September 2009
Volume 50, Issue 9
Free
Glaucoma  |   September 2009
Analysis of α2-adrenergic Receptors and Effect of Brimonidine on Matrix Metalloproteinases and Their Inhibitors in Human Ciliary Body
Author Affiliations
  • Yen Hoong Ooi
    From the Department of Ophthalmology, Massachusetts Eye and Ear Infirmary (MEEI), Boston, Massachusetts.
  • Dong-Jin Oh
    From the Department of Ophthalmology, Massachusetts Eye and Ear Infirmary (MEEI), Boston, Massachusetts.
  • Douglas J. Rhee
    From the Department of Ophthalmology, Massachusetts Eye and Ear Infirmary (MEEI), Boston, Massachusetts.
Investigative Ophthalmology & Visual Science September 2009, Vol.50, 4237-4243. doi:10.1167/iovs.08-2312
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Yen Hoong Ooi, Dong-Jin Oh, Douglas J. Rhee; Analysis of α2-adrenergic Receptors and Effect of Brimonidine on Matrix Metalloproteinases and Their Inhibitors in Human Ciliary Body. Invest. Ophthalmol. Vis. Sci. 2009;50(9):4237-4243. doi: 10.1167/iovs.08-2312.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

purpose. To ascertain the expression pattern of α2-adrenergic receptors in the ciliary body (CB) and determine the effect of brimonidine on matrix metalloproteinases (MMPs) and tissue inhibitors of metalloproteinases (TIMPs) in ciliary body smooth muscle (CBSM) cells.

methods. Qualitative RT-PCR was performed to detect the mRNA of the α2-adrenergic receptor subtypes α2A, α2B, and α2C in CB and CBSM cultures. Immunohistochemistry and immunoblot analysis were performed to further investigate α2A receptor expression in CB tissue and CBSM cells. CBSM cells from 15 different human donors received control or brimonidine tartrate (45 nM) for 1, 3, or 7 days. Changes in pro-MMP-1, -2, -3, -9, and -24 and TIMP-1, -2, -3, and -4 levels were evaluated by Western blot, with GAPDH as the endogenous control. Zymography was used to assess the activity of MMP-1, -2, -3, and -9.

results. The mRNA of α2A, α2B, and α2C were detected in CB tissue and CBSM cells. Immunohistochemistry localized α2A receptors within the CB stroma. Immunoblot analysis demonstrated production by CBSM cells. Brimonidine increased pro-MMP-9 an average of 116% ± 34% (P = 0.0360); enzymatic activity of MMP-9 was unchanged. TIMP-4 decreased an average of 25% ± 8% (P = 0.0329) in conditioned medium, but increased 70% ± 13% (P = 0.0057) in cell lysates.

conclusions. The presence of α2A, α2B, and α2C in CB tissue and CBSM cells indicates the possibility that brimonidine affects uveoscleral outflow. However, the changes in MMP-9 and TIMP-4 without significant changes in MMP-9 activity suggest that a role of the MMP/TIMP system in outflow is unlikely.

Elevated intraocular pressure (IOP) is a causative risk factor for the incidence and prevalence of glaucoma. 1 The exact molecular events that regulate IOP remain elusive, but elevated IOP results from abnormal aqueous outflow. 2 Some antiglaucoma medications lower IOP by enhancing aqueous drainage. By studying the underlying mechanism by which these medications act, a fundamental control mechanism for IOP regulation may be elucidated. 
Brimonidine tartrate (Alphagan; Allergan, Irvine, CA) was introduced in the United States in 1996. As a monotherapy, brimonidine lowers IOP approximately as effectively as timolol when used three times daily. 3  
Some fluorophotometry studies have suggested that brimonidine enhances uveoscleral outflow, 4 5 6 but not all studies have found a change in uveoscleral drainage with brimonidine. 7 Apraclonidine, a relatively nonselective α2-adrenergic agonist, worsens outflow facility, perhaps due to its worse receptor selectivity for α2. 8 Brimonidine decreases aqueous secretion by stimulation of the three α2-adrenergic receptor subtypes: α2A, α2B, and α2C (Gluchowski C, et al. IOVS 1994;35:ARVO Abstract 669). 9 10 11 12 13 Activation of α2-adrenoceptors decreases cyclic adenosine monophosphate (cAMP) levels in the nonpigmented ciliary body (CB) epithelium, resulting in lower aqueous production. 4 8 14 15 Receptor ligand binding and immunohistochemical studies consistently show strong signal/binding (i.e., high density) within the CB epithelium, the anatomic location of aqueous production. 16 17 Two research groups sought to identify the expression and distribution of α2-adrenergic receptors and agreed that α2B and α2C are in CB stroma. 17 18 However, they disagreed on the presence of α2A. 
Within the CB stroma portion of the uveoscleral tract, outflow resistance can be modulated by both ciliary smooth muscle cell tone 19 20 21 22 23 and enhanced turnover of extracellular matrix (ECM) by matrix metalloproteinases (MMPs). 24 25 26 27 28 29 30 31 Eleven MMPs are expressed in the CB smooth muscle (CBSM) cells. 31 Latanoprost, a prostaglandin F analogue, enhances uveoscleral outflow by shifting the MMP:TIMP ratio toward increased ECM turnover in the CB; 27 28 29 31 32 the ECM changes are observable morphologically. 24 25 In CB, latanoprost has been shown to induce or increase the expression of MMP-1, -2, -3, -9 and -17. 26 29 31 In trabecular meshwork, latanoprost increases the mRNA of MMP-1, -3, -17, and -24. 33 Our purpose was to ascertain the expression of α2-adrenergic receptor A in CB stroma and to determine the effect of brimonidine on selected MMPs and tissue inhibitors of metalloproteinases (TIMPs) on CBSM cells. 
Methods
Tissue and Cell Culture
The expression of the three α2-adrenergic receptors was determined by isolating the anterior segment and CB tissue in corneoscleral buttons from three donor eyes (three donors: two 61 years and one 56 years of age; Lions Eye Bank of Delaware Valley, Philadelphia, PA). For the study of MMPs and TIMPs, CBs were dissected from human donor corneoscleral buttons obtained from the Massachusetts Eye and Ear Infirmary within 6 hours of corneal transplant surgery. CBSM cell cultures were generated from CBs isolated from 15 separate donor eyes, ages 23 to 65 years (National Disease Research Interchange, Philadelphia, PA, and Lions Eye Bank of Delaware Valley). All procedures were performed in accordance with the Declaration of Helsinki. 
From whole eyes, the anterior segment of the globe was incised and isolated approximately 5 mm posterior to the limbus. After careful removal of the lens and iris, the CB was pulled from its attachment to the scleral spur. In general, significant portions of longitudinal ciliary muscle remains attached to the scleral spur; the longitudinal fibers are the area of filtration through the uveoscleral tract. This tissue is then sharply dissected from the sclera spur and isolated for culture. 
CBSM cells were cultured according to previously published protocols. 31 32 The cell identity confirmatory immunohistochemistry, performed by labeling with anti-desmin and anti-smooth muscle actin antibodies as described by Weinreb et al., 32 revealed that >99% of cells in culture were CBSM cells. In addition, our cells had a typical morphologic appearance, with individual cells having a spindle shape; once confluent, the cells grew in bundles mimicking the pattern in muscles. The cultures were maintained in Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen-Gibco, Grand Island, NY) containing 20% fetal bovine serum, 1% l-glutamine (2 mM), and gentamicin (0.1 mg/mL) at 37°C in a 10% CO2 atmosphere. All the cells used were from passage-4 and -5 cultures. 
Once grown to confluence, the cultures were maintained for 1 week. The cells were incubated in serum-free medium for 24 hours and exposed to vehicle control (0.02% distilled water) or to 45 or 450 nM of brimonidine tartrate (Allergan, Irvine, CA), for 24 hours; 45 nM approximates the peak aqueous concentration after topical administration of brimonidine. 34 35 36 Cell lines from four donors were further treated for 7 days; the medium was changed and collected daily with supplementation of brimonidine 45 nM, and immunoblot analysis and zymography were performed in four cell lines after 3 and 7 days of treatment. 
Reverse Transcription–Polymerase Chain Reaction
RT-PCR was performed using total RNA isolated from CB tissue and CBSM cells (SuperScript One-Step RT-PCR with Platinum Taq System; Invitrogen) in accordance with the manufacturer’s protocol, which includes a DNAase step. RT-PCR was initially performed with oligonucleotide primers specific to the mRNA of the α2-adrenergic receptor subtypes (Table 1) . Two tubes were run in parallel with the second tube containing only Taq polymerase to ensure that the source of the RT-PCR product was mRNA. For each reaction, 100 ng of template RNA was used (200 μM dNTP, 1.2 mM Mg, 0.2 μM of each primer). Amplification was performed with a thermocycler (model 2700, Thermocycler; Applied Biosystems, Inc. [ABI], Foster City, CA). The parameters were as follows: cDNA synthesis 50°C for 25 minutes; denaturation at 94°C for 2 minutes; and amplification for 40 cycles of 94°C for 15 seconds, annealing for 20 seconds, and extension at 72°C for 45 seconds. A final extension of 72°C for 10 minutes was run after the 40 cycles. The mRNA concentration in the CB tissue was low, and so reamplification was performed (PCR reagent system; Invitrogen). 
Ten percent of the RT-PCR product was used as DNA template for the PCR reaction. PCR conditions were as follows: incubation at 94°C for 2 minutes, followed by amplification at 94°C for 30 seconds, annealing for 30 seconds, and extension at 72°C for 30 seconds for 35 cycles. A final extension was run at 72°C for 7 minutes. Reamplification was not necessary for cultures of CBSM cells. 
Gel electrophoresis was performed on the PCR products using a 2% agarose gel (E-gel; Invitrogen). ôX174 RF DNA/HaeIII ladder (Invitrogen) was run concurrently to verify band size. The RT-PCR product was then purified (QIAquick PCR Purification Kit; Qiagen, Valencia, CA) in accordance with the manufacturer’s protocol. The DNA was sequenced at the core facility at Jefferson Medical College. Results from the sequencing were analyzed by using the standard nucleotide-nucleotide (blastn) algorithm contained in the BLAST software package (www.ncbi.nlm.nih.gov/blast/ provided in the public domain by NCBI, Bethesda, MD). 
Immunofluorescent Staining
The 4- and 6-μm 10% formalin-fixed, paraffin-embedded anterior segment sections were deparaffinized in xylene, rinsed with phosphate-buffered saline with 0.05% Tween 20 (PBS-T), and incubated with 10% normal goat serum and then with polyclonal antibody against the α2A-adrenergic receptor (dilution 1:100; Genex Bioscience, Hayward, CA) and a monoclonal antibody against α-smooth muscle actin (dilution 1:100; Sigma-Aldrich, St. Louis, MO). Binding of the primary antibodies was localized with Alexa Fluor 594 goat anti-rabbit IgG and Alexa Fluor 488 goat anti-mouse IgG (dilution 1:100; Invitrogen-Molecular Probes, Eugene, OR). Alexa Fluor 488 phalloidin (dilution 1:400; Invitrogen-Molecular Probes) was incubated with the secondary antibodies. Images were then analyzed with a fluorescence microscope (BX51; Olympus, Lake Success, NY). 
Because the cross-reactivity within the nuclei has been observed by other groups using anti-α-smooth muscle actin antibodies, 37 we performed additional staining with anti-F-actin, anti-α2A-adrenergic receptor antibodies, and nuclear stain. 
Western Blot Analysis
Western blot analysis was used to determine protein levels. Equal amounts of protein from whole-cell lysates or concentrated (Amicon Ultra-4, 10K; Millipore, Milford, MA) conditioned medium were mixed with 2× reducing buffer (125 mM of Tris-HCl [pH 6.8], 4% SDS, 20% glycerol, 0.01% bromophenol blue, and 5 mg/mL DTT) at a 1:10 ratio and were boiled for 3 minutes. The samples were electrophoresed in 11% SDS-polyacrylamide gel at 130 V in tank buffer (250 mM Tris, 192 mM glycine, and 0.1% SDS), in a mini electrophoresis system (XCell SureLock Mini-Cell; Invitrogen). The separated proteins were blotted onto a nitrocellulose membrane with 0.45-μm pore size (Invitrogen) in blotting buffer (250 mM Tris, 192 mM glycine, and 10% methanol). The membrane was incubated in blocking buffer (Rockland, Gilbertsville, PA) and 1× TBS (20 mM Tris-HCl [pH 7.6], and 137 mM NaCl) at 1:1 ratio at room temperature. The membrane was then incubated in primary antibody (Table 2)buffered with blocking buffer and 1× TBS/T (1× TBS with 0.1% Tween-20) at a 1:1 ratio overnight at 4°C. The following day after washing in TBS/T for 10 minutes, the membranes were incubated with infrared dye (IRDye 800)-conjugated affinity purified anti-Mouse or anti-Rabbit IgG (Rockland, Gilbertsville, PA) diluted 1:10,000 for 1 hour. The membranes were washed with 1× TBS/T and scanned with an infrared imaging system (Odyssey; Li-Cor, Lincoln, NE). The bands were quantified with densitometric software (Olympus; Li-Cor). 
Zymographic Analysis
Zymography is used to analyze the ability of MMP-2 and -9 to degrade gelatin and MMP-1 and -3 to degrade casein. Zymography techniques for MMPs other than MMP-1, -2, -3, and -9 have not been described in studies of ocular tissue. Gelatin (0.1%) or β-casein (0.1%) was mixed into liquid acrylamide when casting polyacrylamide gels. Concentrated conditioned medium was mixed with 2× Tris-glycine-SDS zymography sample buffer (125 mM Tris-HCl [pH 6.8], 4% SDS, 20% glycerol, 0.01% bromophenol blue) at a 1:10 ratio and was loaded into 10% SDS-polyacrylamide gels. The samples were electrophoresed at 130 V in tank buffer. The gels were washed at room temperature with 2.5% Triton X-100 (renaturing buffer), then transferred to development buffer (50 mM Tris-HCl [pH 7.5], 0.2 M NaCl, 5 mM CaCl2, and 0.05% NaN3) overnight at 37°C. The resultant gels were stained with 0.1% Coomassie brilliant blue G-250 (Bio-Rad, Hercules, CA) solution for at least 3 hours, then destained with fixing/destaining solution until clear bands were visible and contrasted well with the blue background of the nondegraded substrate. The gels were scanned and analyzed for relative densities with the infrared imaging system (Odyssey; Li-Cor). All the MMPs were identified based on their molecular weights resolved by zymography and were confirmed by purified MMP-1, -2, -3, and -9 (Chemicon, Temecula, CA) as positive controls. 
Statistical Analysis
Results are presented as the mean ± SEM and statistical significance (P < 0.05) was evaluated by (paired) Student’s t-test or repeated-measures one-way ANOVA. 
Results
α2-Adrenergic Receptor Expression
The mRNA transcripts were identified for α2A, α2B, and α2C in CB tissue and CBSM cells (Fig. 1A) . Because of the disagreement regarding the expression of α2A, we also sought the distribution of the protein; Western blot analysis demonstrated bands from both CB tissue and CBSM cells (Fig. 1B) . Immunofluorescence staining revealed strong reactivity of the epithelium, but a very low signal pattern within the stroma (Fig. 2 3) . Dual staining showed that α2A has a very low level of overlap with α-smooth muscle actin and F-actin, respectively. Although the CBSM cells transcribe α2A in culture, the protein is present in very low levels in vivo. 
Effect on MMP and TIMP Levels
MMPs -1, -2, -3, and -9 are secreted proteins and were identified in conditioned medium (Fig. 4A) . We were not able to detect them in the cell lysates. Conversely, MMP-24 (MT5-MMP) was membrane bound and found in the cell lysates (Fig. 4A)but not in the conditioned medium. The major unglycosylated form of pro-MMP-1 was present approximately 70% more than the glycosylated form (P = 0.0305). However, there was approximately 90% more glycosylated pro-MMP-3 than the major unglycosylated form (P = 0.0181). Little is known about the physiological function of glycosylation of these MMPs. 
In response to the peak pharmacologic dose of brimonidine, 45 nM, pro-MMP-9 increased 116% ± 34% (P = 0.026; Table 3 , Fig. 5A ). An increase in pro-MMP-9 by 42% ± 12% (P = 0.0394) was also seen at 3 days. The levels of pro-MMP-1, -2, -3, and -24 did not change at 1 or 3 days (P > 0.05). At 7 days, there was a decrease of approximately 50% of all MMPs, TIMPs, and GAPDH compared with baseline values, although there were no observed morphologic changes in the cultured cells. The enzymatic activity of MMP-1, -2, and -9 did not change at 1 or 3 days. Intermediate MMP-1 and active MMP-2 and -9 were identified with positive controls on zymography (Fig. 6) . MMP-3 was not identified on zymography. No changes in the level or activity of the examined MMPs were seen at 24 hours with 450 nM brimonidine. 
TIMP-1, -2, -3, and -4 were found at 28, 21, 32 27, and 29 kDa, respectively (Fig. 4B) . All TIMPs were found in both conditioned medium and cell lysates. However, in cell lysates, the basal levels of TIMP-1, -2, and -3 are consistently close to the lowest limit of detection; brimonidine did not significantly change the basal protein levels. 
In conditioned medium, TIMP-4 decreased an average of 25% ± 8% (P = 0.0329) at 45 nM of brimonidine, with a further dose-dependent decrease of 38% ± 13% (P = 0.0417) in response to 450 nM brimonidine (Fig. 5B) . In cell lysates, TIMP-4 increased an average of 70% ± 13% (P = 0.0057) at 45 nM brimonidine (Fig. 5C) . No other significant changes were found. 
Discussion
Our results confirm the transcription of α2B and α2C in CB tissue and CBSM cells found by other groups. 17 18 We have demonstrated that α2A is also present at very low levels similarly reported by Bylund and Chacko. 18 CBSM cell cultures had greater amounts of α2A. The causes of this difference may be due to greater amounts of α2A relative to the total protein content since the sole source of protein from CBSM cell cultures are the cells and underlying matrix. Since all three receptors are expressed by CBSM cells, it is plausible that brimonidine has an effect on uveoscleral outflow. Evidence from transgenic null mice with deletion of the individual α2-adrenergic receptors indicates that, separately, these receptors are not involved in diurnal IOP variation. 48  
In most tissues, the MMP:TIMP ratio determines the rate of ECM turnover. 49 50 51 MMPs are zinc-dependent endopetidases, and with the exception of the membrane bound subfamily, are secreted as inactive/zymogen (i.e., pro-) forms. Once activated, MMPs, as a group, can degrade all components of the surrounding ECM as well as activate proteins involved in cell signaling. 52 Membrane-bound MMPs can degrade ECM components immediately surrounding the plasma membrane, but also have regulatory roles such as activation of pro-MMPs. 53 54 55 56 57 58 59 60  
Brimonidine increased the levels of pro-MMP-9. However, the activity of MMP-9 was not altered in 72 hours of treatment. We found that induction of MMP-9 is one of the significant changes in response to latanoprost. However, the increase of pro-MMP-9 without an increase in activity seems unlikely to cause increased ECM turnover. Latanoprost induces numerous changes in MMP transcription in CBSM cells. Brimonidine decreased TIMP-4 in the conditioned medium, but increased TIMP-4 accumulation in CBSM cell lysates. From this finding, we can extrapolate that the increase in pro-MMP-9, without increased activity, and disparate effects on TIMP-4 would have a small impact on uveoscleral outflow. 
In humans, brimonidine’s reported effect on uveoscleral outflow is not immediate and is seen at approximately 1 week. 4 6 The time course in vivo cannot be duplicated in cell culture; cell culture is a useful model system to study cellular and enzymatic action. However, we did carry cell cultures to 7 days, at which point, there was a generalized reduction of protein since the amount of GAPDH decreased dramatically despite equal protein loading. Based on the results, the period for CBSM cell cultures in a serum-free state to be used in the study of these molecular mechanisms should be no more than 72 hours. If a delayed effect on MMPs occurred, it is likely that we would have observed it. 
We were unable to identify active MMP-3 in zymography. One group described latanoprost increasing MMP-3 activity in the culture medium of complete human corneoscleral explant by casein zymographs; however, the MMP-3 could have been secreted by any of the anterior segment tissues. 28 Others were able to detect MMP-3 only after enhancement by TNFα, IL-1, and 12-tetradecanoylphorbol-13-acetate (TPA)-enhanced MMP-3 expression in human trabecular meshwork in casein zymography, without which the baseline level was at the lowest limit of detection. 43 61 62 63 64 Weinreb et al. 26 described a 50-kDa band in a casein zymograph as an intermediate or partially activated form of MMP-3 in control samples of human CB. Fully activated MMP-3 has a molecular mass of 41 to 45 kDa. 38 65 To confirm our assay, pure MMP-3 protein was run in casein zymography and revealed two bands at approximately 57 and 45 kDa, corresponding to pro- and intermediate or active MMP-3 (data not shown). Although we were able to identify pro-MMP-3, brimonidine did not appear to activate MMP-3. 
TIMPs are secreted proteins that are kinetic inhibitors of MMPs, but can also be involved in the activation of the zymogen form. 52 All four known human TIMPs are present in CB. 31 The presence of TIMP-4 protein in both conditioned medium and cell lysates suggests its importance in human CBSM cells. In rat vasculature, the combination of upregulation of MMP-2, and -9 accompanied by a decrease in TIMP-4 led to increased collagen turnover in vessel walls. 66 Pro-MMP-2 is activated in TIMP-4-deficient mice, as it is in wild-type, indicating a pure inhibitory role for TIMP-4. 67  
All the α2-adrenergic receptors are expressed by the CBSM cells. Stimulation of α2-adrenergic (e.g., brimonidine) and inhibition of α-1-adrenergic receptors (e.g., bunazosin) have been associated with increased uveoscleral flow. 4 6 68 Bunazosin does not have an appreciable effect on CBSM MMPs. 69 Similarly, brimonidine’s effect on uveoscleral outflow does not appear to be mediated by altering the MMP/TIMP system. Further study of other ECM degrading enzymes or muscular tone may be valuable in elucidating the mechanism of increased uveoscleral outflow. 
 
Table 1.
 
Oligonucleotide Primer Sequences Used for RT-PCR
Table 1.
 
Oligonucleotide Primer Sequences Used for RT-PCR
Subtype Primer Sequences Expected Band Size (bp)
α2A F: CTCTTCCTGGTGTCTCTGGC 232
R: GGTTGTACTCGATGGCCTGT
α2B F: CCTGGCCTCCAGCATCGGAT 612
R: ATGACCACAGCCAGCACGAA
α2C F: GTGGTGATCGCCGTGCTGAC 573
R: CGTTTTCGGTAGTCGGGGAC
Table 2.
 
Primary Antibodies and Dilutions Used for Western Blot Analysis
Table 2.
 
Primary Antibodies and Dilutions Used for Western Blot Analysis
Antibodies Manufacturer Dilution Identified Band (kDa)
α2A (P) Genex Bioscience 1:5,000 49
MMP-1 (M) R&D Systems* 1:1,000 52, 57
MMP-2 (M) R&D Systems 1:1,000 72
MMP-3 (P) Chemicon 1:1,000 57, 59
MMP-9 (P) Chemicon 1:1,000 92
MMP-24 (P) Chemicon 1:1,000 64
TIMP-1 (P) Chemicon 1:20K 28
TIMP-2 (P) Chemicon 1:2,000 21
TIMP-3 (P) Calbiochem 1:200 27
TIMP-4 (P) Chemicon 1:7,000 29
GAPDH (P) R&D Systems 1:20–40K 36
Figure 1.
 
The mRNA transcripts of α2A, α2B, and α2C in human CB tissue and CBSM cells and Western blot analysis of protein extracted from CBSM cells and CB tissue for α2A. (A) Results of RT-PCR for mRNA of α2-adrenergic receptor subtypes, α2A, α2B, and α2C from CBSM cells and CB tissue isolated from a 56-year-old donor, showing single bands corresponding to expected sizes of 232, 612, and 573 bp, respectively. The ôX174 RF DNA/HaeIII ladder was used. Lanes correspond to blank (*), negative control (PCR only: lanes 1, 3, 6, 8, 9, and 11) and RT-PCR of CBSM cells for α2A (lane 2), α2B (lane 5), and α2C (lane 10), as well as of CB tissue (lanes 4, 7, and 12). (B) Western blot of protein extracted from CBSM cells and CB tissue for α2A at ∼64 kDa. Lanes correspond to blank (*), 10 μg of protein from CB tissue (lane 1) and CBSM cells (lane 3) and 50 μg of protein from CBSM cells (lane 2) and CB tissue (lane 4) incubated with both primary and secondary antibodies. α2A protein from CB tissue was detected at a much lower level than from CBSM cells.
Figure 1.
 
The mRNA transcripts of α2A, α2B, and α2C in human CB tissue and CBSM cells and Western blot analysis of protein extracted from CBSM cells and CB tissue for α2A. (A) Results of RT-PCR for mRNA of α2-adrenergic receptor subtypes, α2A, α2B, and α2C from CBSM cells and CB tissue isolated from a 56-year-old donor, showing single bands corresponding to expected sizes of 232, 612, and 573 bp, respectively. The ôX174 RF DNA/HaeIII ladder was used. Lanes correspond to blank (*), negative control (PCR only: lanes 1, 3, 6, 8, 9, and 11) and RT-PCR of CBSM cells for α2A (lane 2), α2B (lane 5), and α2C (lane 10), as well as of CB tissue (lanes 4, 7, and 12). (B) Western blot of protein extracted from CBSM cells and CB tissue for α2A at ∼64 kDa. Lanes correspond to blank (*), 10 μg of protein from CB tissue (lane 1) and CBSM cells (lane 3) and 50 μg of protein from CBSM cells (lane 2) and CB tissue (lane 4) incubated with both primary and secondary antibodies. α2A protein from CB tissue was detected at a much lower level than from CBSM cells.
Figure 2.
 
Immunofluorescent staining of ciliary processes obtained from an 81-year-old donor eye with antibodies against α2A (A) and α-smooth muscle actin (B). There was strong staining within the epithelium with a diffuse signal pattern within the stroma. The pattern of staining within the CB stroma shows some overlap with smooth muscle cells, rather than being isolated to blood vessels (C). A negative control with a 2° antibody only demonstrated no stain (D). Scale bar, 40 μm.
Figure 2.
 
Immunofluorescent staining of ciliary processes obtained from an 81-year-old donor eye with antibodies against α2A (A) and α-smooth muscle actin (B). There was strong staining within the epithelium with a diffuse signal pattern within the stroma. The pattern of staining within the CB stroma shows some overlap with smooth muscle cells, rather than being isolated to blood vessels (C). A negative control with a 2° antibody only demonstrated no stain (D). Scale bar, 40 μm.
Figure 3.
 
Immunofluorescent staining of ciliary processes obtained from a 61-year-old donor eye with antibodies against α2A (D) and F-actin (E). α2A shows strong staining within the epithelium with a pattern of bands within the stroma. F-actin shows an even staining pattern with a pattern of actin filaments within the stroma. The staining pattern of α2A within the CB stroma shows a very low level of overlap with F actin filaments (F) and strong overlap with the ciliary epithelium. (A, rectangle) The approximately site shown in (CF). A negative control with a 2° antibody demonstrated no stain (B). Scale bar: (A) 200 μm; (BF) 20 μm.
Figure 3.
 
Immunofluorescent staining of ciliary processes obtained from a 61-year-old donor eye with antibodies against α2A (D) and F-actin (E). α2A shows strong staining within the epithelium with a pattern of bands within the stroma. F-actin shows an even staining pattern with a pattern of actin filaments within the stroma. The staining pattern of α2A within the CB stroma shows a very low level of overlap with F actin filaments (F) and strong overlap with the ciliary epithelium. (A, rectangle) The approximately site shown in (CF). A negative control with a 2° antibody demonstrated no stain (B). Scale bar: (A) 200 μm; (BF) 20 μm.
Figure 4.
 
Representative immunoblots of culture medium or cell lysates from human CBSM cells for MMPs and TIMPs. (A) Interstitial collagenase (MMP-1) was present at molecular masses of 52 38 39 40 and 57 kDa, corresponding to unglycosylated and glycosylated forms of pro-MMP-1. Gelatinase A (MMP-2) was identified at 72 kDa 41 corresponding to the pro forms of MMP-2. Stromelysin-1 (MMP-3) was present at 57 38 and 59 kDa, 42 43 corresponding to unglycosylated and glycosylated forms of pro-MMP-3, respectively. MT5-MMP (MMP-24) was identified at 64 kDa 44 corresponding to pro-MMP-24. (B) TIMPs-1, -2, and -3 yielded single bands at molecular masses of 28, 21, and 27 kDa, respectively, from conditioned medium. C represents control sample; 1× and 10× represent samples incubated with 45 and 450 nM of brimonidine tartrate, respectively, for 24 hours.
Figure 4.
 
Representative immunoblots of culture medium or cell lysates from human CBSM cells for MMPs and TIMPs. (A) Interstitial collagenase (MMP-1) was present at molecular masses of 52 38 39 40 and 57 kDa, corresponding to unglycosylated and glycosylated forms of pro-MMP-1. Gelatinase A (MMP-2) was identified at 72 kDa 41 corresponding to the pro forms of MMP-2. Stromelysin-1 (MMP-3) was present at 57 38 and 59 kDa, 42 43 corresponding to unglycosylated and glycosylated forms of pro-MMP-3, respectively. MT5-MMP (MMP-24) was identified at 64 kDa 44 corresponding to pro-MMP-24. (B) TIMPs-1, -2, and -3 yielded single bands at molecular masses of 28, 21, and 27 kDa, respectively, from conditioned medium. C represents control sample; 1× and 10× represent samples incubated with 45 and 450 nM of brimonidine tartrate, respectively, for 24 hours.
Table 3.
 
Changes in MMP and TIMP Expression in Response to 24-Hour Incubation with 45 and 450 nM Brimonidine
Table 3.
 
Changes in MMP and TIMP Expression in Response to 24-Hour Incubation with 45 and 450 nM Brimonidine
Protein 45 nM of Brimonidine (% of Control) 450 nM of Brimonidine (% of Control)
Pro-MMP-1 1 ± 21 10 ± 28
Pro-MMP-2 8 ± 8 23 ± 10
Pro-MMP-3 15 ± 24 25 ± 26
Pro-MMP-9 116 ± 34* 25 ± 9
MMP-24 (lysates) −13 ± 5 6 ± 13
Intermediate MMP-1 6 ± 4 7 ± 4
Active MMP-2 −3 ± 1 −4 ± 2
Active MMP-9 −1 ± 5 −2 ± 5
TIMP-1 23 ± 28 9 ± 23
TIMP-2 −3 ± 7 19 ± 19
TIMP-3 21 ± 32 15 ± 25
TIMP-4 −25 ± 8* −38 ± 13*
TIMP-4 (lysates) 70 ± 13* 39 ± 26
Figure 5.
 
Effect of brimonidine on MMP-9 and TIMP-4 expression levels in CBSM cells. (A) Representative immunoblot for MMP-9 expression level from a 45 year old donor. Gelatinase B (MMP-9) was identified at 92 kDa. 42 Densitometric analysis of five independent donors revealed that the pharmacologic dose (45 nM) of brimonidine produced a statistically significant increase (116% ± 34%) in pro-MMP-9. (B) Representative immunoblot for TIMP-4 expression level from a 40 year old donor. TIMP-4 yielded a 29-kDa single band. A statistically significant decrease (25% ± 8%) in TIMP-4 in response to 45 nM of brimonidine and a further dose-dependent decrease (38% ± 13%) at 450 nM of brimonidine from five separate donors. (C) Representative immunoblot for TIMP-4 expression level in the cell lysates from a 44-year-old donor. Densitometric analysis showed that pharmacologic dose (45 nM) of brimonidine produced a statistically significant increase (70% ± 13%) in TIMP-4. Data are the mean ± SEM of normalized densitometry measurements (n = 5). *Significant at P < 0.05 vs. control. C represents control sample; 1× and 10× represent samples incubated with 45 and 450 nM of brimonidine tartrate, respectively, for 24 hours.
Figure 5.
 
Effect of brimonidine on MMP-9 and TIMP-4 expression levels in CBSM cells. (A) Representative immunoblot for MMP-9 expression level from a 45 year old donor. Gelatinase B (MMP-9) was identified at 92 kDa. 42 Densitometric analysis of five independent donors revealed that the pharmacologic dose (45 nM) of brimonidine produced a statistically significant increase (116% ± 34%) in pro-MMP-9. (B) Representative immunoblot for TIMP-4 expression level from a 40 year old donor. TIMP-4 yielded a 29-kDa single band. A statistically significant decrease (25% ± 8%) in TIMP-4 in response to 45 nM of brimonidine and a further dose-dependent decrease (38% ± 13%) at 450 nM of brimonidine from five separate donors. (C) Representative immunoblot for TIMP-4 expression level in the cell lysates from a 44-year-old donor. Densitometric analysis showed that pharmacologic dose (45 nM) of brimonidine produced a statistically significant increase (70% ± 13%) in TIMP-4. Data are the mean ± SEM of normalized densitometry measurements (n = 5). *Significant at P < 0.05 vs. control. C represents control sample; 1× and 10× represent samples incubated with 45 and 450 nM of brimonidine tartrate, respectively, for 24 hours.
Figure 6.
 
Representative zymograms of MMPs from the conditioned culture medium of human CBSM cells. (A) Two bands were observed in the casein zymographs corresponding to the latent (52 kDa) and intermediate (48 kDa) forms of MMP-1. 45 Intermediate MMP-1 is 200% more active than the pro-MMP-1 (P < 0.01). (B) Four major bands were observed in the gelatin zymographs corresponding to the latent (72 kDa) and active (66 kDa) forms of MMP-2 46 47 and the latent (92 kDa) and active (88 kDa) forms of MMP-9 (C). C represents control sample; 1× and 10× represent samples incubated with 45 and 450 nM of brimonidine tartrate, respectively, for 24 hours.
Figure 6.
 
Representative zymograms of MMPs from the conditioned culture medium of human CBSM cells. (A) Two bands were observed in the casein zymographs corresponding to the latent (52 kDa) and intermediate (48 kDa) forms of MMP-1. 45 Intermediate MMP-1 is 200% more active than the pro-MMP-1 (P < 0.01). (B) Four major bands were observed in the gelatin zymographs corresponding to the latent (72 kDa) and active (66 kDa) forms of MMP-2 46 47 and the latent (92 kDa) and active (88 kDa) forms of MMP-9 (C). C represents control sample; 1× and 10× represent samples incubated with 45 and 450 nM of brimonidine tartrate, respectively, for 24 hours.
BolandMV, QuigleyHA. Risk factors and open-angle glaucoma: classification and application. J Glaucoma. 2007;14:166–172.
BrubakerRF. Clinical measurements of aqueous dynamics: implications for addressing glaucoma.CivanMM eds. The Eye’s Aqueous Humor. From Secretion to Glaucoma. 1998;233–284.San Diego Academic Press.
KonstasAG, StewartWC, TopouzisF, TersisI, HolmesKT, StangosNT. Brimonidine 0.2% given two or three times daily versus timolol maleate 0.5% in primary open-angle glaucoma. Am J Ophthalmol. 2001;131:729–733. [CrossRef] [PubMed]
TorisCB, GleasonML, CamrasCB, YablonskiME. Effects of brimonidine on aqueous humor dynamics in human eyes. Arch Ophthalmol. 1995;113:1514–1517. [CrossRef] [PubMed]
LarssonL-I. Aqueous humor flow in normal human eyes treated with brimonidine and timolol, alone and in combination. Arch Ophthalmol. 2001;119:492–495. [CrossRef] [PubMed]
TorisCB, CamrasCB, YablonskiME. Acute versus chronic effects of brimonidine on aqueous humor dynamics in ocular hypertensive patients. Am J Ophthalmol. 1999;128:8–14. [CrossRef] [PubMed]
MausTL, NauC, BrubakerRF. Comparison of the early effects of brimonidine and apraclonidine as topical ocular hypotensive agents. Arch Ophthalmol. 1999;117:586–591. [CrossRef] [PubMed]
TorisCB, GleasonML, CamrasCB, YablonskiME. Effects of apraclonidine on aqueous humor dynamics in human eyes. Ophthalmology. 1995;102:456–461. [CrossRef] [PubMed]
HarrisonJK, PearsonWR, LynchKR. Molecular characterization of α1- and α2-adrenoceptors. Trends Pharmacol Sci. 1991;12:62–67. [CrossRef] [PubMed]
MacDonaldE, KobilkaBK, ScheinnM. Gene targeting: homing in on α2-adrenoceptor-subtype function. Trends Pharmacol Sci. 1997;18:445–458.
KobilkaBK, MatsuiH, KobilkaTS, et al. Cloning, sequencing, and expression of the gene coding for the human platelet α2-adrenergic receptor. Science. 1987;238:650–656. [CrossRef] [PubMed]
ReganJW, KoblikaTS, Yang-FengTL, CaronMG, KefkowitzRJ, KobliskBK. Cloning and expression of a human kidney cDNA for an α2-adrenergic receptor subtype. Proc Natl Acad Sci USA. 1988;85:6301–6305. [CrossRef] [PubMed]
LomasneyJW, LorenzW, AllenLF, et al. Expression of the α2-adrenergic receptor family: cloning and characterization of a human α2-adrenergic receptor subtype, the gene for which is located on chromosome 2. Proc Natl Acad Sci USA. 1990;87:5094–5098. [CrossRef] [PubMed]
MittagTW, TormayA. Drug responses of adenylate cyclase in iris-ciliary body determined by adenine labeling. Invest Ophthalmol Vis Sci. 1985;26:39–40.
GabeltBT, RobinsonJC, HubbardWC, et al. Apraclonidine and brimonidine effects on anterior ocular and cardiovascular physiology in normal and sympathectomized monkeys. Exp Eye Res. 1994;59:633–644. [CrossRef] [PubMed]
MatsuoT, CynaderMS. Localization of alpha-2 adrenergic receptors in the human eye. Ophthalmic Res. 1992;24:231–219.
HuangY, GilDW, VanscheeuwijckP, StamerWD, ReganJW. Localization of α2-adrenergic receptor subtypes in the anterior segment of the human eye with selective antibodies. Invest Ophthalmol Vis Sci. 1995;36:2729–2739. [PubMed]
BylundDB, ChackoDM. Characterization of alpha2 adrenergic receptor subtypes in human ocular tissue homogenates. Invest Ophthalmol Vis Sci. 1999;40:2299–2306. [PubMed]
BárányEH. Localized contraction and relaxation within the ciliary muscle of the vervet monkey (Cercopithecus ethiops).RohenJW eds. The Structure of the Eye: Second Symposium. 1965;287–311.FK Schattauer Verlag Stuttgart, Germany.
BillA, PhillipsI. Uveoscleral drainage of aqeous humor in human eyes. Exp Eye Res. 1971;21:275–281.
BillA. Effects of atropine and pilocarpine on aqueous humour dynamics in cynomolgus monkeys (Macaca irus). Exp Eye Res. 1967;6:120–125. [CrossRef] [PubMed]
TownsendDJ, BrubakerRF. Immediate effect of epinephrine on aqueous formation in the normal human eye as measured by fluorophotometry. Invest Ophthalmol Vis Sci. 1980;19:256–266. [PubMed]
SchenkerJI, YablonskiME, PodosSM, LinderL. Fluorophotometric study of epinephrine and timolol in human subjects. Arch Ophthalmol. 1981;99:1212–1216. [CrossRef] [PubMed]
Lütjen-DrecollE, TammE. Morphological study of the anterior segment of cynomolgus monkey eyes following treatment with prostaglandin F. Exp Eye Res. 1988;47:761–769. [CrossRef] [PubMed]
Lütjen-DrecollE, TammE. The effects of ocular hypotensive doses of PGF2 alpha-isopropylester on anterior segment morphology. Prog Clin Biol Res. 1989;312:437–446. [PubMed]
WeinrebRN, KashiwagiK, KashiwagiF, TuskaharaS, LindseyJD. Prostaglandins increase matrix metalloproteinase release from human ciliary smooth muscle cells. Invest Ophthalmol Vis Sci. 1997;38:2772–2780. [PubMed]
OcklindA. Effect of latanoprost on the extracellular matrix of the ciliary muscle: a study on cultured cells and tissue sections. Exp Eye Res. 1998;67:179–191. [CrossRef] [PubMed]
El-ShabrawiY, EckhardtM, BergholdA, et al. Synthesis pattern of matrix metalloproteinases (MMPs) and inhibitors (TIMPs) in human explant organ cultures after treatment with latanoprost and dexamethasone. Eye. 2000;14:375–383. [CrossRef] [PubMed]
LindseyJD, KashiwagiK, BoyleD, KashiwagiF, FiresteinGS, WeinrebRN. Prostaglandins increase proMMP-1 and proMMP-3 secretion by human ciliary smooth muscle cells. Curr Eye Res. 1996;15:869–875. [CrossRef] [PubMed]
AnthonyTL, LindseyJD, WeinrebRN. Latanoprost’s effects on TIMP-1 and TIMP-2 expression in human ciliary muscle cells. Invest Ophthalmol Vis Sci. 2002;43:3705–3711. [PubMed]
OhDJ, MartinJL, WilliamsAJ, et al. Analysis of expression of matrix metalloproteinases and tissue inhibitors of metalloproteinases in human ciliary body following latanoprost. Invest Ophthalmol Vis Sci. 2006;47:953–963. [CrossRef] [PubMed]
WeinrebRN, KimD-M, LindseyJD. Propagation of ciliary smooth muscle cells invitro and effects of prostaglandin F on calcium efflux. Invest Ophthalmol Vis Sci. 1992;33:2679–2686. [PubMed]
OhDJ, MartinJL, WilliamsAJ, RussellP, BirkDE, RheeDJ. Effect of latanoprost on the expression of matrix metalloproteinases and their tissue inhibitors in human trabecular meshwork cells. Invest Ophthalmol Vis Sci. 2006;47:3887–3895. [CrossRef] [PubMed]
KeramanosNK, LamariF, KatsimprisJ, GartaganisS. Development of an HPLC method for determining the alpha2-adrenergic receptor agonist brimonidine in blood serum and aqueous humor of the eye. Biomed Chromatogr. 1999;13:86–89. [CrossRef] [PubMed]
TzovolouDN, LamariF, MelaEK, GartaganisSP, Karamanos. Capillary electrophoretic analysis of brimonidin in aqueous humor of the eye and blood sera and realtion of its levels with intraocular pressure. Biomed Chromatogr. 2000;14:301–305. [CrossRef] [PubMed]
AcheampongAA, SmallD, BaumgartenV, WeltyD, Tang-LiuD. Formulation effects on ocular absorption of brimonidine in rabbit eyes. J Ocul Pharmacol Ther. 2002;18:325–337. [CrossRef] [PubMed]
SebeA, KeivonenSK, FinthaA, et al. Tranforming growth factor-b-induced alpha-smooth muscle actin expression in renal proximal tubular cells is regulated by p38b mitogen-activated protein kinase, extracellular signal-regulated protein kinase 1,2 and the Smad signaling during epithelial-myofibroblast transdifferentiation. Nepthrol Dial Transplant. 2008;23:1537–1545. [CrossRef]
NagaseH, SuzukiK, MorodomiT, EnghildJJ, SalvesenG. Activation mechanisms of the precursors of matrix metalloproteinases 1, 2 and 3. Matrix Suppl. 1992;1:237–244. [PubMed]
WangN, LindseyJD, AngertM. Latanoprost and matrix metalloproteinase-1 in human choroid organ cultures. Curr Eye Res. 2001;22(3)198–207. [CrossRef] [PubMed]
HinzB, RöschS, RamerR. Latanoprost induces matrix metalloproteinase-1 expression in human nonpigmented ciliary epithelial cells through a cyclooxygenase-2-dependent mechanism. FASEB J. 2005;19(13)1929–1931. [PubMed]
HusainS, JafriF, CrossonCE. Acute effects of PGF2alpha on MMP-2 secretion from human ciliary muscle cells: a PKC- and ERK-dependent process. Invest Ophthalmol Vis Sci. 2005;46(5)1706–1713. [CrossRef] [PubMed]
HatamochiA, KurodaK, ShinkaiH. Regulation of matrix metalloproteinase (MMP) expression in cutis laxa fibroblasts: upregulation of MMP-1, MMP-3 and MMP-9 genes but not of the MMP-2 gene. Br J Dermatol. 1998;138(5)757–762. [CrossRef] [PubMed]
KelleyMJ, RoseAY, SongK, et al. Synergism of TNF and IL-1 in the induction of matrix metalloproteinase-3 in trabecular meshwork. Invest Ophthalmol Vis Sci. 2007;48(6)2634–2643. [CrossRef] [PubMed]
LlanoE, PendásAM, FreijeJP. Identification and characterization of human MT5-MMP, a new membrane-bound activator of progelatinase a overexpressed in brain tumors. Cancer Res. 1999;59(11)2570–2576. [PubMed]
QianLW, XieJ, YeF. Kaposi’s sarcoma-associated herpesvirus infection promotes invasion of primary human umbilical vein endothelial cells by inducing matrix metalloproteinases. J Virol. 2007;81(13)7001–7010. [CrossRef] [PubMed]
SankaK, MaddalaR, EpsteinDL. Influence of actin cytoskeletal integrity on matrix metalloproteinase-2 activation in cultured human trabecular meshwork cells. Invest Ophthalmol Vis Sci. 2007;48(5)2105–2114. [CrossRef] [PubMed]
ConleySM, BruhnRL, MorganPV. Selenium’s effects on MMP-2 and TIMP-1 secretion by human trabecular meshwork cells. Invest Ophthalmol Vis Sci. 2004;45(2)473–479. [CrossRef] [PubMed]
AiharaM, LindseyJD, WeinrebRN. Effect on diurnal intraocular pressure variation of eliminating the alpha-2 adrenergic receptor subtypes in the mouse. Invest Ophthalmol Vis Sci. 2008;49:929–933. [CrossRef] [PubMed]
KhasigovPZ, PodobedOV, GrachevaTS, SalbievKD, GrachevSV, BerezovTT. Role of matrix metalloproteinases and their inhibitors in tumor invasion and metastasis. Biochemistry (Mosc). 2003;68:711–717. [CrossRef] [PubMed]
PauschingerM, ChandrasekharanK, SchultheissJP. Myocardial remodeling in viral heart disease: possible interactions between inflammatory mediators and MMP-TIMP system. Heart Fail Rev. 2004;9:21–31. [CrossRef] [PubMed]
SteinmetzEF, BuckleyC, ShamesML, et al. Treatment with simvastatin suppresses the development of experimental abdominal aortic aneurysms in normal and hypercholesterolemic mice. Ann Surg. 2005;241:92–101. [PubMed]
WoessnerJF. MMPs and TIMPs: an historical perspective. Methods Mol Biol. 2001;151:8–11.
EgawaN, KoshikawaN, TomariT, NabeshimaK, IsobeT, SeikiM. Membrane type 1 matrix metalloproteinase (MT1-MMP/MMP-14) cleaves and releases a 22-kDa extracellular matrix metalloproteinase inducer (EMMPRIN) fragment from tumor cells. J Biol Chem. 2006;281(49)37576–37585. [CrossRef] [PubMed]
MiyamoriH, TakinoT, KobayashiY, et al. Claudin promotes activation of pro-matrix metalloproteinase-2 mediated by membrane-type matrix metalloproteinases. J Biol Chem. 2001;276(30)28204–28211. [CrossRef] [PubMed]
OverallCM, TamE, McQuibbanGA, et al. Domain interactions in the gelatinase A. TIMP-2.MT1-MMP activation complex: the ectodomain of the 44-kDa form of membrane type-1 matrix metalloproteinase does not modulate gelatinase A activation. J Biol Chem. 2000;275(50)39497–39506. [CrossRef] [PubMed]
MorrisonCJ, ButlerGS, BiggHF, RobertsCR, SolowayPD, OverallCM. Cellular activation of MMP-2 (gelatinase A) by MT2-MMP occurs via a TIMP-2-independent pathway. J Biol Chem. 2001;276(50)47402–47410. [CrossRef] [PubMed]
MorrisonCJ, OverallCM. TIMP independence of matrix metalloproteinase (MMP)-2 activation by membrane type 2 (MT2)-MMP is determined by contributions of both the MT2-MMP catalytic and hemopexin C domains. J Biol Chem. 2006;281(36)26528–26539. [CrossRef] [PubMed]
KnäuperV, BaileyL, WorleyJR, SolowayP, PattersonML, MurphyG. Cellular activation of proMMP-13 by MT1-MMP depends on the C-terminal domain of MMP-13. FEBS Lett. 2002;532(1–2)127–130. [CrossRef] [PubMed]
LafleurMA, HollenbergMD, AtkinsonSJ, KnäuperV, MurphyG, EdwardsDR. Activation of pro-(matrix metalloproteinase-2) (pro-MMP-2) by thrombin is membrane-type-MMP-dependent in human umbilical vein endothelial cells and generates a distinct 63 kDa active species. Biochem J. 2001;357:107–115. [CrossRef] [PubMed]
KnäuperV, WillH, López-OtinC, et al. Cellular mechanisms for human procollagenase-3 (MMP-13) activation: evidence that MT1-MMP (MMP-14) and gelatinase a (MMP-2) are able to generate active enzyme. J Biol Chem. 1996;271(29)17124–17131. [CrossRef] [PubMed]
HosseiniM, RoseAY, SongK, et al. IL-1 and TNF induction of matrix metalloproteinase-3 by c-Jun N-terminal kinase in trabecular meshwork. Invest Ophthalmol Vis Sci. 2006;47(4)1469–1476. [CrossRef] [PubMed]
AlexanderJP, AcottTS. Involvement of the Erk-MAP kinase pathway in TNFalpha regulation of trabecular matrix metalloproteinases and TIMPs. Invest Ophthalmol Vis Sci. 2003;44(1)164–169. [CrossRef] [PubMed]
AlexanderJP, AcottTS. Involvement of protein kinase C in TNFalpha regulation of trabecular matrix metalloproteinases and TIMPs. Invest Ophthalmol Vis Sci. 2001;42(12)2831–2838. [PubMed]
AlexanderJP, SamplesJR, Van BuskirkEM, AcottTS. Expression of matrix metalloproteinases and inhibitor by human trabecular meshwork. Invest Ophthalmol Vis Sci. 1991;32(1)172–180. [PubMed]
WilhelmSM, CollierIE, KronbergerA, et al. Human skin fibroblast stromelysin: structure, glycosylation, substrate specificity, and differential expression in normal and tumorigenic cells. Proc Natl Acad Sci USA. 1987;84(19)6725–6729. [CrossRef] [PubMed]
ChanCY, ChenYS, MaMC, ChenCF. Remodeling of experimental arteriovenous fistula with increased matrix metalloproteinase expression in rats. J Vasc Surg. 2007;45:804–811. [CrossRef] [PubMed]
EnglishJL, KassiriZ, KoskivirtaI, et al. Individual TIMP deficiencies differentially impact pro-MMP-2 activation. J Biol Chem. 2006;281:10337–10346. [CrossRef] [PubMed]
OshikaT, AriaeM, SugiyamaT, NakajimaM, AzumaI. Effect of bunazosin hydrochloride on intraocular pressure and aqueous humor dynamics in normotensive human eyes. Arch Ophthalmol. 1991;109:1569–1574. [CrossRef] [PubMed]
AkaishiT, TakagiY, MatsugiT, IshidaN, HaraH, KashiwagiK. Effects of bunazosin hydrochloride on ciliary muscle constriction and matrix metalloproteinase activities. J Glaucoma. 2004;13:312–318. [CrossRef] [PubMed]
Figure 1.
 
The mRNA transcripts of α2A, α2B, and α2C in human CB tissue and CBSM cells and Western blot analysis of protein extracted from CBSM cells and CB tissue for α2A. (A) Results of RT-PCR for mRNA of α2-adrenergic receptor subtypes, α2A, α2B, and α2C from CBSM cells and CB tissue isolated from a 56-year-old donor, showing single bands corresponding to expected sizes of 232, 612, and 573 bp, respectively. The ôX174 RF DNA/HaeIII ladder was used. Lanes correspond to blank (*), negative control (PCR only: lanes 1, 3, 6, 8, 9, and 11) and RT-PCR of CBSM cells for α2A (lane 2), α2B (lane 5), and α2C (lane 10), as well as of CB tissue (lanes 4, 7, and 12). (B) Western blot of protein extracted from CBSM cells and CB tissue for α2A at ∼64 kDa. Lanes correspond to blank (*), 10 μg of protein from CB tissue (lane 1) and CBSM cells (lane 3) and 50 μg of protein from CBSM cells (lane 2) and CB tissue (lane 4) incubated with both primary and secondary antibodies. α2A protein from CB tissue was detected at a much lower level than from CBSM cells.
Figure 1.
 
The mRNA transcripts of α2A, α2B, and α2C in human CB tissue and CBSM cells and Western blot analysis of protein extracted from CBSM cells and CB tissue for α2A. (A) Results of RT-PCR for mRNA of α2-adrenergic receptor subtypes, α2A, α2B, and α2C from CBSM cells and CB tissue isolated from a 56-year-old donor, showing single bands corresponding to expected sizes of 232, 612, and 573 bp, respectively. The ôX174 RF DNA/HaeIII ladder was used. Lanes correspond to blank (*), negative control (PCR only: lanes 1, 3, 6, 8, 9, and 11) and RT-PCR of CBSM cells for α2A (lane 2), α2B (lane 5), and α2C (lane 10), as well as of CB tissue (lanes 4, 7, and 12). (B) Western blot of protein extracted from CBSM cells and CB tissue for α2A at ∼64 kDa. Lanes correspond to blank (*), 10 μg of protein from CB tissue (lane 1) and CBSM cells (lane 3) and 50 μg of protein from CBSM cells (lane 2) and CB tissue (lane 4) incubated with both primary and secondary antibodies. α2A protein from CB tissue was detected at a much lower level than from CBSM cells.
Figure 2.
 
Immunofluorescent staining of ciliary processes obtained from an 81-year-old donor eye with antibodies against α2A (A) and α-smooth muscle actin (B). There was strong staining within the epithelium with a diffuse signal pattern within the stroma. The pattern of staining within the CB stroma shows some overlap with smooth muscle cells, rather than being isolated to blood vessels (C). A negative control with a 2° antibody only demonstrated no stain (D). Scale bar, 40 μm.
Figure 2.
 
Immunofluorescent staining of ciliary processes obtained from an 81-year-old donor eye with antibodies against α2A (A) and α-smooth muscle actin (B). There was strong staining within the epithelium with a diffuse signal pattern within the stroma. The pattern of staining within the CB stroma shows some overlap with smooth muscle cells, rather than being isolated to blood vessels (C). A negative control with a 2° antibody only demonstrated no stain (D). Scale bar, 40 μm.
Figure 3.
 
Immunofluorescent staining of ciliary processes obtained from a 61-year-old donor eye with antibodies against α2A (D) and F-actin (E). α2A shows strong staining within the epithelium with a pattern of bands within the stroma. F-actin shows an even staining pattern with a pattern of actin filaments within the stroma. The staining pattern of α2A within the CB stroma shows a very low level of overlap with F actin filaments (F) and strong overlap with the ciliary epithelium. (A, rectangle) The approximately site shown in (CF). A negative control with a 2° antibody demonstrated no stain (B). Scale bar: (A) 200 μm; (BF) 20 μm.
Figure 3.
 
Immunofluorescent staining of ciliary processes obtained from a 61-year-old donor eye with antibodies against α2A (D) and F-actin (E). α2A shows strong staining within the epithelium with a pattern of bands within the stroma. F-actin shows an even staining pattern with a pattern of actin filaments within the stroma. The staining pattern of α2A within the CB stroma shows a very low level of overlap with F actin filaments (F) and strong overlap with the ciliary epithelium. (A, rectangle) The approximately site shown in (CF). A negative control with a 2° antibody demonstrated no stain (B). Scale bar: (A) 200 μm; (BF) 20 μm.
Figure 4.
 
Representative immunoblots of culture medium or cell lysates from human CBSM cells for MMPs and TIMPs. (A) Interstitial collagenase (MMP-1) was present at molecular masses of 52 38 39 40 and 57 kDa, corresponding to unglycosylated and glycosylated forms of pro-MMP-1. Gelatinase A (MMP-2) was identified at 72 kDa 41 corresponding to the pro forms of MMP-2. Stromelysin-1 (MMP-3) was present at 57 38 and 59 kDa, 42 43 corresponding to unglycosylated and glycosylated forms of pro-MMP-3, respectively. MT5-MMP (MMP-24) was identified at 64 kDa 44 corresponding to pro-MMP-24. (B) TIMPs-1, -2, and -3 yielded single bands at molecular masses of 28, 21, and 27 kDa, respectively, from conditioned medium. C represents control sample; 1× and 10× represent samples incubated with 45 and 450 nM of brimonidine tartrate, respectively, for 24 hours.
Figure 4.
 
Representative immunoblots of culture medium or cell lysates from human CBSM cells for MMPs and TIMPs. (A) Interstitial collagenase (MMP-1) was present at molecular masses of 52 38 39 40 and 57 kDa, corresponding to unglycosylated and glycosylated forms of pro-MMP-1. Gelatinase A (MMP-2) was identified at 72 kDa 41 corresponding to the pro forms of MMP-2. Stromelysin-1 (MMP-3) was present at 57 38 and 59 kDa, 42 43 corresponding to unglycosylated and glycosylated forms of pro-MMP-3, respectively. MT5-MMP (MMP-24) was identified at 64 kDa 44 corresponding to pro-MMP-24. (B) TIMPs-1, -2, and -3 yielded single bands at molecular masses of 28, 21, and 27 kDa, respectively, from conditioned medium. C represents control sample; 1× and 10× represent samples incubated with 45 and 450 nM of brimonidine tartrate, respectively, for 24 hours.
Figure 5.
 
Effect of brimonidine on MMP-9 and TIMP-4 expression levels in CBSM cells. (A) Representative immunoblot for MMP-9 expression level from a 45 year old donor. Gelatinase B (MMP-9) was identified at 92 kDa. 42 Densitometric analysis of five independent donors revealed that the pharmacologic dose (45 nM) of brimonidine produced a statistically significant increase (116% ± 34%) in pro-MMP-9. (B) Representative immunoblot for TIMP-4 expression level from a 40 year old donor. TIMP-4 yielded a 29-kDa single band. A statistically significant decrease (25% ± 8%) in TIMP-4 in response to 45 nM of brimonidine and a further dose-dependent decrease (38% ± 13%) at 450 nM of brimonidine from five separate donors. (C) Representative immunoblot for TIMP-4 expression level in the cell lysates from a 44-year-old donor. Densitometric analysis showed that pharmacologic dose (45 nM) of brimonidine produced a statistically significant increase (70% ± 13%) in TIMP-4. Data are the mean ± SEM of normalized densitometry measurements (n = 5). *Significant at P < 0.05 vs. control. C represents control sample; 1× and 10× represent samples incubated with 45 and 450 nM of brimonidine tartrate, respectively, for 24 hours.
Figure 5.
 
Effect of brimonidine on MMP-9 and TIMP-4 expression levels in CBSM cells. (A) Representative immunoblot for MMP-9 expression level from a 45 year old donor. Gelatinase B (MMP-9) was identified at 92 kDa. 42 Densitometric analysis of five independent donors revealed that the pharmacologic dose (45 nM) of brimonidine produced a statistically significant increase (116% ± 34%) in pro-MMP-9. (B) Representative immunoblot for TIMP-4 expression level from a 40 year old donor. TIMP-4 yielded a 29-kDa single band. A statistically significant decrease (25% ± 8%) in TIMP-4 in response to 45 nM of brimonidine and a further dose-dependent decrease (38% ± 13%) at 450 nM of brimonidine from five separate donors. (C) Representative immunoblot for TIMP-4 expression level in the cell lysates from a 44-year-old donor. Densitometric analysis showed that pharmacologic dose (45 nM) of brimonidine produced a statistically significant increase (70% ± 13%) in TIMP-4. Data are the mean ± SEM of normalized densitometry measurements (n = 5). *Significant at P < 0.05 vs. control. C represents control sample; 1× and 10× represent samples incubated with 45 and 450 nM of brimonidine tartrate, respectively, for 24 hours.
Figure 6.
 
Representative zymograms of MMPs from the conditioned culture medium of human CBSM cells. (A) Two bands were observed in the casein zymographs corresponding to the latent (52 kDa) and intermediate (48 kDa) forms of MMP-1. 45 Intermediate MMP-1 is 200% more active than the pro-MMP-1 (P < 0.01). (B) Four major bands were observed in the gelatin zymographs corresponding to the latent (72 kDa) and active (66 kDa) forms of MMP-2 46 47 and the latent (92 kDa) and active (88 kDa) forms of MMP-9 (C). C represents control sample; 1× and 10× represent samples incubated with 45 and 450 nM of brimonidine tartrate, respectively, for 24 hours.
Figure 6.
 
Representative zymograms of MMPs from the conditioned culture medium of human CBSM cells. (A) Two bands were observed in the casein zymographs corresponding to the latent (52 kDa) and intermediate (48 kDa) forms of MMP-1. 45 Intermediate MMP-1 is 200% more active than the pro-MMP-1 (P < 0.01). (B) Four major bands were observed in the gelatin zymographs corresponding to the latent (72 kDa) and active (66 kDa) forms of MMP-2 46 47 and the latent (92 kDa) and active (88 kDa) forms of MMP-9 (C). C represents control sample; 1× and 10× represent samples incubated with 45 and 450 nM of brimonidine tartrate, respectively, for 24 hours.
Table 1.
 
Oligonucleotide Primer Sequences Used for RT-PCR
Table 1.
 
Oligonucleotide Primer Sequences Used for RT-PCR
Subtype Primer Sequences Expected Band Size (bp)
α2A F: CTCTTCCTGGTGTCTCTGGC 232
R: GGTTGTACTCGATGGCCTGT
α2B F: CCTGGCCTCCAGCATCGGAT 612
R: ATGACCACAGCCAGCACGAA
α2C F: GTGGTGATCGCCGTGCTGAC 573
R: CGTTTTCGGTAGTCGGGGAC
Table 2.
 
Primary Antibodies and Dilutions Used for Western Blot Analysis
Table 2.
 
Primary Antibodies and Dilutions Used for Western Blot Analysis
Antibodies Manufacturer Dilution Identified Band (kDa)
α2A (P) Genex Bioscience 1:5,000 49
MMP-1 (M) R&D Systems* 1:1,000 52, 57
MMP-2 (M) R&D Systems 1:1,000 72
MMP-3 (P) Chemicon 1:1,000 57, 59
MMP-9 (P) Chemicon 1:1,000 92
MMP-24 (P) Chemicon 1:1,000 64
TIMP-1 (P) Chemicon 1:20K 28
TIMP-2 (P) Chemicon 1:2,000 21
TIMP-3 (P) Calbiochem 1:200 27
TIMP-4 (P) Chemicon 1:7,000 29
GAPDH (P) R&D Systems 1:20–40K 36
Table 3.
 
Changes in MMP and TIMP Expression in Response to 24-Hour Incubation with 45 and 450 nM Brimonidine
Table 3.
 
Changes in MMP and TIMP Expression in Response to 24-Hour Incubation with 45 and 450 nM Brimonidine
Protein 45 nM of Brimonidine (% of Control) 450 nM of Brimonidine (% of Control)
Pro-MMP-1 1 ± 21 10 ± 28
Pro-MMP-2 8 ± 8 23 ± 10
Pro-MMP-3 15 ± 24 25 ± 26
Pro-MMP-9 116 ± 34* 25 ± 9
MMP-24 (lysates) −13 ± 5 6 ± 13
Intermediate MMP-1 6 ± 4 7 ± 4
Active MMP-2 −3 ± 1 −4 ± 2
Active MMP-9 −1 ± 5 −2 ± 5
TIMP-1 23 ± 28 9 ± 23
TIMP-2 −3 ± 7 19 ± 19
TIMP-3 21 ± 32 15 ± 25
TIMP-4 −25 ± 8* −38 ± 13*
TIMP-4 (lysates) 70 ± 13* 39 ± 26
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×