October 2011
Volume 52, Issue 11
Free
Genetics  |   October 2011
Replication Study Supports CTNND2 as a Susceptibility Gene for High Myopia
Author Affiliations & Notes
  • Boyu Lu
    From the State Key Laboratory of Ophthalmology, Zhongshan Ophthalmic Center, Sun Yat-sen University, Guangzhou, China.
  • Dan Jiang
    From the State Key Laboratory of Ophthalmology, Zhongshan Ophthalmic Center, Sun Yat-sen University, Guangzhou, China.
  • Panfeng Wang
    From the State Key Laboratory of Ophthalmology, Zhongshan Ophthalmic Center, Sun Yat-sen University, Guangzhou, China.
  • Yang Gao
    From the State Key Laboratory of Ophthalmology, Zhongshan Ophthalmic Center, Sun Yat-sen University, Guangzhou, China.
  • Wenmin Sun
    From the State Key Laboratory of Ophthalmology, Zhongshan Ophthalmic Center, Sun Yat-sen University, Guangzhou, China.
  • Xueshan Xiao
    From the State Key Laboratory of Ophthalmology, Zhongshan Ophthalmic Center, Sun Yat-sen University, Guangzhou, China.
  • Shiqiang Li
    From the State Key Laboratory of Ophthalmology, Zhongshan Ophthalmic Center, Sun Yat-sen University, Guangzhou, China.
  • Xiaoyun Jia
    From the State Key Laboratory of Ophthalmology, Zhongshan Ophthalmic Center, Sun Yat-sen University, Guangzhou, China.
  • Xiangming Guo
    From the State Key Laboratory of Ophthalmology, Zhongshan Ophthalmic Center, Sun Yat-sen University, Guangzhou, China.
  • Qingjiong Zhang
    From the State Key Laboratory of Ophthalmology, Zhongshan Ophthalmic Center, Sun Yat-sen University, Guangzhou, China.
  • Corresponding author: Qingjiong Zhang, Ophthalmic Genetics and Molecular Biology, Zhongshan Ophthalmic Center, Sun Yat-sen University, 54 Xianlie Road, Guangzhou 510060, China; qingjiongzhang@yahoo.com
  • Footnotes
    2  These authors contributed equally to the work presented here and should therefore be regarded as equivalent authors.
Investigative Ophthalmology & Visual Science October 2011, Vol.52, 8258-8261. doi:10.1167/iovs.11-7914
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Boyu Lu, Dan Jiang, Panfeng Wang, Yang Gao, Wenmin Sun, Xueshan Xiao, Shiqiang Li, Xiaoyun Jia, Xiangming Guo, Qingjiong Zhang; Replication Study Supports CTNND2 as a Susceptibility Gene for High Myopia. Invest. Ophthalmol. Vis. Sci. 2011;52(11):8258-8261. doi: 10.1167/iovs.11-7914.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

Purpose.: The CTNND2 gene is located in the linkage interval of high myopia locus MYP16 and two single-nucleotide polymorphisms (SNPs; rs6885224 and rs12716080) in CTNND2 were recently shown to associate with high myopia. This study evaluated such associations in an independent case-control series.

Methods.: A total of 2773 unrelated individuals were enrolled in this study, including 1203 subjects with high myopia (spherical refraction at each meridian ≤ −6.00 D), 615 subjects with moderate myopia (−6.00 D < spherical refraction ≤ −4.00 D), and 955 controls (−0.50 D to +1.00 D, spherical equivalent). Genomic DNA was prepared from venous leukocytes. SNPs rs6885224 and rs12716080 in CTNND2 were determined by Sanger sequencing. Allele and genotype frequencies of the SNPs were compared between cases and controls by χ2 test (α = 0.05).

Results.: One SNP, rs6885224, in CTNND2 showed significant differences in genotype and allele frequencies between high myopia and controls (genotype P = 2.17E×10−5, allele P = 5.29E×10−6, odds ratio [OR] = 0.69, 95% confidence interval [CI] = 0.591–0.812), as well as between moderate myopia and controls (genotype P = 0.009, allele P = 0.005, OR = 0.765, 95% CI = 0.633–0.924). rs12716080 showed no statistical difference between myopias and controls.

Conclusions.: These results confirmed the strong association between CTNND2 polymorphism and myopia. The minor allele C of rs6885224 was protective against myopia in this study but was a risk allele in a previous study.

Myopia is the most common cause of visual impairment, with an average prevalence of 30% worldwide. 1 3 It affects approximately 50% to 70% of populations in some urban areas in East Asia. 4 8 High myopia, defined as refractive error equal to or greater than −6 D, is a leading cause of blindness due to its associated myopic retinopathy and other complications. 9,10 Both environmental factors and genetic factors contribute to myopia development, 11 15 whereas the molecular mechanism of myopia is still undetermined. 
Molecular genetic study provides a unique tool to investigate the molecular basis of myopia. Linkage studies have mapped at least 17 myopia susceptibility loci, such as MYP1–3 and MYP5–18. 16 29 Genome-wide association studies (GWAS) have identified single-nucleotide polymorphisms (SNPs) in different chromosomal regions significantly associated with myopia. 30 32 However, the exact responsible genes in these loci await further studies. 
Of those myopia susceptible loci, one, MYP16 (MIM 612554), was mapped to chromosome 5p15.33-p15.2 based on linkage evidence of three Chinese families with autosomal dominant high myopia. 27 Recently, a GWAS study identified a strong association between high myopia and genetic variations in CTNND2, 33 which is located inside the linkage interval of MYP16. It would be of interest to know whether this association can be replicated by independent studies. In this study, association of the two reported SNPs (rs6885224 and rs12716080 in CTNND2) with myopia was evaluated in an independent case-control series. 
Materials and Methods
Subjects
Written informed consent, conforming to the tenets of the Declaration of Helsinki, was obtained from the participating individuals or their guardians before the collection of clinical data and genomic samples in this study. The Institutional Review Board of Zhongshan Ophthalmic Center approved this study. 
A total of 2773 unrelated Chinese subjects were collected at the Ophthalmic Genetic and Molecular Biology Laboratory of Zhongshan Ophthalmic Center, including 1203 subjects with high myopia (spherical refraction at each meridian ≤ −6.00 D), 615 subjects with moderate myopia (−6.00 D < spherical refraction ≤ −4.00 D), and 955 controls (−0.50 D to +1.00 D, spherical equivalent). 
The criteria for 1203 subjects with high myopia were as follows: spherical refraction ≤ −6.00 D and exclusion of other known ocular or systemic diseases. The criteria for 615 subjects with moderate myopia were: −6.00 D < spherical refraction ≤ −4.00 D; best corrected visual acuity of ≥0.8; myopia occurred during school age without family history of high myopia; college students with at least 12 years education in schools; and exclusion of other known eye or systemic diseases. The control individuals met the following criteria: received at least 12 years education in schools; bilateral refraction between −0.50 D and +1.00 D (spherical equivalent); best unaided visual acuity of ≥1.0; without family history of high myopia; and without other known eye or systemic diseases. A cutoff of −4.00 D for moderate myopia is based on reported refractive errors development in Hong Kong children. 4,34 36 According to the reports, the average annual change in spherical equivalent refraction (SER) for children with myopia (SER ≤ −0.50 D) was −0.63 D, compared with −0.29 D for those who were not myopic at the beginning of the study. Then those children who were not myopic at the beginning of study would develop a refraction of −3.6 D (−0.29 D times 12 school years) until university age. Myopia subjects with genetic inclination in addition to the environmental factors should carry a refractive error lower than −3.60 D (more myopic) at university age. So a cut-off of −4.00 D for moderate myopia was chosen, given that this study aimed to reveal genetic basis for myopia susceptibility. 4  
The results of ophthalmologic examinations were recorded, including vision acuity (unaided, near, and/or best), color vision, slit-lamp, and direct ophthalmoscope examination. Refractive errors were measured with an auto refractometer (Topcon KR-8000, Paramus, NJ) after cycloplegia (Mydrin-P, Santen Pharmaceutical Co. Ltd., Osaka, Japan). Ocular biometric axial length was measured by an optical biometer (IOL Master V5.0; Carl Zeiss Meditec AG, Jena, Germany). Additional examinations, including an electroretinogram and fundus photograph, were taken in selected individuals. The refractions had been compared between right eye and left eye in the subjects, and no statistical difference existed, so we selected the data of right eye for analysis. 
Genotyping
Genomic DNA was prepared from venous leukocytes of each individual using the standard phenol/chloroform method. The SNPs rs6885224 and rs12716080 were genotyped by Sanger sequencing. Primers used for amplification and sequencing are listed in Table 1. Sequencing was performed with a cycle sequencing kit (ABI BigDye Terminator v3.1 Cycle Sequencing Kit; Applied Biosystems, Foster City, CA), using a genetic analyzer (ABI 3100 Genetic Analyzer; Applied Biosystems). Sequencing results from all the subjects were compared with CTNND2 consensus sequence (National Center for Biotechnology Information, Build37.2 NG_023544.1) using DNA and protein sequence analysis software (SeqMan II program of the Lasergene package; DNAStar Inc., Madison, WI). 
Table 1.
 
Primers Used for Amplification and Sequencing
Table 1.
 
Primers Used for Amplification and Sequencing
SNP Primer Sequence (5′–3′) Amplicon Length (bp) Annealing Temperature (°C)
rs12716080-F GGGGCTGTCACCACTACCTC 383 62
rs12716080-R ACCCCTGGGACTCCTACAAGA
rs6885224-F ATTGCCTTGGGGTTTCTTTT 222 58
rs6885224-R TCTGCCACCATATCTTCATCA
Statistical Analysis
Commercial analytical software (SPSS ver. 13; SPSS Science, Chicago, IL) was applied for computing all the data. Hardy–Weinberg equilibrium (HWE) was initially evaluated for each SNP distribution in each group. The respective allele and genotype frequencies of each SNP were compared between myopia and controls by χ2 test (α = 0.05), and P < 0.05 was considered as statistically significant between myopias and controls. The minor allele frequency, minor allele odds ratio (OR), and its 95% confidence interval (95% CI) were calculated to estimate the effect size of the minor allele on myopia. Software (Haploview 4.2) was used to calculate r 2, which indicates the extent of linkage disequilibrium of these two SNPs. 
Results
Basic information of the subjects is listed in Table 2. Genotyping of the two SNPs (rs12716080 and rs6885224) in CTNND2 was successful for all 2773 subjects. These two SNPs in each group were in HWE. One SNP, rs6885224, showed significant differences in genotype and allele frequencies between high myopia and controls (genotype P = 2.17E×10−5, allele P = 5.29E×10−6, OR = 0.69, 95% CI = 0.591–0.812), as well as between moderate myopia and controls (genotype P = 0.009, allele P = 0.005, OR = 0.765, 95% CI = 0.633–0.924). The other SNP, rs12716080, showed no significant differences either between high myopia and controls or between moderate myopia and controls (Table 3). Based on the genotype data of 2773 samples, r 2 = 0.517 (<0.80) was figured out, which indicates that these two SNPs are not in linkage disequilibrium. The minor allele C of rs6885224 was protective against myopia in this study but was a risk allele in the previous study. 33  
Table 2.
 
Basic Information of the 2773 Subjects
Table 2.
 
Basic Information of the 2773 Subjects
Group High Myopia Moderate Myopia Normal Control
Subjects, n 1203 615 955
Refraction S ≤ −6.00 D −6.00D < S ≤ − 4.00 D 0.50 D ≤ SE ≤ + 1.00 D
Age, y 18.53 ± 6.64 20.70 ± 1.59 24.49 ± 2.82
Sex, male 49.33% 50.30% 58.47%
Mean refraction −8.56 ± 1.66D −5.06 ± 0.52 D 0.17 ± 0.46 D
Table 3.
 
Genotyping of the Two SNPs in CTNND2 in 2773 Subjects
Table 3.
 
Genotyping of the Two SNPs in CTNND2 in 2773 Subjects
SNP ID Allele (A/B) Group N Genotype P Genotype Allele P Allele Minor Allele MAF OR 95% CI
A/A A/B B/B A B
rs12716080 G/T S ≤ −6.00 D 1203 70 458 675 0.658 598 1808 0.366 0.249 1.067 0.927–1.228
−6.00 D < S ≤ −4.00 D 615 43 231 341 0.302 317 913 0.180 G 0.258 1.120 0.949–1.322
−0.50 D ≤ SE ≤ + 1.00 D 955 50 352 553 452 1458 0.237
rs6885224 C/T S ≤ −6.00 D 1203 34 288 881 2.17E-05 356 2050 5.29E-06 0.148 0.692 0.591–0.812
−6.00 D < S ≤ −4.00 D 615 11 176 428 0.009 198 1032 0.005 C 0.161 0.765 0.633–0.924
−0.50 D ≤ SE ≤ + 1.00 D 955 39 305 611 383 1527 0.201
Discussion
Previously, a genome-wide linkage scan mapped a myopia locus (MYP16, MIM 612554) on chromosome 5p15.33-p15.2, based on analysis of three Chinese families with autosomal dominant high myopia living in Hong Kong. 27 This locus was further supported by an additional genome-wide linkage scan of Asian families. 37 Recently, a GWAS study on Singapore Chinese revealed that genetic variations in the noncoding region of CTNND2, the SNPs rs6885224 and rs12716080, were associated with high myopia. 33 The CTNND2 gene is located inside the linkage interval of MYP16. In this study, the SNPs rs6885224 and rs12716080 in CTNND2 were analyzed in 1818 myopia subjects (1203 with high myopia and 615 with moderate myopia) and 955 normal controls. Our results not only confirmed the association between rs6885224 in CTNND2 and high myopia, but also suggested that this SNP may associate with moderate myopia in the Chinese population. These lines of evidence suggested that MYP16 might be a common locus responsible for high myopia in Chinese as well as in Japanese. Whether the genetic variants in CTNND2 are associated with high myopia in other populations requires further studies. 
CTNND2 encodes an adhesive junction associated protein of the armadillo/β-catena super family, which interacts with several transcriptional factors such as Pax6, E2F1, and Hes1 38 40 and is involved in brain and eye development and cancer formation. 41,42 Heterozygous deletion of CTNND2 was found in Cri-du-Chat syndrome, 43 but increased expression of CTNND2 was associated with prostate tumors and breast tumors. 44,45 Whether expression of CTNND2 was altered in myopia individuals is worthy of further study. 
The SNP rs6885224 is situated in the noncoding region of CTNND2. A 20-kilobase genomic DNA region encompassing rs6885224 in CTNND2 is speculated to regulate mRNA transcription (http://genome.ucsc.edu/; University of California, Santa Cruz, Santa Cruz, CA) and, therefore, may affect the expression of gene CTNND2. Similarly, the noncoding region was also suggested to play a possible regulatory role in two other GWAS studies for myopia, 31,32 where significant associations were found between genomic regions at 15q14 and 15q25 and myopia but there were no coding sequence variations. 
The association was found only for rs6885224 but not for rs12716080 in this study. A previous study suggested that these two SNPs were in linkage disequilibrium with r 2 = 0.89. However, our data suggested these two SNPs are not in linkage disequilibrium, with r 2 = 0.517. This may explain that only one of the two SNPs is associated with myopia in our study. 
As observed in this study, the effect direction of the minor allele at rs6885224 was in the opposite direction compared with the original study. 33 Several previous association studies on other diseases have also reported that the minor allele was observed in the opposite direction for a certain disease in different studies. 46 52 Lin et al. 53 demonstrated that multilocus effects and variation in interlocus correlations contributed to this phenomenon. One possible explanation is that the ancestry variations predisposed to myopia may occur independently on different alleles in different study populations. Elucidating the functional variations predisposing to myopia at this locus in further studies may lead to the understanding of this mystery. 
In conclusion, our study supports the association between SNP rs6885224 in CTNND2 and high myopia. This result together with previous linkage and GWAS studies imply that the genomic region around rs6885224 in CTNND2 may be an important locus predisposing myopia in Chinese population. Additional studies are expected to reveal how the SNPs in CTNND2 could be associated with high myopia. 
Footnotes
 Supported in part by National Science Fund for Distinguished Young Scholars Grant 30725044 and Natural Science Foundation of Guangdong Province Grant 8251008901000020.
Footnotes
 Disclosure: B. Lu, None; D. Jiang, None; P. Wang, None; Y. Gao, None; W. Sun, None; X. Xiao, None; S. Li, None; X. Jia, None; X. Guo, None; Q. Zhang, None
The authors thank all subjects for their participation. 
References
Kempen AH Mitchell P Lee KE . The prevalence of refractive errors among adults in the United States, Western Europe, and Australia. Arch Ophthalmol. 2004;122:495–505. [CrossRef] [PubMed]
Vitale S Ellwein L Cotch MF Ferris FL3rd Sperduto R . Prevalence of refractive error in the United States, 1999–2004. Arch Ophthalmol. 2008;126:1111–1119. [CrossRef] [PubMed]
Young TL . Molecular genetics of human myopia: an update. Optom Vis Sci. 2009;86:E8–E22. [CrossRef] [PubMed]
Fan DS Lam DS Lam RF . Prevalence, incidence, and progression of myopia of school children in Hong Kong. Invest Ophthalmol Vis Sci. 2004;45:1071–1075. [CrossRef] [PubMed]
He M Zeng J Liu Y Xu J Pokharel GP Ellwein LB . Refractive error and visual impairment in urban children in southern China. Invest Ophthalmol Vis Sci. 2004;45:793–799. [CrossRef] [PubMed]
Matsumura H Hirai H . Prevalence of myopia and refractive changes in students from 3 to 17 years of age. Surv Ophthalmol. 1999;44(suppl 1):S109–S115. [CrossRef] [PubMed]
Sawada A Tomidokoro A Araie M Iwase A Yamamoto T . Refractive errors in an elderly Japanese population: the Tajimi study. Ophthalmology. 2008;115:363–370. [CrossRef] [PubMed]
Wong TY Foster PJ Hee J . Prevalence and risk factors for refractive errors in adult Chinese in Singapore. Invest Ophthalmol Vis Sci. 2000;41:2486–2494. [PubMed]
Stone RA Khurana TS . Gene profiling in experimental models of eye growth: clues to myopia pathogenesis. Vision Res. 2010;50:2322–2333. [CrossRef] [PubMed]
Saw SM Gazzard G Shih-Yen EC Chua WH . Myopia and associated pathological complications. Ophthalmic Physiol Opt. 2005;25:381–391. [CrossRef] [PubMed]
Feldkamper M Schaeffel F . Interactions of genes and environment in myopia. Dev Ophthalmol. 2003;37:34–49. [PubMed]
Hammond CJ Snieder H Gilbert CE Spector TD . Genes and environment in refractive error: the twin eye study. Invest Ophthalmol Vis Sci. 2001;42:1232–1236. [PubMed]
Pacella R McLellan J Grice K Del Bono EA Wiggs JL Gwiazda JE . Role of genetic factors in the etiology of juvenile-onset myopia based on a longitudinal study of refractive error. Optom Vis Sci. 1999;76:381–386. [CrossRef] [PubMed]
Saw SM . A synopsis of the prevalence rates and environmental risk factors for myopia. Clin Exp Optom. 2003;86:289–294. [CrossRef] [PubMed]
Saw SM Chua WH Wu HM Yap E Chia KS Stone RA . Myopia: gene–environment interaction. Ann Acad Med Singapore. 2000;29:290–297. [PubMed]
Schwartz M Haim M Skarsholm D . X-linked myopia: Bornholm eye disease. Linkage to DNA markers on the distal part of Xq. Clin Genet. 1990;38:281–286. [CrossRef] [PubMed]
Young TL Ronan SM Drahozal LA . Evidence that a locus for familial high myopia maps to 18p. Am J Hum Genet. 1998;63:109–119. [CrossRef] [PubMed]
Young TL Ronan SM Alvear AB . A second locus for familial high myopia maps to chromosome 12q. Am J Hum Genet. 1998;63:1419–1424. [CrossRef] [PubMed]
Paluru P Ronan SM Heon E . New locus for autosomal dominant high myopia maps to the long arm of chromosome 17. Invest Ophthalmol Vis Sci. 2003;44:1830–1836. [CrossRef] [PubMed]
Stambolian D Ibay G Reider L . Genomewide linkage scan for myopia susceptibility loci among Ashkenazi Jewish families shows evidence of linkage on chromosome 22q12. Am J Hum Genet. 2004;75:448–459. [CrossRef] [PubMed]
Hammond CJ Andrew T Mak YT Spector TD . A susceptibility locus for myopia in the normal population is linked to the PAX6 gene region on chromosome 11: a genomewide scan of dizygotic twins. Am J Hum Genet. 2004;75:294–304. [CrossRef] [PubMed]
Zhang Q Guo X Xiao X Jia X Li S Hejtmancik JF . A new locus for autosomal dominant high myopia maps to 4q22–q27 between D4S1578 and D4S1612. Mol Vis. 2005;11:554–560. [PubMed]
Paluru PC Nallasamy S Devoto M Rappaport EF Young TL . Identification of a novel locus on 2q for autosomal dominant high-grade myopia. Invest Ophthalmol Vis Sci. 2005;46:2300–2307. [CrossRef] [PubMed]
Zhang Q Guo X Xiao X Jia X Li S Hejtmancik JF . Novel locus for X linked recessive high myopia maps to Xq23–q25 but outside MYP1. J Med Genet. 2006;43:e20. [CrossRef] [PubMed]
Wojciechowski R Moy C Ciner E . Genomewide scan in Ashkenazi Jewish families demonstrates evidence of linkage of ocular refraction to a QTL on chromosome 1p36. Hum Genet. 2006;119:389–399. [CrossRef] [PubMed]
Nallasamy S Paluru PC Devoto M Wasserman NF Zhou J Young TL . Genetic linkage study of high-grade myopia in a Hutterite population from South Dakota. Mol Vis. 2007;13:229–236. [PubMed]
Lam CY Tam PO Fan DS . A genome-wide scan maps a novel high myopia locus to 5p15. Invest Ophthalmol Vis Sci. 2008;49:3768–3778. [CrossRef] [PubMed]
Paget S Julia S Vitezica ZG Soler V Malecaze F Calvas P . Linkage analysis of high myopia susceptibility locus in 26 families. Mol Vis. 2008;14:2566–2574. [PubMed]
Yang Z Xiao X Li S Zhang Q . Clinical and linkage study on a consanguineous Chinese family with autosomal recessive high myopia. Mol Vis. 2009;15:312–318. [PubMed]
Nakanishi H Yamada R Gotoh N . A genome-wide association analysis identified a novel susceptible locus for pathological myopia at 11q24.1. PLoS Genet. 2009;5:e1000660. [CrossRef] [PubMed]
Hysi PG Young TL Mackey DA . A genome-wide association study for myopia and refractive error identifies a susceptibility locus at 15q25. Nat Genet. 2010;42:902–905. [CrossRef] [PubMed]
Solouki AM Verhoeven VJM Van Duijn CM . A genome-wide association study identifies a susceptibility locus for refractive errors and myopia at 15q14. Nat Genet. 2010;42:897–901. [CrossRef] [PubMed]
Li YJ Goh L Khor CC . Genome-wide association studies reveal genetic variants in CTNND2 for high myopia in Singapore Chinese. Ophthalmology. 2011;118:368–375. [CrossRef] [PubMed]
Fan DSP Cheung EYY Lai RYK Kwok AKH Lam DSC . Myopia progression among preschool Chinese children in Hong Kong. Ann Acad Med Singapore. 2004;33:39–43. [PubMed]
Goldschmidt E Lam CS Opper S . The development of myopia in Hong Kong children. Acta Ophthalmol Scand. 2001;79:228–232. [CrossRef] [PubMed]
Edwards MH . The development of myopia in Hong Kong children between the ages of 7 and 12 years: a five-year longitudinal study. Ophthalmic Physiol Opt. 1999;19:286–294. [CrossRef] [PubMed]
Li YJ Guggenheim JA Bulusu A . An international collaborative family-based whole-genome linkage scan for high-grade myopia. Invest Ophthalmol Vis Sci. 2009;50:3116–3127. [CrossRef] [PubMed]
Zhang J Lu JP Suter DM . Isoform- and dose-sensitive feedback interactions between paired box 6 gene and delta-catenin in cell differentiation and death. Exp Cell Res. 2010;316:1070–1081. [CrossRef] [PubMed]
Lu JP Zhang J Kim K . Human homolog of Drosophila Hairy and enhancer of split 1, Hes1, negatively regulates δ-catenin (CTNND2) expression in cooperation with E2F1 in prostate cancer. Mol Cancer. 2010;9:304. [CrossRef] [PubMed]
Kim K Oh M Ki F . Identification of E2F1 as a positive transcriptional regulator for delta-catenin. Biochem Biophys Res Commun. 2008;369:414–420. [CrossRef] [PubMed]
Duparc RH Boutemmine D Champagne MP Tetreault N Bernier G . Pax6 is required for delta-catenin/neurojugin expression during retinal, cerebellar and cortical development in mice. Dev Biol. 2006;300:647–655. [CrossRef] [PubMed]
Zeng Y Abdallah A Lu JP . δ-Catenin promotes prostate cancer cell growth and progression by altering cell cycle and survival gene profiles. Mol Cancer. 2009;8:19. [CrossRef] [PubMed]
Medina M Marinescu RC Overhauser J Kosik KS . Hemizygosity of delta-catenin (CTNND2) is associated with severe mental retardation in Cri-du-Chat syndrome. Genomics. 2000;63:157–164. [CrossRef] [PubMed]
Bertucci F Finetti P Cervera N . Gene expression profiling shows medullary breast cancer is a subgroup of basal breast cancers. Cancer Res. 2006;66:4636–4644. [CrossRef] [PubMed]
Lu Q Zhang J Allison R . Identification of extracellular delta-catenin accumulation for prostate cancer detection. Prostate. 2009;69:411–418. [CrossRef] [PubMed]
Hughes LB Reynolds RJ Brown EE . Most common single-nucleotide polymorphisms associated with rheumatoid arthritis in subjects of European ancestry confer risk of rheumatoid arthritis in African-Americans. Arthritis Rheum. 2010;62:3547–3553. [CrossRef] [PubMed]
Cruchaga C Nowotny P Kauwe JS . Association and expression analyses with single-nucleotide polymorphisms in TOMM40 in Alzheimer disease. Arch Neurol. 2011;68:1013–1019. [CrossRef] [PubMed]
Morgan AR Hollingworth P Abraham R . Association analysis of dynamin-binding protein (DNMBP) on chromosome 10q with late onset Alzheimer's disease in a large caucasian UK sample. Am J Med Genet B Neuropsychiatr Genet. 2009;150B:61–64. [CrossRef] [PubMed]
Harsløf T Tofteng CL Husted LB . Polymorphisms of the peroxisome proliferator-activated receptor γ (PPARγ) gene are associated with osteoporosis. Osteoporos Int. 2011;22:2655–2666. [CrossRef] [PubMed]
Kupfer SS Anderson JR Hooker S . Genetic heterogeneity in colorectal cancer associations between African and European Americans. Gastroenterology. 2010;139:1677–1685. [CrossRef] [PubMed]
McGuire V Den Eeden SK Tanner CM . Association of DRD2 and DRD3 polymorphisms with Parkinson's disease in a multiethnic consortium. J Neurol Sci. 2011;307:22–29. [CrossRef] [PubMed]
O'Mara TA Ferguson K Fahey P . CHEK2, MGMT, SULT1E1 and SULT1A1 polymorphisms and endometrial cancer risk. Twin Res Hum Genet. 2011;14:328–332. [CrossRef] [PubMed]
Lin PI Vance JM Pericak-Vance MA Martin ER . No gene is an island: the flip-flop phenomenon. Am J Hum Genet. 2007;80:531–538. [CrossRef] [PubMed]
Table 1.
 
Primers Used for Amplification and Sequencing
Table 1.
 
Primers Used for Amplification and Sequencing
SNP Primer Sequence (5′–3′) Amplicon Length (bp) Annealing Temperature (°C)
rs12716080-F GGGGCTGTCACCACTACCTC 383 62
rs12716080-R ACCCCTGGGACTCCTACAAGA
rs6885224-F ATTGCCTTGGGGTTTCTTTT 222 58
rs6885224-R TCTGCCACCATATCTTCATCA
Table 2.
 
Basic Information of the 2773 Subjects
Table 2.
 
Basic Information of the 2773 Subjects
Group High Myopia Moderate Myopia Normal Control
Subjects, n 1203 615 955
Refraction S ≤ −6.00 D −6.00D < S ≤ − 4.00 D 0.50 D ≤ SE ≤ + 1.00 D
Age, y 18.53 ± 6.64 20.70 ± 1.59 24.49 ± 2.82
Sex, male 49.33% 50.30% 58.47%
Mean refraction −8.56 ± 1.66D −5.06 ± 0.52 D 0.17 ± 0.46 D
Table 3.
 
Genotyping of the Two SNPs in CTNND2 in 2773 Subjects
Table 3.
 
Genotyping of the Two SNPs in CTNND2 in 2773 Subjects
SNP ID Allele (A/B) Group N Genotype P Genotype Allele P Allele Minor Allele MAF OR 95% CI
A/A A/B B/B A B
rs12716080 G/T S ≤ −6.00 D 1203 70 458 675 0.658 598 1808 0.366 0.249 1.067 0.927–1.228
−6.00 D < S ≤ −4.00 D 615 43 231 341 0.302 317 913 0.180 G 0.258 1.120 0.949–1.322
−0.50 D ≤ SE ≤ + 1.00 D 955 50 352 553 452 1458 0.237
rs6885224 C/T S ≤ −6.00 D 1203 34 288 881 2.17E-05 356 2050 5.29E-06 0.148 0.692 0.591–0.812
−6.00 D < S ≤ −4.00 D 615 11 176 428 0.009 198 1032 0.005 C 0.161 0.765 0.633–0.924
−0.50 D ≤ SE ≤ + 1.00 D 955 39 305 611 383 1527 0.201
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×