
    the Moorfields Eye Hospital, London, United Kingdom; and
  • Isabelle Russell-Eggitt
    the Great Ormond Street Hospital for Children, London, United Kingdom.
  • David M. Hunt
    UCL Institute of Ophthalmology, London, United Kingdom;
  • Anthony T. Moore
    UCL Institute of Ophthalmology, London, United Kingdom;
    the Moorfields Eye Hospital, London, United Kingdom; and
    the Great Ormond Street Hospital for Children, London, United Kingdom.
  • Lisa Ebihara
    the Department of Physiology and Biophysics, Rosalind Franklin School of Medicine and Science, North Chicago, Illinois;
  • Eric C. Beyer
    From the Department of Pediatrics, Section of Hematology/Oncology, University of Chicago, Chicago, Illinois;
  • Viviana M. Berthoud
    From the Department of Pediatrics, Section of Hematology/Oncology, University of Chicago, Chicago, Illinois;
  • Corresponding author: Viviana M. Berthoud, Department of Pediatrics, Section of Hematology/Oncology, University of Chicago, 5841 S. Maryland Avenue, MC 4060, Chicago, IL 60637; vberthou@peds.bsd.uchicago.edu
Investigative Ophthalmology & Visual Science December 2009, Vol.50, 5837-5845. doi:10.1167/iovs.09-3759
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to Subscribers Only
      Sign In or Create an Account ×
    • Get Citation

      Peter J. Minogue, Jun-Jie Tong, Anita Arora, Isabelle Russell-Eggitt, David M. Hunt, Anthony T. Moore, Lisa Ebihara, Eric C. Beyer, Viviana M. Berthoud; A Mutant Connexin50 with Enhanced Hemichannel Function Leads to Cell Death. Invest. Ophthalmol. Vis. Sci. 2009;50(12):5837-5845. doi: 10.1167/iovs.09-3759.

      Download citation file:


      © 2016 Association for Research in Vision and Ophthalmology.

      ×
  • Supplements
Abstract

Purpose.: To determine the consequences of expression of a novel connexin50 (CX50) mutant identified in a child with congenital total cataracts.

Methods.: The GJA8 gene was directly sequenced. Formation of functional channels was assessed by the two-microelectrode voltage-clamp method. Connexin protein levels and distribution were assessed by immunoblot analysis and immunofluorescence. The proportion of apoptotic cells was determined by flow cytometry.

Results.: Direct sequencing of the GJA8 gene identified a 137 G>T transition that resulted in the replacement of glycine by valine at position 46 of the coding region of CX50 (CX50G46V). Both CX50 and CX50G46V induced gap junctional currents in pairs of Xenopus oocytes. In single Xenopus oocytes, CX50G46V induced connexin hemichannel currents that were activated by removal of external calcium; their magnitudes were much higher than those in oocytes injected with similar amounts of CX50 cRNA. When expressed in HeLa cells under the control of an inducible promoter, both CX50 and CX50G46V formed gap junctional plaques. Induction of CX50G46V expression led to a decrease in the number of cells and an increase in the proportion of apoptotic cells. CX50G46V-induced cell death was prevented by high concentrations of extracellular calcium ions.

Conclusions.: Unlike previously characterized CX50 mutants that exhibit impaired trafficking and/or lack of function, CX50G46V traffics properly to the plasma membrane and forms functional hemichannels and gap junction channels; however, it causes cell death even when expressed at minute levels. The biochemical results indirectly suggest a potential novel mechanism by which connexin mutants could lead to cataracts: cytotoxicity due to enhanced hemichannel function.

Homeostasis in the avascular lens depends on the function of an extensive network of gap junctions. 1 Gap junctions are plasma membrane specializations that contain clusters of intercellular channels that allow transfer of molecules up to 1 kDa between communicating cells. Gap junction channels are oligomeric assemblies of subunit proteins called connexins (CX). A gap junction channel is formed by the coaxial alignment of two hexameric hemichannels contributed by apposing cells. Hemichannels at the nonjunctional plasma membrane may also be functional allowing communication between the extracellular compartment and the cytoplasm. The repertoire of connexins expressed by lens cells depends on their differentiation stage. Epithelial cells express CX43 and CX50; differentiating cells express CX43, CX46, and CX50; and fiber cells express CX46 and CX50. 26 Cx46 and Cx50 share some functions in the lens, but Cx46 cannot replace Cx50 in its role in postnatal cell proliferation. 7  
The importance of gap junctions in lens function has been emphasized by the association of mutations in the human genes encoding CX46 and CX50 (GJA3 and GJA8) with inherited congenital cataracts. 810 Congenital cataracts account for 10% of childhood blindness and are genetically and phenotypically heterogenous. 8 Inheritance is most commonly autosomal dominant, although autosomal recessive and X-linked forms have also been reported. 
All the cataract-associated mutant CX46 and CX50 proteins that have been analyzed show impaired trafficking to the plasma membrane and/or lack of formation of functional gap junctional channels. 1119 In this article, we report a novel CX50 mutant that forms functional gap junctional channels and hemichannels, and its expression is associated with decreased cell survival and death. 
Materials and Methods
Reagents
Unless otherwise specified, all chemicals were obtained from Sigma Chemical Co. (St. Louis, MO). 
Patient Ascertainment and Collection of Genetic Material
DNA from patients with congenital cataract seen at Moorfields Eye Hospital and the Hospital for Children was screened for mutations in the GJA8, γ S-crystallin, EPHA2 receptor tyrosine kinase, and SLC16A12 genes. Approval for this study was obtained from the local research ethics committee. Written informed consent, which adhered to the tenets of the Declaration of Helsinki, was obtained from all adult individuals and from the parents of children younger than 16 years. Genomic DNA was extracted from venous blood leukocytes (Nucleon II DNA extraction kit; Tepnel Life Sciences, Manchester, UK). 
Sequencing
PCRs were performed with patient genomic DNA as the template to amplify the GJA8 gene, with the following primers, CX501F: GCTCAGCTCTTGCCTTCTCC, CX501R: GCTGCAGCGGTACAGAGG; CX502F: GGCAGCAAAGGCACTAAGAA, CX502R: CGAACTGATTGAAAGGCTTG; and CX503F: CCCACTATTTCCCCTTGACC, CX503R: TCCTTTCATCTTGCCCTACG. PCR products were purified from agarose gels (QIAquick Gel Extraction Kit; Qiagen, Crawley, West Sussex, UK). Direct sequencing of these PCR products identified a heterozygous G>T transition at position 137. The mutation was confirmed by amplifying the coding region of the GJA8 gene, subcloning PCR products into pGEM-TEasy (Promega, Southhampton, UK), and sequencing them. All sequencing reactions were cycle-sequenced with dye termination chemistry (Big Dye Terminator Ready Reaction Mix; Applied Biosystems, Inc. [ABI], Warrington, UK) and analyzed (PRISM 3100 Genetic Analyzer; ABI). 
Subcloning of Human CX50 DNA
Human wild-type CX50 coding sequence was subcloned into pSP64TII 18,20 , pcDNA3.1/Hygro(+) (Invitrogen Life Technologies, Carlsbad, CA), 18 and pIND(SP1) (Invitrogen Life Technologies). The mutant (CX50G46V) allele was generated by a kit (QuickChange Site-Directed Mutagenesis kit; Agilent Technologies UK, Ltd., Cheshire, UK) with primers 5′-GCAGAGTTCGTGTGGGTGGATGAGCAATCCGAC and 3′-GTCGGATTGCTCATCCACCCACACGAACTCTGC. The products were sequenced to check the fidelity of the amplification reaction. The PCR products were then subcloned into pSP64TII, pcDNA3.1/Hygro(+), and pIND(SP1) vectors. 
Expression of Connexins in Xenopus Oocytes
Plasmids were linearized with SalI. Capped RNA was synthesized (mMessage mMachine SP6 Kit; Ambion, Austin, TX). RNA was quantified by measuring absorbance at 260 nm, and integrity was further assessed by agarose gel electrophoresis. 
Adult female Xenopus laevis were anesthetized with tricaine and a partial ovariectomy was performed. The animals were maintained and treated in accordance with National Institute of Health guidelines and the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. Oocytes were defolliculated and microinjected with an oligonucleotide antisense to the endogenous Xenopus CX38 and 2 to 4 ng of connexin cRNAs (or no cRNA for controls), as previously described. 21  
Electrophysiological Measurements
Connexin cRNA-injected oocytes were devitellinized. 22 Paired and unpaired oocytes were incubated at 18°C for 24 hours before electrophysiological recording. Double two-microelectrode voltage-clamp experiments were performed (Geneclamp 500 with an Axoclamp 2A voltage-clamp amplifier; Axon Instruments, Union City, CA). The microelectrodes were filled with 3 M KCl and had a resistance between 0.1 and 0.6 MΩ. To prevent electrode leakage, the tips of the electrodes were backfilled with 1% agar in 3 M KCl. For simple measurements of gap junctional coupling, both cells of a pair were held initially at −40 mV, and voltage-clamp steps were applied to one cell while holding the second cell at −40 mV. Under these conditions, the change in current measured in the second cell would be equal to the junctional current (Ij ), but of opposite polarity. The junctional conductance (gj ) was calculated as (gj = Ij /Vj ), where Vj = V cell 2V cell 1. For measurements of hemichannel currents in single oocytes, a series of voltage-clamp steps were applied between −70 and +30 mV in increments of 10 mV from a holding potential of −80 mV. Pulse generation and data acquisition were performed using a computer-driven data acquisition and control system (PCLAMP6 software and a TL-1 acquisition system; Axon Instruments). Currents were filtered at 20 to 50 Hz and digitized (PCLAMP6 software and Digidata 1200; Axon Instruments). All experiments were performed at room temperature (20–22°C). 
Cell Culture
HeLa cells were grown in MEM supplemented with nonessential amino acids, 10% fetal bovine serum, 2 mM glutamine, 100 U/mL penicillin G and 100 μg/mL streptomycin sulfate (Invitrogen Life Technologies). The cells were transfected (Lipofectin Transfection Reagent and Plus Reagent; Invitrogen Life Technologies) according to the manufacturer's directions. Stably transfected ponasterone A–inducible cells were grown with 175 μg/mL zeocin (Invitrogen Life Technologies) and 132 μg/mL hygromycin (Calbiochem, Gibbstown, NJ). 
Generation of Ponasterone A–Inducible HeLa Cells
Connexin-deficient HeLa cells were first stably transfected with a plasmid containing DNA coding for the ecdysone receptor (pVgRXR; Invitrogen Life Technologies). Stable expression of the ecdysone receptor was verified by transiently transfecting the cells with a reporter plasmid that drives inducible expression of β-galactosidase (pINDβ-gal; Invitrogen Life Technologies) and performing a β-galactosidase assay after induction with 1 μM ponasterone A (Invitrogen Life Technologies). A positive clone was selected and stably transfected with either wild-type human CX50 or CX50G46V subcloned into the pIND(SP1) vector. 
Immunoblot Analysis
Cells at approximately 90% confluence were harvested in PBS, 4 mM EDTA, 2 mM PMSF, 1 mg/mL 4-(2-aminoethyl)benzenesulfonyl fluoride hydrochloride (Pefabloc SC; Roche Applied Science, Indianapolis, IN), 10 μg/mL leupeptin, 10 μg/mL pepstatin, and 1 μg/mL aprotinin and sonicated. The protein concentration in the homogenates was determined by the Bradford assay. 23 Aliquots from cell homogenates containing 50 μg of protein were resolved on 9% SDS-containing polyacrylamide gels, transferred to membranes (Immobilon P; Millipore, Billerica, MA), and subjected to immunoblot analysis with affinity purified rabbit polyclonal anti-CX50 antibodies. 14  
Immunofluorescence
HeLa cells stably transfected with CX50 or CX50G46V subcloned into the pIND(SP1) vector were plated on four-well slides (Lab-Tek Nalge Nunc International chamber slides; Thermo Fisher Scientific, Rochester, NY). Twenty-four hours later, the cells were induced by treatment with 1 μM ponasterone A. Forty-eight hours after induction, the cells were rinsed with phosphate buffered saline (PBS) and fixed for 15 minutes in 4% paraformaldehyde at room temperature. They were then permeabilized in 1% Triton X-100 in PBS and blocked in 1% Triton X-100, 10% normal goat serum in PBS. Immunofluorescence was performed with affinity purified rabbit polyclonal anti-CX50 antibodies, as previously described. 14  
Determination of Cell Numbers
The cells were treated with 1 μM ponasterone A 24 hours after plating. Ninety-six hours later, they were observed under the microscope, and a minimum of nine visual fields were photographed. The number of live cells per visual field was manually counted. The results are presented as the number of live cells per square millimeter remaining in uninduced and induced cultures (0 ± SEM). 
MTS Assay
The MTS (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt) assay (CellTiter 96 AQ nonradioactive cell proliferation assay; Promega, Madison, WI) was performed according to the manufacturer's instructions. The cells were plated on 24-well plates. After 24 hours, the cells were treated with 1 μM ponasterone A or 0.1% ethanol (the final concentration of ethanol used as solvent for the ponasterone) and incubated for an additional 72 hours. After that time, 200 μL of MTS solution was added to each well, the cells were incubated for 30 minutes at 37°C in a humidified 5% CO2 atmosphere, and the absorbance at 490 nm, which is proportional to the number of living/surviving cells, was measured with a spectrophotometer (DU-64; Beckman Coulter Inc., Fullerton, CA). 
Assessment of Apoptosis by Flow Cytometry
HeLa cells were plated on 100-mm dishes and cultured for 24 hours. Then, the cells were treated with either 1 μM ponasterone A or ethanol and grown for another 48 hours. The cell culture medium containing floating cells was collected, the attached cells were lifted off the dish by trypsinization, and the combined cell suspension was centrifuged to pellet the cells. The pellet was rinsed in PBS and centrifuged at 1300g twice. The pellet was then resuspended in 1.2 mL of PBS. Three milliliters of ice-cold 95% ethanol was added drop-wise with vortexing, and the cells were then incubated for 30 minutes. Fifteen milliliters of PBS was added, and the cells were pelleted at 1900g for 10 minutes. The supernatant was discarded, and the cell pellet was resuspended in 15 mL of PBS, and centrifuged at 1900g for 10 minutes. The supernatant was discarded again, and the cell pellet was resuspended in 4.5 mL of PBS. Five hundred microliters of 1 mg/mL RNase were added, and the cells were incubated for 30 minutes at 37°C. The cells were then rinsed with 5 mL PBS and spun down at 1900g twice. Finally, the cells were resuspended in 2 mL of propidium iodide (PI) staining solution (10 mg PI/100 mL PBS), and the samples were analyzed by flow cytometry (FACScan; BD Bioscience, San Jose, CA). 
Results
Identification of a Novel CX50 Mutation
Direct sequencing of the GJA8 gene in a panel of probands with cataract where the underlying causative mutation was not known revealed a novel heterozygous mutation in a child of Palestinian origin with an early-onset total cataract. This was confirmed by the cloning of the PCR products and sequencing of the DNA inserts. The GJA8 gene had been screened as part of an ongoing collaboration between the Institute of Ophthalmology and the University of Chicago to determine the role of CX50 in human cataract. The panel had also been screened by ourselves or our collaborators for mutations in the EPHA2 receptor tyrosine kinase, 24 γ S-crystallin, and the SLC16A12 genes. No mutations in these genes were identified in the DNA from this child. The identified mutation corresponded to a 137G>T nucleotide transition within the coding region of CX50 that resulted in the replacement of the glycine at position 46 with a valine (CX50G46V; Figs. 1A, 1B). Hydropathicity algorithms predict that this amino acid localizes at the beginning of the first extracellular loop (Fig. 1C). This child also had small eyes and pupils that did not dilate well. Unfortunately, leukocyte samples from the parents and sibling were not available, and they did not consent to further examination or mutation screening. Therefore, segregation of the phenotype and direct genetic correlation of this mutation with the disease are not possible. 
Figure 1.
 
Identification of a novel mutation of CX50 in a patient with total cataract. (A, B) Chromatograms show the sequence through the region of the GJA8 gene containing nucleotides 132-141 of the coding region from an unaffected (A) and from the affected (B) individual. (C) The predicted localization of the G46V missense mutation within the topology of CX50 in the plasma membrane.
Figure 1.
 
Identification of a novel mutation of CX50 in a patient with total cataract. (A, B) Chromatograms show the sequence through the region of the GJA8 gene containing nucleotides 132-141 of the coding region from an unaffected (A) and from the affected (B) individual. (C) The predicted localization of the G46V missense mutation within the topology of CX50 in the plasma membrane.
Effects of CX50G46V Expression
To study the cellular behavior of the mutant CX50 in HeLa cells and compare it with that of wild-type CX50, we attempted to isolate stably transfected clones. However, despite multiple attempts using the same strategy previously used to express wild-type CX50 and other mutants, 14 , 1719 we were unable to obtain any stably transfected clones of HeLa cells expressing CX50G46V. This result led us to infer that expression of the CX50G46V protein has deleterious effects. 
CX50G46V Forms Functional Channels
The ability of CX50G46V to form functional gap junctional channels was characterized by two-electrode, voltage clamp in Xenopus oocyte pairs. Pairs of oocytes injected with 2 to 4 ng of CX50G46V cRNA developed gap junctional conductances with mean values that were not significantly different from those determined in oocyte pairs injected with wild-type CX50 cRNA (Table 1). Pairs of control oocytes injected with no connexin cRNA showed no coupling. 
Table 1.
 
Functional Gap Junctional Channels Formed by CX50G46V
Table 1.
 
Functional Gap Junctional Channels Formed by CX50G46V
Cell 1/Cell 2 Junctional Conductance (μS) n
No cRNA/No cRNA 0.3 ± 0.1 8
CX50/CX50 41.6 ± 16.8 8
CX50G46V/CX50G46V 51.8 ± 34.2 9
Oocytes expressing CX50G46V showed reduced resting potentials compared with oocytes injected with CX50 cRNA even when the bathing solution contained cobalt ions, which have been previously shown to block other connexin hemichannels. 20,25 These results suggest that expression of CX50G46V also had deleterious effects in Xenopus oocytes. 
Because the deleterious effects of CX50G46V protein expression could result from connexin-mediated hemichannel activity, we tested the ability of wild-type and mutant CX50 to induce macroscopic hemichannel currents in the nonjunctional plasma membrane using a two-electrode, voltage-clamp technique with no added extracellular Ca2+. Oocytes injected with only 2 to 4 ng of CX50G46V cRNA developed large outward currents that activated on depolarization (Figs. 2A, 2B, Table 2). In contrast, little or no detectable hemichannel currents were observed in oocytes injected with wild-type CX50 cRNA or antisense-treated control oocytes (Figs. 2A, 2B, Table 2). The hemichannel currents detected in CX50G46V cRNA-injected oocytes were substantially reduced by increasing the extracellular concentration of Ca2+ ([Ca2+]o) from nominally 0 to 1 mM (Fig. 2C, Table 3). 
Figure 2.
 
CX50G46V formed large hemichannel currents in Xenopus oocytes that can be blocked by extracellular calcium ions. (A) Comparison of hemichannel currents in control oocytes (top) or oocytes injected with equal amounts of CX50 (middle) or CX50G46V (bottom) cRNA. Currents were elicited in response to voltage-clamp steps between −80 and +30 mV in 10 mV increments from a holding potential of −80 mV. (B) Steady-state current-voltage relationships in control, CX50, and CX50G46V cRNA-injected oocytes. Each point in the curve represents the mean ± SEM. Recordings were performed in oocytes kept in modified Barth's solution containing 0 added calcium and 1.0 mM magnesium. (C) Current traces recorded from a CX50G46V cRNA-injected oocyte before and after application of calcium. In the presence of 0 added external calcium, a large current was observed that was mostly activated at a holding potential of −40 mV and tended to close on application of large positive and negative voltage-clamp steps. Application of 1 mM Ca2+ to the bathing media caused a marked reduction in current amplitude that was more pronounced at negative potentials. The sequence of voltage-clamp steps is shown above the currents. Dashed line: 0 current level.
Figure 2.
 
CX50G46V formed large hemichannel currents in Xenopus oocytes that can be blocked by extracellular calcium ions. (A) Comparison of hemichannel currents in control oocytes (top) or oocytes injected with equal amounts of CX50 (middle) or CX50G46V (bottom) cRNA. Currents were elicited in response to voltage-clamp steps between −80 and +30 mV in 10 mV increments from a holding potential of −80 mV. (B) Steady-state current-voltage relationships in control, CX50, and CX50G46V cRNA-injected oocytes. Each point in the curve represents the mean ± SEM. Recordings were performed in oocytes kept in modified Barth's solution containing 0 added calcium and 1.0 mM magnesium. (C) Current traces recorded from a CX50G46V cRNA-injected oocyte before and after application of calcium. In the presence of 0 added external calcium, a large current was observed that was mostly activated at a holding potential of −40 mV and tended to close on application of large positive and negative voltage-clamp steps. Application of 1 mM Ca2+ to the bathing media caused a marked reduction in current amplitude that was more pronounced at negative potentials. The sequence of voltage-clamp steps is shown above the currents. Dashed line: 0 current level.
Table 2.
 
Functional Hemichannels Formed by CX50G46V
Table 2.
 
Functional Hemichannels Formed by CX50G46V
Cell Hemichannel Current (nA) n
No cRNA 12.2 ± 12.2 2
CX50 9.8 ± 5.6 3
CX50G46V 277.1 ± 30.3 4
Table 3.
 
Inhibition of CX50G46V Hemichannel Currents by Increased [Ca2+]o
Table 3.
 
Inhibition of CX50G46V Hemichannel Currents by Increased [Ca2+]o
[Ca2+]o (mM) Hemichannel Current (nA) n
0 600.6 ± 64.1 7
1 115.7 ± 37.3 7
CX50G46V Expression Decreases Cell Viability/Survival
To facilitate study of such potential toxic effect(s) of CX50G46V, we generated HeLa cells stably transfected with wild-type CX50 or CX50G46V in which their expression was under the control of a ponasterone A–inducible promoter (HeLa-CX50ind and HeLa-CX50G46Vind, respectively). These clones expressed only a small amount of wild-type CX50 or CX50G46V under control conditions (uninduced) as detected by the presence of a band recognized by anti-CX50 antibodies in immunoblots; such a band was not observed in HeLa cells expressing only the ecdysone receptor (Fig. 3A). 
Figure 3.
 
Immunodetection of wild-type and mutant CX50 in HeLa cells. (A) Aliquots from homogenates of untransfected HeLa cells and HeLa cells transfected with wild-type CX50 or CX50G46V without induction and after induction with 1 μM ponasterone A for 48 hours were subjected to immunoblot analysis using anti-CX50 antibodies. No CX50 protein bands were detected in untransfected HeLa cells. HeLa cells transfected with wild-type or mutant CX50 (HeLa-CX50ind or HeLa-CX50G46Vind, respectively) showed a low level of CX50 protein expression before induction, but the CX50 protein levels increased markedly in both transfected cells after induction. The migration positions of the molecular mass standards are indicated. (B, C) HeLa-CX50ind and HeLa-CX50G46Vind cells were fixed 48 hours after induction and subjected to immunofluorescence using anti-CX50 antibodies. Both HeLa-CX50ind (B) and HeLa-CX50G46Vind (C) showed a significant number of gap junctional plaques. Bar, 18 μm.
Figure 3.
 
Immunodetection of wild-type and mutant CX50 in HeLa cells. (A) Aliquots from homogenates of untransfected HeLa cells and HeLa cells transfected with wild-type CX50 or CX50G46V without induction and after induction with 1 μM ponasterone A for 48 hours were subjected to immunoblot analysis using anti-CX50 antibodies. No CX50 protein bands were detected in untransfected HeLa cells. HeLa cells transfected with wild-type or mutant CX50 (HeLa-CX50ind or HeLa-CX50G46Vind, respectively) showed a low level of CX50 protein expression before induction, but the CX50 protein levels increased markedly in both transfected cells after induction. The migration positions of the molecular mass standards are indicated. (B, C) HeLa-CX50ind and HeLa-CX50G46Vind cells were fixed 48 hours after induction and subjected to immunofluorescence using anti-CX50 antibodies. Both HeLa-CX50ind (B) and HeLa-CX50G46Vind (C) showed a significant number of gap junctional plaques. Bar, 18 μm.
Induction of HeLa-CX50ind and HeLa-CX50G46Vind cells by ponasterone A treatment led to a marked increase in levels of wild-type CX50 and CX50G46V as detected by immunoblotting (Fig. 3A), an effect that was not observed in HeLa cells expressing only the ecdysone receptor (Fig. 3A). Immunofluorescence microscopy of HeLa-CX50ind and HeLa-CX50G46Vind after ponasterone A treatment revealed that both CX50 and CX50G46V were localized at appositional membranes, where they formed gap junction plaques, and in the perinuclear region, probably the Golgi compartment (Figs. 3B, 3C). Immunofluorescence microscopy also revealed that not every cell in the HeLa-CX50G46Vind clones showed anti-CX50 immunoreactivity. Approximately 80% of cells were positive. Moreover, the proportion of cells exhibiting CX50 immunoreactivity in the HeLa-CX50G46Vind decreased with successive passages. In contrast, the clones expressing wild-type CX50 consistently showed uniform immunostaining. 
To test directly whether expression of CX50G46V had a deleterious effect on cell growth/survival, we compared the effects of induced CX50 and CX50G46V expression on the number of cells. Cultures of HeLa-CX50ind cells treated with 1 μM ponasterone A for 96 hours contained similar numbers of cells compared to cultures of uninduced cells (Figs. 4A, 4B). In contrast, cultures of ponasterone A–treated HeLa-CX50G46Vind cells showed a dramatic decrease in the number of cells compared with untreated cultures of HeLa-CX50G46Vind cells (Figs. 4C, 4D). Quantitation of these results revealed no significant difference between uninduced and induced HeLa-CX50ind cells, but the number of cells in induced cultures of HeLa-CX50G46Vind was only approximately 23% of that observed in uninduced sister cultures (Fig. 4E). Similarly, while induction of CX50 expression for 72 hours had no effect on cell viability as assessed by the colorimetric MTS assay, induction of CX50G46V expression dramatically reduced cell viability (Fig. 5). 
Figure 4.
 
Induction of CX50G46V protein expression decreased the number of cells. (AD) Phase-contrast photomicrographs from cultures of HeLa-CX50ind (A, B) and HeLa-CX50G46Vind (C, D) that were left untreated (A, C) or that were induced with 1 μM ponasterone A (B, D). (E) Quantitation of the data as the mean ± SEM of the number of cells per square millimeter for uninduced (−) and induced (+) cultures of HeLa-CX50ind (CX50) and HeLa-CX50G46Vind (CX50G46V) cells. Although the number of cells remaining in the culture was dramatically decreased 96 hours after treatment of HeLa-CX50G46Vind cells with ponasterone A, the cell density in HeLa-CX50ind cells was unaffected. Bar, 111 μm.
Figure 4.
 
Induction of CX50G46V protein expression decreased the number of cells. (AD) Phase-contrast photomicrographs from cultures of HeLa-CX50ind (A, B) and HeLa-CX50G46Vind (C, D) that were left untreated (A, C) or that were induced with 1 μM ponasterone A (B, D). (E) Quantitation of the data as the mean ± SEM of the number of cells per square millimeter for uninduced (−) and induced (+) cultures of HeLa-CX50ind (CX50) and HeLa-CX50G46Vind (CX50G46V) cells. Although the number of cells remaining in the culture was dramatically decreased 96 hours after treatment of HeLa-CX50G46Vind cells with ponasterone A, the cell density in HeLa-CX50ind cells was unaffected. Bar, 111 μm.
Figure 5.
 
Expression of CX50G46V protein decreased cell viability/survival. Graph represents the viability of HeLa-CX50ind (WT) and HeLa-CX50G46Vind (G46V) cells that were left untreated (■) or that were treated with 1 μM ponasterone A (Image Not Available) for 72 hours. Cell viability was determined with the MTS assay, in which the absorbance at 490 nm is proportional to the number of viable cells.
Figure 5.
 
Expression of CX50G46V protein decreased cell viability/survival. Graph represents the viability of HeLa-CX50ind (WT) and HeLa-CX50G46Vind (G46V) cells that were left untreated (■) or that were treated with 1 μM ponasterone A (Image Not Available) for 72 hours. Cell viability was determined with the MTS assay, in which the absorbance at 490 nm is proportional to the number of viable cells.
Induction of Apoptosis by CX50G46V Expression
The differential effects of CX50 and CX50G46V on the number of cells prompted us to test whether the expression of CX50G46V increases the proportion of cells containing sub-G1 amounts of DNA, a hallmark of apoptosis. 26 HeLa-CX50ind and HeLa-CX50G46Vind cells were left untreated or were treated with 1 μM ponasterone A for 48 hours and labeled with propidium iodide. Cell cycle kinetics were analyzed by flow cytometry. Under control conditions, cells expressing CX50G46V protein showed a higher proportion of cells containing sub-G1 amounts of DNA than cells expressing CX50 (Fig. 6, compare 6A with 6C). The proportion of apoptotic cells was further increased after ponasterone A–induced expression of CX50G46V (compare Fig. 6C with 6D), but it remained unaffected after induction of wild-type CX50 expression (compare Fig. 6A with 6B). 
Figure 6.
 
Expression of CX50G46V protein increased the proportion of apoptotic cells. Shown are the results of cell cycle analysis of propidium iodide-stained HeLa-CX50ind (A, B) and HeLa-CX50G46Vind (C, D) cells that were left uninduced (A, C) or were induced by treatment with 1 μM ponasterone A for 48 hours (B, D). This analysis revealed an increase in the sub-G1 fraction after induction of CX50G46V protein expression by treatment with 1 μM ponasterone A for 48 hours.
Figure 6.
 
Expression of CX50G46V protein increased the proportion of apoptotic cells. Shown are the results of cell cycle analysis of propidium iodide-stained HeLa-CX50ind (A, B) and HeLa-CX50G46Vind (C, D) cells that were left uninduced (A, C) or were induced by treatment with 1 μM ponasterone A for 48 hours (B, D). This analysis revealed an increase in the sub-G1 fraction after induction of CX50G46V protein expression by treatment with 1 μM ponasterone A for 48 hours.
The uncontrolled opening of hemichannels can lead to cell death. To test whether extracellular calcium was sufficient to inhibit this process, we incubated control Xenopus oocytes and oocytes expressing CX50 or CX50G46V in the presence of 0, 1, or 3 mM external calcium. Control oocytes or oocytes injected with CX50 cRNA showed almost 100% survival for at least 22 hours, the latest time point studied (Fig. 7). However, oocytes injected with CX50G46V cRNA incubated in the absence of extracellular calcium showed signs of cell death, including irregularities in the boundary between the vegetal and animal poles, discoloration of the pigment in the animal pole and release of cytoplasmic material into the media. These changes were more dramatic at longer times after microinjection of the cRNA (Fig. 7B). Incubation of CX50G46V cRNA-injected oocytes in media containing increasing concentrations of calcium ions resulted in an increasing proportion of normal looking oocytes (Fig. 7B). In the presence of 3 mM extracellular calcium, most of the cells continued to appear normal at 17 and 22 hours after injection of CX50G46V cRNA (Fig. 7). 
Figure 7.
 
Expression of CX50G46V induced hemichannel activity–dependent oocyte death. Oocytes were injected with similar amounts of CX50 or CX50G46V cRNA and incubated in modified Barth's solution containing 0, 1, or 3 mM Ca2+ overnight at 18°C. (A) Oocytes injected with CX50G46V cRNA showed obvious blebbing and discoloration (arrows) when incubated in modified Barth's solution containing 1 mM Ca2+ for 17 hours (bottom left). In contrast, oocytes injected with CX50 cRNA or oligonucleotide antisense to the endogenous Xenopus CX38 (Control) showed no apparent detrimental changes when studied under identical conditions (top). The rate of cell death of the CX50G46V cRNA-injected oocytes was significantly reduced by increasing the external calcium concentration from 1 to 3 mM (bottom right). (B) Graphs represent the number of surviving oocytes at different times after injection of cRNA in media containing 0, 1 or 3 mM Ca2+. Oocytes were scored for cell viability based on appearance, as illustrated in (A).
Figure 7.
 
Expression of CX50G46V induced hemichannel activity–dependent oocyte death. Oocytes were injected with similar amounts of CX50 or CX50G46V cRNA and incubated in modified Barth's solution containing 0, 1, or 3 mM Ca2+ overnight at 18°C. (A) Oocytes injected with CX50G46V cRNA showed obvious blebbing and discoloration (arrows) when incubated in modified Barth's solution containing 1 mM Ca2+ for 17 hours (bottom left). In contrast, oocytes injected with CX50 cRNA or oligonucleotide antisense to the endogenous Xenopus CX38 (Control) showed no apparent detrimental changes when studied under identical conditions (top). The rate of cell death of the CX50G46V cRNA-injected oocytes was significantly reduced by increasing the external calcium concentration from 1 to 3 mM (bottom right). (B) Graphs represent the number of surviving oocytes at different times after injection of cRNA in media containing 0, 1 or 3 mM Ca2+. Oocytes were scored for cell viability based on appearance, as illustrated in (A).
Discussion
In this study, we have described and characterized a novel CX50 mutant that resulted in the replacement of the glycine at position 46 by a valine. This glycine is highly conserved, as it is present in the sequences of all Cx50 orthologues that have been deposited in the database. Moreover, the corresponding residue is a glycine in nine of the other human connexins. The resultant mutant, CX50G46V, traffics properly to the plasma membrane where it forms gap junctional plaques and functional channels. Yet, the viability of cells expressing this mutant is reduced. 
The CX50 mutant described in this study, CX50G46V, is unique compared with the previously characterized cataract-associated connexin mutants, because it can form functional gap junctional plaques as efficiently as wild-type CX50. Previously described human and mouse mutants within the same region (e.g., CX50E48K, CX50D47N, mCX50D47A, mCX50S50P) are nonfunctional when expressed by themselves (Beyer EC, et al. IOVS 2007;48:ARVO E-Abstract 3635). 12,16,19 These results imply that not all mutations in amino acids within the first extracellular loop of CX50 result in loss of intercellular coupling. They also imply that replacement of glycine at position 46 by valine does not alter the docking capability of CX50 hemichannels to form gap junctional channels. 
One of the most interesting features of CX50G46V is its significantly increased ability to form functional hemichannels compared with wild-type CX50; injection of minute amounts of CX50G46V cRNA was sufficient to induce large hemichannel currents. Wild-type CX50 is much less efficient at forming functional hemichannels than wild-type CX46 and its orthologues 27,28 which have been extensively studied to characterize hemichannel properties. 20,25,2931 The hemichannel currents in oocytes injected with CX50G46V cRNA exhibited properties similar to those of CX46 hemichannels; they activated on depolarization and showed a reversal potential at around −10 mV. 20,25,29 Similar to mouse CX50 and rat CX46 hemichannel currents, 25,27,31,32 the magnitudes of CX50G46V hemichannel currents were dependent on the extracellular concentration of Ca2+
Formation of functional hemichannels by CX50G46V suggests that amino acid residue 46, which has been suggested to line the pore in the open state, 33 is important for CX50 hemichannel behavior. The presence of a glycine at position 46 may minimize the opening of CX50 hemichannels at physiological concentrations of extracellular Ca2+. Of interest, a disease-associated form of CX26 with a missense mutation at the corresponding position (CX26G45E) also has an increased capability to form hemichannels compared with wild-type CX26. 34,35 This suggests that the hemichannel behavior of other wild-type and mutant connexins may also be modulated by the identity of the amino acid residue present at this position. 
Several lines of evidence indicated that expression of CX50G46V in mammalian cells had deleterious effects: (1) We were unable to obtain HeLa cell clones that constitutively expressed CX50G46V; (2) cell count and viability were markedly reduced in cultures that had been induced to express CX50G46V; (3) expression of CX50G46V led to an increase in the proportion of cells containing sub-G1 amounts of DNA, a hallmark of apoptosis 26 ; and (4) CX50G46V expression was lost with subculturing of cells. None of these effects was observed in cells expressing wild-type CX50. 
The deleterious effects on cell survival are likely responsible for the loss of expression of the mutant protein in HeLa-CX50G46Vind cells with successive subculturing, especially if we consider that the expression system used was rather “leaky” (as indicated by the presence of a CX50 band in immunoblots from samples of uninduced cells), there was some heterogeneity in the HeLa-CX50G46Vind cell clones (i.e., not all cells showed expression of CX50G46V after induction), and the low levels of CX50G46V expression in uninduced cultures were sufficient to increase the proportion of apoptotic cells compared with uninduced HeLa-CX50ind cells. All these factors would favor the expansion of the cells that did not express the mutant protein. 
Our data showed that induction of CX50G46V expression for 72 hours led to approximately 50% reduction in cell viability, as assessed by the MTS assay, and CX50G46V expression for 96 hours led to a 77% decrease in the number of cells compared with uninduced cultures. These decreases resulted at least in part from induction of apoptosis in cells expressing CX50G46V. Because no activators of this pathway were added to the cultures, our data imply that expression of CX50G46V protein per se led to activation of apoptosis. A possible explanation for this lies in the capacity of CX50G46V to form functional hemichannels. Opening of CX50 hemichannels would allow ions to flow according to their concentration gradients. The resultant imbalance in intracellular ion homeostasis may lead to induction of apoptosis. Similar to CX50G46V, the disease-associated mutant CX26G45E is also able to induce apoptosis when transfected into HEK293 cells. 34 In our experiments, the dependence of CX50G46V-induced cell death on hemichannel activity was suggested by the survival of cells at increased extracellular concentrations of Ca2+
The differences between the percentage of apoptotic cells 48 hours after induction (approximately 10%) and the percentage of viable cells observed in the next 24 to 48 hours after induction (<50%) suggests that expression of the mutant CX50 has other deleterious cellular effects in addition to induction of apoptosis. CX50G46V may have caused nonapoptotic cell death or inhibited proliferation of the HeLa cells. In fact, gap junctional coupling provided through wild-type CX50 has been implicated in postnatal lens cell proliferation in mice. 36  
In the lens, CX50G46V hemichannels may be functional, because the aqueous humor bathing it contains a lower concentration of calcium ions than serum or culture medium. 37 How then might the expression of a mutant connexin with increased hemichannel activity affect the viability of lens cells? At the cellular level, opening of CX50G46V hemichannels may trigger a complex sequence of events including loss of membrane potential, disruption of transmembrane ion gradients, and entry of calcium ions, followed by decreased metabolic activity (and loss of cytoplasmic ATP) and finally decreased cell growth and cell death. Extrapolating to the lens, the expression of CX50G46V could have similar effects to those observed after expression of toxic proteins, leading to abnormal lens development and microphthalmia. 38,39 Based on the functional and biochemical data and the patient's presentation with bilateral congenital cataracts, it is possible that there is a causative link, although we do not have direct genetic evidence as we were unable to obtain samples from other family members. Confirmation of the role of this mutation in cataract formation will depend on the identification of this mutation in other family members or individuals with inherited cataract. 
Footnotes
 Supported by National Institutes of Health Grants R01EY08368 (ECB) and R01EY10589 (LE) and Wellcome Trust Grant 068083 (AA).
Footnotes
 Disclosure: P.J. Minogue, None; J.-J. Tong, None; A. Arora, None; I. Russell-Eggitt, None D.M. Hunt, None; A.T. Moore, None; L. Ebihara, None; E.C. Beyer, None; V.M. Berthoud, None
Footnotes
 The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact.
The authors thank Xiaoqin Xiu for performing the initial electrophysiological studies of the mutant. 
References
Goodenough DA . The crystalline lens: a system networked by gap junctional intercellular communication. Semin Cell Biol. 1992;3:49–58. [CrossRef] [PubMed]
Beyer EC Kistler J Paul DL Goodenough DA . Antisera directed against connexin43 peptides react with a 43-kD protein localized to gap junctions in myocardium and other tissues. J Cell Biol. 1989;108:595–605. [CrossRef] [PubMed]
Musil LS Beyer EC Goodenough DA . Expression of the gap junction protein connexin43 in embryonic chick lens: molecular cloning, ultrastructural localization, and post-translational phosphorylation. J Membr Biol. 1990;116:163–175. [CrossRef] [PubMed]
Paul DL Ebihara L Takemoto LJ Swenson KI Goodenough DA . Connexin46, a novel lens gap junction protein, induces voltage-gated currents in nonjunctional plasma membrane of Xenopus oocytes. J Cell Biol. 1991;115:1077–1089. [CrossRef] [PubMed]
White TW Bruzzone R Goodenough DA Paul DL . Mouse Cx50, a functional member of the connexin family of gap junction proteins, is the lens fiber protein MP70. Mol Biol Cell. 1992;3:711–720. [CrossRef] [PubMed]
Rong P Wang X Niesman I . Disruption of Gja8 (α8 connexin) in mice leads to microphthalmia associated with retardation of lens growth and lens fiber maturation. Development. 2002;129:167–174. [PubMed]
White TW . Unique and redundant connexin contributions to lens development. Science. 2002;295:319–320. [CrossRef] [PubMed]
Reddy MA Francis PJ Berry V Bhattacharya SS Moore AT . Molecular genetic basis of inherited cataract and associated phenotypes. Surv Ophthalmol. 2004;49:300–315. [CrossRef] [PubMed]
Hejtmancik JF . Congenital cataracts and their molecular genetics. Semin Cell Dev Biol. 2008;19:134–149. [CrossRef] [PubMed]
Berthoud VM Beyer EC . Oxidative stress, lens gap junctions, and cataracts. Antioxid Redox Signal. 2009;11:339–353. [CrossRef] [PubMed]
Pal JD Berthoud VM Beyer EC Mackay D Shiels A Ebihara L . Molecular mechanism underlying a Cx50-linked congenital cataract. Am J Physiol. 1999;276:C1443–C1446. [PubMed]
Xu X Ebihara L . Characterization of a mouse Cx50 mutation associated with the No2 mouse cataract. Invest Ophthalmol Vis Sci. 1999;40:1844–1850. [PubMed]
Pal JD Liu X Mackay D . Connexin46 mutations linked to congenital cataract show loss of gap junction channel function. Am J Physiol Cell Physiol. 2000;279:C596–C602. [PubMed]
Berthoud VM Minogue PJ Guo J . Loss of function and impaired degradation of a cataract-associated mutant connexin50. Eur J Cell Biol. 2003;82:209–221. [CrossRef] [PubMed]
Minogue PJ Liu X Ebihara L Beyer EC Berthoud VM . An aberrant sequence in a connexin46 mutant underlies congenital cataracts. J Biol Chem. 2005;280:40788–40795. [CrossRef] [PubMed]
DeRosa AM Xia CH Gong X White TW . The cataract-inducing S50P mutation in Cx50 dominantly alters the channel gating of wild-type lens connexins. J Cell Sci. 2007;120:4107–4116. [CrossRef] [PubMed]
Thomas BC Minogue PJ Valiunas V . Cataracts are caused by alterations of a critical N-terminal positive charge in connexin50. Invest Ophthalmol Vis Sci. 2008;49:2549–2556. [CrossRef] [PubMed]
Arora A Minogue PJ Liu X . A novel GJA8 mutation is associated with autosomal dominant lamellar pulverulent cataract: further evidence for gap junction dysfunction in human cataract. J Med Genet. 2006;43:e2. [CrossRef] [PubMed]
Arora A Minogue PJ Liu X . A novel connexin50 mutation associated with congenital nuclear pulverulent cataracts. J Med Genet. 2008;45:155–160. [CrossRef] [PubMed]
Ebihara L Berthoud VM Beyer EC . Distinct behavior of connexin56 and connexin46 gap junctional channels can be predicted from the behavior of their hemi-gap-junctional channels. Biophys J. 1995;68:1796–1803. [CrossRef] [PubMed]
Tong JJ Liu X Dong L Ebihara L . Exchange of gating properties between rat cx46 and chicken cx45.6. Biophys J. 2004;87:2397–2406. [CrossRef] [PubMed]
Ebihara L . Expression of gap junctional proteins in Xenopus oocyte pairs. Methods Enzymol. 1992;207:376–380. [PubMed]
Bradford MM . A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72:248–254. [CrossRef] [PubMed]
Zhang T Hua R Xiao W . Mutations of the EPHA2 receptor tyrosine kinase gene cause autosomal dominant congenital cataract. Hum Mut. 2009;30:E603–E611. [CrossRef] [PubMed]
Ebihara L Steiner E . Properties of a nonjunctional current expressed from a rat connexin46 cDNA in Xenopus oocytes. J Gen Physiol. 1993;102:59–74. [CrossRef] [PubMed]
Ormerod MG Collins MKL Rodriguez-Tarduchy G Robertson D . Apoptosis in interleukin-3-dependent haemopoietic cells: quantification by two flow cytometric methods. J Immunol Methods. 1992;153:57–65. [CrossRef] [PubMed]
Ebihara L Xu X Oberti C Beyer EC Berthoud VM . Co-expression of lens fiber connexins modifies hemi-gap-junctional channel behavior. Biophys J. 1999;76:198–206. [CrossRef] [PubMed]
Beahm DL Hall JE . Hemichannel and junctional properties of connexin 50. Biophys J. 2002;82:2016–2031. [CrossRef] [PubMed]
Gupta VK Berthoud VM Atal N Jarillo JA Barrio LC Beyer EC . Bovine connexin44, a lens gap junction protein: molecular cloning, immunologic characterization, and functional expression. Invest Ophthalmol Vis Sci. 1994;35:3747–3758. [PubMed]
Trexler EB Bukauskas FF Bennett MVL Bargiello TA Verselis VK . Rapid and direct effects of pH on connexins revealed by the connexin46 hemichannel preparation. J Gen Physiol. 1999;113:721–742. [CrossRef] [PubMed]
Srinivas M Calderon DP Kronengold J Verselis VK . Regulation of connexin hemichannels by monovalent cations. J Gen Physiol. 2005;127:67–75. [CrossRef]
Valiunas V Weingart R . Electrical properties of gap junction hemichannels identified in transfected HeLa cells. Pflügers Arch. 2000;440:366–379. [CrossRef] [PubMed]
Verselis VK Trelles MP Rubinos C Bargiello TA Srinivas M . Loop gating of connexin hemichannels involves movement of pore-lining residues in the first extracellular loop domain. J Biol Chem. 2009;284:4484–4493. [CrossRef] [PubMed]
Stong BC Chang Q Ahmad S Lin X . A novel mechanism for connexin 26 mutation linked deafness: cell death caused by leaky gap junction hemichannels. Laryngoscope. 2006;116:2205–2210. [CrossRef] [PubMed]
Gerido DA DeRosa AM Richard G White TW . Aberrant hemichannel properties of Cx26 mutations causing skin disease and deafness. Am J Physiol Cell Physiol. 2007;293:C337–C345. [CrossRef] [PubMed]
White TW Gao Y Li L Sellitto C Srinivas M . Optimal lens epithelial cell proliferation is dependent on the connexin isoform providing gap junctional coupling. Invest Ophthalmol Vis Sci. 2007;48:5630–5637. [CrossRef] [PubMed]
Duncan G Jacob TJC . Calcium and the physiology of cataract. Ciba Found Symp. 1984;106:132–152. [PubMed]
Breitman ML Clapoff S Rossant J . Genetic ablation: targeted expression of a toxin gene causes microphthalmia in transgenic mice. Science. 1987;238:1563–1565. [CrossRef] [PubMed]
Landel CP Zhao J Bok D Evans GA . Lens-specific expression of recombinant ricin induces developmental defects in the eyes of transgenic mice. Genes Dev. 1988;2:1168–1178. [CrossRef] [PubMed]
Figure 1.
 
Identification of a novel mutation of CX50 in a patient with total cataract. (A, B) Chromatograms show the sequence through the region of the GJA8 gene containing nucleotides 132-141 of the coding region from an unaffected (A) and from the affected (B) individual. (C) The predicted localization of the G46V missense mutation within the topology of CX50 in the plasma membrane.
Figure 1.
 
Identification of a novel mutation of CX50 in a patient with total cataract. (A, B) Chromatograms show the sequence through the region of the GJA8 gene containing nucleotides 132-141 of the coding region from an unaffected (A) and from the affected (B) individual. (C) The predicted localization of the G46V missense mutation within the topology of CX50 in the plasma membrane.
Figure 2.
 
CX50G46V formed large hemichannel currents in Xenopus oocytes that can be blocked by extracellular calcium ions. (A) Comparison of hemichannel currents in control oocytes (top) or oocytes injected with equal amounts of CX50 (middle) or CX50G46V (bottom) cRNA. Currents were elicited in response to voltage-clamp steps between −80 and +30 mV in 10 mV increments from a holding potential of −80 mV. (B) Steady-state current-voltage relationships in control, CX50, and CX50G46V cRNA-injected oocytes. Each point in the curve represents the mean ± SEM. Recordings were performed in oocytes kept in modified Barth's solution containing 0 added calcium and 1.0 mM magnesium. (C) Current traces recorded from a CX50G46V cRNA-injected oocyte before and after application of calcium. In the presence of 0 added external calcium, a large current was observed that was mostly activated at a holding potential of −40 mV and tended to close on application of large positive and negative voltage-clamp steps. Application of 1 mM Ca2+ to the bathing media caused a marked reduction in current amplitude that was more pronounced at negative potentials. The sequence of voltage-clamp steps is shown above the currents. Dashed line: 0 current level.
Figure 2.
 
CX50G46V formed large hemichannel currents in Xenopus oocytes that can be blocked by extracellular calcium ions. (A) Comparison of hemichannel currents in control oocytes (top) or oocytes injected with equal amounts of CX50 (middle) or CX50G46V (bottom) cRNA. Currents were elicited in response to voltage-clamp steps between −80 and +30 mV in 10 mV increments from a holding potential of −80 mV. (B) Steady-state current-voltage relationships in control, CX50, and CX50G46V cRNA-injected oocytes. Each point in the curve represents the mean ± SEM. Recordings were performed in oocytes kept in modified Barth's solution containing 0 added calcium and 1.0 mM magnesium. (C) Current traces recorded from a CX50G46V cRNA-injected oocyte before and after application of calcium. In the presence of 0 added external calcium, a large current was observed that was mostly activated at a holding potential of −40 mV and tended to close on application of large positive and negative voltage-clamp steps. Application of 1 mM Ca2+ to the bathing media caused a marked reduction in current amplitude that was more pronounced at negative potentials. The sequence of voltage-clamp steps is shown above the currents. Dashed line: 0 current level.
Figure 3.
 
Immunodetection of wild-type and mutant CX50 in HeLa cells. (A) Aliquots from homogenates of untransfected HeLa cells and HeLa cells transfected with wild-type CX50 or CX50G46V without induction and after induction with 1 μM ponasterone A for 48 hours were subjected to immunoblot analysis using anti-CX50 antibodies. No CX50 protein bands were detected in untransfected HeLa cells. HeLa cells transfected with wild-type or mutant CX50 (HeLa-CX50ind or HeLa-CX50G46Vind, respectively) showed a low level of CX50 protein expression before induction, but the CX50 protein levels increased markedly in both transfected cells after induction. The migration positions of the molecular mass standards are indicated. (B, C) HeLa-CX50ind and HeLa-CX50G46Vind cells were fixed 48 hours after induction and subjected to immunofluorescence using anti-CX50 antibodies. Both HeLa-CX50ind (B) and HeLa-CX50G46Vind (C) showed a significant number of gap junctional plaques. Bar, 18 μm.
Figure 3.
 
Immunodetection of wild-type and mutant CX50 in HeLa cells. (A) Aliquots from homogenates of untransfected HeLa cells and HeLa cells transfected with wild-type CX50 or CX50G46V without induction and after induction with 1 μM ponasterone A for 48 hours were subjected to immunoblot analysis using anti-CX50 antibodies. No CX50 protein bands were detected in untransfected HeLa cells. HeLa cells transfected with wild-type or mutant CX50 (HeLa-CX50ind or HeLa-CX50G46Vind, respectively) showed a low level of CX50 protein expression before induction, but the CX50 protein levels increased markedly in both transfected cells after induction. The migration positions of the molecular mass standards are indicated. (B, C) HeLa-CX50ind and HeLa-CX50G46Vind cells were fixed 48 hours after induction and subjected to immunofluorescence using anti-CX50 antibodies. Both HeLa-CX50ind (B) and HeLa-CX50G46Vind (C) showed a significant number of gap junctional plaques. Bar, 18 μm.
Figure 4.
 
Induction of CX50G46V protein expression decreased the number of cells. (AD) Phase-contrast photomicrographs from cultures of HeLa-CX50ind (A, B) and HeLa-CX50G46Vind (C, D) that were left untreated (A, C) or that were induced with 1 μM ponasterone A (B, D). (E) Quantitation of the data as the mean ± SEM of the number of cells per square millimeter for uninduced (−) and induced (+) cultures of HeLa-CX50ind (CX50) and HeLa-CX50G46Vind (CX50G46V) cells. Although the number of cells remaining in the culture was dramatically decreased 96 hours after treatment of HeLa-CX50G46Vind cells with ponasterone A, the cell density in HeLa-CX50ind cells was unaffected. Bar, 111 μm.
Figure 4.
 
Induction of CX50G46V protein expression decreased the number of cells. (AD) Phase-contrast photomicrographs from cultures of HeLa-CX50ind (A, B) and HeLa-CX50G46Vind (C, D) that were left untreated (A, C) or that were induced with 1 μM ponasterone A (B, D). (E) Quantitation of the data as the mean ± SEM of the number of cells per square millimeter for uninduced (−) and induced (+) cultures of HeLa-CX50ind (CX50) and HeLa-CX50G46Vind (CX50G46V) cells. Although the number of cells remaining in the culture was dramatically decreased 96 hours after treatment of HeLa-CX50G46Vind cells with ponasterone A, the cell density in HeLa-CX50ind cells was unaffected. Bar, 111 μm.
Figure 5.
 
Expression of CX50G46V protein decreased cell viability/survival. Graph represents the viability of HeLa-CX50ind (WT) and HeLa-CX50G46Vind (G46V) cells that were left untreated (■) or that were treated with 1 μM ponasterone A (Image Not Available) for 72 hours. Cell viability was determined with the MTS assay, in which the absorbance at 490 nm is proportional to the number of viable cells.
Figure 5.
 
Expression of CX50G46V protein decreased cell viability/survival. Graph represents the viability of HeLa-CX50ind (WT) and HeLa-CX50G46Vind (G46V) cells that were left untreated (■) or that were treated with 1 μM ponasterone A (Image Not Available) for 72 hours. Cell viability was determined with the MTS assay, in which the absorbance at 490 nm is proportional to the number of viable cells.
Figure 6.
 
Expression of CX50G46V protein increased the proportion of apoptotic cells. Shown are the results of cell cycle analysis of propidium iodide-stained HeLa-CX50ind (A, B) and HeLa-CX50G46Vind (C, D) cells that were left uninduced (A, C) or were induced by treatment with 1 μM ponasterone A for 48 hours (B, D). This analysis revealed an increase in the sub-G1 fraction after induction of CX50G46V protein expression by treatment with 1 μM ponasterone A for 48 hours.
Figure 6.
 
Expression of CX50G46V protein increased the proportion of apoptotic cells. Shown are the results of cell cycle analysis of propidium iodide-stained HeLa-CX50ind (A, B) and HeLa-CX50G46Vind (C, D) cells that were left uninduced (A, C) or were induced by treatment with 1 μM ponasterone A for 48 hours (B, D). This analysis revealed an increase in the sub-G1 fraction after induction of CX50G46V protein expression by treatment with 1 μM ponasterone A for 48 hours.
Figure 7.
 
Expression of CX50G46V induced hemichannel activity–dependent oocyte death. Oocytes were injected with similar amounts of CX50 or CX50G46V cRNA and incubated in modified Barth's solution containing 0, 1, or 3 mM Ca2+ overnight at 18°C. (A) Oocytes injected with CX50G46V cRNA showed obvious blebbing and discoloration (arrows) when incubated in modified Barth's solution containing 1 mM Ca2+ for 17 hours (bottom left). In contrast, oocytes injected with CX50 cRNA or oligonucleotide antisense to the endogenous Xenopus CX38 (Control) showed no apparent detrimental changes when studied under identical conditions (top). The rate of cell death of the CX50G46V cRNA-injected oocytes was significantly reduced by increasing the external calcium concentration from 1 to 3 mM (bottom right). (B) Graphs represent the number of surviving oocytes at different times after injection of cRNA in media containing 0, 1 or 3 mM Ca2+. Oocytes were scored for cell viability based on appearance, as illustrated in (A).
Figure 7.
 
Expression of CX50G46V induced hemichannel activity–dependent oocyte death. Oocytes were injected with similar amounts of CX50 or CX50G46V cRNA and incubated in modified Barth's solution containing 0, 1, or 3 mM Ca2+ overnight at 18°C. (A) Oocytes injected with CX50G46V cRNA showed obvious blebbing and discoloration (arrows) when incubated in modified Barth's solution containing 1 mM Ca2+ for 17 hours (bottom left). In contrast, oocytes injected with CX50 cRNA or oligonucleotide antisense to the endogenous Xenopus CX38 (Control) showed no apparent detrimental changes when studied under identical conditions (top). The rate of cell death of the CX50G46V cRNA-injected oocytes was significantly reduced by increasing the external calcium concentration from 1 to 3 mM (bottom right). (B) Graphs represent the number of surviving oocytes at different times after injection of cRNA in media containing 0, 1 or 3 mM Ca2+. Oocytes were scored for cell viability based on appearance, as illustrated in (A).
Table 1.
 
Functional Gap Junctional Channels Formed by CX50G46V
Table 1.
 
Functional Gap Junctional Channels Formed by CX50G46V
Cell 1/Cell 2 Junctional Conductance (μS) n
No cRNA/No cRNA 0.3 ± 0.1 8
CX50/CX50 41.6 ± 16.8 8
CX50G46V/CX50G46V 51.8 ± 34.2 9
Table 2.
 
Functional Hemichannels Formed by CX50G46V
Table 2.
 
Functional Hemichannels Formed by CX50G46V
Cell Hemichannel Current (nA) n
No cRNA 12.2 ± 12.2 2
CX50 9.8 ± 5.6 3
CX50G46V 277.1 ± 30.3 4
Table 3.
 
Inhibition of CX50G46V Hemichannel Currents by Increased [Ca2+]o
Table 3.
 
Inhibition of CX50G46V Hemichannel Currents by Increased [Ca2+]o
[Ca2+]o (mM) Hemichannel Current (nA) n
0 600.6 ± 64.1 7
1 115.7 ± 37.3 7
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×