August 2011
Volume 52, Issue 9
Free
Retinal Cell Biology  |   August 2011
Effect of miR-23 on Oxidant-Induced Injury in Human Retinal Pigment Epithelial Cells
Author Affiliations & Notes
  • Haijiang Lin
    From the Departments of Ophthalmology and Visual Sciences and
  • Jinqiao Qian
    Biochemistry and Molecular Biology, University of Texas Medical Branch, Galveston, Texas; and
    the Department of Anesthesiology, the First Affiliated Hospital of Kunming Medical College, Kunming, Yunnan, China.
  • Alexander C. Castillo
    Biochemistry and Molecular Biology, University of Texas Medical Branch, Galveston, Texas; and
  • Bo Long
    Biochemistry and Molecular Biology, University of Texas Medical Branch, Galveston, Texas; and
  • Kyle T. Keyes
    Biochemistry and Molecular Biology, University of Texas Medical Branch, Galveston, Texas; and
  • Guanglin Chen
    Biochemistry and Molecular Biology, University of Texas Medical Branch, Galveston, Texas; and
  • Yumei Ye
    Biochemistry and Molecular Biology, University of Texas Medical Branch, Galveston, Texas; and
  • Corresponding author: Yumei Ye, The Department of Biochemistry and Molecular Biology, University of Texas Medical Branch, MRB 5:108, 301 University Boulevard, Galveston, TX 77555; yumye@utmb.edu
  • Footnotes
    2  These authors contributed equally to the work presented here and should therefore be regarded as equivalent authors.
Investigative Ophthalmology & Visual Science August 2011, Vol.52, 6308-6314. doi:10.1167/iovs.10-6632
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Haijiang Lin, Jinqiao Qian, Alexander C. Castillo, Bo Long, Kyle T. Keyes, Guanglin Chen, Yumei Ye; Effect of miR-23 on Oxidant-Induced Injury in Human Retinal Pigment Epithelial Cells. Invest. Ophthalmol. Vis. Sci. 2011;52(9):6308-6314. doi: 10.1167/iovs.10-6632.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

Purpose.: Micro(mi)RNAs negatively regulate a wide variety of genes through degradation or posttranslational inhibition of their target genes. The purpose of this study was to investigate the role of miR-23a in modulating RPE cell survival and gene expression in response to oxidative damage.

Methods.: The expression level of miR-23a was measured in macular retinal pigment epithelial (RPE) cells of donor eyes with aged-related macular degeneration (AMD) and age-matched normal eyes by using qRT-PCR. Cultured human ARPE-19 cells were transfected with miR-23a mimic or inhibitor. Cell viability was assessed by the MTT assay. Apoptosis was determined by incubating cells with hydrogen peroxide (H2O2) or t-butylhydroperoxide (tBH). Caspase-3 activity and DNA fragmentation were measured by enzyme-linked immunosorbent assays. The protein relevant to apoptosis, such as Fas expression level, was analyzed by Western blot analysis.

Results.: miR-23a expression was significantly downregulated in macular RPE cells from AMD eyes. H2O2-induced ARPE-19 cell death and apoptosis were increased by an miR-23a inhibitor and decreased by an miR-23a mimic. Computational analysis found a putative target site of miR-23a in the 3′UTR of Fas mRNA, which was verified by a luciferase reporter assay. Forced overexpression of miR-23a decreased H2O2 or tBH-induced Fas upregulation, and this effect was blocked by downregulation of miR-23a.

Conclusions.: The protection of RPE cells against oxidative damage is afforded by miR-23a through regulation of Fas, which may be a novel therapeutic target in retinal degenerative diseases.

Micro (mi)RNAs are small, noncoding molecules that have emerged as critical regulators of gene expression via translational repression or mRNA degradation. 1 3 Studies have shown that miRNAs control diverse aspects of eye development and differentiation. 4,5 Since miRNAs are involved in controlling various pathways, they have been regarded as novel therapeutic targets for various diseases such as cancer and cardiovascular and regenerative eye diseases. 2,6 8 Numerous studies have demonstrated that miRNAs are involved in regulation of cell survival in response to oxidative stress. 9,10 High levels of reactive oxygen species (ROS)–induced RPE cell damage play an important role in the pathogenesis of AMD. 11 14 Exposure of cells to oxidant generators, such as H2O2 or tBH, elicits changes in expression of multiple genes, and these changes are responsible for ROS-mediated RPE cell death and apoptosis. 14 17 The extrinsic apoptosis pathway is activated by apoptosis-inducing ligands, such as the Fas ligand (Faso). 18 The increased Fas expression in AMD photoreceptors has been found in eyes with exudative AMD and in those with geographic atrophy. 19  
miR-23a is a key factor in the regulation of oligodendroglia development and myelin formation. 20 Inhibition of miR-23a downregulates cell growth. 21 In addition, miR-23a regulates retinoic-acid–induced neuronal differentiation of NT2 cells through regulation of Hes1 expression at the posttranscriptional level. 22 Recent studies have suggested that miR-23a regulates mitochondrial glutamine metabolism and is associated with ROS in human P-493 B lymphoma cells and PC3 prostate cancer cells. 23 However, the role of miR-23a in oxidative stress of RPE cells remains unclear. In the present study, the miR-23a expression level in AMD was evaluated, and the interaction between miR-23a and apoptotic factor, such as Fas in oxidative stress, was determined. 
Materials and Methods
Antibodies against Fas were purchased from Upstate Biotechnology (Lake Placid, NY). An miRNA isolation kit (mirVana) and a qRT-PCR miRNA detection kit were purchased from Ambion (Austin, TX). Human ARPE-19 cells were purchased from the American Type Culture Collection (ATCC, Manassas, VA). MTT cell respiration assay kit was purchased from R&D System (Minneapolis, MN). Sources of other reagents are indicated in the text. 
Cell Culture
Eyes of aged normal (60–80 years) and AMD (60–80 years) donors were obtained from the National Disease Research Interchange (NDRI; Philadelphia, PA), the Lions Eye Bank of Texas (Houston, TX), or the Minnesota Lions Eye Bank (St. Paul, MN), in accordance with the provisions of the Declaration of Helsinki for research involving human tissue. The eyes were received, and the globes were dissected under sterile conditions. An 8-mm sterile trephine was used to remove a disc of the RPE cell layer, Bruch's membrane, and choroid from the macular area. The RPE cells were loosened after trypsin digestion (30 minutes at 37°C) and were then collected and spun at 1000 rpm in a centrifuge at 4°C for 5 minutes. The pellet was resuspended in fresh cell growth medium. Test for purity of the cultures using cytokeratin antibody staining showed 97% RPE cells at the time of isolation. 
Determination of miR-23a Expression Level
Primary cultured macular RPE cells were seeded at 1 × 106 per 100-mm plate and incubated until 80% to 90% confluent. RPE cells were then harvested at passage 3. Total RNA was extracted from RPE cells (Trizol Reagent; Invitrogen, Carlsbad, CA). Enrichment of small RNA was performed (mirVana miRNA Isolation Kit; Ambion) and quantified (mirVana qRT-PCR miRNA Detection Kit; Ambion), as described before. 24 For real-time PCR, SYBR Green (SYBR Green I; Invitrogen) was used for quantification of miRNA transcripts, according to the manufacturer's instructions. The appropriate cycle threshold (Ct) was determined using the automatic baseline determination feature. Reactions containing qRT-PCR primer sets were specific for human miR-23a. As an internal control, U6 was used for miR-23a template normalization. The relative gene expression was calculated by comparing cycle times for miR-23a. 25,26 RPE cells from four different donors per group were used. 
Northern Blot Analysis
Northern-blot analyses were performed with a kit (Signosis, Sunnyvale, CA) per the manufacturer's instructions. Briefly, the total RNA (40 μg) was run on a 15% polyacrylamide-urea gel, transferred to a nitrocellulose membrane (Hybond-N+; Amersham Pharmacia Biotech Inc) with a semidry apparatus (BioRad, Hercules, CA) and UV crosslinked (Stratalinker; Stratagene). Membranes were exposed using a chemiluminescence imaging system (Ultralum, Inc., Claremont, CA). The normalization of the result was done by stripping the blot and probing it for U6 expression. 
miRNA Transfection
ARPE-19 cells were maintained in the growth medium for 24 hours to reach 70% confluence, and transfection was performed (Endofectin; GeneCopoeia, Rockville, MD). For miR-23a upregulation, precursor miR-23a (sequence: ggccggcugggguuccuggggaugggauuugcuuccugucacaaaucacauugccagggauuuccaaccgacc; GeneCopoeia) was added directly to the transfection complexes at a final concentration of 0.5 μg/mL. For the miR-23a knockdown, miR-23a inhibitor plasmid (GeneCopoeia) was added at the final concentrations of 25, 50, 100, and 150 ng/mL. Cells were incubated at 37°C with 5% CO2 for 24 hours with antibiotic-free medium. miR-23a levels were measured (mirVana qRT-PCR miRNA Detection Kit; Ambion). Scrambled miRNA controls were applied. 
Cell Viability Assays
After transfection, medium was replaced with MEM supplemented with 0.5% FBS. ARPE-19 cells were exposed to 100, 300, or 600 μM H2O2 for 16 hours. The viability of ARPE-19 cells was measured in an MTT assay. Briefly, the cells were treated with 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT; 0.5 mg/mL) for 4 hours at 37°C. The attached cells were lysed in 2-isopropanol containing 0.04 M HCl, and the amount of metabolized MTT was determined with a microplate reader. 
Caspase-3 Activity
Caspase-3 activity was determined with a colorimetric assay kit (BioSource, Hopkinton, MA) per the manufacturer's instructions. In brief, samples were lysed, and the assay was performed by incubating 200 μg cell lysate in 100 μL of reaction buffer containing 5 μL of caspase-3 substrate (4 mM DEVD-pNA). Caspase-3 activity was evaluated by spectrophotometry at 405 nm. 
Detection of Apoptosis
The degree of intracellular DNA fragmentation (apoptosis) was quantified by cell viability ELISA (Cell Death Detection ELISA plus kit; Roche, Welwyn Garden City, UK). After transfection, cells in triplicate wells were stimulated with H2O2 for 16 hours. The assay was based on a quantitative sandwich enzyme-immunoassay directed against cytoplasmic histone-associated DNA fragments and was performed according to the manufacturer's instructions. 
Estimation of Mitochondrial Cytochrome c and AIF Release
The release of mitochondrial cytochrome c into the cytosol was determined by ELISA (MBL International, Woburn, MA), per the manufacturer's instructions. The change in color was monitored at a wavelength of 450 nm using a plate reader (Molecular Devices, Sunnyvale, CA). Measurements were performed in duplicate, and the cytochrome c content was expressed as OD450 per mg protein. AIF (apoptosis-inducing factor) in the cytosol was detected in the extracted mitochondria-free cytosolic protein fraction by immunoblot assay. 
Luciferase Reporter Assay
The 3′UTR of human Fas, with or without miR-23a binding site mutation, was cloned into the cloning site of the pMir-Luc-target vector (OriGene Technologies, Inc., Rockville, MD), and the precursor of the miR-23a expression clone (miR-23a) was constructed in a CMV promoter and fused with an eGFP system (GeneCopoeia). The miR-23a expression clone (miR-23a) was constructed in a CMV promoter, and a luciferase assay was performed (Luc-Pair miR Luciferase Assay Kit; GeneCopoeia). The cells were plated in six wells until 70% confluent and transfected with (1) 1.0 μg Fas 3′UTR; (2) Fas 3′UTR +1.4 μg sc-miR (miRNA scramble control); (3) Fas 3′UTR +1.4 μg miR-23a; (4) Fas 3′UTR +1.4 μg miR-23a + 100 ng sc-inh (miRNA inhibitor scramble control); (5) Fas 3′UTR +1.4 μg miR-23a + (20, 50, or 100 ng) inh-23a; and (6) Fas 3′UTR with miR-23a seed-matching mutation (Fas 3′UTRmt) +miR-23a. The cells were transferred to a 96-well plate 18 hours after transfection and cultured for another 24 hours. Both firefly luciferase and Renilla luciferase activities were determined in the HEK293 cell line. Firefly luciferase activity was then normalized with Renilla luciferase activities in the same well. 
Western Blot Analysis
Samples were homogenized in lysis buffer (in mM): 25 Tris HCl (pH 7.4), 0.5 EDTA, 0.5 EGTA, 1 phenylmethylsulfonyl fluoride, 1 dithiothreitol, 25 NaF, 1 Na3VO4, 1% Triton X-100, 2% SDS and 1% protease inhibitor cocktail. Protein (70 μg) was fractionated by SDS-PAGE (4%–20% polyacrylamide gels) and transferred to PVDF membranes (Millipore, Bedford, MA). Samples were incubated with anti-Fas antibodies. Bound antibodies were detected using the chemiluminescent substrate (NEN Life Science Products, Boston, MA). Protein signals were quantified with an image-scanning densitometer and normalized to the corresponding β-actin signal. 
LDH Release Assay
ARPE-19 cells were transfected with miR-23a precursor, inhibitor, or scramble control. To trigger apoptosis, 300 μM H2O2 or 300 μM tBH were then added. Intracellular LDH release was measured by using an LDH assay kit (Cayman Chemical, Ann Arbor, MI) per instructions of the manufacturer. 
Statistical Analysis
Data are presented as the mean ± SD. Analysis of variance (ANOVA) with the Sidak correction for multiple comparisons was applied to compare the different groups. P < 0.05 was considered statistically significant. 
Results
miR-23a Expression in AMD and Its Response to Oxidative Stress
To evaluate the expression levels of miR-23a in RPE cells from the macula of AMD and normal age-matched donor eyes, qRT-PCR was used. miR-23a was significantly downregulated in AMD compared with normal (Fig. 1A). The results were confirmed by Northern blot analysis (Fig. 1B). Collectively, aberrant expression of miR-23a was a remarkable characteristic in the RPE cells of human AMD, suggesting the possibility that it could function as a mediator in the process of AMD development. N-(4-hydoxyphenyl)-retinamide (4HPR), a retinoic acid, has been reported to induce ROS generation and increase the expression level of miR-23a in ARPE-19 cells. 27 Our results showed that the expression level of miR-23a in primary cultured RPE cells increased when exposed to H2O2 at 100 to 200 μM, but decreased at 300 to 500 μM (Fig. 1C). The same pattern was followed in ARPE-19 cells (Fig. 1D). Previous studies suggest that 200 μM H2O2 does not affect ARPE-19 cell viability. 28,29 Persistent elevation of phosphorylated-Akt induced by 200 μM H2O2 may enhance the ARPE cell's ability to resist the damaging effects of low level oxidative stress. 28 Preconditioning the cells by low dose of H2O2 induces resistance to killing, 30 while high doses of H2O2 produced toxicity through oxidative stress. 31 Different enzyme activities or signaling pathways are triggered in cells treated with different doses of H2O2. 30,31 Our results suggest that H2O2 causes differential expression of miR-23a based on the dose. The increased level of miR-23a induced by 200 μM in our study indicated that miR-23a may also play a role in cell survival. However, higher concentrations of H2O2 may induce destruction of RPE cells. The combined effect of apoptosis and necrosis may decrease the level of miR-23a. 
Figure 1.
 
Changes in RPE cells from the macula of AMD and age-matched (normal) control eyes. (A) Expression levels of miR-23a in RPE cells from normal and AMD donor eyes were analyzed by qRT-PCR. The levels are expressed relative to normal values in four independent experiments. Mean levels in control groups (normal) were defined as 100%. *P < 0.001 versus normal. (B) Northern blot analysis confirmed aberrant miR-23a expression levels in RPE cells. The small housekeeping RNA U6 (106 nt) was used as a loading control. *P < 0.002 versus normal. The expression levels of miR-23a in primary cultured RPE (C) and ARPE-19 (D) cells were measured after 4 hours of exposure to 0, 100, 200, 300, 400, and 500 μM H2O2 (n = 4). Mean levels in the control group (0 μM H2O2) were defined as 100%. *P < 0.05 vs. 0 μM H2O2.
Figure 1.
 
Changes in RPE cells from the macula of AMD and age-matched (normal) control eyes. (A) Expression levels of miR-23a in RPE cells from normal and AMD donor eyes were analyzed by qRT-PCR. The levels are expressed relative to normal values in four independent experiments. Mean levels in control groups (normal) were defined as 100%. *P < 0.001 versus normal. (B) Northern blot analysis confirmed aberrant miR-23a expression levels in RPE cells. The small housekeeping RNA U6 (106 nt) was used as a loading control. *P < 0.002 versus normal. The expression levels of miR-23a in primary cultured RPE (C) and ARPE-19 (D) cells were measured after 4 hours of exposure to 0, 100, 200, 300, 400, and 500 μM H2O2 (n = 4). Mean levels in the control group (0 μM H2O2) were defined as 100%. *P < 0.05 vs. 0 μM H2O2.
The Effect of miR-23a on Cell Viability in ARPE-19 Cells Subjected to Oxidative Injury
To assess the functional consequences of up and downregulation of miR-23a, antisense inhibitor (inh-23a) and pre-miR-23a (miR-23a) were transfected or co-transfected into human ARPE-19 cells. The expression levels of miR-23a were increased approximately 3.5-fold by 0.5 μg/mL of miR-23a compared with the control (Fig. 2A). In contrast, miR-23a levels were decreased by the specific inhibitor, inh-23a (25, 50, 100, 150 ng/mL), in a dose-dependent manner. Maximum inhibition was reached at a concentration of 150 ng/mL. Endogenous miR-23a was inhibited by inh-23a at 100 and 150 ng/mL. Scrambled controls (Sc-23a, Sc-inh) had no effect. Overexpression of miR-23a had no effect on cell viability, whereas inhibition of miR-23a reduced cell growth (Fig. 2B). Cell viability, as assessed by MTT assay, was reduced at 300 μM H2O2 (Fig. 2C[b]). In cells subjected to H2O2 exposure, overexpression of miR-23a increased cell viability, and this effect was abolished by co-transfection of inhibitor (inh-23a). miR-23a attenuated the cell death induced by 300 μM H2O2, and this effect was abolished by inh-23a (Fig. 2D). 
Figure 2.
 
Effect of miR-23a on viability of ARPE-19 cells. (A) ARPE-19 cells were transfected with pre-miR-23a (miR-23a; 0.5 μg/mL) or various concentrations of inhibitor (inh-23a; 25, 50, 100, and 150 ng/mL) for 24 hours (n = 4). miR-23a expression levels were assessed by qRT-PCR after 24 hours of transfection (n = 4). *P < 0.001 versus control. #P < 0.01 versus miR-23a. (B) ARPE-19 cells were transfected with miR-23a (0.5 μg/mL), SC-miR (0.5 μg/mL), SC-inh (150 ng/mL), or inh-23a (25, 50,100, and 150 ng/mL) for 16 hours. Cell viability was determined by MTT assay (n = 8). *P < 0.001 versus control. Results are expressed as percentages of the control, taken as 100%. (C) ARPE-19 cells were transfected with miR-23a and co-transfected with inh-23a or scrambled controls for 24 hours before challenge with H2O2 for 16 hours. Cell viability was determined by MTT assay (n = 8). (D) Cell death was assessed by trypan blue (n = 7). *P < 0.0001 versus control; #P < 0.0001 vs. 300 μM H2O2; $P < 0.001 versus miR-23a.
Figure 2.
 
Effect of miR-23a on viability of ARPE-19 cells. (A) ARPE-19 cells were transfected with pre-miR-23a (miR-23a; 0.5 μg/mL) or various concentrations of inhibitor (inh-23a; 25, 50, 100, and 150 ng/mL) for 24 hours (n = 4). miR-23a expression levels were assessed by qRT-PCR after 24 hours of transfection (n = 4). *P < 0.001 versus control. #P < 0.01 versus miR-23a. (B) ARPE-19 cells were transfected with miR-23a (0.5 μg/mL), SC-miR (0.5 μg/mL), SC-inh (150 ng/mL), or inh-23a (25, 50,100, and 150 ng/mL) for 16 hours. Cell viability was determined by MTT assay (n = 8). *P < 0.001 versus control. Results are expressed as percentages of the control, taken as 100%. (C) ARPE-19 cells were transfected with miR-23a and co-transfected with inh-23a or scrambled controls for 24 hours before challenge with H2O2 for 16 hours. Cell viability was determined by MTT assay (n = 8). (D) Cell death was assessed by trypan blue (n = 7). *P < 0.0001 versus control; #P < 0.0001 vs. 300 μM H2O2; $P < 0.001 versus miR-23a.
The Effect of miR-23a on Caspase-3 Activity and Apoptosis Induced by H2O2
To evaluate the effect of miR-23a on RPE cell apoptosis, we measured caspase-3 activity (an early marker of apoptosis) and DNA fragmentation, a late marker of apoptosis. 32,33 Caspase-3 activity was strongly induced in RPE cells after exposure to 300 μM H2O2 for 12 hours, but decreased in cells transfected with miR-23a (Fig. 3A). As early as 6 to 9 hours, 0.5 μg/mL miR-23a significantly reduced the caspase-3 activity that was induced by H2O2. Co-transfection of inh-23a reversed the effect. We next measured DNA fragmentation in RPE cells to confirm our observation. As shown in Figure 3B, significant DNA fragmentation was detected in cells challenged with 300 μM H2O2. H2O2 induced DNA fragmentation was inhibited in cells overexpressing miR-23a, but not in cells co-transfected with the inhibitor inh-23a. Co-transfection of scramble control Sc-inh had no effect. In addition, we performed an assay for apoptosis (Chromatin Condensation/Dead Cell Apoptosis Kit; Invitrogen) which was based on fluorescence detection of the compacted state of the chromatin in apoptotic cells. The representative picture for H2O2-treated cells showed strong bright blue fluorescence (apoptotic nuclei; Hoechst 33342 dye) and red fluorescence (dead cells; propidium iodide) (Fig. 3C). For quantification, the number of apoptotic cells was counted in at least six randomly selected fields (magnification, ×40) under the microscope with four independent samples and was plotted in a graph (Fig. 3D). Results showed that miR-23a significantly decreased the oxidative stress-induced apoptosis compared with control. These results clearly indicate that miR-23a plays an important role in cytoprotection of RPE cells by prevention of apoptosis. 
Figure 3.
 
Effect of miR-23a on apoptosis of ARPE-19 cells. ARPE-19 cells were transfected with miR-23a, inh-23a, or negative controls for 24 hours before treatment with 300 μM H2O2. (A) Caspase-3 activation was examined during a 12-hour challenge with H2O2, with a caspase-3 activity assay kit (n = 6). *P < 0.001 vs. untreated control cells; **P < 0.05 vs. 300 μM H2O2. (B) DNA fragmentation was measured by ELISA after 16 hours of exposure to H2O2. Results are expressed as the mean ± SD *P < 0.001 vs. untreated control cells; #P < 0.0001 vs. 300 μM H2O2; $P < 0.001 vs. miR-23a. (C) Apoptotic cells were visualized by using blue fluorescent Hoechst 33342 dye, and red fluorescent propidium iodide. Strong blue fluorescent spots showed apoptotic DNA cleavage. Red fluorescence showed dead cells (necrosis). Representative images were selected from four independent experiments. Scale bar, 40 μm. Magnification, ×60. (D) The average number of apoptotic cells in six microscope fields from each treatment was determined. Four experiments were performed for comparison of the different treatments. Results are expressed as the mean ± SD. *P < 0.05 vs. untreated control cells. #P < 0.01 vs. 300 μM H2O2.
Figure 3.
 
Effect of miR-23a on apoptosis of ARPE-19 cells. ARPE-19 cells were transfected with miR-23a, inh-23a, or negative controls for 24 hours before treatment with 300 μM H2O2. (A) Caspase-3 activation was examined during a 12-hour challenge with H2O2, with a caspase-3 activity assay kit (n = 6). *P < 0.001 vs. untreated control cells; **P < 0.05 vs. 300 μM H2O2. (B) DNA fragmentation was measured by ELISA after 16 hours of exposure to H2O2. Results are expressed as the mean ± SD *P < 0.001 vs. untreated control cells; #P < 0.0001 vs. 300 μM H2O2; $P < 0.001 vs. miR-23a. (C) Apoptotic cells were visualized by using blue fluorescent Hoechst 33342 dye, and red fluorescent propidium iodide. Strong blue fluorescent spots showed apoptotic DNA cleavage. Red fluorescence showed dead cells (necrosis). Representative images were selected from four independent experiments. Scale bar, 40 μm. Magnification, ×60. (D) The average number of apoptotic cells in six microscope fields from each treatment was determined. Four experiments were performed for comparison of the different treatments. Results are expressed as the mean ± SD. *P < 0.05 vs. untreated control cells. #P < 0.01 vs. 300 μM H2O2.
Mitochondrial Cytochrome c and AIF Release and Nuclear Translocation
Cytochrome c (Cyt-c) and AIF are apoptotic factors normally located in the mitochondria. Translocation of mitochondrial AIF to the nuclei has been suggested to be a caspase-independent event in apoptosis. 34,35 The leakage of Cyt-c from mitochondria into the cytoplasm is known to activate caspases and initiate apoptosis. 22,25 We therefore examined leakage of Cyt-c in our experiment after oxidative stimulation. The protein content of Cyt-c from the mitochondria-free cytosolic fraction increased in a dose-dependent manner after 16 hours of exposure to H2O2 (Fig. 4A). The elevated Cyt-c was decreased after transfection of miR-23a; the effect was reversed by co-transfection of inh-23a. The AIF protein content measured in the mitochondria-free cytosolic fraction was increased when exposed to 300 to 500 μM H2O2 for 16 hours (Fig. 4B). Transfection with miR-23a significantly prevented AIF protein release into the cytosol. 
Figure 4.
 
Mitochondrial cytochrome c and AIF release. ARPE-19 cells were transfected with miR-23a, inh-23a, or negative controls for 16 hours before treatment with 0 to 500 μM H2O2. (A) The release of mitochondrial cytochrome c was estimated by examining the cytochrome c protein content in the extracted mitochondria-free cytosolic fraction with an ELISA. (B) The AIF protein content was determined in mitochondria-free cytosolic fraction by Western blot analysis to indicate the extent of mitochondrial release. The data were presented as the mean percentage ± SD relative to 0 μM H2O2. *P < 0.05 vs. 0 μM H2O2; #P < 0.05 vs. 500 μM.
Figure 4.
 
Mitochondrial cytochrome c and AIF release. ARPE-19 cells were transfected with miR-23a, inh-23a, or negative controls for 16 hours before treatment with 0 to 500 μM H2O2. (A) The release of mitochondrial cytochrome c was estimated by examining the cytochrome c protein content in the extracted mitochondria-free cytosolic fraction with an ELISA. (B) The AIF protein content was determined in mitochondria-free cytosolic fraction by Western blot analysis to indicate the extent of mitochondrial release. The data were presented as the mean percentage ± SD relative to 0 μM H2O2. *P < 0.05 vs. 0 μM H2O2; #P < 0.05 vs. 500 μM.
Fas Is the Target of miR-23a for Inhibition of Apoptosis
The targets of miR-23a were identified through computational (TargetScan 5.1) and bioinformatics approaches hosted by the Wellcome Trust Sanger Institute (Hinxton, UK). Fas was identified as one of the highly potential miR-23a targets. The predictive binding sites of miR-23a on 3′UTRs of human Fas are shown in Figure 5A. Fas 3′UTRs with an miR-23a binding site or with seed-matching mutation were fused to a luciferase reporter gene. miR-23a significantly repressed luciferase activity, whereas nontargeted controls had no effect (Fig. 5B). This suppression effect was blocked by co-transfection of various amounts of inhibitor against miR-23a in a dose-dependent manner. At the highest dose, the reporter activity is higher than the control. This finding may be attributable to the fact that this vector-based inhibitor blocked the regulatory effect of endogenous miR-23a, which would result in increased translational activity of miR-23a 3′-UTR transcript. 
Figure 5.
 
Fas, a positive regulator of apoptosis, is targeted by miR-23a. (A) A putative target site of miR-23a is highly conserved in the Fas mRNA 3′UTR. The diagrams for construction of pMir-Luc-Fas 3′UTR luciferase reporter plasmid (Fas 3′UTR), precursor miR-23a expression clone (miR-23a), miR-23a inhibitor (inh-23a), and scrambled controls (Sc-miR, Sc-inh) are shown. (B) Fas 3′UTR, Fas 3′UTRmt, miR-23a, inh-23a, Sc-miR, or Sc-inh were transfected or co-transfected into the 293 cell line, and luciferase activity was determined. *P < 0.01 vs. Fas 3′UTR (cont); #P < 0.01 vs. miR-23a. (C) ARPE-19 cells were transfected with miR-23a or co-transfected with inh-23a for 24 hours and then treated with or without H2O2 or 300 μM tBH for 4 hours. Fas protein expression was assessed by Western blot analysis. (D) ARPE-19 cells were transfected with miR-23a, inh-23a, Sc-miR, or Sc-inh for 24 hours and then treated with 300 μM H2O2 or 300 μM tBH for 24 hours or left untreated, and an LDH release assay was performed. *P < 0.001 vs. untreated group (Control); #P < 0.0001 vs. 300 μM H2O2; $P < 0.0001 vs. 300 μM H2O2+miR-23a; ^P < 0.001 vs. 300 μM tBH; &P < 0.001 vs. 300 μM tBH+miR-23a.
Figure 5.
 
Fas, a positive regulator of apoptosis, is targeted by miR-23a. (A) A putative target site of miR-23a is highly conserved in the Fas mRNA 3′UTR. The diagrams for construction of pMir-Luc-Fas 3′UTR luciferase reporter plasmid (Fas 3′UTR), precursor miR-23a expression clone (miR-23a), miR-23a inhibitor (inh-23a), and scrambled controls (Sc-miR, Sc-inh) are shown. (B) Fas 3′UTR, Fas 3′UTRmt, miR-23a, inh-23a, Sc-miR, or Sc-inh were transfected or co-transfected into the 293 cell line, and luciferase activity was determined. *P < 0.01 vs. Fas 3′UTR (cont); #P < 0.01 vs. miR-23a. (C) ARPE-19 cells were transfected with miR-23a or co-transfected with inh-23a for 24 hours and then treated with or without H2O2 or 300 μM tBH for 4 hours. Fas protein expression was assessed by Western blot analysis. (D) ARPE-19 cells were transfected with miR-23a, inh-23a, Sc-miR, or Sc-inh for 24 hours and then treated with 300 μM H2O2 or 300 μM tBH for 24 hours or left untreated, and an LDH release assay was performed. *P < 0.001 vs. untreated group (Control); #P < 0.0001 vs. 300 μM H2O2; $P < 0.0001 vs. 300 μM H2O2+miR-23a; ^P < 0.001 vs. 300 μM tBH; &P < 0.001 vs. 300 μM tBH+miR-23a.
Since Fas has an important role in ROS-mediated apoptosis, we assessed its functional involvement in RPE cell survival and death in response to oxidative damage. Fas expression decreased in response to a lower dose of H2O2 (200 μM; Fig. 5C). Fas expression increased in 300 μM H2O2- or 300 μM tBH-treated ARPE-19 cells. Importantly, forced overexpression of miR-23a reduced Fas expression. The effect was reversed by abrogation of miR-23a, indicating a pivotal role of miR-23a in RPE survival in response to oxidant injury. Notably the inhibition of Fas by miR23a inhibitor was only partial after oxidative injury, indicating multiple signaling pathways were involved in Fas regulation. 36,37 Oxidative stress is a major stimulus in eliciting Fas and FasL expression, and modulation of Fas and FasL expression is regulated by the existence of cAMP. 37 Here, we demonstrate that Fas expression is regulated by miR-23a at posttranslational levels. Furthermore, treatment with 400 μM H2O2 or 300 μM tBH led to an increase in cell damage, as evaluated by LDH release assay (Fig. 5D). miR-23a reduced cell injury when compared with that of the scrambled control. ARPE-19 cells were co-transfected with an antisense miR-23a-specific inhibitor (inh-23a) to block miR-23a expression. Inh-23a abolished the miR-23a-induced cytoprotective effects. Taken together, these results demonstrated that Fas is the target of miR-23a expression for inhibition of apoptosis. 
Discussion
The novel findings of this study are summarized as follows. First, we identified that miR-23a expression was downregulated in macular RPE cells from AMD patients compared to normal donors. Second, we showed that forced overexpression of miR-23a reduced the cell death induced by H2O2. The protective effect of miR-23a was blocked by miR-23a inhibition. Finally, we identified that miR-23a binds to 3′UTR of Fas, an apoptotic factor involved in ROS-mediated cell death. Downregulation of Fas by miR-23a could help to protect RPE cells from oxidative damage. For the first time, we showed an antiapoptotic effect of miR-23a against oxidative injury and the expression changes of miR-23a could be very important in ROS-mediated cell death/survival and gene expression. 
miR-23a plays a critical role in the regulation of development, 20 differentiation, 22 cell growth, and apoptosis. 21 Our results indicated that miR-23a was downregulated in RPE cells from AMD eyes. In addition, we demonstrated that miR-23a was downregulated in primary cultured RPE and ARPE-19 cells at a higher dose of H2O2. ROS-mediated oxidative damage is thought to play a crucial role in AMD. 11,38,39 Our results showed that with overexpression of miR-23a, RPE cells were resistant to oxidative stress-induced cell death, caspase-3 activity, and DNA fragmentation. Oxidative injury is associated with apoptosis. Cytochrome c and AIF normally located in the mitochondria and their release into the cytosol are initiated by apoptosis. 34 Cytochrome c and AIF protein release into the cytosol was elevated in oxidative conditions, but decreased after transfection of miR-23a. This result indicated that an alternative pathway of programmed cell death, independent of caspase activation, was inhibited by miR-23a. Furthermore, forced overexpression of miR-23a in ARPE-19 cells markedly reduced cell damage induced by H2O2 or tBH, as evaluated by LDH release assay (Fig. 5D). Inhibition of miR-23a resulted in a significant increase in cell damage. Chabra et al. 40 showed that overexpression of the miR-23a, 27a, 24-2 cluster in HEK293T cells induces caspase-dependent and -independent apoptosis. However, expression of miR23a was very low, whereas the expression levels of miR24-2 and miR27a were significantly higher after transfection of the cluster. The induction of apoptosis may be due to the upregulation of miR-27a and miR-24-2. FADD protein, the target of miR-27a, is a key death receptor adaptor molecule. In our study, miR-23a clearly played an important role in cytoprotection of ARPE-19 cells. Nevertheless, the physiological and pharmacological significance of miR-23a in H2O2-mediated injury responses in vivo should be verified in future studies. 
Oxidative, particularly photo-oxidative, processes are critical in pathogenesis and development of eye disease such as retinal degeneration. 39,41 43 Multiple oxidation-sensitive genes and factors are induced when RPE cells are exposed to ROS. 44 46 Oxidant-induced gene regulation has been extensively studied at epigenetic and transcriptional levels. 15,47,48 More recently, regulation of gene expression at the posttranscriptional level has been thought to be just as important as epigenetic and transcriptional controls. 49 However, the effects of ROS on gene expression regulation at the posttranscriptional level, such as translational regulation by miRNA, are currently uncertain. The activation of the Fas death receptor and apoptotic pathway is stimulated by oxidants. 50 Interaction between FasL and an agonistic anti-Fas antibody to Fas initiates a signal transduction pathway for apoptosis. 51,52 Through computational analysis, 3′UTR of Fas has the putative miR-23a binding sequence. Coincidentally, increased Fas and FasL expression were detected in photoreceptors 19 and in the RPE monolayer of the choroidal neovascular membranes from patients with AMD. 53 Fas has also been detected to be upregulated in AMD, mimicking the Ccl2/Cx3cr1 double-knockout mouse model. 54 The phenomenon of miR-23a downregulation in parallel with upregulation of Fas, suggesting that a possible pathologic cell death pathway may contribute to the development of AMD. 
Our results indicated that Fas was indeed a functional target gene of miR-23a that is involved in miR-23a-mediated protective effects on RPE cell injury elicited by H2O2. Our novel findings may have extensive implications for the diagnosis and treatment of a variety of eye diseases related to ROS, such as AMD. 
Footnotes
 Disclosure: H. Lin, None; J. Qian, None; A.C. Castillo, None; B. Long, None; K. T. Keyes, None; G. Chen, None; Y. Ye, None
References
Bartel DP . MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004;116:281–297. [CrossRef] [PubMed]
Divakaran V Mann DL . The emerging role of microRNAs in cardiac remodeling and heart failure. Circ Res. 2008;103:1072–1083. [CrossRef] [PubMed]
van Rooij E Olson EN . MicroRNAs: powerful new regulators of heart disease and provocative therapeutic targets. J Clin Invest. 2007:2369–2376.
Karali M Peluso I Marigo V Banfi S . Identification and characterization of microRNAs expressed in the mouse eye. Invest Ophthalmol Vis Sci. 2007;48:509–515. [CrossRef] [PubMed]
Li X Carthew RW . A microRNA mediates EGF receptor signaling and promotes photoreceptor differentiation in the Drosophila eye. Cell. 2005;123:1267–1277. [CrossRef] [PubMed]
Eiring AM Harb JG Neviani P . miR-328 functions as an RNA decoy to modulate hnRNP E2 regulation of mRNA translation in leukemic blasts. Cell. 2010;140:652–665. [CrossRef] [PubMed]
Martello G Rosato A Ferrari F . A MicroRNA targeting dicer for metastasis control. Cell. 2010;141:1195–1207. [CrossRef] [PubMed]
Loscher CJ Hokamp K Wilson JH . A common microRNA signature in mouse models of retinal degeneration. Exp Eye Res. 2008;87:529–534. [CrossRef] [PubMed]
Cheng Y Liu X Zhang S Lin Y Yang J Zhang C . MicroRNA-21 protects against the H(2)O(2)-induced injury on cardiac myocytes via its target gene PDCD4. J Mol Cell Cardiol. 2009;47:5–14. [CrossRef] [PubMed]
Tang Y Zheng J Sun Y Wu Z Liu Z Huang G . MicroRNA-1 regulates cardiomyocyte apoptosis by targeting Bcl-2. Int Heart J. 2009;50:377–387. [CrossRef] [PubMed]
Winkler BS Boulton ME Gottsch JD Sternberg P . Oxidative damage and age-related macular degeneration. Mol Vis. 1999;5:32. [PubMed]
Hollyfield JG . Age-related macular degeneration: the molecular link between oxidative damage, tissue-specific inflammation and outer retinal disease: the Proctor lecture. Invest Ophthalmol Vis Sci. 2010;51:1275–1281. [CrossRef] [PubMed]
Cai J Wu M Nelson KC Sternberg PJr Jones DP . Oxidant-induced apoptosis in cultured human retinal pigment epithelial cells. Invest Ophthalmol Vis Sci. 1999;40:959–966. [PubMed]
Kim MH Chung J Yang JW Chung SM Kwag NH Yoo JS . Hydrogen peroxide-induced cell death in a human retinal pigment epithelial cell line, ARPE-19. Korean J Ophthalmol. 2003;17:19–28. [CrossRef] [PubMed]
Weigel AL Handa JT Hjelmeland LM . Microarray analysis of H2O2-, HNE-, or tBH-treated ARPE-19 cells. Free Radic Biol Med. 2002;33:1419–1432. [CrossRef] [PubMed]
Pocrnich CE Liu H Feng M Peng T Feng Q Hutnik CM . p38 mitogen-activated protein kinase protects human retinal pigment epithelial cells exposed to oxidative stress. Can J Ophthalmol. 2009;44:431–436. [CrossRef] [PubMed]
Zareba M Raciti MW Henry MM Sarna T Burke JM . Oxidative stress in ARPE-19 cultures: do melanosomes confer cytoprotection? Free Radic Biol Med. 2006;40:87–100. [CrossRef] [PubMed]
Ashkenazi A Dixit VM . Apoptosis control by death and decoy receptors. Curr Opin Cell Biol. 1999;11:255–260. [CrossRef] [PubMed]
Dunaief JL Dentchev T Ying GS Milam AH . The role of apoptosis in age-related macular degeneration. Arch Ophthalmol. 2002;120:1435–1442. [CrossRef] [PubMed]
Lin ST Fu YH . miR-23 regulation of lamin B1 is crucial for oligodendrocyte development and myelination. Dis Model Mech. 2009;2:178–188. [CrossRef] [PubMed]
Cheng AM Byrom MW Shelton J Ford LP . Antisense inhibition of human miRNAs and indications for an involvement of miRNA in cell growth and apoptosis. Nucleic Acids Res. 2005;33:1290–1297. [CrossRef] [PubMed]
Kawasaki H Taira K . Hes1 is a target of microRNA-23 during retinoic-acid-induced neuronal differentiation of NT2 cells. Nature. 2003;423:838–842. [CrossRef] [PubMed]
Gao P Tchernyshyov I Chang TC . c-Myc suppression of miR-23a/b enhances mitochondrial glutaminase expression and glutamine metabolism. Nature. 2009;458:762–765. [CrossRef] [PubMed]
Ye Y Hu Z Lin Y Zhang C Perez-Polo JR . Downregulation of microRNA-29 by antisense inhibitors and a PPAR-gamma agonist protects against myocardial ischemia-reperfusion injury. Cardiovasc Res. 2010;87:535–544. [CrossRef] [PubMed]
Cheng Y Ji R Yue J . MicroRNAs are aberrantly expressed in hypertrophic heart: do they play a role in cardiac hypertrophy? Am J Pathol. 2007;170:1831–1840. [CrossRef] [PubMed]
Ji R Cheng Y Yue J . MicroRNA expression signature and antisense-mediated depletion reveal an essential role of MicroRNA in vascular neointimal lesion formation. Circ Res. 2007;100:1579–1588. [CrossRef] [PubMed]
Kutty RK Samuel W Jaworski C . MicroRNA expression in human retinal pigment epithelial (ARPE-19) cells: increased expression of microRNA-9 by N-(4-hydroxyphenyl)retinamide. Mol Vis. 2010;16:1475–1486. [PubMed]
Faghiri Z Bazan NG . PI3K/Akt and mTOR/p70S6K pathways mediate neuroprotectin D1-induced retinal pigment epithelial cell survival during oxidative stress-induced apoptosis. Exp Eye Res. 2010;90:718–725. [CrossRef] [PubMed]
Tsao YP Ho TC Chen SL Cheng HC . Pigment epithelium-derived factor inhibits oxidative stress-induced cell death by activation of extracellular signal-regulated kinases in cultured retinal pigment epithelial cells. Life Sci. 2006;79:545–550. [CrossRef] [PubMed]
Bose K Bhaumik G Ghosh R . Chronic low dose exposure to hydrogen peroxide changes sensitivity of V79 cells to different damaging agents. Indian J Exp Biol. 2003;41:832–836. [PubMed]
Garg TK Chang JY . Oxidative stress causes ERK phosphorylation and cell death in cultured retinal pigment epithelium: prevention of cell death by AG126 and 15-deoxy-delta 12, 14-PGJ2. BMC Ophthalmol. 2003;3:5. [CrossRef] [PubMed]
Watanabe M Hitomi M van der Wee K . The pros and cons of apoptosis assays for use in the study of cells, tissues, and organs. Microsc Microanal. 2002;8:375–391. [CrossRef] [PubMed]
Stadelmann C Lassmann H . Detection of apoptosis in tissue sections. Cell Tissue Res. 2000;301:19–31. [CrossRef] [PubMed]
Chang HY Yang X . Proteases for cell suicide: functions and regulation of caspases. Microbiol Mol Biol Rev. 2000;64:821–846. [CrossRef] [PubMed]
Joza N Susin SA Daugas E . Essential role of the mitochondrial apoptosis-inducing factor in programed cell death. Nature. 2001;410:549–554. [CrossRef] [PubMed]
Kasibhatla S Genestier L Green DR . Regulation of fas-ligand expression during activation-induced cell death in T lymphocytes via nuclear factor kappaB. J Biol Chem. 1999;274:987–992. [CrossRef] [PubMed]
Facchinetti F Furegato S Terrazzino S Leon A . H(2)O(2) induces upregulation of Fas and Fas ligand expression in NGF-differentiated PC12 cells: modulation by cAMP. J Neurosci Res. 2002;69:178–188. [CrossRef] [PubMed]
Cai J Nelson KC Wu M Sternberg PJr Jones DP . Oxidative damage and protection of the RPE. Prog Retin Eye Res. 2000;19:205–221. [CrossRef] [PubMed]
Williams DL . Oxidative stress and the eye. Vet Clin North Am Small Anim Pract. 2008;38:179–192, vii. [CrossRef] [PubMed]
Chhabra R Adlakha YK Hariharan M Scaria V Saini N . Upregulation of miR-23a–27a-24–2 cluster induces caspase-dependent and -independent apoptosis in human embryonic kidney cells. PLoS One. 2009;4:e5848. [CrossRef] [PubMed]
Wiktorowska-Owczarek A Nowak JZ . Pathogenesis and prophylaxis of AMD: focus on oxidative stress and antioxidants [in Polish]. Postepy Hig Med Dosw (Online) 2010;64:333–343. [PubMed]
Janik-Papis K Ulinska M Krzyzanowska A . Role of oxidative mechanisms in the pathogenesis of age-related macular degeneration (in Polish). Klin Oczna 2009;111:168–173. [PubMed]
He S Yaung J Kim YH Barron E Ryan SJ Hinton DR . Endoplasmic reticulum stress induced by oxidative stress in retinal pigment epithelial cells. Graefes Arch Clin Exp Ophthalmol. 2008;246:677–683. [CrossRef] [PubMed]
Weigel AL Ida H Boylan SA Hjelmeland LM . Acute hyperoxia-induced transcriptional response in the mouse RPE/choroid. Free Radic Biol Med. 2003;35:465–474. [CrossRef] [PubMed]
Joffre C Leclere L Buteau B . Oxysterols induced inflammation and oxidation in primary porcine retinal pigment epithelial cells. Curr Eye Res. 2007;32:271–280. [CrossRef] [PubMed]
Alizadeh M Wada M Gelfman CM Handa JT Hjelmeland LM . Downregulation of differentiation specific gene expression by oxidative stress in ARPE-19 cells. Invest Ophthalmol Vis Sci. 2001;42:2706–2713. [PubMed]
Cerda S Weitzman SA . Influence of oxygen radical injury on DNA methylation. Mutat Res. 1997;386:141–152. [CrossRef] [PubMed]
Vandenbroucke K Robbens S Vandepoele K Inze D Van de Peer Y Van Breusegem F . Hydrogen peroxide-induced gene expression across kingdoms: a comparative analysis. Mol Biol Evol. 2008;25:507–516. [CrossRef] [PubMed]
Halbeisen RE Galgano A Scherrer T Gerber AP . Post-transcriptional gene regulation: from genome-wide studies to principles. Cell Mol Life Sci. 2008;65:798–813. [CrossRef] [PubMed]
Jiang S Wu MW Sternberg P Jones DP . Fas mediates apoptosis and oxidant-induced cell death in cultured hRPE cells. Invest Ophthalmol Vis Sci. 2000;41:645–655. [PubMed]
Nagata S . Apoptosis by death factor. Cell. 1997;88:355–365. [CrossRef] [PubMed]
Chinnaiyan AM Dixit VM . Portrait of an executioner: the molecular mechanism of FAS/APO-1-induced apoptosis. Semin Immunol. 1997;9:69–76. [CrossRef] [PubMed]
Hinton DR He S Lopez PF . Apoptosis in surgically excised choroidal neovascular membranes in age-related macular degeneration. Arch Ophthalmol. 1998;116:203–209. [CrossRef] [PubMed]
Cao X Liu M Tuo J Shen D Chan CC . The effects of quercetin in cultured human RPE cells under oxidative stress and in Ccl2/Cx3cr1 double deficient mice. Exp Eye Res. 2010;91:15–25. [CrossRef] [PubMed]
Figure 1.
 
Changes in RPE cells from the macula of AMD and age-matched (normal) control eyes. (A) Expression levels of miR-23a in RPE cells from normal and AMD donor eyes were analyzed by qRT-PCR. The levels are expressed relative to normal values in four independent experiments. Mean levels in control groups (normal) were defined as 100%. *P < 0.001 versus normal. (B) Northern blot analysis confirmed aberrant miR-23a expression levels in RPE cells. The small housekeeping RNA U6 (106 nt) was used as a loading control. *P < 0.002 versus normal. The expression levels of miR-23a in primary cultured RPE (C) and ARPE-19 (D) cells were measured after 4 hours of exposure to 0, 100, 200, 300, 400, and 500 μM H2O2 (n = 4). Mean levels in the control group (0 μM H2O2) were defined as 100%. *P < 0.05 vs. 0 μM H2O2.
Figure 1.
 
Changes in RPE cells from the macula of AMD and age-matched (normal) control eyes. (A) Expression levels of miR-23a in RPE cells from normal and AMD donor eyes were analyzed by qRT-PCR. The levels are expressed relative to normal values in four independent experiments. Mean levels in control groups (normal) were defined as 100%. *P < 0.001 versus normal. (B) Northern blot analysis confirmed aberrant miR-23a expression levels in RPE cells. The small housekeeping RNA U6 (106 nt) was used as a loading control. *P < 0.002 versus normal. The expression levels of miR-23a in primary cultured RPE (C) and ARPE-19 (D) cells were measured after 4 hours of exposure to 0, 100, 200, 300, 400, and 500 μM H2O2 (n = 4). Mean levels in the control group (0 μM H2O2) were defined as 100%. *P < 0.05 vs. 0 μM H2O2.
Figure 2.
 
Effect of miR-23a on viability of ARPE-19 cells. (A) ARPE-19 cells were transfected with pre-miR-23a (miR-23a; 0.5 μg/mL) or various concentrations of inhibitor (inh-23a; 25, 50, 100, and 150 ng/mL) for 24 hours (n = 4). miR-23a expression levels were assessed by qRT-PCR after 24 hours of transfection (n = 4). *P < 0.001 versus control. #P < 0.01 versus miR-23a. (B) ARPE-19 cells were transfected with miR-23a (0.5 μg/mL), SC-miR (0.5 μg/mL), SC-inh (150 ng/mL), or inh-23a (25, 50,100, and 150 ng/mL) for 16 hours. Cell viability was determined by MTT assay (n = 8). *P < 0.001 versus control. Results are expressed as percentages of the control, taken as 100%. (C) ARPE-19 cells were transfected with miR-23a and co-transfected with inh-23a or scrambled controls for 24 hours before challenge with H2O2 for 16 hours. Cell viability was determined by MTT assay (n = 8). (D) Cell death was assessed by trypan blue (n = 7). *P < 0.0001 versus control; #P < 0.0001 vs. 300 μM H2O2; $P < 0.001 versus miR-23a.
Figure 2.
 
Effect of miR-23a on viability of ARPE-19 cells. (A) ARPE-19 cells were transfected with pre-miR-23a (miR-23a; 0.5 μg/mL) or various concentrations of inhibitor (inh-23a; 25, 50, 100, and 150 ng/mL) for 24 hours (n = 4). miR-23a expression levels were assessed by qRT-PCR after 24 hours of transfection (n = 4). *P < 0.001 versus control. #P < 0.01 versus miR-23a. (B) ARPE-19 cells were transfected with miR-23a (0.5 μg/mL), SC-miR (0.5 μg/mL), SC-inh (150 ng/mL), or inh-23a (25, 50,100, and 150 ng/mL) for 16 hours. Cell viability was determined by MTT assay (n = 8). *P < 0.001 versus control. Results are expressed as percentages of the control, taken as 100%. (C) ARPE-19 cells were transfected with miR-23a and co-transfected with inh-23a or scrambled controls for 24 hours before challenge with H2O2 for 16 hours. Cell viability was determined by MTT assay (n = 8). (D) Cell death was assessed by trypan blue (n = 7). *P < 0.0001 versus control; #P < 0.0001 vs. 300 μM H2O2; $P < 0.001 versus miR-23a.
Figure 3.
 
Effect of miR-23a on apoptosis of ARPE-19 cells. ARPE-19 cells were transfected with miR-23a, inh-23a, or negative controls for 24 hours before treatment with 300 μM H2O2. (A) Caspase-3 activation was examined during a 12-hour challenge with H2O2, with a caspase-3 activity assay kit (n = 6). *P < 0.001 vs. untreated control cells; **P < 0.05 vs. 300 μM H2O2. (B) DNA fragmentation was measured by ELISA after 16 hours of exposure to H2O2. Results are expressed as the mean ± SD *P < 0.001 vs. untreated control cells; #P < 0.0001 vs. 300 μM H2O2; $P < 0.001 vs. miR-23a. (C) Apoptotic cells were visualized by using blue fluorescent Hoechst 33342 dye, and red fluorescent propidium iodide. Strong blue fluorescent spots showed apoptotic DNA cleavage. Red fluorescence showed dead cells (necrosis). Representative images were selected from four independent experiments. Scale bar, 40 μm. Magnification, ×60. (D) The average number of apoptotic cells in six microscope fields from each treatment was determined. Four experiments were performed for comparison of the different treatments. Results are expressed as the mean ± SD. *P < 0.05 vs. untreated control cells. #P < 0.01 vs. 300 μM H2O2.
Figure 3.
 
Effect of miR-23a on apoptosis of ARPE-19 cells. ARPE-19 cells were transfected with miR-23a, inh-23a, or negative controls for 24 hours before treatment with 300 μM H2O2. (A) Caspase-3 activation was examined during a 12-hour challenge with H2O2, with a caspase-3 activity assay kit (n = 6). *P < 0.001 vs. untreated control cells; **P < 0.05 vs. 300 μM H2O2. (B) DNA fragmentation was measured by ELISA after 16 hours of exposure to H2O2. Results are expressed as the mean ± SD *P < 0.001 vs. untreated control cells; #P < 0.0001 vs. 300 μM H2O2; $P < 0.001 vs. miR-23a. (C) Apoptotic cells were visualized by using blue fluorescent Hoechst 33342 dye, and red fluorescent propidium iodide. Strong blue fluorescent spots showed apoptotic DNA cleavage. Red fluorescence showed dead cells (necrosis). Representative images were selected from four independent experiments. Scale bar, 40 μm. Magnification, ×60. (D) The average number of apoptotic cells in six microscope fields from each treatment was determined. Four experiments were performed for comparison of the different treatments. Results are expressed as the mean ± SD. *P < 0.05 vs. untreated control cells. #P < 0.01 vs. 300 μM H2O2.
Figure 4.
 
Mitochondrial cytochrome c and AIF release. ARPE-19 cells were transfected with miR-23a, inh-23a, or negative controls for 16 hours before treatment with 0 to 500 μM H2O2. (A) The release of mitochondrial cytochrome c was estimated by examining the cytochrome c protein content in the extracted mitochondria-free cytosolic fraction with an ELISA. (B) The AIF protein content was determined in mitochondria-free cytosolic fraction by Western blot analysis to indicate the extent of mitochondrial release. The data were presented as the mean percentage ± SD relative to 0 μM H2O2. *P < 0.05 vs. 0 μM H2O2; #P < 0.05 vs. 500 μM.
Figure 4.
 
Mitochondrial cytochrome c and AIF release. ARPE-19 cells were transfected with miR-23a, inh-23a, or negative controls for 16 hours before treatment with 0 to 500 μM H2O2. (A) The release of mitochondrial cytochrome c was estimated by examining the cytochrome c protein content in the extracted mitochondria-free cytosolic fraction with an ELISA. (B) The AIF protein content was determined in mitochondria-free cytosolic fraction by Western blot analysis to indicate the extent of mitochondrial release. The data were presented as the mean percentage ± SD relative to 0 μM H2O2. *P < 0.05 vs. 0 μM H2O2; #P < 0.05 vs. 500 μM.
Figure 5.
 
Fas, a positive regulator of apoptosis, is targeted by miR-23a. (A) A putative target site of miR-23a is highly conserved in the Fas mRNA 3′UTR. The diagrams for construction of pMir-Luc-Fas 3′UTR luciferase reporter plasmid (Fas 3′UTR), precursor miR-23a expression clone (miR-23a), miR-23a inhibitor (inh-23a), and scrambled controls (Sc-miR, Sc-inh) are shown. (B) Fas 3′UTR, Fas 3′UTRmt, miR-23a, inh-23a, Sc-miR, or Sc-inh were transfected or co-transfected into the 293 cell line, and luciferase activity was determined. *P < 0.01 vs. Fas 3′UTR (cont); #P < 0.01 vs. miR-23a. (C) ARPE-19 cells were transfected with miR-23a or co-transfected with inh-23a for 24 hours and then treated with or without H2O2 or 300 μM tBH for 4 hours. Fas protein expression was assessed by Western blot analysis. (D) ARPE-19 cells were transfected with miR-23a, inh-23a, Sc-miR, or Sc-inh for 24 hours and then treated with 300 μM H2O2 or 300 μM tBH for 24 hours or left untreated, and an LDH release assay was performed. *P < 0.001 vs. untreated group (Control); #P < 0.0001 vs. 300 μM H2O2; $P < 0.0001 vs. 300 μM H2O2+miR-23a; ^P < 0.001 vs. 300 μM tBH; &P < 0.001 vs. 300 μM tBH+miR-23a.
Figure 5.
 
Fas, a positive regulator of apoptosis, is targeted by miR-23a. (A) A putative target site of miR-23a is highly conserved in the Fas mRNA 3′UTR. The diagrams for construction of pMir-Luc-Fas 3′UTR luciferase reporter plasmid (Fas 3′UTR), precursor miR-23a expression clone (miR-23a), miR-23a inhibitor (inh-23a), and scrambled controls (Sc-miR, Sc-inh) are shown. (B) Fas 3′UTR, Fas 3′UTRmt, miR-23a, inh-23a, Sc-miR, or Sc-inh were transfected or co-transfected into the 293 cell line, and luciferase activity was determined. *P < 0.01 vs. Fas 3′UTR (cont); #P < 0.01 vs. miR-23a. (C) ARPE-19 cells were transfected with miR-23a or co-transfected with inh-23a for 24 hours and then treated with or without H2O2 or 300 μM tBH for 4 hours. Fas protein expression was assessed by Western blot analysis. (D) ARPE-19 cells were transfected with miR-23a, inh-23a, Sc-miR, or Sc-inh for 24 hours and then treated with 300 μM H2O2 or 300 μM tBH for 24 hours or left untreated, and an LDH release assay was performed. *P < 0.001 vs. untreated group (Control); #P < 0.0001 vs. 300 μM H2O2; $P < 0.0001 vs. 300 μM H2O2+miR-23a; ^P < 0.001 vs. 300 μM tBH; &P < 0.001 vs. 300 μM tBH+miR-23a.
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×