October 2011
Volume 52, Issue 11
Free
Genetics  |   October 2011
Association of Genetic Variation on Chromosome 9p21 with Polypoidal Choroidal Vasculopathy and Neovascular Age-Related Macular Degeneration
Author Affiliations & Notes
  • Xiongze Zhang
    From the State Key Laboratory of Ophthalmology, Zhongshan Ophthalmic Center, Sun Yat-sen University, Guangzhou, China.
  • Feng Wen
    From the State Key Laboratory of Ophthalmology, Zhongshan Ophthalmic Center, Sun Yat-sen University, Guangzhou, China.
  • Chengguo Zuo
    From the State Key Laboratory of Ophthalmology, Zhongshan Ophthalmic Center, Sun Yat-sen University, Guangzhou, China.
  • Meng Li
    From the State Key Laboratory of Ophthalmology, Zhongshan Ophthalmic Center, Sun Yat-sen University, Guangzhou, China.
  • Hui Chen
    From the State Key Laboratory of Ophthalmology, Zhongshan Ophthalmic Center, Sun Yat-sen University, Guangzhou, China.
  • Kunfang Wu
    From the State Key Laboratory of Ophthalmology, Zhongshan Ophthalmic Center, Sun Yat-sen University, Guangzhou, China.
  • Corresponding author: Feng Wen, State Key Laboratory of Ophthalmology, Zhongshan Ophthalmic Center, Sun Yat-sen University, 54 South Xianlie Road, Guangzhou, 510060, China; wenfeng208@yahoo.com.cn
Investigative Ophthalmology & Visual Science October 2011, Vol.52, 8063-8067. doi:10.1167/iovs.11-7820
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Xiongze Zhang, Feng Wen, Chengguo Zuo, Meng Li, Hui Chen, Kunfang Wu; Association of Genetic Variation on Chromosome 9p21 with Polypoidal Choroidal Vasculopathy and Neovascular Age-Related Macular Degeneration. Invest. Ophthalmol. Vis. Sci. 2011;52(11):8063-8067. doi: 10.1167/iovs.11-7820.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

Purpose.: Polypoidal choroidal vasculopathy (PCV) contains aneurismal morphologic and histopathologic feature and it is considered to be a possible distinct entity from neovascular age-related macular degeneration (AMD). In this study, the association of identified risk variants for intracranial aneurysm on chromosome 9p21 with PCV and neovascular AMD in a Chinese Han population was investigated.

Methods.: The authors genotyped rs1333040 and rs10757278 on 9p21 in 177 PCV patients, 131 neovascular AMD patients, and 182 controls using a genotyping method and direct DNA sequencing. Allele and genotypes frequencies in the PCV and neovascular AMD groups were compared with controls using a free open-source software and binary logistic regression analysis.

Results.: Rs1333040 was not associated with PCV or neovascular AMD. Rs10757278 was significantly associated with PCV [risk allele: A, P (allelic) = 0.014; odds ratio = 1.44; 95% confidence interval, 1.08–1.94], but not associated with neovascular AMD. After adjusting for sex, age, smoking status, history of hypertension, type 2 diabetes, and coronary artery disease, the odds ratio for homozygous carriers of rs10757278-A was 2.10 (95% confidence interval, 1.14–3.85) for PCV.

Conclusions.: The rs10757278 on chromosome 9p21 is significantly associated with the risk of PCV but not with neovascular AMD in the Chinese Han population.

Polypoidal choroidal vasculopathy (PCV) is a form of serosanguineous maculopathy found in a significant proportion of Asian patients. 1 3 It is characterized by an abnormal choroidal vascular network with characteristic aneurismal dilations at the border of the vascular network. 4 6 Patients with PCV frequently suffer multiple recurrent serous and hemorrhagic detachments of the retinal pigment epithelium (RPE). 4 Indocyanine green angiography (ICGA) can be used to make a definitive diagnosis of PCV. The widespread availability of ICGA has helped us to recognize PCV as a possible distinct clinical entity from age-related macular degeneration (AMD) both clinically and demographically. 4,7 An advanced stage of AMD is characterized by choroidal neovascularization (neovascular AMD, nAMD) or geographic atrophy. The choroidal neovascularization of nAMD appears in the macular area leading to subretinal hemorrhages, serous retinal detachments, fibrous scars and/or RPE atrophy. 8 There are two different perspectives about the nature of PCV lesions regarding the variants of choroidal neovascularization 9,10 and abnormalities of the inner choroidal vessels. 11,12 However, the differences between the pathogeneses of PCV and nAMD are still unknown. 
The dilations of PCV are seen as reddish-orange lesions ophthalmoscopically, and they are clearly visible as aneurismal hyperfluorescence during the early-phase of ICGA. 13,14 Pulsation of the vascular dilations is a unique and important characteristic of PCV. 12,15,16 The pulsatile movement is also observed in some arterial aneurysms, including retinal macroaneurysms. 17,18 Histopathologic findings demonstrate notable sclerotic changes in PCV lesions and disruption of the elastic layer within the wall of polypoidal vessels, 11,19 which is known to decrease the elasticity and strength of the vascular wall leading to aneurysm formation. 20,21 Moreover, the elastin gene has also been reported to be associated with both intracranial aneurysm 22 and PCV. 23 Though the precise etiology of PCV is still undetermined, the aneurismal morphologic and histopathologic features of PCV suggest its possible association with aneurysm. Intracranial aneurysm and PCV both originate from branches of the internal carotid artery and are likely to share some predisposing factors. The chromosome 9p21 is well known to be associated with coronary artery disease 24 26 and type 2 diabetes. 27 29 Recently, two single nucleotide polymorphisms (SNPs) on 9p21 (rs1333040 and rs10757278) associated with intracranial aneurysm were identified by a multinational, genome-wide association study. 30 The association of intracranial aneurysm with rs10757278-G was replicable in many populations, 31 33 while the association of intracranial aneurysm with rs1333040-T was confirmed in Japanese 34 and other populations 32 as well. We hypothesized that these two SNPs might play a role in the susceptibility of PCV. 
In this study, we genotyped rs1333040 and rs10757278 on 9p21 and analyzed the associations between these two SNPs and PCV in a Chinese Han population. Additionally, for comparison of PCV and nAMD, we also analyzed the associations between the two SNPs and nAMD. 
Methods
Study Population
All case and control subjects were Chinese Han individuals recruited from the Zhongshan Ophthalmic Center. The study protocol was approved by the institutional review board at the Zhongshan Ophthalmic Center of Sun Yat-sen University and was performed in accordance with the tenets of the Declaration of Helsinki. Informed consent was obtained from all study subjects that provided medical information and blood samples. All study subjects were unrelated, and they were asked about their smoking status and provided a detailed medical history. 
All PCV and nAMD patients underwent ophthalmic examinations, including visual acuity measurements, slit-lamp biomicroscopy, ophthalmoscope, color fundus photography, fluorescein angiography, and ICGA. The diagnosis of PCV was based on identification of characteristic polypoidal choroidal vascular dilations with or without branching inner choroidal vessels on ICGA. Thus, all PCV patients enrolled in this study met the criteria of definitive cases of PCV, as proposed by the Japanese Study Group of PCV. 35 Cases diagnosed as probable 35 were excluded because they were difficult to distinguish from AMD cases. The diagnosis of nAMD was based on identification of choroidal neovascularization by fluorescein angiography and ICGA. All nAMD cases were classified as stage 4 by the Rotterdam Study classification. 36 Geographic atrophy, another advanced form of AMD, was excluded from this study. Moreover, patients with other neovascularized maculopathies, such as pathologic myopia, angioid streaks, presumed ocular histoplasmosis, and retinal angiomatous proliferation, were excluded. 
All control subjects were aged ≥ 50 years. They all underwent ophthalmic examinations, including visual acuity measurements, slit-lamp biomicroscopy, ophthalmoscope examination, and 50° color fundus photography. Those with macular degeneration of any cause, macular changes (such as drusen or pigment abnormalities), or media opacities preventing clear visualization of the macula were excluded from the study. 
Genotyping
Collection of peripheral blood samples and extraction of genomic DNA were performed as previously described. 37 We genotyped rs1333040 and rs10757278 on 9p21 with a genotyping system (Multiplex SNaPshot system; Applied Biosystems, Foster City, CA) using a genetic analyzer (ABI 3730XL; Applied Biosystems). Genotypes of the SNPs were determined using software (Genemapper v4.1; Applied Biosystems). The sequences of primers used for each SNP are provided in Table 1. To confirm the accuracy of the genetic analysis method (Multiplex SNaPshot), randomly selected subjects (10% of all samples) were analyzed by direct sequencing (Shanghai Generay Biotech Co., Ltd., China). All the primers used for direct sequencing are available on request. 
Table 1.
 
Primers for SNPs
Table 1.
 
Primers for SNPs
SNP Primers Extension Primer
rs1333040 F: TCATTCAAGAGAGACAGGAGG TTTTTTTTTTTAGGGTCAGAGGTAAGAATG
R: GAGCCACTGTTGTAGTATACC
rs10757278 F: TAGTTGGAACTGAACTGAGGC TTTTTTTTTTTTTTTTTTTGGGTGTGGTCATTCCGGTA
R: CTACTCTGTCTTGATTCTGC
Statistical Analysis
Differences in baseline characteristics between cases and controls were assessed using the unpaired Student's t-test for means and χ2 tests for proportions, with statistical software (SPSS 13.0 for Windows; SPSS Inc., Chicago, IL). Deviations from the Hardy-Weinberg equilibrium were tested using the exact test implemented in the open-source software package (PLINK v1.07; http://pngu.mgh.harvard.edu/∼purcell/plink/index.shtml). The minor allele frequency was calculated based on all the case and control subjects. Allele frequencies between cases and controls were evaluated for each SNP using the χ2 test (implemented in PLINK). For the genotypic additive model we used the logistic option (in PLINK), which provided a test based on logistic regression; for the dominant and recessive model we used the model option (in PLINK), which provided a χ2 test. The odds ratio (OR) and corresponding 95% confidence interval (CI) were calculated relative to the major allele and the wild type homozygote. Binary logistic regression analysis in computer software (SPSS 13.0 for Windows; SPSS Inc.) was used to estimate the adjusted genotype-specific odds ratio and 95% CIs with adjustment for sex, age, smoking status, history of hypertension, type 2 diabetes, and coronary artery disease. Power calculation of single association was performed using software (PGA; Power for Genetic Association Analyses). 38 The Bonferroni correction was used to control inflation of the type I error rate, where a value of P < 0.025 was considered statistically significant. 
Results
A total of 490 subjects were enrolled in this study, including 177 patients with PCV, 131 patients with nAMD, and 182 control individuals. The baseline characteristics of the study groups, including sex, age, smoking status, history of hypertension, type 2 diabetes, and coronary artery disease are summarized in Table 2. The mean age of the PCV group (65 ± 8.45 years) was significantly lower than the control group (68 ± 9.17 years) (P < 0.001). The proportion of subjects with a history of hypertension in the nAMD group (33.6%) was significantly higher than that in the control group (20.9%) (P = 0.012). Meanwhile, the proportion of subjects with a history of coronary artery disease in the nAMD group (8.4%) was significantly higher than the control group (1.6%) (P = 0.004). Other baseline characteristics assessed in the PCV group and nAMD group showed no statistical differences when compared with the control group. 
Table 2.
 
Baseline Characteristics of the Study Subjects
Table 2.
 
Baseline Characteristics of the Study Subjects
Characteristics Control (n = 182) PCV (n = 177)* nAMD (n = 131)*
Female sex, n (%) 69 (37.9) 60 (33.9)† 47 (35.9)†
Age, mean ± SD (range), y 68 ± 9.17 (50–87) 65 ± 8.45 (42–85)‡ 67 ± 9.46 (46–84)†
Smoker, n (%) 62 (34.1) 71 (40.1)† 48 (36.6)†
Hypertension, n (%) 38 (20.9) 48 (27.1)† 44 (33.6)§
Type 2 diabetes, n (%) 10 (5.5) 11 (6.2)† 12 (9.2)†
Coronary artery disease, n (%) 3 (1.6) 8 (4.5)† 11 (8.4)‡
Genotyping call rates were 100% for both SNPs across patients and controls. Genotypes of the replicate samples were confirmed by direct sequencing with a consensus rate of 100%. The genotyping data of rs1333040 and rs10757278 on chromosome 9p21 did not show any significant deviations from Hardy-Weinberg equilibrium tests in each group (Table 3). The minor allele frequencies in each group are summarized in Table 3. Rs10757278 was found to be significantly associated with PCV [P (allelic) = 0.014; risk allele A: 52.8% in PCV versus 43.7% in control], but lacked association with nAMD [P (allelic) = 0.118; risk allele A: 50.0% in nAMD versus 43.7% in control]. Rs1333040 exhibited no association with PCV or nAMD. The genotype-specific effects of the SNPs in PCV and nAMD are summarized in Table 4. Rs10757278 remained significantly associated with PCV in an additive model and a recessive model [P (genotypic) = 0.016 and 0.018, respectively], but not in a dominant model [P (genotypic) = 0.108]. After adjusting for sex, age, smoking status, history of hypertension, type 2 diabetes, and coronary artery disease, we estimated the odds ratios for homozygous and heterozygous carriers of the risk allele A of rs10757278 to be, respectively, 2.10 [95% CI, 1.14–3.85; P = 0.017] and 1.17 [95% CI, 0.70–1.96; P = 0.560] for PCV. Rs10757278 in nAMD and rs1333040 in PCV or nAMD exhibited no significant genotype-specific effects. In the power analysis, given minor allele frequencies and sample sizes, we obtained > 75% statistical power for all the detections of associations (Table 4) with genotype relative risks at 1.01 and 2.00, disease prevalence of 0.56% for nAMD 39 and 0.14% for PCV, 2,39 respectively, and a false positive rate of 5%, under a codominant model with two degrees of freedom. 
Table 3.
 
Association between Minor Allele Frequency of Variants on 9p21 and PCV and nAMD
Table 3.
 
Association between Minor Allele Frequency of Variants on 9p21 and PCV and nAMD
SNP Position (bp) Population Minor Allele* MAF HWE OR (95% CI) P Allelic
rs1333040 22073404 Control C 0.297 0.213
PCV 0.348 0.869 1.26 (0.92–1.73) 0.146
nAMD 0.344 0.563 1.24 (0.88–1.74) 0.215
rs10757278 22114477 Control A 0.437 0.881
PCV 0.528 0.452 1.44 (1.08–1.94) 0.014
nAMD 0.500 1.000 1.29 (0.94–1.77) 0.118
Table 4.
 
Association between Genotype of Variants on 9p21 and PCV and nAMD
Table 4.
 
Association between Genotype of Variants on 9p21 and PCV and nAMD
Disease SNP P Genotypic Genotype Genotype Distribution (%) OR (95% CI) P Adjusted OR (95% CI)* Adjusted P * Statistical Power (%)†
Model Value Control Case
PCV rs1333040 Additive 0.138 TT 47.3 42.9 1 1
Dominant 0.411 CT‡ 46.2 44.6 1.06 (0.69–1.65) 0.779 1.10 (0.70–1.73) 0.691
Recessive 0.059 CC‡ 6.6 12.4 2.08 (0.96–4.47) 0.063 2.03 (0.92–4.46) 0.079
0.140§ 83.9
PCV rs10757278 Additive 0.016 GG 31.3 23.7 1 1
Dominant 0.108 AG‡ 50.0 46.9 1.24 (0.75–2.04) 0.400 1.17 (0.70–1.96) 0.560
Recessive 0.018 AA‡ 18.7 29.4 2.08 (1.15–3.74) 0.015 2.10 (1.14–3.85) 0.017
0.019§ 82.6
nAMD rs1333040 Additive 0.207 TT 47.3 44.3 1 1
Dominant 0.602 CT‡ 46.2 42.7 0.99 (0.62–1.59) 0.962 1.03 (0.62–1.69) 0.912
Recessive 0.055 CC‡ 6.6 13.0 2.10 (0.93–4.72) 0.073 2.32 (0.99–5.36) 0.050
0.137§ 77.5
nAMD rs10757278 Additive 0.118 GG 31.3 25.2 1 1
Dominant 0.237 AG‡ 50.0 49.6 1.24 (0.72–2.10) 0.441 1.29 (0.74–2.67) 0.371
Recessive 0.166 AA‡ 18.7 25.2 1.68 (0.88–3.19) 0.115 1.94 (0.99–3.79) 0.054
0.056§ 75.8
Discussion
PCV and nAMD have common associations with the complement factor H (CFH) and the HtrA serine peptidase 1 (HTRA1) genes, 40,41 which suggests some genetic similarity between these two entities. Given the differences in the clinical presentation between PCV and nAMD, several studies 7 focused on determining other genetic components of these two entities to find out if these two different phenotypes can be attributed to differences in genetic components that may reveal different underlying pathogenic mechanisms. In our previous study, 37 we investigated the serpin peptidase inhibitor, clade G, member 1 (SERPING1) gene in PCV. The SERPING1 gene, whose protein product is a key regulator of the classic complement pathway, was reported to be associated with AMD. 42 However, we did not find any association between its four tag SNPs and PCV in the Chinese Han population. Complement factor 2 (C2) and factor B (CFB) genes also have associations with nAMD, but not with PCV in Chinese population. 40 These findings may indicate a different role for the complement system in pathogenesis of PCV and nAMD. The elastin gene, as mentioned above, is associated with both intracranial aneurysm and PCV, but it is not associated with nAMD. 23 In this Chinese Han population study, we identified the association between rs10757278 on 9p21 and PCV, and we demonstrated that rs10757278, another genetic variant strongly associated with intracranial aneurysm, affected the susceptibility of PCV and nAMD differently. The result that rs10757278 was not associated with nAMD in our study is consistent with the AMD genetic study by Haas et al. 43 in a Caucasian Austrian population. Combined with the aneurismal morphologic and histopathologic features of PCV lesions, our results provide new evidence to bring the nature of PCV a little closer to that of intracranial aneurysm from the basis of nAMD. The genome-wide association studies for AMD have led to substantial discoveries, 44 but PCV is not isolated from these cohorts by ICGA and investigated separately. It will help rectify the misclassification bias of association results and explain the different pathogenic mechanisms to treat PCV and nAMD separately, especially in Asian cohorts. 
PCV is a common disease in the elderly Chinese population, amounting to 24.5% of patients suspected of having nAMD. 2 We estimated the OR for homozygous carriers of rs10757278-A to be moderate at 2.10 for PCV. However, because the risk allele is very common in the Chinese Han population, it contributes substantially to the susceptibility of PCV. Despite these results, it seems that rs10757278 is not the driving force behind PCV. The HapMap data demonstrate that the frequencies of rs10757278-A are 53% and 50% in Han Chinese in Beijing (CHB) and United States residents with ancestry from northern and western Europe (CEU), respectively. However, PCV is relatively uncommon in Americans, only amounting to 7.8% of patients suspected of having nAMD. 5 Although the association of rs10757278 and PCV in Caucasians is unknown, the ethnic difference of PCV incidence may not be interpreted by the rs10757278 variant. 
Besides the PCV association shown in this study and intracranial aneurysm mentioned above, rs10757278 on the 9p21 interval is also reported to be associated with coronary artery disease, 24,31 ischemic stroke, 45 and abdominal aortic aneurysm. 31 Coronary artery disease, ischemic stroke, and abdominal aortic aneurysm are closely related to atherosclerosis, which is characterized by accumulation of lipids, inflammatory cells, calcium, and necrosis within the walls of large and medium sized arteries, forming atherosclerotic plaque. 46 The plaques may then encroach the lumen of arteries gradually and slow down the blood flow, or the plaques may rupture, forming a thrombus that suddenly blocks arterial blood flow. The arterial wall may also develop degenerative changes, leading to localized dilatation or aneurysm. However, there is no evidence that PCV and intracranial aneurysm have a relationship with atherosclerosis. PCV and intracranial aneurysm are somewhat similar histopathologically. Intracranial aneurysm, located at an arterial bifurcation, has a thin media or none at all, and the internal elastic lamina is either absent or severely fragmented. 47 PCV, which mostly involves choroidal arterioles, is characterized by the disrupted inner elastic layer in the sclerotic arteriolar wall. 19 Helgadottir et al. 31 studied the effects of the rs10757278 variant on five arterial diseases, including coronary artery disease, abdominal aortic aneurysm, intracranial aneurysm, peripheral arterial disease, and large artery atherosclerotic or cardiogenic stroke combined, indicating that the variant had a role in a pathophysiological component common to these arterial phenotypes. This component might involve abnormal vascular remodeling and/or repair rather than atherosclerosis. Chromosome 9p21 “risk” interval is devoid of protein-coding genes. It does overlap a large noncoding RNA termed antisense noncoding RNA, in the INK locus. The 9p21 interval lies adjacent to a cluster of cell-cycle regulating genes, including cyclin-dependent kinase inhibitor 2A and 2B (CDKN2A and CDKN2B). Visel et al. 48 deleted a 70 kb noncoding region on mouse chromosome 4, which is orthologous to the human 9p21 risk interval, and observed markedly decreased expression levels of CDKN2A and CDNK2B in the mutant mice and doubling of the proliferative capacity of mutant aortic smooth muscle cells in culture. These results indicate that the 9p21 risk interval regulates vascular cell proliferation and senescence, and it confirms the presumption put forth in the study by Helgadottir et al., 31 implying that the 9p21 risk interval, including rs10757278, is pivotal for vascular remodeling and/or repair. Thus, the sequence variant rs10757278 on 9p21 may function as a genetic determinant of the tissue response to unfavorable conditions that impact choroidal vasculature, attributing to the development of abnormal choroidal vascular network and aneurismal dilations presented in PCV. Our results also suggest that the PCV pathogenesis might be partially different from nAMD. 
Intriguingly, the risk variant in our study was tagged by allele A of the SNP rs10757278 for PCV, rather than allele G known for the other associated vascular diseases previously mentioned. 24,30 33,45 This suggests that PCV and the other vascular diseases may be situated at opposite sides within the same pathophysiological process influenced by rs10757278. In our study, the patients with PCV were not susceptible to coronary artery disease. Furthermore, variants on 9p21 are reported to increase platelet aggregation on coronary artery disease and stroke, 49 but PCVs with severe thrombocytopenia have been reported. 50 The lower abdominal aorta, coronary arteries, and the circle of Willis, where abdominal aortic aneurysm, coronary artery disease, and intracranial aneurysm occur, respectively, are all large and medium sized arteries. However, PCV involves choroidal arterioles and even capillaries. 19 It is unknown whether the allele A and allele G of rs10757278 might produce the different biological effects on the vessels of certain sizes separately. Therefore, the dual role for rs10757278 on 9p21 in modulating susceptibility to vascular diseases serves to demonstrate the biological plausibility of the genetic associations uncovered here. 
The major limitation of this study is the relatively small sample size and lack of replication group. Extended cohorts with both PCV and nAMD patients offering higher statistical power will be necessary to confirm our association results. Another limitation of this study is the lack of complete survey of all tag SNPs in the 9p21 interval. Thorough investigations on 9p21 polymorphisms in PCV and nAMD susceptibility will also be required. 
In summary, we investigated rs1333040 and rs10757278, two intracranial aneurysm-associated SNPs on chromosome 9p21 in PCV and nAMD. We determined that rs1333040 was not associated with PCV or nAMD. We also determined that rs10757278 was significantly associated with PCV, but not associated with nAMD. It indicates that chromosome 9p21 might affect the susceptibility of PCV and nAMD differently. Allele A of rs10757278, rather than allele G, was shown to confer risk of PCV. Further studies with larger sample sizes are needed to confirm the association results and such an effort should also focus on a comprehensive understanding of the influence of genetic variant of 9p21 on the susceptibility of PCV and other vascular diseases. 
Footnotes
 Supported by the National Natural Science Foundation of China Grant 81070745.
Footnotes
 Disclosure: X. Zhang, None; F. Wen, None; C. Zuo, None; M. Li, None; H. Chen, None; K. Wu, None
References
Wen F Chen C Wu D Li H . Polypoidal choroidal vasculopathy in elderly Chinese patients. Graefes Arch Clin Exp Ophthalmol. 2004;242:625–629. [CrossRef] [PubMed]
Liu Y Wen F Huang S . Subtype lesions of neovascular age-related macular degeneration in Chinese patients. Graefes Arch Clin Exp Ophthalmol. 2007;245:1441–1445. [CrossRef] [PubMed]
Maruko I Iida T Saito M Nagayama D Saito K . Clinical characteristics of exudative age-related macular degeneration in Japanese patients. Am J Ophthalmol. 2007;144:15–22. [CrossRef] [PubMed]
Yannuzzi LA Sorenson J Spaide RF Lipson B . Idiopathic polypoidal choroidal vasculopathy (IPCV). Retina. 1990;10:1–8. [CrossRef] [PubMed]
Yannuzzi LA Wong DW Sforzolini BS . Polypoidal choroidal vasculopathy and neovascularized age-related macular degeneration. Arch Ophthalmol. 1999;117:1503–1510. [CrossRef] [PubMed]
Ciardella AP Donsoff IM Huang SJ Costa DL Yannuzzi LA . Polypoidal choroidal vasculopathy. Surv Ophthalmol. 2004;49:25–37. [CrossRef] [PubMed]
Laude A Cackett PD Vithana EN . Polypoidal choroidal vasculopathy and neovascular age-related macular degeneration: same or different disease? Prog Retin Eye Res. 2010;29:19–29. [CrossRef] [PubMed]
de Jong PT . Age-related macular degeneration. N Engl J Med. 2006;355:1474–1485. [CrossRef] [PubMed]
Lafaut BA Aisenbrey S Van den Broecke C Bartz-Schmidt KU Heimann K . Polypoidal choroidal vasculopathy pattern in age-related macular degeneration: a clinicopathologic correlation. Retina. 2000;20:650–654. [PubMed]
Terasaki H Miyake Y Suzuki T Nakamura M Nagasaka T . Polypoidal choroidal vasculopathy treated with macular translocation: clinical pathological correlation. Br J Ophthalmol. 2002;86:321–327. [CrossRef] [PubMed]
Okubo A Sameshima M Uemura A Kanda S Ohba N . Clinicopathological correlation of polypoidal choroidal vasculopathy revealed by ultrastructural study. Br J Ophthalmol. 2002;86:1093–1098. [CrossRef] [PubMed]
Yuzawa M Mori R Kawamura A . The origins of polypoidal choroidal vasculopathy. Br J Ophthalmol. 2005;89:602–607. [CrossRef] [PubMed]
Spaide RF Yannuzzi LA Slakter JS Sorenson J Orlach DA . Indocyanine green videoangiography of idiopathic polypoidal choroidal vasculopathy. Retina. 1995;15:100–110. [CrossRef] [PubMed]
Iida T Yannuzzi LA Freund KB . Retinal angiopathy and polypoidal choroidal vasculopathy. Retina. 2002;22:455–463. [CrossRef] [PubMed]
Okubo A Ito M Sameshima M Uemura A Sakamoto T . Pulsatile blood flow in the polypoidal choroidal vasculopathy. Ophthalmology. 2005;112:1436–1441. [CrossRef] [PubMed]
Okubo A Hirakawa M Ito M Sameshima M Sakamoto T . Clinical features of early and late stage polypoidal choroidal vasculopathy characterized by lesion size and disease duration. Graefes Arch Clin Exp Ophthalmol. 2008;246:491–499. [CrossRef] [PubMed]
Burns D Kumar V . Blood vessels. In: Kumar V Cotran R Robbins S eds. Basic Pathology. Philadelphia: WB Saunders; 1997:325–360.
Schneider U Wagner AL Kreissig I . Indocyanine green videoangiography of hemorrhagic retinal arterial macroaneurysms. Ophthalmologica. 1997;211:115–118. [CrossRef] [PubMed]
Kuroiwa S Tateiwa H Hisatomi T Ishibashi T Yoshimura N . Pathological features of surgically excised polypoidal choroidal vasculopathy membranes. Clin Experiment Ophthalmol. 2004;32:297–302. [CrossRef] [PubMed]
Miskolczi L Guterman LR Flaherty JD Hopkins LN . Saccular aneurysm induction by elastase digestion of the arterial wall: a new animal model. Neurosurgery. 1998;43:595–600, discussion 600–591. [CrossRef] [PubMed]
Anidjar S Salzmann JL Gentric D Lagneau P Camilleri JP Michel JB . Elastase-induced experimental aneurysms in rats. Circulation. 1990;82:973–981. [CrossRef] [PubMed]
Ruigrok YM Rinkel GJ . Genetics of intracranial aneurysms. Stroke. 2008;39:1049–1055. [CrossRef] [PubMed]
Kondo N Honda S Ishibashi K Tsukahara Y Negi A . Elastin gene polymorphisms in neovascular age-related macular degeneration and polypoidal choroidal vasculopathy. Invest Ophthalmol Vis Sci. 2008;49:1101–1105. [CrossRef] [PubMed]
Helgadottir A Thorleifsson G Manolescu A . A common variant on chromosome 9p21 affects the risk of myocardial infarction. Science. 2007;316:1491–1493. [CrossRef] [PubMed]
McPherson R Pertsemlidis A Kavaslar N . A common allele on chromosome 9 associated with coronary heart disease. Science. 2007;316:1488–1491. [CrossRef] [PubMed]
Samani NJ Erdmann J Hall AS . Genomewide association analysis of coronary artery disease. N Engl J Med. 2007;357:443–453. [CrossRef] [PubMed]
Zeggini E Weedon MN Lindgren CM . Replication of genome-wide association signals in UK samples reveals risk loci for type 2 diabetes. Science. 2007;316:1336–1341. [CrossRef] [PubMed]
Scott LJ Mohlke KL Bonnycastle LL . A genome-wide association study of type 2 diabetes in Finns detects multiple susceptibility variants. Science. 2007;316:1341–1345. [CrossRef] [PubMed]
Saxena R Voight BF Lyssenko V . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels. Science. 2007;316:1331–1336. [CrossRef] [PubMed]
Yasuno K Bilguvar K Bijlenga P . Genome-wide association study of intracranial aneurysm identifies three new risk loci. Nat Genet. 2010;42:420–425. [CrossRef] [PubMed]
Helgadottir A Thorleifsson G Magnusson KP . The same sequence variant on 9p21 associates with myocardial infarction, abdominal aortic aneurysm and intracranial aneurysm. Nat Genet. 2008;40:217–224. [CrossRef] [PubMed]
Deka R Koller DL Lai D . The relationship between smoking and replicated sequence variants on chromosomes 8 and 9 with familial intracranial aneurysm. Stroke. 2010;41:1132–1137. [CrossRef] [PubMed]
Olsson S Csajbok LZ Jood K Nylen K Nellgard B Jern C . Association between genetic variation on chromosome 9p21 and aneurysmal subarachnoid haemorrhage. J Neurol Neurosurg Psychiatry. 2010;82:384–388. [CrossRef] [PubMed]
Hashikata H Liu W Inoue K . Confirmation of an association of single-nucleotide polymorphism rs1333040 on 9p21 with familial and sporadic intracranial aneurysms in Japanese patients. Stroke. 2010;41:1138–1144. [CrossRef] [PubMed]
Japnese Study Group of Polypoidal Choroidal Vasculopathy. Criteria for diagnosis of polypoidal choroidal vasculopathy[in Japanese]. Nippon Ganka Gakkai Zasshi. 2005;109:417–427. [PubMed]
van Leeuwen R Klaver CC Vingerling JR Hofman A de Jong PT . The risk and natural course of age-related maculopathy: follow-up at 6 1/2 years in the Rotterdam study. Arch Ophthalmol. 2003;121:519–526. [CrossRef] [PubMed]
Li M Wen F Zuo C . SERPING1 polymorphisms in polypoidal choroidal vasculopathy. Mol Vis. 2010;16:231–239. [PubMed]
Menashe I Rosenberg PS Chen BE . PGA: power calculator for case-control genetic association analyses. BMC Genet. 2008;9:36. [CrossRef] [PubMed]
Kawasaki R Yasuda M Song SJ . The prevalence of age-related macular degeneration in Asians: a systematic review and meta-analysis. Ophthalmology. 2010;117:921–927. [CrossRef] [PubMed]
Lee KY Vithana EN Mathur R . Association analysis of CFH, C2, BF, and HTRA1 gene polymorphisms in Chinese patients with polypoidal choroidal vasculopathy. Invest Ophthalmol Vis Sci. 2008;49:2613–2619. [CrossRef] [PubMed]
Lima LH Schubert C Ferrara DC . Three major loci involved in age-related macular degeneration are also associated with polypoidal choroidal vasculopathy. Ophthalmology. 2010;117:1567–1570. [CrossRef] [PubMed]
Ennis S Jomary C Mullins R . Association between the SERPING1 gene and age-related macular degeneration: a two-stage case-control study. Lancet. 2008;372:1828–1834. [CrossRef] [PubMed]
Haas P Aggermann T Steindl K . Genetic cardiovascular risk factors and age-related macular degeneration. Acta Ophthalmol. 2011;89:335–338. [CrossRef] [PubMed]
Peter I Seddon JM . Genetic epidemiology: successes and challenges of genome-wide association studies using the example of age-related macular degeneration. Am J Ophthalmol. 2010;150:450–452.e452. [CrossRef] [PubMed]
Anderson CD Biffi A Rost NS Cortellini L Furie KL Rosand J . Chromosome 9p21 in ischemic stroke: population structure and meta-analysis. Stroke. 2010;41:1123–1131. [CrossRef] [PubMed]
Falk E Shah PK Fuster V . Coronary plaque disruption. Circulation. 1995;92:657–671. [CrossRef] [PubMed]
Schievink WI . Intracranial aneurysms. N Engl J Med. 1997;336:28–40. [CrossRef] [PubMed]
Visel A Zhu Y May D . Targeted deletion of the 9p21 non-coding coronary artery disease risk interval in mice. Nature. 2010;464:409–412. [CrossRef] [PubMed]
Musunuru K Post WS Herzog W . Association of single nucleotide polymorphisms on chromosome 9p21.3 with platelet reactivity: a potential mechanism for increased vascular disease. Circ Cardiovasc Genet. 2010;3:445–453. [CrossRef] [PubMed]
Lip PL Hope-Ross MW Gibson JM . Idiopathic polypoidal choroidal vasculopathy: a disease with diverse clinical spectrum and systemic associations. Eye. 2000;14(pt 5):695–700. [CrossRef] [PubMed]
Table 1.
 
Primers for SNPs
Table 1.
 
Primers for SNPs
SNP Primers Extension Primer
rs1333040 F: TCATTCAAGAGAGACAGGAGG TTTTTTTTTTTAGGGTCAGAGGTAAGAATG
R: GAGCCACTGTTGTAGTATACC
rs10757278 F: TAGTTGGAACTGAACTGAGGC TTTTTTTTTTTTTTTTTTTGGGTGTGGTCATTCCGGTA
R: CTACTCTGTCTTGATTCTGC
Table 2.
 
Baseline Characteristics of the Study Subjects
Table 2.
 
Baseline Characteristics of the Study Subjects
Characteristics Control (n = 182) PCV (n = 177)* nAMD (n = 131)*
Female sex, n (%) 69 (37.9) 60 (33.9)† 47 (35.9)†
Age, mean ± SD (range), y 68 ± 9.17 (50–87) 65 ± 8.45 (42–85)‡ 67 ± 9.46 (46–84)†
Smoker, n (%) 62 (34.1) 71 (40.1)† 48 (36.6)†
Hypertension, n (%) 38 (20.9) 48 (27.1)† 44 (33.6)§
Type 2 diabetes, n (%) 10 (5.5) 11 (6.2)† 12 (9.2)†
Coronary artery disease, n (%) 3 (1.6) 8 (4.5)† 11 (8.4)‡
Table 3.
 
Association between Minor Allele Frequency of Variants on 9p21 and PCV and nAMD
Table 3.
 
Association between Minor Allele Frequency of Variants on 9p21 and PCV and nAMD
SNP Position (bp) Population Minor Allele* MAF HWE OR (95% CI) P Allelic
rs1333040 22073404 Control C 0.297 0.213
PCV 0.348 0.869 1.26 (0.92–1.73) 0.146
nAMD 0.344 0.563 1.24 (0.88–1.74) 0.215
rs10757278 22114477 Control A 0.437 0.881
PCV 0.528 0.452 1.44 (1.08–1.94) 0.014
nAMD 0.500 1.000 1.29 (0.94–1.77) 0.118
Table 4.
 
Association between Genotype of Variants on 9p21 and PCV and nAMD
Table 4.
 
Association between Genotype of Variants on 9p21 and PCV and nAMD
Disease SNP P Genotypic Genotype Genotype Distribution (%) OR (95% CI) P Adjusted OR (95% CI)* Adjusted P * Statistical Power (%)†
Model Value Control Case
PCV rs1333040 Additive 0.138 TT 47.3 42.9 1 1
Dominant 0.411 CT‡ 46.2 44.6 1.06 (0.69–1.65) 0.779 1.10 (0.70–1.73) 0.691
Recessive 0.059 CC‡ 6.6 12.4 2.08 (0.96–4.47) 0.063 2.03 (0.92–4.46) 0.079
0.140§ 83.9
PCV rs10757278 Additive 0.016 GG 31.3 23.7 1 1
Dominant 0.108 AG‡ 50.0 46.9 1.24 (0.75–2.04) 0.400 1.17 (0.70–1.96) 0.560
Recessive 0.018 AA‡ 18.7 29.4 2.08 (1.15–3.74) 0.015 2.10 (1.14–3.85) 0.017
0.019§ 82.6
nAMD rs1333040 Additive 0.207 TT 47.3 44.3 1 1
Dominant 0.602 CT‡ 46.2 42.7 0.99 (0.62–1.59) 0.962 1.03 (0.62–1.69) 0.912
Recessive 0.055 CC‡ 6.6 13.0 2.10 (0.93–4.72) 0.073 2.32 (0.99–5.36) 0.050
0.137§ 77.5
nAMD rs10757278 Additive 0.118 GG 31.3 25.2 1 1
Dominant 0.237 AG‡ 50.0 49.6 1.24 (0.72–2.10) 0.441 1.29 (0.74–2.67) 0.371
Recessive 0.166 AA‡ 18.7 25.2 1.68 (0.88–3.19) 0.115 1.94 (0.99–3.79) 0.054
0.056§ 75.8
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×