October 2011
Volume 52, Issue 11
Free
Retina  |   October 2011
Effects of Shear Stress on the Gene Expressions of Endothelial Nitric Oxide Synthase, Endothelin-1, and Thrombomodulin in Human Retinal Microvascular Endothelial Cells
Author Affiliations & Notes
  • Akihiro Ishibazawa
    From the Departments of Ophthalmology and
  • Taiji Nagaoka
    From the Departments of Ophthalmology and
  • Tatsuhisa Takahashi
    Mathematical Information Science, Asahikawa Medical University, Asahikawa, Japan;
  • Kimiko Yamamoto
    Department of Biomedical Engineering, Graduate School of Medicine, University of Tokyo, Tokyo, Japan; and
  • Akira Kamiya
    Department of Biomedical Engineering, Graduate School of Medicine, University of Tokyo, Tokyo, Japan; and
  • Joji Ando
    Laboratory of Biomedical Engineering, Dokkyo Medical University, Tochigi, Japan.
  • Akitoshi Yoshida
    From the Departments of Ophthalmology and
  • Corresponding author: Taiji Nagaoka, Department of Ophthalmology, Asahikawa Medical University, Midorigaoka Higashi 2-1-1-1, Asahikawa 078-8510, Japan; nagaoka@asahikawa-med.ac.jp
Investigative Ophthalmology & Visual Science October 2011, Vol.52, 8496-8504. doi:10.1167/iovs.11-7686
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Akihiro Ishibazawa, Taiji Nagaoka, Tatsuhisa Takahashi, Kimiko Yamamoto, Akira Kamiya, Joji Ando, Akitoshi Yoshida; Effects of Shear Stress on the Gene Expressions of Endothelial Nitric Oxide Synthase, Endothelin-1, and Thrombomodulin in Human Retinal Microvascular Endothelial Cells. Invest. Ophthalmol. Vis. Sci. 2011;52(11):8496-8504. doi: 10.1167/iovs.11-7686.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

Purpose.: Physiological shear stress is higher in the retinal microcirculatory network than in other organs. The effects of laminar shear stress on gene expression in human retinal microvascular endothelial cells (HRMECs) was investigated.

Methods.: Cultured HRMECs on glass plates were exposed to a laminar shear stress of 0, 1.5, 6, 15, 30, 60, or 100 dyne/cm2 for 24 hours and to 60 dyne/cm2 for 0, 1, 3, 6, 12, 24, or 48 hours. The mRNA expressions of endothelial nitric oxide synthase (eNOS), endothelin-1 (ET-1), and thrombomodulin (TM) in the HRMECs were evaluated using real-time reverse transcription polymerase chain reaction.

Results.: The HRMECs elongated and aligned parallel with the flow direction based on the shear stress and exposure times. The expression of eNOS mRNA gradually increased and became saturated at 60 dyne/cm2; ET-1 mRNA expression increased at 1.5 dyne/cm2 but decreased below that of the static control at shear stresses of 30 dyne/cm2 or more. TM mRNA expression in response to shear stress increased linearly from 0 to 100 dyne/cm2. A shear stress of 60 dyne/cm2 for 6 hours or more promoted eNOS and TM mRNA expression but suppressed ET-1 mRNA expression in HRMECs.

Conclusions.: Long-term exposure to a physiological shear stress in the retinal arterioles up-regulated eNOS and TM mRNA expressions and downregulated ET-1 mRNA expression in HRMECs. These results suggest that shear stress may be associated with the vasoregulatory and antithrombotic properties of retinal vessels under physiological conditions present during retinal circulation.

The endothelial cells (ECs) covering the luminal surface of the blood vessel wall are continuously exposed to a tangential force (i.e., fluid or wall shear stress), generated intrinsically by blood flow. The ECs respond to shear stress and change their morphology, function, and gene expressions to regulate blood flow and maintain tissue homeostasis. 1 3 The responses of ECs to shear stress are also associated with blood flow-dependent phenomena, including vascular remodeling, 4 angiogenesis, 5 atherosclerosis, 6,7 and thromboembolism. 8 Previous clinical studies have reported that retinal circulation is impaired in patients with retinal vascular diseases, such as diabetic retinopathy (DR). 9 11 Recently, we found that not only the retinal blood flow (RBF), but also the shear rate (an index of shear stress) decreased in the retinal arterioles of patients with type 2 diabetes without retinopathy, suggesting that endothelial dysfunction of the retinal arterioles may be associated with a decrease in retinal blood flow and wall shear stress in patients with diabetes. 12 However, a few studies have reported the relationship between shear stress and the functions of the retinal vascular ECs: shear-induced hydraulic conductivity 13 and the effects of pulsatile flow in a pericyte-coculture model of the retinal vasculature 14,15 were the only evidence that were obtained. These studies did not elucidate the effects of “laminar” shear stress generated by laminar blood flow in the retinal vessels. 
Using a laser Doppler velocimetry system, 16 we previously reported that the average wall shear stress values in the first-order retinal arterioles and venules were 54 dyne/cm2 and 24 dyne/cm2, respectively, in healthy humans. 17 These findings indicated for the first time that the arteriovenous distribution of wall shear stress in the retinal microcirculatory network is higher than in other vascular beds in other tissues, such as the aorta and the carotid, brachial, and femoral arteries (approximately 15 dyne/cm2). 18 However, how shear stress affects ECs in the retinal microvasculature remains unclear. 
To elucidate the pathogenesis of retinal vascular diseases, the gene regulation involved in endothelial function in relation to shear stress must be understood. Endothelial nitric oxide synthase (eNOS), endothelin-1 (ET-1), and thrombomodulin (TM) are known to be important genes and critical mediators of local vascular tone and natural anticoagulation in microvascular ECs. In the present study, we investigated how cultured human retinal microvascular endothelial cells (HRMECs) respond to various magnitudes and durations of laminar shear stress in terms of eNOS, ET-1, and TM gene expressions. 
Methods
Cell Culture
The primary HRMECs (ACBRI 181; Cell Systems Corporation, Kirkland, WA) were cultured at the bottom of 1% gelatin-coated flasks containing medium-199 (M-199) supplemented with 15% fetal bovine serum, 2 mM l-glutamine, 50 U/mL penicillin, 50 μg/mL streptomycin (Invitrogen-Gibco, Grand Island, NY), 50 μg/mL heparin (Sigma-Aldrich Co., St. Louis, MO), and 30 μg/mL endothelial cell growth factor (BD Biosciences, San Jose, CA) in an incubator at 37 °C with 5% CO2. The cultured cells were routinely passaged by trypsinization in a 0.05% trypsin-2 mM EDTA solution before reaching confluence. At the final stage, the cells were seeded at a density of 2.0 × 104 cells per cm2 on each glass plate coated with 1% gelatin. For these experiments, we used all the cells from the 7th to 10th passages. The purity of the HRMECs was determined using the typical cobblestone morphology of ECs and immunofluorescent staining for von Willebrand Factor. This study was performed in accordance with the tenets of the Declaration of Helsinki. 
Shear Stress Experiments
To expose the confluent monolayer of the HRMECs to the shear stress associated with fluid flow, we used a parallel-plate type of flow chamber (Fig. 1A). 19 One side of the flow chamber consisted of a glass plate on which the HRMECs were cultured; the other side was a polycarbonate plate. These two flat surfaces were held 0.02 cm apart by a polytetrafluoroethylene gasket. The closed circuit including the flow chamber, a peristaltic pump (SJ1220; ATTO Co., Tokyo, Japan), and a medium reservoir was connected in series using silicone tubes. These experiments were performed in an incubator at 37 °C with 5% CO2. Based on the structure of the flow chamber (Fig. 1B), the shear rate (γ̇, 1/s) and shear stress (τ, dyne/cm2) acting on the cells were calculated using the following formulas: γ̇ = 6/(a2b) and τ = μ · γ̇, where is the volumetric flow rate (mL/s), a and b are the height and width (cm) of the channel in the cross section, and μ is the viscosity of the perfused fluid. The fluid (M-199) enters through a small-caliber entrance and then flows through a rectangular space (5.5 cm) in the upper plate. Passage through this space alters the fluid-flow into a flow with a width of 5.5 cm. Then, the flow expands into a flat rectangular chamber. In preliminary experiments, 19 the characteristics of flow through a chamber containing a glass plate were visually examined at various perfusion rates by circulating medium containing suspended polystyrene flakes. The flow patterns, as analyzed using a high-speed video camera, showed no visible turbulence, and the flakes moved at a constant rate at all locations on the glass plate. In the present study, the flow was assumed to be laminar in the channel, because the Reynolds number was approximately 22 (much lower than 1000) even at the highest flow velocity with low viscosity. 20 Therefore, almost all the HRMECs (excluding only a small portion of the cells at the edge of the glass plate) were exposed to the laminar shear stress calculated using the above-mentioned formula. 
Figure 1.
 
Flow circuit system and flow chamber. (A) The closed circuit, including the flow chamber, a peristaltic pump, and a medium reservoir, are connected by silicone tubes. (B) Structure of the parallel plate type flow chamber. The shear rate (γ̇, 1/s) and shear stress (τ, dyne/cm2) acting on the cells were calculated using the formulas: γ̇ = 6/(a2b) and τ = μ · γ̇, where is the volumetric flow rate (mL/sec), a and b are the height and width (cm) of the channel in the cross section, and μ is the viscosity of the perfused fluid.
Figure 1.
 
Flow circuit system and flow chamber. (A) The closed circuit, including the flow chamber, a peristaltic pump, and a medium reservoir, are connected by silicone tubes. (B) Structure of the parallel plate type flow chamber. The shear rate (γ̇, 1/s) and shear stress (τ, dyne/cm2) acting on the cells were calculated using the formulas: γ̇ = 6/(a2b) and τ = μ · γ̇, where is the volumetric flow rate (mL/sec), a and b are the height and width (cm) of the channel in the cross section, and μ is the viscosity of the perfused fluid.
We used M-199 and M-199 containing 5% dextran 21 (MW 148,000; Sigma-Aldrich) to generate high shear stresses using media of different viscosities: 0.00945 poise for the former and 0.0378 poise for the latter. Using the low-viscosity medium, shear rates of 0, 158, and 1587 1/s were applied to generate shear stresses of 0, 1.5, and 15 dyne/cm2, respectively. Using the high-viscosity medium, shear rates of 0, 158, 794, 1587, and 2645 1/s were applied to generate shear stresses of 0, 6, 30, 60, and 100 dyne/cm2, respectively. To ensure the velocity of fluid flow through the chamber, the volume of flow was monitored using an ultrasonic transit time flow sensor (T106; Transonic Systems Inc., Ithaca, NY). 
Imaging and Analysis
After exposure to flow, the glass plates on which the HRMECs were cultured were removed from the flow chamber and rinsed in prewarmed phosphate buffered saline. Images of random optical fields away from the glass plate edge were obtained using an inverted microscope (Axiovert 40 C; Carl Zeiss, Oberkochen, Germany) with a 10 × phase objective lens. Software (AxioVision 4.5; Carl Zeiss) was used to analyze the images. The lengths of the major and minor axes of each cell were calculated. The aspect ratio (major axis/minor axis) for each cell and the angle difference between the major axis and the flow direction were calculated to elucidate the quantitative degree of cellular elongation and alignment, respectively, in response to flow. 22,23 Data were obtained for 60 cells in three images using triplicate flow experiments for each group. Each cell was treated as a separate data point for statistical purposes. 
Real-Time RT-PCR Analysis
Total RNA samples were isolated from the cells (TRI Reagent, T9424; Sigma-Aldrich). Reverse transcription (RT) was performed using a 20-μL mixture containing 1 μg of total RNA (Transcriptor First Strand cDNA Synthesis Kit; Roche, Basel, Switzerland), according to the manufacturer's protocol. After RT, real-time polymerase chain reaction (PCR) was performed (CYBR Premix EX Tag, RR041A and Smart Cycler II System; TaKaRa Biochemicals, Kyoto, Japan); the specific primer pairs are shown in Table 1. For all the amplifications, the cycling conditions were as follows: an initial denaturation period for 15 seconds at 95 °C, followed by 40 cycles of 15 seconds at 95 °C, 15 seconds at 60 °C, and 30 seconds at 72 °C. After each run, melting curves were generated to verify a specific product formation. The quantification of each gene expression signal was normalized with respect to the signal for the GAPDH gene. The relative-fold changes in the expression of each gene were determined using the 2−ΔΔCt method. 24  
Table 1.
 
Oligonucleotide Primers Used for Gene Expression Analysis by Real-Time RT-PCR
Table 1.
 
Oligonucleotide Primers Used for Gene Expression Analysis by Real-Time RT-PCR
Gene Accession Number Forward Primers, 5′–3′ Reverse Primers, 5′–3′
eNOS (NOS3) NM_000603 GGGACCACATAGGTGTCTGC CCAGCACAGCTACAGTGAGG
ET-1 (EDN1) NM_001955 AGCCCTAGGTCCAAGAGAGC AGTCAGGAACCAGCAGAGGA
TM (THBD) NM_000361 AGAGCCAACTGCGAGTACCA GGAGATGCCTATGAGCAAGC
GAPDH NM_002046 ACATCATCCCTGCCTCTACTGG AGTGGGTGTCGCTGTTGAAGTC
Statistical Analysis
All values are expressed as the mean ± SD. A one-way analysis of variance (ANOVA) was used to compare the mean values for the aspect ratio, the angle difference, and the mRNA levels expressed in the control cells (in stationary medium), and stimulated cells (flow medium). When a significant F ratio was observed, Bonferroni's post hoc test was used to identify significant differences. The data points for the levels of mRNA expressions were subjected to least-squares fitting with approximate equations as a function of the shear rate or shear stress: (1) y = baseline + Δ · [1 − EXP(−x/TC)] for eNOS; (2) y = baseline + Δ · [EXP(−x/TC)] for ET-1; and (3) y = αx +β for TM, where α and β are constants and TC is the so-called “time constant” used in control engineering or electrical engineering to quantify a responsive property of a fitted curve. To elucidate the independence of the low and high viscosity groups, the differences between the observed data and the fitted curves were examined using an unpaired t-test. When the differences were significant, the fitted curves in terms of shear rates were separated. Differences were considered significant for all analyses at P < 0.05. 
Results
Morphologic Changes of HRMECs
HRMECs cultured on individual glass plates were exposed to seven levels of prolonged shear stress (0, 1.5, 6, 15, 30, 60, or 100 dyne/cm2) for 24 hours. Figure 2A shows the magnitude-dependent effects of flow on the morphology of the cultured HRMECs. Under the static (0 dyne/cm2) control condition, the cells of a confluent monolayer appeared to be polygonal and randomly disposed. In contrast, under flow conditions, the cells gradually elongated and aligned parallel to the direction of flow as the shear stress increased. Notably, the cells remained viable without desquamation even at 100 dyne/cm2. A quantitative analysis of the aspect ratio as a measure of cellular elongation is shown in Figure 2B. The aspect ratio significantly (P < 0.01) increased up until 15 dyne/cm2, whereas the aspect ratios from 30 to 100 dyne/cm2 did not differ significantly from that observed at 15 dyne/cm2. The angle difference between the major axis of each cell and the flow direction is shown in Figure 2C. Static cells appeared to be oriented randomly, with a mean angle difference of 45.4°, whereas cells exposed to 6 dyne/cm2 or more were significantly (P < 0.01) aligned, with a mean angle difference of 23.5° or less. Likewise, Figure 3A shows the time-dependent flow effects on the morphology of the HRMECs. When the cells were exposed to 60 dyne/cm2 for 0, 1, 3, 6, 12, and 24 hours, the aspect ratio (Fig. 3B) and the angle difference (Fig. 3C) changed significantly (P < 0.01) after 6 hours of exposure to flow. 
Figure 2.
 
Morphologic changes in HRMECs exposed to different magnitudes of flow. (A) HRMECs cultured on individual glass plates were exposed to seven levels of prolonged shear stress: 0 (control), 1.5, 6, 15, 30, 60, or 100 dyne/cm2 for 24 hours. The flow direction is from left to right. Scale bar, 100 μm. (B) Aspect ratio of the cells, calculated as the ratio of the length of the major axis to the length of the minor axis and used as a measure of cellular elongation. (C) Angle difference between the long axis of the cells and the horizontal flow direction, used as an indication of cell alignment. Under flow conditions with increasing shear stress, the cells gradually elongated and aligned parallel to the direction of flow. The values are expressed as the mean ± SD (n = 60 cells). *P < 0.01, compared with a static control (0 dyne/cm2).
Figure 2.
 
Morphologic changes in HRMECs exposed to different magnitudes of flow. (A) HRMECs cultured on individual glass plates were exposed to seven levels of prolonged shear stress: 0 (control), 1.5, 6, 15, 30, 60, or 100 dyne/cm2 for 24 hours. The flow direction is from left to right. Scale bar, 100 μm. (B) Aspect ratio of the cells, calculated as the ratio of the length of the major axis to the length of the minor axis and used as a measure of cellular elongation. (C) Angle difference between the long axis of the cells and the horizontal flow direction, used as an indication of cell alignment. Under flow conditions with increasing shear stress, the cells gradually elongated and aligned parallel to the direction of flow. The values are expressed as the mean ± SD (n = 60 cells). *P < 0.01, compared with a static control (0 dyne/cm2).
Figure 3.
 
Morphologic changes in HRMECs with different durations of exposure to flow. (A) The HRMECs were exposed to a shear stress of 60 dyne/cm2 for 0, 1, 3, 6, 12, or 24 hours. The flow direction is from left to right. Scale bar, 100 μm. The aspect ratio (B) and angle difference (C) of the cells were calculated to evaluate the degree of cellular elongation and alignment, respectively. Over time, the HRMECs elongated and aligned parallel to the direction of flow, especially after 6 hours of exposure. The values are expressed as mean ± SD (n = 60 cells). *P < 0.01, compared with a static control (0 hours).
Figure 3.
 
Morphologic changes in HRMECs with different durations of exposure to flow. (A) The HRMECs were exposed to a shear stress of 60 dyne/cm2 for 0, 1, 3, 6, 12, or 24 hours. The flow direction is from left to right. Scale bar, 100 μm. The aspect ratio (B) and angle difference (C) of the cells were calculated to evaluate the degree of cellular elongation and alignment, respectively. Over time, the HRMECs elongated and aligned parallel to the direction of flow, especially after 6 hours of exposure. The values are expressed as mean ± SD (n = 60 cells). *P < 0.01, compared with a static control (0 hours).
eNOS mRNA Expression in Response to Shear Stress
After individual HRMECs were exposed continuously to each level of shear stress for 24 hours, changes in eNOS mRNA expression in the HRMECs were analyzed using real-time RT-PCR. The eNOS mRNA expression level in the HRMECs gradually increased with increasing shear rates; however, the levels of eNOS mRNA expression plotted against the shear rate for the higher viscosity group were greater than those for the lower viscosity group (Fig. 4A). The low- and high-viscosity groups should have been regarded as separate groups, with P < 0.05. However, the data points for eNOS mRNA expression plotted against shear stress were not statistically divided into two groups according to the different viscosities but fell along a single approximate-exponential curve (Fig. 4B), suggesting that eNOS mRNA expression gradually increased as the shear stress increased and became almost saturated at 60 dyne/cm2
Figure 4.
 
Relationships between eNOS mRNA expression and shear rates (A) and shear stresses (B) in the HRMECs. The cells were exposed to flow with two different viscosities for 24 hours. Changes in the mRNA expressions were analyzed using real-time RT-PCR. (A) The expression of eNOS mRNA in the HRMECs gradually increased as the shear rate increased; however, the levels of eNOS mRNA expression plotted against the shear rate with the higher viscosity were greater than those with the lower viscosity. (B) The increase in the levels of eNOS mRNA expression plotted against the shear stress fell along a single approximately exponential curve. The values are expressed as mean ± SD (n = 5 or 6). *P < 0.05, **P < 0.01, compared with a static control (0 dyne/cm2). † P < 0.05, compared with 15 dyne/cm2.
Figure 4.
 
Relationships between eNOS mRNA expression and shear rates (A) and shear stresses (B) in the HRMECs. The cells were exposed to flow with two different viscosities for 24 hours. Changes in the mRNA expressions were analyzed using real-time RT-PCR. (A) The expression of eNOS mRNA in the HRMECs gradually increased as the shear rate increased; however, the levels of eNOS mRNA expression plotted against the shear rate with the higher viscosity were greater than those with the lower viscosity. (B) The increase in the levels of eNOS mRNA expression plotted against the shear stress fell along a single approximately exponential curve. The values are expressed as mean ± SD (n = 5 or 6). *P < 0.05, **P < 0.01, compared with a static control (0 dyne/cm2). † P < 0.05, compared with 15 dyne/cm2.
ET-1 mRNA Expression in Response to Shear Stress
Figure 5A shows the relationship between ET-1 mRNA expression and the shear rates. The ET-1 mRNA expression level increased at a low shear rate, whereas the expressions at much higher shear rates decreased below that at a static condition. The low- and high-viscosity groups should have been regarded as separate groups, with P < 0.05. Similarly, the ET-1 mRNA levels at 1.5 dyne/cm2 significantly (P < 0.01) increased, whereas those at higher shear stresses (30 dyne/cm2 or more) significantly (P < 0.05) decreased below that at the static condition (Fig. 5B). The changes in ET-1 mRNA expressions plotted against shear stress also fell along one monophasic curve because the data points as a function of shear stress were not statistically divided into two groups according to the different viscosities. 
Figure 5.
 
Relationship between ET-1 mRNA expression and the shear rates (A) or shear stresses (B) in HRMECs. The cells were exposed to flow with two different viscosities for 24 hours. Changes in the mRNA expressions were analyzed using real-time RT-PCR. (A) The ET-1 mRNA expression increased at a low shear rate, whereas expressions at much higher shear rates decreased below that observed under a static condition. (B) Similarly, the ET-1 mRNA levels at 1.5 dyne/cm2 significantly increased, whereas those at higher shear stresses significantly decreased below that observed under a static condition. The changes in the levels of ET-1 mRNA expression plotted against shear stress fell along a single monophasic curve. The values are mean ± SD (n = 5 or 6). *P < 0.05, **P < 0.01, compared with a static control (0 dyne/cm2).
Figure 5.
 
Relationship between ET-1 mRNA expression and the shear rates (A) or shear stresses (B) in HRMECs. The cells were exposed to flow with two different viscosities for 24 hours. Changes in the mRNA expressions were analyzed using real-time RT-PCR. (A) The ET-1 mRNA expression increased at a low shear rate, whereas expressions at much higher shear rates decreased below that observed under a static condition. (B) Similarly, the ET-1 mRNA levels at 1.5 dyne/cm2 significantly increased, whereas those at higher shear stresses significantly decreased below that observed under a static condition. The changes in the levels of ET-1 mRNA expression plotted against shear stress fell along a single monophasic curve. The values are mean ± SD (n = 5 or 6). *P < 0.05, **P < 0.01, compared with a static control (0 dyne/cm2).
TM mRNA Expression in Response to Shear Stress
TM mRNA expression gradually increased with an increasing shear rate (Fig. 6A), and the TM mRNA levels plotted against shear stress increased linearly (Fig. 6B). The low- and high-viscosity groups should have been regarded as separate groups, with P < 0.05. However, the data points as a function of shear stress could not be statistically divided into the groups classified according to the different viscosities. 
Figure 6.
 
Relationship between TM mRNA expression and shear rates (A) or shear stresses (B) in HRMECs. The cells were exposed to flow with two different viscosities for 24 hours. Changes in the mRNA expressions were analyzed using real-time RT-PCR. (A) The TM mRNA expression gradually increased with an increasing shear rate, while the expressions with higher viscosity were greater than those with the lower viscosity at the same shear rate. (B) The TM mRNA levels plotted against shear stress increased linearly. The values are the mean ± SD (n = 5 or 6). *P < 0.05, **P < 0.01, compared with a static control (0 dyne/cm2). † P < 0.05, compared with 15 dyne/cm2.
Figure 6.
 
Relationship between TM mRNA expression and shear rates (A) or shear stresses (B) in HRMECs. The cells were exposed to flow with two different viscosities for 24 hours. Changes in the mRNA expressions were analyzed using real-time RT-PCR. (A) The TM mRNA expression gradually increased with an increasing shear rate, while the expressions with higher viscosity were greater than those with the lower viscosity at the same shear rate. (B) The TM mRNA levels plotted against shear stress increased linearly. The values are the mean ± SD (n = 5 or 6). *P < 0.05, **P < 0.01, compared with a static control (0 dyne/cm2). † P < 0.05, compared with 15 dyne/cm2.
Gene Expression in Response to High Shear Stress for Various Durations
Because a shear stress, especially of 60 dyne/cm2 or more, significantly promoted the expressions of eNOS and TM mRNA and suppressed the expression of ET-1 mRNA (Figs. 4, 5, and 6), HRMECs were also exposed to a constant shear stress of 60 dyne/cm2, which almost corresponded to that occurring in retinal arterioles, for 0, 1, 3, 6, 12, 24, or 48 hours to examine the effects of different durations of shear stress. The eNOS and TM mRNA expression levels increased significantly (P < 0.05) after 6 to 24 hours of exposure to 60 dyne/cm2, followed by a decrease at 48 hours (Figs. 7A, 7C). In contrast, ET-1 mRNA expression gradually decreased by > 90%, compared with that in static control cells, at 48 hours (Fig. 7B). 
Figure 7.
 
Gene expression in HRMECs after different periods of exposure to flow. HRMECs were exposed to a shear stress of 60 dyne/cm2 for 0, 1, 3, 6, 12, 24, or 48 hours. (A) eNOS mRNA expression significantly (P < 0.05) increased after 6 to 24 hours, followed by a decrease after 48 hours. (B) ET-1 mRNA expression had decreased by more than 90%, compared with that observed in static control cells, after 48 hours. (C) TM mRNA expression increased gradually up until 24 hours after shear stress exposure. The values are expressed as mean ± SD (n = 5 to 7). *P < 0.05, **P < 0.01, compared with a static control (0 hours). † P < 0.05, compared with the values observed at 3 hours.
Figure 7.
 
Gene expression in HRMECs after different periods of exposure to flow. HRMECs were exposed to a shear stress of 60 dyne/cm2 for 0, 1, 3, 6, 12, 24, or 48 hours. (A) eNOS mRNA expression significantly (P < 0.05) increased after 6 to 24 hours, followed by a decrease after 48 hours. (B) ET-1 mRNA expression had decreased by more than 90%, compared with that observed in static control cells, after 48 hours. (C) TM mRNA expression increased gradually up until 24 hours after shear stress exposure. The values are expressed as mean ± SD (n = 5 to 7). *P < 0.05, **P < 0.01, compared with a static control (0 hours). † P < 0.05, compared with the values observed at 3 hours.
Discussion
The present study showed for the first time that laminar shear stress morphologically and functionally affected cultured HRMECs in magnitude- and time-dependent manners. Many previous studies have reported the effects of shear stress on signal transductions, gene expressions, and protein products in vascular ECs from various organs other than the retina; the average magnitudes of shear stress that were loaded on the cultured ECs varied from 0 to 30 dyne/cm2. 25 28 We previously reported that the systolic, mean, and diastolic shear stresses in first-order retinal arterioles were approximately 100, 60, and 30 dyne/cm2, respectively, in healthy subjects, 17,29 suggesting that the arteriovenous distribution of the blood flow velocity and wall shear stress in the microcirculatory network of the human retina are higher than in other organs, even under physiological conditions. Therefore, we examined the effects of higher shear stresses ranging from 0 to 100 dyne/cm2 in the present study. 
The present study showed that the cultured HRMECs exposed to laminar shear stress elongated and aligned with their long axes parallel to the direction of flow in magnitude- (Fig. 2) and time-dependent manners (Fig. 3). Our findings were consistent with the results in the ECs of other organs and species in previous studies performed under aortic levels of shear stress. 1,25 In addition, the aspect ratio and the angle difference of ECs, which were previously established in other studies, 22,23 are valuable for elucidating the quantitative degrees of the morphologic changes in HRMECs (Figs. 2B, 2C, 3B, 3C). According to these analyses, HRMECs exposed to even 100 dyne/cm2 showed almost similar changes in morphology to those seen at 15 dyne/cm2, suggesting that HRMECs may sense the flow direction even at higher flow conditions and that the morphology may change in the same manner as for an aortic level of flow. 
Regarding the effect of flow, changes in the mass transport of chemical mediators in media and the action of shear stress should be considered. The diffusional accumulation of chemical mediators (e.g., adenosine trisphosphate [ATP] and cholesterol), on the EC surface is modulated by the wall shear rate. 30 To identify the relative importance of the shear rate and the shear stress to gene expression, we examined the changes in mRNA expressions in HRMECs after exposure to two media with different viscosities. Our results showed that the increases in the mRNA expressions of eNOS (Fig. 4A) and TM (Fig. 6A) and the decrease in ET-1 mRNA expression (Fig. 5A) corresponding to perfusion with a high-viscosity medium were always larger than those for perfusion with a low-viscosity medium at any given shear rate. Furthermore, the changes in each mRNA expression level plotted against shear stress fell along a single curve (Figs. 4B, 5B) and one line (Fig. 6B), suggesting that the wall shear stress is the critical factor in the responses of eNOS, ET-1, and TM to flow, even at a high flow condition of 100 dyne/cm2
Regarding the time courses for the expressions of each of the studied mRNAs in the HRMECs in response to 60 dyne/cm2 (Fig. 7), our results were almost consistent with previous studies in which ECs were exposed to aortic levels of shear stress (i.e., from 15 to 30 dyne/cm2); eNOS mRNA was significantly upregulated after 6 hours of flow exposure in bovine aortic endothelial cells (BAECs), 27 whereas ET-1 mRNA was downregulated significantly after 24 hours of exposure to shear stress in human umbilical vein endothelial cells (HUVECs). 28 In addition, Takada et al. 26 showed that the TM mRNA level in HUVECs reached a maximum after 8 hours. Moreover, our results showed that the eNOS and TM mRNA levels peaked after 24 hours of exposure to 60 dyne/cm2 and that the ET-1 mRNA level was almost completely suppressed after 48 hours. Because the long-term exposure of the cultured HRMECs to shear stress simulated the in vivo situation most closely, the present results may contribute to our understanding of the physiologic significance of the dependence of eNOS, ET-1, and TM mRNA expression on the magnitude of the shear stress in the in vivo retinal microvasculature. 
In the present study, the shear stress-dependent increase in eNOS mRNA expression was consistent with previous studies, in which BAECs were exposed to 4 and 25 dyne/cm2 for 6 hours. 27,31 Furthermore, our results regarding the saturated expression of eNOS mRNA at 60 dyne/cm2 were similar to those of another study 32 reporting that the expression of eNOS protein in BAECs exposed to approximately 15 to 100 dyne/cm2 plateaued at approximately 40 to 60 dyne/cm2. We previously reported that endothelium-derived nitric oxide (NO) contributed to the basal retinal vascular tone in feline retinal arterioles. 33 Because the increased NO synthesis was paralleled by the upregulation of eNOS mRNA in ECs, 34 our results suggested that eNOS gene expression can be upregulated in microvascular ECs in the human retina, which are constantly exposed to higher shear stresses, probably resulting in constant NO synthesis and the maintenance of the basal vascular tone. 
Furthermore, because human retinal vessels lack extrinsic innervation, the retinal vessel caliber and local blood flow are normally regulated by nonnervous intrinsic mechanisms. 35 Particularly at the level of large arterioles, flow-induced vasodilation plays an important role in regulating blood flow and pressure to maintain tissue homeostasis. 36 Indeed, Hein et al. 37 showed that flow-induced NO produced vasodilation in isolated human and porcine retinal arterioles. Taken together, these findings suggest that the shear-dependent increase in eNOS mRNA expression in HRMECs is likely related to the vasodilatory responses of the retinal arterioles to increased flow. 
The significant downregulation of ET-1 mRNA in HRMECs resulting from high shear stresses of 30 dyne/cm2 or more (Fig. 5) agreed with previous studies of BAECs 25 and HUVECs 28 exposed to arterial shear stress. Because flow-induced NO is involved in the downregulation of ET-1 mRNA, 28,38 our results indicated that ET-1 gene expression in the ECs of retinal microvessels might be suppressed markedly by the inverse upregulation of eNOS under the high shear stress physiological conditions in the retinal circulation. 
Although many inconsistent results have been reported for the expression of ET-1 mRNA in response to low shear stress in cultured ECs from various organs other than the retina, 25,28,38,39 we first observed the upregulation of ET-1 mRNA in response to low shear stress in human retinal ECs. Pericytes are distributed more densely in the retinal capillaries than in other organs, including the brain. 40 Because pericytes regulate the capillary diameter through contraction and relaxation 41 in response to ET-1 42,43 and NO, 44 respectively, they play an important role in regulating the vascular tone in the retinal microcirculation. Therefore, the increase in ET-1 mRNA expression in response to low shear stresses might partly contribute to pericyte contraction in response to reduced perfusion, thereby maintaining an adequate shear stress in the retinal peripheral circulation. 
Because the retinal circulation is an end-arterial system without anastomoses, 41 segmental arterial thromboembolism may cause nonperfusion of the occluded areas. TM, a high-affinity receptor for thrombin on the surface of ECs, has been implicated in the endothelial regulation of fibrinolysis and coagulation 45 ; TM is a natural anticoagulant on ECs. We showed for the first time that the expression of TM mRNA increased monotonically in response to shear stress as high as 100 dyne/cm2 (Fig. 6), a response that was previously confirmed at 15 dyne/cm2 in HUVECs. 26 This shear stress-dependent upregulation of TM might contribute to the antithrombotic properties of retinal arterioles and venules under physiological conditions. Because NO can also inhibit platelet aggregation and adhesion to the vascular wall, the high shear stress might contribute to the maintenance of a nonthrombogenic surface on the retinal vascular lumen via the upregulation of eNOS and TM mRNA in human retinal ECs. 
In the present study, the morphologic changes of the HRMECs exposed to shear stresses of 15 dyne/cm2 or more seemed to be stable; exposure to 15 dyne/cm2 was sufficient for the HRMECs to become notably elongated and almost completely aligned parallel to the direction of flow. In contrast, the eNOS and TM mRNA levels changed further in a magnitude-dependent response to shear stresses of > 15 dyne/cm2. The patterns of EC response to shear stress vary for different kinds of responses that are detected. Previously, our DNA microarray analysis revealed that approximately 3% of all genes examined showed some kind of response to low or high shear stress. 46 The temporal profiles of gene responses analyzed using a clustering method showed variable, not uniform, patterns. These different responses are suspected to be due to the differences in shear stress sensing and complex signal transductions, 3 but the detailed mechanisms have not yet been elucidated. Further advanced studies are needed to clarify these points. 
The present study had some limitations. First, the number of plots was smaller for the low viscosity group than for the high viscosity group in Figures 4 56. Because we performed the experiments in triplicate for one plot to ensure the accuracy of the experiments, we simultaneously used a total of 18 flow-loading devices. This was the maximum number of devices available to us. Because we were mainly interested in the effects of ‘higher’ shear stresses (30, 60, and 100 dyne/cm2) on gene expression in HRMECs, we made more plots for experiments involving higher shear stresses. Second, we only performed the current experiments under physiological flow conditions but did not investigate the effect of flow-exposure under pathologic conditions, such as hyperglycemia. A previous study reported that elevated glucose attenuated the flow-stimulated activity of eNOS in bovine retinal microvascular ECs. 15 Considering the retinal circulation in diabetic retinopathy, a medium containing a high glucose concentration or advanced glycation end products may be needed to precondition the ECs and/or flow experiments. 
In conclusion, we showed that cultured ECs of human retinal microvessels underwent changes in their morphology and gene expressions in response to high shear stress in magnitude- and time-dependent manners, resulting in the increased expression of eNOS and TM mRNA. We also observed that the expression of ET-1 mRNA increased in response to a low shear stress but decreased in response to a high shear stress. The relationships among wall shear stress and the gene expressions of eNOS, ET-1, and TM might help to clarify the pathogenesis of impaired retinal circulation. 
Footnotes
 Supported by a Grant-in-Aid for Young Scientists (B) 23791956 (AI) and Scientific Research (C) 18591904 (TN) from the Ministry of Education, Science, and Culture, Tokyo, Japan; and the Uehara Memorial Foundation (TN).
Footnotes
 Disclosure: A. Ishibazawa, None; T. Nagaoka, None; T. Takahashi, None; K. Yamamoto, None; A. Kamiya, None; J. Ando, None; A. Yoshida, None
References
Dewey CFJr Bussolari SR Gimbrone MAJr Davies PF . The dynamic response of vascular endothelial cells to fluid shear stress. J Biomech Eng. 1981;103:177–185. [CrossRef] [PubMed]
Sato M Ohashi T . Biorheological views of endothelial cell responses to mechanical stimuli. Biorheology. 2005;42:421–441. [PubMed]
Ando J Yamamoto K . Vascular mechanobiology: endothelial cell responses to fluid shear stress. Circ J. 2009;73:1983–1992. [CrossRef] [PubMed]
Kamiya A Togawa T . Adaptive regulation of wall shear stress to flow change in the canine carotid artery. Am J Physiol. 1980;239:H14–H21. [PubMed]
Ueda A Koga M Ikeda M Kudo S Tanishita K . Effect of shear stress on microvessel network formation of endothelial cells with in vitro three-dimensional model. Am J Physiol Heart Circ Physiol. 2004;287:H994–H1002. [CrossRef] [PubMed]
Cunningham KS Gotlieb AI . The role of shear stress in the pathogenesis of atherosclerosis. Lab Invest. 2005;85:9–23. [CrossRef] [PubMed]
Nagaoka T Ishii Y Takeuchi T Takahashi A Sato E Yoshida A . Relationship between the parameters of retinal circulation measured by laser Doppler velocimetry and a marker of early systemic atherosclerosis. Invest Ophthalmol Vis Sci. 2005;46:720–725. [CrossRef] [PubMed]
Egbrink MG Van Gestel MA Broeders MA . Regulation of microvascular thromboembolism in vivo. Microcirculation. 2005;12:287–300. [CrossRef] [PubMed]
Grunwald JE Riva CE Sinclair SH Brucker AJ Petrig BL . Laser Doppler velocimetry study of retinal circulation in diabetes mellitus. Arch Ophthalmol. 1986;104:991–996. [CrossRef] [PubMed]
Bursell SE Clermont AC Kinsley BT Simonson DC Aiello LM Wolpert HA . Retinal blood flow changes in patients with insulin-dependent diabetes mellitus and no diabetic retinopathy. Invest Ophthalmol Vis Sci. 1996;37:886–897. [PubMed]
Konno S Feke GT Yoshida A Fujio N Goger DG Buzney SM . Retinal blood flow changes in type I diabetes. A long-term follow-up study. Invest Ophthalmol Vis Sci. 1996;37:1140–1148. [PubMed]
Nagaoka T Sato E Takahashi A Yokota H Sogawa K Yoshida A . Impaired retinal circulation in patients with type 2 diabetes mellitus: retinal laser Doppler velocimetry study. Invest Ophthalmol Vis Sci. 2010;51:6729–6734. [CrossRef] [PubMed]
Lakshminarayanan S Gardner TW Tarbell JM . Effect of shear stress on the hydraulic conductivity of cultured bovine retinal microvascular endothelial cell monolayers. Curr Eye Res. 2000;21:944–951. [CrossRef] [PubMed]
Walshe TE Ferguson G Connell P O'Brien C Cahill PA . Pulsatile flow increases the expression of eNOS, ET-1, and prostacyclin in a novel in vitro coculture model of the retinal vasculature. Invest Ophthalmol Vis Sci. 2005;46:375–382. [CrossRef] [PubMed]
Connell P Walshe T Ferguson G Gao W O'Brien C Cahill PA . Elevated glucose attenuates agonist- and flow-stimulated endothelial nitric oxide synthase activity in microvascular retinal endothelial cells. Endothelium. 2007;14:17–24. [CrossRef] [PubMed]
Yoshida A Feke GT Mori F . Reproducibility and clinical application of a newly developed stabilized retinal laser Doppler instrument. Am J Ophthalmol. 2003;135:356–361. [CrossRef] [PubMed]
Nagaoka T Yoshida A . Noninvasive evaluation of wall shear stress on retinal microcirculation in humans. Invest Ophthalmol Vis Sci. 2006;47:1113–1119. [CrossRef] [PubMed]
Cheng C Helderman F Tempel D . Large variations in absolute wall shear stress levels within one species and between species. Atherosclerosis. 2007;195:225–235. [CrossRef] [PubMed]
Kosaki K Ando J Korenaga R Kurokawa T Kamiya A . Fluid shear stress increases the production of granulocyte-macrophage colony-stimulating factor by endothelial cells via mRNA stabilization. Circ Res. 1998;82:794–802. [CrossRef] [PubMed]
Gnasso A Carallo C Irace C . Association between intima-media thickness and wall shear stress in common carotid arteries in healthy male subjects. Circulation. 1996;94:3257–3262. [CrossRef] [PubMed]
Ando J Ohtsuka A Korenaga R Kawamura T Kamiya A . Wall shear stress rather than shear rate regulates cytoplasmic Ca++ responses to flow in vascular endothelial cells. Biochem Biophys Res Commun. 1993;190:716–723. [CrossRef] [PubMed]
Kowalsky GB Byfield FJ Levitan I . oxLDL facilitates flow-induced realignment of aortic endothelial cells. Am J Physiol Cell Physiol. 2008;295:C332–C340. [CrossRef] [PubMed]
Brower JB Targovnik JH Bowen BP Caplan MR Massia SP . Elevated glucose impairs the endthelial cell response to shear stress. Cellular and Molecular Bioengineering. 2009;2:533–543. [CrossRef]
Livak KJ Schmittgen TD . Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta C(T)) method. Methods. 2001;25:402–408. [CrossRef] [PubMed]
Malek A Izumo S . Physiological fluid shear stress causes downregulation of endothelin-1 mRNA in bovine aortic endothelium. Am J Physiol. 1992;263:C389–C396. [PubMed]
Takada Y Shinkai F Kondo S . Fluid shear stress increases the expression of thrombomodulin by cultured human endothelial cells. Biochem Biophys Res Commun. 1994;205:1345–1352. [CrossRef] [PubMed]
Ranjan V Xiao Z Diamond SL . Constitutive NOS expression in cultured endothelial cells is elevated by fluid shear stress. Am J Physiol. 1995;269:H550–H555. [PubMed]
Morawietz H Talanow R Szibor M . Regulation of the endothelin system by shear stress in human endothelial cells. J Physiol. 2000;525:761–770. [CrossRef] [PubMed]
Takahashi T Nagaoka T Yanagida H . A mathmatical model for the distribution of hemodynamic parameters in the human retinal microvascular network. J Biorheol. 2009;23:77–86. [CrossRef]
Caro CG Fitz-Gerald JM Schroter RC . Atheroma and arterial wall shear. Observation, correlation and proposal of a shear dependent mass transfer mechanism for atherogenesis. Proc R Soc Lond B Biol Sci. 1971;177:109–159. [CrossRef] [PubMed]
Xiao Z Zhang Z Ranjan V Diamond SL . Shear stress induction of the endothelial nitric oxide synthase gene is calcium-dependent but not calcium-activated. J Cell Physiol. 1997;171:205–211. [CrossRef] [PubMed]
Metaxa E Meng H Kaluvala SR Szymanski MP Paluch RA Kolega J . Nitric oxide-dependent stimulation of endothelial cell proliferation by sustained high flow. Am J Physiol Heart Circ Physiol. 2008;295:H736–H742. [CrossRef] [PubMed]
Nagaoka T Sakamoto T Mori F Sato E Yoshida A . The effect of nitric oxide on retinal blood flow during hypoxia in cats. Invest Ophthalmol Vis Sci. 2002;43:3037–3044. [PubMed]
Noris M Morigi M Donadelli R . Nitric oxide synthesis by cultured endothelial cells is modulated by flow conditions. Circ Res. 1995;76:536–543. [CrossRef] [PubMed]
Laties AM . Central retinal artery innervation. Absence of adrenergic innervation to the intraocular branches. Arch Ophthalmol. 1967;77:405–409. [CrossRef] [PubMed]
Kuo L Davis MJ Chilian WM . Longitudinal gradients for endothelium-dependent and -independent vascular responses in the coronary microcirculation. Circulation. 1995;92:518–525. [CrossRef] [PubMed]
Hein TW Rosa RHJr Yuan Z Roberts E Kuo L . Divergent roles of nitric oxide and rho kinase in vasomotor regulation of human retinal arterioles. Invest Ophthalmol Vis Sci. 2010;51:1583–1590. [CrossRef] [PubMed]
Kuchan MJ Frangos JA . Shear stress regulates endothelin-1 release via protein kinase C and cGMP in cultured endothelial cells. Am J Physiol. 1993;264:H150–H156. [PubMed]
Yoshizumi M Kurihara H Sugiyama T . Hemodynamic shear stress stimulates endothelin production by cultured endothelial cells. Biochem Biophys Res Commun. 1989;161:859–864. [CrossRef] [PubMed]
Shepro D Morel NM . Pericyte physiology. FASEB J. 1993;7:1031–1038. [PubMed]
Pournaras CJ Rungger-Brandle E Riva CE Hardarson SH Stefansson E . Regulation of retinal blood flow in health and disease. Prog Retin Eye Res. 2008;27:284–330. [CrossRef] [PubMed]
Chakravarthy U Gardiner TA Anderson P Archer DB Trimble ER . The effect of endothelin 1 on the retinal microvascular pericyte. Microvasc Res. 1992;43:241–254. [CrossRef] [PubMed]
Lam HC Lee JK Lu CC Chu CH Chuang MJ Wang MC . Role of endothelin in diabetic retinopathy. Curr Vasc Pharmacol. 2003;1:243–250. [CrossRef] [PubMed]
Schonfelder U Hofer A Paul M Funk RH . In situ observation of living pericytes in rat retinal capillaries. Microvasc Res. 1998;56:22–29. [CrossRef] [PubMed]
Sadler JE . Thrombomodulin structure and function. Thromb Haemost. 1997;78:392–395. [PubMed]
Ohura N Yamamoto K Ichioka S . Global analysis of shear stress-responsive genes in vascular endothelial cells. J Atheroscler Thromb. 2003;10:304–313. [CrossRef] [PubMed]
Figure 1.
 
Flow circuit system and flow chamber. (A) The closed circuit, including the flow chamber, a peristaltic pump, and a medium reservoir, are connected by silicone tubes. (B) Structure of the parallel plate type flow chamber. The shear rate (γ̇, 1/s) and shear stress (τ, dyne/cm2) acting on the cells were calculated using the formulas: γ̇ = 6/(a2b) and τ = μ · γ̇, where is the volumetric flow rate (mL/sec), a and b are the height and width (cm) of the channel in the cross section, and μ is the viscosity of the perfused fluid.
Figure 1.
 
Flow circuit system and flow chamber. (A) The closed circuit, including the flow chamber, a peristaltic pump, and a medium reservoir, are connected by silicone tubes. (B) Structure of the parallel plate type flow chamber. The shear rate (γ̇, 1/s) and shear stress (τ, dyne/cm2) acting on the cells were calculated using the formulas: γ̇ = 6/(a2b) and τ = μ · γ̇, where is the volumetric flow rate (mL/sec), a and b are the height and width (cm) of the channel in the cross section, and μ is the viscosity of the perfused fluid.
Figure 2.
 
Morphologic changes in HRMECs exposed to different magnitudes of flow. (A) HRMECs cultured on individual glass plates were exposed to seven levels of prolonged shear stress: 0 (control), 1.5, 6, 15, 30, 60, or 100 dyne/cm2 for 24 hours. The flow direction is from left to right. Scale bar, 100 μm. (B) Aspect ratio of the cells, calculated as the ratio of the length of the major axis to the length of the minor axis and used as a measure of cellular elongation. (C) Angle difference between the long axis of the cells and the horizontal flow direction, used as an indication of cell alignment. Under flow conditions with increasing shear stress, the cells gradually elongated and aligned parallel to the direction of flow. The values are expressed as the mean ± SD (n = 60 cells). *P < 0.01, compared with a static control (0 dyne/cm2).
Figure 2.
 
Morphologic changes in HRMECs exposed to different magnitudes of flow. (A) HRMECs cultured on individual glass plates were exposed to seven levels of prolonged shear stress: 0 (control), 1.5, 6, 15, 30, 60, or 100 dyne/cm2 for 24 hours. The flow direction is from left to right. Scale bar, 100 μm. (B) Aspect ratio of the cells, calculated as the ratio of the length of the major axis to the length of the minor axis and used as a measure of cellular elongation. (C) Angle difference between the long axis of the cells and the horizontal flow direction, used as an indication of cell alignment. Under flow conditions with increasing shear stress, the cells gradually elongated and aligned parallel to the direction of flow. The values are expressed as the mean ± SD (n = 60 cells). *P < 0.01, compared with a static control (0 dyne/cm2).
Figure 3.
 
Morphologic changes in HRMECs with different durations of exposure to flow. (A) The HRMECs were exposed to a shear stress of 60 dyne/cm2 for 0, 1, 3, 6, 12, or 24 hours. The flow direction is from left to right. Scale bar, 100 μm. The aspect ratio (B) and angle difference (C) of the cells were calculated to evaluate the degree of cellular elongation and alignment, respectively. Over time, the HRMECs elongated and aligned parallel to the direction of flow, especially after 6 hours of exposure. The values are expressed as mean ± SD (n = 60 cells). *P < 0.01, compared with a static control (0 hours).
Figure 3.
 
Morphologic changes in HRMECs with different durations of exposure to flow. (A) The HRMECs were exposed to a shear stress of 60 dyne/cm2 for 0, 1, 3, 6, 12, or 24 hours. The flow direction is from left to right. Scale bar, 100 μm. The aspect ratio (B) and angle difference (C) of the cells were calculated to evaluate the degree of cellular elongation and alignment, respectively. Over time, the HRMECs elongated and aligned parallel to the direction of flow, especially after 6 hours of exposure. The values are expressed as mean ± SD (n = 60 cells). *P < 0.01, compared with a static control (0 hours).
Figure 4.
 
Relationships between eNOS mRNA expression and shear rates (A) and shear stresses (B) in the HRMECs. The cells were exposed to flow with two different viscosities for 24 hours. Changes in the mRNA expressions were analyzed using real-time RT-PCR. (A) The expression of eNOS mRNA in the HRMECs gradually increased as the shear rate increased; however, the levels of eNOS mRNA expression plotted against the shear rate with the higher viscosity were greater than those with the lower viscosity. (B) The increase in the levels of eNOS mRNA expression plotted against the shear stress fell along a single approximately exponential curve. The values are expressed as mean ± SD (n = 5 or 6). *P < 0.05, **P < 0.01, compared with a static control (0 dyne/cm2). † P < 0.05, compared with 15 dyne/cm2.
Figure 4.
 
Relationships between eNOS mRNA expression and shear rates (A) and shear stresses (B) in the HRMECs. The cells were exposed to flow with two different viscosities for 24 hours. Changes in the mRNA expressions were analyzed using real-time RT-PCR. (A) The expression of eNOS mRNA in the HRMECs gradually increased as the shear rate increased; however, the levels of eNOS mRNA expression plotted against the shear rate with the higher viscosity were greater than those with the lower viscosity. (B) The increase in the levels of eNOS mRNA expression plotted against the shear stress fell along a single approximately exponential curve. The values are expressed as mean ± SD (n = 5 or 6). *P < 0.05, **P < 0.01, compared with a static control (0 dyne/cm2). † P < 0.05, compared with 15 dyne/cm2.
Figure 5.
 
Relationship between ET-1 mRNA expression and the shear rates (A) or shear stresses (B) in HRMECs. The cells were exposed to flow with two different viscosities for 24 hours. Changes in the mRNA expressions were analyzed using real-time RT-PCR. (A) The ET-1 mRNA expression increased at a low shear rate, whereas expressions at much higher shear rates decreased below that observed under a static condition. (B) Similarly, the ET-1 mRNA levels at 1.5 dyne/cm2 significantly increased, whereas those at higher shear stresses significantly decreased below that observed under a static condition. The changes in the levels of ET-1 mRNA expression plotted against shear stress fell along a single monophasic curve. The values are mean ± SD (n = 5 or 6). *P < 0.05, **P < 0.01, compared with a static control (0 dyne/cm2).
Figure 5.
 
Relationship between ET-1 mRNA expression and the shear rates (A) or shear stresses (B) in HRMECs. The cells were exposed to flow with two different viscosities for 24 hours. Changes in the mRNA expressions were analyzed using real-time RT-PCR. (A) The ET-1 mRNA expression increased at a low shear rate, whereas expressions at much higher shear rates decreased below that observed under a static condition. (B) Similarly, the ET-1 mRNA levels at 1.5 dyne/cm2 significantly increased, whereas those at higher shear stresses significantly decreased below that observed under a static condition. The changes in the levels of ET-1 mRNA expression plotted against shear stress fell along a single monophasic curve. The values are mean ± SD (n = 5 or 6). *P < 0.05, **P < 0.01, compared with a static control (0 dyne/cm2).
Figure 6.
 
Relationship between TM mRNA expression and shear rates (A) or shear stresses (B) in HRMECs. The cells were exposed to flow with two different viscosities for 24 hours. Changes in the mRNA expressions were analyzed using real-time RT-PCR. (A) The TM mRNA expression gradually increased with an increasing shear rate, while the expressions with higher viscosity were greater than those with the lower viscosity at the same shear rate. (B) The TM mRNA levels plotted against shear stress increased linearly. The values are the mean ± SD (n = 5 or 6). *P < 0.05, **P < 0.01, compared with a static control (0 dyne/cm2). † P < 0.05, compared with 15 dyne/cm2.
Figure 6.
 
Relationship between TM mRNA expression and shear rates (A) or shear stresses (B) in HRMECs. The cells were exposed to flow with two different viscosities for 24 hours. Changes in the mRNA expressions were analyzed using real-time RT-PCR. (A) The TM mRNA expression gradually increased with an increasing shear rate, while the expressions with higher viscosity were greater than those with the lower viscosity at the same shear rate. (B) The TM mRNA levels plotted against shear stress increased linearly. The values are the mean ± SD (n = 5 or 6). *P < 0.05, **P < 0.01, compared with a static control (0 dyne/cm2). † P < 0.05, compared with 15 dyne/cm2.
Figure 7.
 
Gene expression in HRMECs after different periods of exposure to flow. HRMECs were exposed to a shear stress of 60 dyne/cm2 for 0, 1, 3, 6, 12, 24, or 48 hours. (A) eNOS mRNA expression significantly (P < 0.05) increased after 6 to 24 hours, followed by a decrease after 48 hours. (B) ET-1 mRNA expression had decreased by more than 90%, compared with that observed in static control cells, after 48 hours. (C) TM mRNA expression increased gradually up until 24 hours after shear stress exposure. The values are expressed as mean ± SD (n = 5 to 7). *P < 0.05, **P < 0.01, compared with a static control (0 hours). † P < 0.05, compared with the values observed at 3 hours.
Figure 7.
 
Gene expression in HRMECs after different periods of exposure to flow. HRMECs were exposed to a shear stress of 60 dyne/cm2 for 0, 1, 3, 6, 12, 24, or 48 hours. (A) eNOS mRNA expression significantly (P < 0.05) increased after 6 to 24 hours, followed by a decrease after 48 hours. (B) ET-1 mRNA expression had decreased by more than 90%, compared with that observed in static control cells, after 48 hours. (C) TM mRNA expression increased gradually up until 24 hours after shear stress exposure. The values are expressed as mean ± SD (n = 5 to 7). *P < 0.05, **P < 0.01, compared with a static control (0 hours). † P < 0.05, compared with the values observed at 3 hours.
Table 1.
 
Oligonucleotide Primers Used for Gene Expression Analysis by Real-Time RT-PCR
Table 1.
 
Oligonucleotide Primers Used for Gene Expression Analysis by Real-Time RT-PCR
Gene Accession Number Forward Primers, 5′–3′ Reverse Primers, 5′–3′
eNOS (NOS3) NM_000603 GGGACCACATAGGTGTCTGC CCAGCACAGCTACAGTGAGG
ET-1 (EDN1) NM_001955 AGCCCTAGGTCCAAGAGAGC AGTCAGGAACCAGCAGAGGA
TM (THBD) NM_000361 AGAGCCAACTGCGAGTACCA GGAGATGCCTATGAGCAAGC
GAPDH NM_002046 ACATCATCCCTGCCTCTACTGG AGTGGGTGTCGCTGTTGAAGTC
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×