April 2012
Volume 53, Issue 4
Free
Retina  |   April 2012
Ephrin-A4 Is Involved in Retinal Neovascularization by Regulating the VEGF Signaling Pathway
Author Notes
  • From the Key Laboratory of Vision Loss and Restoration, Ministry of Education, Department of Ophthalmology, Peking University People's Hospital, Beijing, China. 
  • Corresponding author: Xiaoxin Li, Key Laboratory of Vision Loss and Restoration, Ministry of Education, Department of Ophthalmology, Peking University People's Hospital, Xizhimen South Street 11, 100044 Beijing, China; drxiaoxinli@163.com
Investigative Ophthalmology & Visual Science April 2012, Vol.53, 1990-1998. doi:10.1167/iovs.11-8788
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Wei Du, Wenzhen Yu, Lvzhen Huang, Min Zhao, Xiaoxin Li; Ephrin-A4 Is Involved in Retinal Neovascularization by Regulating the VEGF Signaling Pathway. Invest. Ophthalmol. Vis. Sci. 2012;53(4):1990-1998. doi: 10.1167/iovs.11-8788.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

Purpose.: Retinal neovascularization (NV) is a major cause of blindness. Recent research suggests that factors other than VEGF participate in this process. This study aimed to determine the role of ephrin-A4 in retinal NV.

Methods.: The expression and effect of ephrin-A4 was investigated in a mouse model of oxygen-induced retinopathy (OIR) and the RF/6A retina endothelial cell line. Ephrin-A4 expression and VEGF signaling pathway phosphorylation were determined by PCR, immunohistochemistry, and western blot analyses. ShRNA was used to silence ephrin-A4 in vitro and in vivo. Retinal flat mounts and tube formation assays were performed to evaluate ephrin-A4 function in the NV process in vivo and in vitro.

Results.: Ephrin-A4 was overexpressed in the retina of OIR mice and in RF/6A and RPE cells after CoCl2 stimulation. In vitro, Ephrin-A4/Fc treatment significantly increased the tube number of RF/6A cells on a membrane preparation and the phosphorylation levels of VEGR2, Akt1, and ERK1/2 in RF/6A cells. Moreover, ephrin-A4 knockout markedly suppressed pathologic neovascularization in vivo and inhibited the proliferation and tube formation capacity of RF/6A cells in vitro. Furthermore, in the absence of ephrin-A4, the phosphorylation of VEGFR2, Akt1, and ERK1/2 was defective under VEGF165 stimulation, and the proangiogenic function of VEGF165 was also compromised.

Conclusions.: This study suggests that ephrin-A4 plays an important role in retinal NV and is a potential target against retinal NV. The proangiogenic function of ephrin-A4 may be linked to its crucial role in the VEGF signaling pathway.

Introduction
Retinal neovascularization (NV) is characteristic of retinopathy of prematurity (ROP). In phase I of ROP, relative hyperoxia leads to the suppression of oxygen-regulated growth factors, such as vascular endothelial growth factor (VEGF), which causes a loss of preestablished vessels and cessation of normal retina vessel development. In phase II, a group of overexpressed growth factors from ischemic retina induces pathologic retinal NV. Research and clinical trials have confirmed that VEGF is the principal mediator of retinal NV. However, laboratory and clinical observations suggest that factors other than VEGF are also involved in both normal retinal vasculogenesis and retinal NV. 1,2 It is possible that further investigations of other factors and pathways may yield new therapeutic options. 
Significant progress has been made in recent years to identify factors promoting pathologic retinal NV, such as the Eph/ephrin signaling pathway. Eph receptors include EphA and EphB, and ephrin ligands include ephrin-A and transmembranous ephrin-B. Eph/ephrin molecules are critical regulators of cell contact–dependent signaling and patterning. Eph receptors and their ephrin ligands form an important cell communication system with widespread roles in normal physiology and disease pathogenesis, controlling cell migration and cytoskeletal organization. 36 Ephrin-B2, EphB4, and EphA2 have been shown to be involved in retinal neovasculogenesis. 711 A comparative retinal gene expression analysis in two rodent models of oxygen-induced retinopathy (OIR) identified increased expression levels of members of the VEGF and ephrin receptor signaling pathways in both models. 12 These previous studies underscore the role of the Eph/ephrin signaling pathway in retinal NV and suggest that further studies on the Eph/ephrin signaling pathway in the ROP would help to further understand the mechanism of retinal NV and to find new treatment opportunities. 
In this study, we aimed to investigate the role of ephrin-A4 (Efna4) in ROP vasculogenesis and its potential as a target against ROP. 
Materials and Methods
Mice and Hypoxia-Induced Retinal Vascularization
All animal experiments were approved by the ethics review board of the Peking University People's Hospital (Permit number: 201,097) and were performed with strict adherence to the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. All efforts were made to minimize animal suffering and reduce the number of animals used. OIR was induced in C57BL6 mouse pups according to a protocol that was previously established. 13 In brief, at postnatal day 7 (P7), the mouse pups were exposed to hyperoxia (75% oxygen) for 5 days with their mothers, which inhibits retinal vessel growth and leads to avascular retina. The pups were then returned to room air at P12. Since then, the avascular areas of the retina become hypoxic, and the hypoxic avascular retinas trigger retinal NV, which is at its highest level at P17. At P17, the OIR mice were deeply anesthetized with sodium thiopental and then perfused via the left ventricle with 1 mL of 50 mg/mL FITC-dextran (Sigma-Aldrich, St. Louis, MO) or 1 mL of 2% direct blue dye (Evans blue; Sigma-Aldrich). The mice were euthanized, and retinal flat mounts were prepared after being fixed in 4% paraformaldehyde for 30 minutes. Images were taken using a fluorescence microscope (Olympus, Tokyo). The retinal avascular areas and NV areas were quantified using image processing and image analysis software (Image-Pro Plus; Media Cybernetics, Silver Spring, MD) according to a previous protocol. 13 In brief, the avascular areas or NV areas on each retina were selected, and the numbers of pixels comprising the selected areas were counted. The relative retinal avascular areas and NV areas were calculated by comparing the number of pixels in the affected areas with the total number of pixels in the retina. 
Cell Culture and Treatment
The rhesus macaque choroid-retina endothelial cell line (RF/6A) was obtained from the cell bank at the Chinese Academy of Science. The retinal pigment epithelial cell line (RPE) was obtained from the American Tissue Culture Collection (Manassas, VA). Both cell lines were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS). A total of 70% confluent cultures were treated with 200 μM CoCl2 (Sigma-Aldrich) to mimic hypoxia conditions. The cells were stimulated with 1 or 2 μg/mL recombinant human ephrin-A4/Fc chimera (R&D Systems, Minneapolis, MN). Purified human IgG (1 μg/mL) (R&D Systems) was used as a control. After washing with PBS, the RF/6A cells were incubated in serum-free culture medium containing 100 ng/mL recombinant human VEGF165 (PeproTech, Rocky Hill, NJ) at 37°C for 10 or 30 minutes. Cell proliferation was quantified by a homogeneous, colorimetric cell viability assay (Cell Titer 96 Aqueous One Solution Cell Proliferation Assay; MTS assay; Promega Corp., Madison, WI) according to the manufacturer's protocol. 
Preparation of Murine Stem Cell Virus Retrovirus or Lentivirus Particles Carrying shRNAs
A microRNA-30–based hairpin containing a 21-mer sequence specifically targeting rhesus ephrin-A4 (miEFNA4: ACCTCAACGATTACCTAGACAT) was cloned into the latent membrane protein (LMP) vector (MSCV/LTRmiR30-PIG). A nonsilencing short hairpin RNA (shRNA) targeting sequence (miNS: GCTGAGGTGATAAACAGTTACA) was cloned into the LMP vector and was used as a control. LMP and VSVG were cotransfected into GP2-293 cells. The supernatants were collected 48 hours after transfection. After brief centrifugation to remove cellular debris at 500g for 10 minutes, the virus was concentrated through a centrifugal concentrator (Macrosep; Pall Gelman Laboratory, Ann Arbor, MI) with a 100-kDa molecular mass cutoff and was stored at −80°C. The 21-mer shRNAs specifically targeting mouse ephrin-A4 (Efna4-sh1: GCCCTGTTCGATTCTCAGAAA; Efna4-sh3: CCCGGAAACCTTTGCATTATA) were cloned into the PLL3.7 vector. A nonsilencing shRNA targeting sequence (LV-NS: CTGAGGTGATAAACAGTTACA) was also cloned into PLL3.7 as control. Lentiviral production was conducted as described previously. 14 Briefly, PLL3.7 and the packaging vectors (the ViraPower Packaging Mix; Invitrogen Co., Carlsbad, CA) were cotransfected into 293T cells, and the resulting supernatant was collected after 36 hours. The virus was concentrated using a centrifugal device (Macrosep) with a 100-kDa molecular mass cutoff and was stored at 80°C. Titers were determined by infecting 293T cells with serial dilutions of concentrated lentivirus. We determined the green fluorescent protein expression levels of infected cells by flow cytometry 72 hours after infection; for a typical preparation, the titer was approximately 4–10 × 108 infectious units per mL. 
Intravitreal Injections
Immediately after returning to 21% oxygen, P12 OIR mouse pups were anesthetized, and 1.5 μL of lentivirus (3 × 108 TU/mL) expressing mouse ephrin-A4–specific shRNA (Efna4-sh1 and Efna4-sh3) or nonsilencing sequence (LV-NS) was injected intravitreally to their right eyes with a dissecting microscope using a microinjector (Hamilton Co., Reno, NV) with a 33-gauge needle as described previously. 15,16 For negative and positive controls, 1.5 μL of enhancing solution (used to dilute lentivirus) (Genechem, Shanghai, China) and 1.5 μL bevacizumab (Avastin, Genentech/Roche, South San Francisco, CA) were injected intravitreally. Eyes with lens damage or vitreous hemorrhage after injection were excluded from the subsequent experiments. The ephrin-A4 expression, developmental retinal vessel regrowth, and retinal NV were determined at P17 using real-time PCR and retinal flat mounts. 
PCR Analysis
Total RNA was reverse transcribed into cDNA. Real-time PCR products were generated in 35 cycles from cDNA in a real-time PCR platform (LightCycler 480; Roche Diagnostics, Basel, Switzerland) using a mixture containing commercial nucleic acid stain (SYBR Green) and 1 μL of 100 μM specific primers for ephrin-A4. The nucleic acid stain (SYBR Green) fluorescent signals were used to generate cycle threshold values from which mRNA ratios were calculated when normalized against the GAPDH housekeeping gene. Primers used for mouse, human, and rhesus ephrin-A4 amplification are listed in Table 1
Table I.
 
Primers for Ephrin-A and GAPDH Amplification
Table I.
 
Primers for Ephrin-A and GAPDH Amplification
Genes Primer Sequence Product Size Tm
Human ephrin-A4 CTCGGCTTTGAGTTCTTACC 106 59
CCTTGCAGCAGACAGACACC
Rhesus ephrin-A4 GTGTCCGCCACGTCGTCTA 167 57
CCAGTCCACCATGTATAAAGCA
Human and rhesus GAPDH GAGTCCACTGGCGTCTTCAC 120 57
GTTCACACCCATGACGAACA
Mouse ephrin-A4 CAGCGCTACACACCCTTCCC 142 61
GTGATGACCCGCTCTCCTTG
Mouse GAPDH CCTTCCGTGTTCCTACCC 150 53
CAACCTGGTCCTCAGTGTAG
Western Blot and Immunohistochemistry Analyses
To analyze ephrin-A4, anti–ephrin-A4 (1:500; Abcam, Cambridge, UK) was used for western blot, and anti–ephrin-A4 (1:50, Santa Cruz Biochemicals, Inc., Santa Cruz, CA) was used for immunohistochemistry (IHC). Akt (pan) rabbit mAb (1:500; Cell Signaling Technology [CST], Beverly, MA), phospho-AKT1-S124 antibody (1:500; Abgent, San Diego, CA), phospho-Erk1/2 (Thr202/Tyr204) rabbit mAb (1:2000; CST), phospho-VEGFR2 (Tyr1175) rabbit mAb (1:500; CST), VEGFR2 rabbit mAb (1:500; CST), and phospho-SAPK/JNK (Thr183/Tyr185) rabbit mAb (1:2000; CST) were used to detect phosphorylation signaling in the VEGF signaling pathway. 
In Vitro Tube Formation Assays
In vitro vascular tube formation assays were performed according to the manufacturer's protocol. Briefly, 24-well plates were coated with 300 μL of growth factor reduced membrane preparation (Matrigel; BD Biosciences, Franklin Lakes, NJ). After 24 hours of serum starvation, 100,000 RF/6A cells were plated in wells in the presence or absence of ephrin-A4/Fc (R&D Systems) and were photodocumented after 10 hours. Images were acquired using an inverted microscope (Olympus CK40). The degrees of assembly were quantified by counting the numbers of tubes in assembled endothelial cell networks in 10 random fields (×100 magnification) from each well, with triplicate samples per condition. The data are a representation of three independent experiments/conditions with SDs, and statistical significance was assessed by a two-tailed paired Student's t-test. 
Results
Ephrin-A4 Was Overexpressed in OIR Mouse Retinas
Ephrin-A4 was significantly overexpressed in OIR mouse retinas at P13, P15, and P17 compared with the control mice, which did not express ephrin-A4 in the retinas until P17 (Fig. 1A). Ephrin-A4 expression in OIR mouse retinas decreased to normal levels at P19 and P21, when retinal NV spontaneously regressed IHC staining revealed a significant increase in ephrin-A4 protein in OIR mouse retinas at P13, P15, and P17 compared with the control mice. In normal mice, ephrin-A4 staining was identified in the retinal ganglion neuron layers (GCL) and the inner nuclear layer (INL). In the OIR mice, the ephrin-A4 staining localized to the nerve fiber layer and the retinal ganglion neuron layers (NFL/GCL) and, to a lesser extent, to the INL. The abundant ephrin-A4–positive cells appeared to be colocalized with the retinal vessels and proliferative endothelial cells, as indicated by their locations in the vitreal side of the inner limiting membrane (Fig. 1B). Because we know that the OIR mice experienced retinal NV between P12 and P17 and spontaneous retinal NV regression between P17 and P25, these results demonstrate that ephrin-A4 expression was closely correlated with the retinal NV process in the OIR mice. 
Figure 1.
 
Ephrin-A4 levels were increased in OIR mouse retinas and positively correlated with retinal NV. (A) qRT-PCR analysis of the ephrin-A4 mRNA levels in control mouse retinas (75% O2 ) and OIR mouse retinas (75% O2 +). ***P < 0.001; NS, not significant. (B) IHC analysis of ephrin-A4 protein levels in control mice (21% O2) and the OIR mice. Black arrows indicate positive staining. Retinal layers are labeled as follows: neurofiber layer/retinal ganglion cell layer (NFL/GCL), inner plexiform layer (IPL), inner nuclear layer (INL), outer plexiform layer (OPL), and outer nuclear layer (ONL).
Figure 1.
 
Ephrin-A4 levels were increased in OIR mouse retinas and positively correlated with retinal NV. (A) qRT-PCR analysis of the ephrin-A4 mRNA levels in control mouse retinas (75% O2 ) and OIR mouse retinas (75% O2 +). ***P < 0.001; NS, not significant. (B) IHC analysis of ephrin-A4 protein levels in control mice (21% O2) and the OIR mice. Black arrows indicate positive staining. Retinal layers are labeled as follows: neurofiber layer/retinal ganglion cell layer (NFL/GCL), inner plexiform layer (IPL), inner nuclear layer (INL), outer plexiform layer (OPL), and outer nuclear layer (ONL).
Ephrin-A4 Was Upregulated in Hypoxia-Induced RF/6A and RPE Cells
We investigated whether hypoxia could stimulate ephrin-A4 expression in cultured cell lines. Hypoxia-mimetic CoCl2 treatment stimulated ephrin-A4 expression in RF/6A and RPE cells. An increase in ephrin-A4 expression was detectable within the first several hours, reaching a maximum value within 6 hours in RF/6A cells (10-fold) and 12 hours in RPE cells (3-fold), followed by a return to basal levels after 12 hours (RF/6A) and 24 hours (RPE) of CoCl2 treatment (Figs. 2A, 2B). Together, these data suggest that hypoxia can induce ephrin-A4 expression, which may be important in retinal NV development in OIR mice. 
Figure 2.
 
Hypoxia can upregulate ephrin-A4 expression in RF/6A and RPE cells. (A) Ephrin-A4 expression in RF/6A cells after treatment with 200 μM CoCl2. (B) Ephrin-A4 expression in RPE cells after treatment with 200 μM CoCl2. Each bar represents the mean of three independent experiments. *P < 0.05 compared with baseline.
Figure 2.
 
Hypoxia can upregulate ephrin-A4 expression in RF/6A and RPE cells. (A) Ephrin-A4 expression in RF/6A cells after treatment with 200 μM CoCl2. (B) Ephrin-A4 expression in RPE cells after treatment with 200 μM CoCl2. Each bar represents the mean of three independent experiments. *P < 0.05 compared with baseline.
Ephrin-A4/Fc Promotes the In Vitro Angiogenesis Capacity of RF/6A Cells
The expression pattern of ephrin-A4 in the OIR mouse retinas and hypoxia-induced cell lines suggest that it may function to promote angiogenesis. We tested this hypothesis by performing an in vitro tube formation assay using RF/6A cell lines. The tube numbers of RF/6A cells were increased on a membrane preparation solvent (Matrigel), compared with the IgG control, with 1 or 2 μg per mL of ephrin-A4/Fc chimera stimulation (Figs. 3A, 3B). 
Figure 3.
 
Ephrin-A4/Fc promoted tube formation in vitro. (A, B) Representative micrographs showing RF/6A tube formation (measured 10 hours after plating) mediated by IgG and the recombinant human ephrin-A4/Fc chimera. Each bar represents the average tube number from 10 random fields (×100 magnification), and experiments were repeated three times. *P < 0.05 and **P < 0.01 compared with control values.
Figure 3.
 
Ephrin-A4/Fc promoted tube formation in vitro. (A, B) Representative micrographs showing RF/6A tube formation (measured 10 hours after plating) mediated by IgG and the recombinant human ephrin-A4/Fc chimera. Each bar represents the average tube number from 10 random fields (×100 magnification), and experiments were repeated three times. *P < 0.05 and **P < 0.01 compared with control values.
Silencing Ephrin-A4 Inhibited Retinal NV in OIR Mice
We then determined if ephrin-A4 inhibition could prevent the retinal NV process in OIR mice. An intravitreal injection of Efna4-sh1 or Efna4-sh3 effectively silenced ephrin-A4 expression in the retinas, whereas an injection of an enhancing solution or LV-NS did not affect ephrin-A4 expression (Fig. 4A). After FITC-dextran transfusion, retinal flat mounts revealed that an intravitreal injection of bevacizumab and ephrin-A4-specific shRNA markedly reduced the avascular area in the retinas, whereas injections of an enhancing solution or lentivirus LV-NS were ineffective (Figs. 4B, 4C). 
Figure 4.
 
Silencing ephrin-A4 inhibited pathological neovascularization in the OIR mice. (A) Ephrin-A4 mRNA expression determined by qRT-PCR in OIR mouse retinas after injections of an enhancing solution, LV-NS, Efna4-sh1, or Efna4-sh3. (B) The OIR mice, after receiving intravitreal injections, were perfused with fluorescein isothiocyanate (FITC)-dextran (green) at P17. Retinal flat mounts were prepared for each condition and analyzed by fluorescence microscopy. (C) Quantification of avascular areas in the retinas of OIR mice. (D) At P17, the OIR mice with different treatments were perfused with an azo dye (Evans blue). Retinal flat mounts were prepared for each condition and analyzed by fluorescence microscopy. (E) Quantification of the neovascular area (white arrow) in the retinas of OIR mice. **P < 0.01 and ***P < 0.001 compared with LV-NS values. A minimum of 10 mice were tested for each treatment.
Figure 4.
 
Silencing ephrin-A4 inhibited pathological neovascularization in the OIR mice. (A) Ephrin-A4 mRNA expression determined by qRT-PCR in OIR mouse retinas after injections of an enhancing solution, LV-NS, Efna4-sh1, or Efna4-sh3. (B) The OIR mice, after receiving intravitreal injections, were perfused with fluorescein isothiocyanate (FITC)-dextran (green) at P17. Retinal flat mounts were prepared for each condition and analyzed by fluorescence microscopy. (C) Quantification of avascular areas in the retinas of OIR mice. (D) At P17, the OIR mice with different treatments were perfused with an azo dye (Evans blue). Retinal flat mounts were prepared for each condition and analyzed by fluorescence microscopy. (E) Quantification of the neovascular area (white arrow) in the retinas of OIR mice. **P < 0.01 and ***P < 0.001 compared with LV-NS values. A minimum of 10 mice were tested for each treatment.
Vascular leak is a hallmark of the pathologic neovascular tufts observed in ROP. Retinal flat mounts after a blue dye (Evans blue) transfusion were used to quantify the number of neovascular tufts in OIR mouse retinas. An intravitreal injection of lentivirus expressing ephrin-A4 shRNA markedly decreased the number of neovascular tufts, whereas intravitreal injections of an enhancing solution or lentivirus encoding nonsilencing shRNA were ineffective (Figs. 4D, 4E). 
The decrease in neovascular tufts suggests that silencing ephrin-A4 can suppress pathologic retinal NV. The decreased avascular areas indicate that silencing ephrin-A4 can also protect the retina against retinopathy by enhancing developmental vessel regrowth. 
Two independent ephrin-A4 shRNAs produced similar results in suppressing ephrin-A4 expression and the retinal NV process. Moreover, Efna4-sh1 produced higher suppression of ephrin-A4 expression and also resulted in better suppression of retinal NV compared with Efna4-sh3. These results suggest that the changes observed were caused by specific ephrin-A4 silencing rather than the off-target effect. 
Ephrin-A4 Regulated Angiogenesis through the VEGF Signaling Pathway
Because VEGF is the most dominant factor involved in the developmental and pathologic angiogenesis, we attempted to determine if ephrin-A4 was involved in angiogenesis through the VEGF signaling pathway. RF/6A cells were treated with ephrin-A4/Fc, lysed, and subjected to western blot analysis of the VEGF signaling pathway. Ephrin-A4 stimulation significantly increased the phosphorylation levels of VEGR2 and its downstream molecules Akt1 and ERK1/2 in the RF/6A cells (Fig. 5A). This result indicates that ephrin-A4/Fc stimulation activated the VEGF signaling pathway. 
Figure 5.
 
Ephrin-A4 regulated the angiogenesis capacity of RF/6A cells through the VEGF pathway. (A) RF/6A cells were stimulated with ephrin-A4/Fc, lysed, and subjected to western blot analysis with antibodies to phospho-VEGFR2 (Tyr1175), phospho-Akt1, and phospho-ERK1/2. (B) mRNA expression (by real-time RT-PCR) of ephrin-A4 in RF/6A, RF/6A-miNS, and RF/6A-miEFNA4. (C, D) Representative micrographs showing RF/6A, RF/6A-miNS, and RF/6A-miEFNA4 tube formation (measured at 10 hours after plating) mediated by IgG and VEGF165. (E) MTS assays of RF/6A, RF/6A-miNS, and RF/6A-miEFNA4. *P < 0.05 and ***P < 0.001 represent RF/6A-miEFNA4 compared with RF/6A-miNS. (F) Western blot analysis of ephrin-A4, VEGFR2 (Tyr1175), ERK1/2, Akt, and p54 in RF/6A cell line. (G) Western blot analysis of ephrin-A4, VEGFR2 (Tyr1175), ERK1/2, Akt, and >p54 in the retina of OIR mice after administration of the viral construct. *P < 0.05, **P < 0.01, and ***P < 0.001 compared with control values; †P < 0.01 compared with the RF/6A control value.
Figure 5.
 
Ephrin-A4 regulated the angiogenesis capacity of RF/6A cells through the VEGF pathway. (A) RF/6A cells were stimulated with ephrin-A4/Fc, lysed, and subjected to western blot analysis with antibodies to phospho-VEGFR2 (Tyr1175), phospho-Akt1, and phospho-ERK1/2. (B) mRNA expression (by real-time RT-PCR) of ephrin-A4 in RF/6A, RF/6A-miNS, and RF/6A-miEFNA4. (C, D) Representative micrographs showing RF/6A, RF/6A-miNS, and RF/6A-miEFNA4 tube formation (measured at 10 hours after plating) mediated by IgG and VEGF165. (E) MTS assays of RF/6A, RF/6A-miNS, and RF/6A-miEFNA4. *P < 0.05 and ***P < 0.001 represent RF/6A-miEFNA4 compared with RF/6A-miNS. (F) Western blot analysis of ephrin-A4, VEGFR2 (Tyr1175), ERK1/2, Akt, and p54 in RF/6A cell line. (G) Western blot analysis of ephrin-A4, VEGFR2 (Tyr1175), ERK1/2, Akt, and >p54 in the retina of OIR mice after administration of the viral construct. *P < 0.05, **P < 0.01, and ***P < 0.001 compared with control values; †P < 0.01 compared with the RF/6A control value.
For further clarification, we developed ephrin-A4–knockout RF/6A cell lines. The stable RF/6A-miNS and RF/6A-miEFNA4 cell lines were constructed by infecting RF/6A with miNS or miEFNA4 viral particles, respectively, and selecting with puromycin (5 μg/mL) for a week. The stable cell lines were expanded through one passage after the removal of the puromycin and used for subsequent experiments. MiEFNA4 effectively silenced ephrin-A4 mRNA and protein expression in RF/6A cells (Figs. 5B, 5F). The RF/6A-miEFNA4 cell line exhibited decreased tube formation capacity (on Matrigel) compared with RF/6A and RF/6A-miNS cells (Fig. 4D). An MTS assay revealed that RF/6A-miEFNA4 proliferation was significantly slower than RF/6A-miNS and RF/6A cells (Fig. 5E). Furthermore, 100 ng/mL VEGF165 treatment significantly increased the tube numbers of RF/6A and RF/6A-miNS cells (on Matrigel), but VEGF165 stimulation failed to enhance the tube formation capacity of miEFNA4 cells (Figs. 5C, 5D). 
The western blot analysis of the VEGF signaling pathway revealed that VEGF165 stimulation significantly upregulated the phosphorylation levels of VEGFR2, ERK1/2, and Akt1 in RF/6A and RF/6A-miNS cells. However, VEGF165 treatment failed to upregulate the phosphorylation levels of VEGFR2, ERK1/2, and Akt1 in RF/6A-miEFNA4 cells (Fig. 5F). These results suggest that the VEGF signaling in RF/6A requires ephrin-A4. Knockout ephrin-A4 can inhibit the activation of the VEGF signaling pathway and its angiogenesis promotion capacity. Consistent with the results using the RF/6A cell line, the silencing of ephrin-A4 in the retinas of the OIR mice resulted in a striking reduction in the phosphorylation level of VEGFR2 and ERK1/2. In contrast, the phosphorylation level of Akt1 remained unchanged (Fig. 5G). 
Discussion
Ephrin-A4 is widely expressed in adult human tissue (including the spleen, prostate, ovary, small intestine, and colon) and in human fetal tissue (including the heart, lung, and kidney). 17 Although ephrin-A4 was determined to be involved in nervous system development, 18,19 lymphocyte trafficking, 20 immune reaction, 21 and tumor development, 22,23 we introduced two new concepts in this study regarding the involvement of ephrin-A4 in retinal NV and its molecular mechanism. 
First, we demonstrated that ephrin-A4 plays an important role in retinal NV, a major cause of morbidity in potentially blinding diseases, such as ischemic retinopathies, including proliferative diabetic retinopathy, retinal vein occlusion, and retinopathy of prematurity. 24 In vivo, ephrin-A4 was upregulated in OIR mouse retinas. Silencing ephrin-A4 in OIR mouse retinas using lentivirus-mediated shRNA markedly decreased the number of neovascular tufts and reduced the avascular retina area. These results demonstrate that pathologic NV was suppressed, whereas the retinal developmental angiogenesis process was restored. In vitro, ephrin-A4/Fc promoted the tube formation of endothelial cells, and ephrin-A4 knockout inhibited the tube formation capacity of endothelial cells. These results indicated that ephrin-A4 is another potential target against retinal NV, and further studies should be conducted to determine the value of its clinical application. Ephrin-B2, EphB4, and EphA2 have previously been shown to be involved in retinal neovasculogenesis 711 ; ephrin-A4 is a new member of the Eph/ephrin molecule family involved in the process of retinal NV. Further studies on the Eph/ephrin signaling system may identify other genes that control the retinal angiogenesis process. 
Second, we linked the proangiogenic function of ephrin-A4 to its crucial role in the VEGF signaling pathway. VEGF is the dominant regulator of angiogenesis, both in the embryo and in the adult. VEGF regulates the proliferation, survival, sprouting, and migration of endothelial cells and increases endothelial permeability primarily through the VEGFR2 signaling pathway. 25,26 The binding of VEGF to VEGFR2 causes receptor dimerization and phosphorylation at several tyrosine kinase residues. Phosphorylated tyrosine (Y) 1175 activates the mitogen-activated protein kinase (MAPK)/extracellular-signal-regulated kinase-1/2 (ERK1/2) cascade, leading to endothelial cell proliferation. 27 VEGFR2 Y1175/1173 phosphorylation can also activate the phosphoinositide 3-kinase (PI3K)–Akt pathway, which promotes endothelial cell survival, migration, and vascular permeability. 28,29 In this study, ephrin-A4 stimulation dramatically increased VEGFR2, ERK1/2, and Akt1 phosphorylation levels in RF/6A cells, which is similar to the VEGF pathway signaling process. This phenomenon suggests that ephrin-A4 may be a VEGF signaling pathway regulator. Importantly, in the absence of ephrin-A4 (shRNA silencing), phosphorylation of VEGFR2, ERK1/2, and Akt1 was defective in RF/6A cells with VEGF165 stimulation, and the proangiogenic function of VEGF165 was also compromised. In the retinas of the OIR mice, the silencing of ephrin-A4 resulted in a striking reduction in the phosphorylation level of VEGFR2 and ERK1/2, but not the phosphorylation level of Akt1. We speculate that this may be due to the regulation of Akt1 by factors and pathways other than the VEGF pathway in the retina of the OIR mice. Thus, our results demonstrate that ephrin-A4 is an important VEGF signaling pathway regulator, which thereby controls the angiogenesis process. Recently, Ephrin-B2 was shown to control VEGFR2 and VEGFR3 internalization and signaling, thus controlling VEGF-induced angiogenesis and lymphangiogenesis. 30,31 We did not evaluate the role of ephrin-A4 in VEGFR2 internalization or in regulating VEGFR3. Further studies will be conducted to clarify these questions. 
VEGF is required for the growth of both physiologic and pathologic blood vessels, but the variations in VEGF isoforms are important determinants of the biological activity of VEGF. As reported previously, VEGF164 (VEGF165 in humans) is required for pathologic, but not physiologic, ischemia-induced retinal neovascularization. 32,33 Indeed, blocking VEGF165 with pegaptanib effectively prevented the pathologic neovascularization, whereas the physiologic revascularization was unaffected. According to our results, the signaling of VEGF165 in endothelial cells was blocked by the knockout of ephrin-A4. This may explain why ephrin-A4 silencing inhibits the pathologic retinal NV in the OIR mice while allowing the regrowth of physiologic blood vessels. 
The role of ephrin-A4 in normal retinal development was not investigated by this research and has not been reported previously. In the retina of C57Bl/6 mice, the superficial vascular plexus forms during the first week after birth, and the deep and intermediate vascular plexus forms between P12 and P15. 34 However, normal C57Bl/6 mice do not express ephrin-A4 in the retina until P17. Therefore, the expression pattern of ephrin-A4 in the developing retina of C57Bl/6 mice suggests that ephrin-A4 may not be involved in developmental retinal angiogenesis in mice. However, ephrin-As were found to play important roles in the axon guidance that guides retinal ganglion cell axonal growth cones topographically to their appropriate termination zone. 35,36 In the retina of normal mice, ephrin-A4 staining was identified in the GCL and INL, suggesting a role for ephrin-A4 in the neural development of the retina. 
Previous studies have also shown that ephrin-A1, ephrin-B2, EphA2, and EphB4, in addition to ephrin-B2 and ephrin-A4, are involved in the VEGF signaling pathway. 8,3739 Our findings and these previous reports suggest that the interaction between the VEGF signaling pathway and the Eph/ephrin system may play a vital role in the angiogenesis process. Treatments targeting the VEGF signaling pathway have already yielded some clinical options for NV in eye diseases and tumors. Eph/ephrin signaling may also contain greater opportunities for treating neovascularization diseases. 
In summary, this study demonstrates that ephrin-A4 is a key regulator of angiogenesis that is involved in retinal NV by regulating the VEGF signaling pathway. These findings also provide new insights into the VEGF signaling pathway, which might offer new targets for treating NV diseases. 
References
Dorrell M Uusitalo-Jarvinen H Aguilar E Friedlander M . Ocular neovascularization: basic mechanisms and therapeutic advances. Surv Ophthalmol. 2007;52 (suppl 1):S3–S19. [CrossRef] [PubMed]
Zhang SX Ma JX . Ocular neovascularization: implication of endogenous angiogenic inhibitors and potential therapy. Prog Retin Eye Res. 2007;26:1–37. [CrossRef] [PubMed]
Pasquale EB . Eph receptors and ephrins in cancer: bidirectional signalling and beyond. Nat Rev Cancer. 2010;10:165–180. [CrossRef] [PubMed]
Pitulescu ME Adams RH . Eph/ephrin molecules—a hub for signaling and endocytosis. Genes Dev. 2010;24:2480–2492. [CrossRef] [PubMed]
Arvanitis D Davy A . Eph/ephrin signaling: networks. Genes Dev. 2008;22:416–429. [CrossRef] [PubMed]
Pasquale EB . Eph-ephrin bidirectional signaling in physiology and disease. Cell. 2008;133:38–52. [CrossRef] [PubMed]
Ehlken C Martin G Lange C Therapeutic interference with EphrinB2 signalling inhibits oxygen-induced angioproliferative retinopathy. Acta Ophthalmol. 2011;89:82–90. [CrossRef] [PubMed]
Davies MH Zamora DO Smith JR Powers MR . Soluble ephrin-B2 mediates apoptosis in retinal neovascularization and in endothelial cells. Microvasc Res. 2009;77:382–386. [CrossRef] [PubMed]
Kozulin P Natoli R Madigan MC O'Brien KM Provis JM . Gradients of Eph-A6 expression in primate retina suggest roles in both vascular and axon guidance. Mol Vis. 2009;15:2649–2662. [PubMed]
Chen J Hicks D Brantley-Sieders D Inhibition of retinal neovascularization by soluble EphA2 receptor. Exp Eye Res. 2006;82:664–673. [CrossRef] [PubMed]
Zamora DO Davies MH Planck SR Rosenbaum JT Powers MR . Soluble forms of EphrinB2 and EphB4 reduce retinal neovascularization in a model of proliferative retinopathy. Invest Ophthalmol Vis Sci. 2005;46:2175–2182. [CrossRef] [PubMed]
Recchia FM Xu L Penn JS Boone B Dexheimer PJ . Identification of genes and pathways involved in retinal neovascularization by microarray analysis of two animal models of retinal angiogenesis. Invest Ophthalmol Vis Sci. 2010;51:1098–1105. [CrossRef] [PubMed]
Connor KM Krah NM Dennison RJ Quantification of oxygen-induced retinopathy in the mouse: a model of vessel loss, vessel regrowth and pathological angiogenesis. Nat Protoc. 2009;4:1565–1573. [CrossRef] [PubMed]
Rubinson DA Dillon CP Kwiatkowski AV A lentivirus-based system to functionally silence genes in primary mammalian cells, stem cells and transgenic mice by RNA interference. Nat Genet. 2003;33:401–406. [CrossRef] [PubMed]
Takahashi M . Delivery of genes to the eye using lentiviral vectors. Methods Mol Biol. 2004;246:439–449. [PubMed]
Gao H Pennesi ME Qiao X Intravitreal moxifloxacin: retinal safety study with electroretinography and histopathology in animal models. Invest Ophthalmol Vis Sci. 2006;47:1606–1611. [CrossRef] [PubMed]
Kozlosky CJ Maraskovsky E McGrew JT Ligands for the receptor tyrosine kinases hek and elk: isolation of cDNAs encoding a family of proteins. Oncogene. 1995;10:299–306. [PubMed]
Moss A Alvares D Meredith-Middleton J Ephrin-A4 inhibits sensory neurite outgrowth and is regulated by neonatal skin wounding. Eur J Neurosci. 2005;22:2413–2421. [CrossRef] [PubMed]
Kania A Jessell TM . Topographic motor projections in the limb imposed by LIM homeodomain protein regulation of ephrin-A: EphA interactions. Neuron. 2003;38:581–596. [CrossRef] [PubMed]
Trinidad EM Ballesteros M Zuloaga J Zapata A Alonso-Colmenar LM . An impaired transendothelial migration potential of chronic lymphocytic leukemia (CLL) cells can be linked to ephrin-A4 expression. Blood. 2009;114:5081–5090. [CrossRef] [PubMed]
Aasheim HC Munthe E Funderud S Smeland EB Beiske K Logtenberg T . A splice variant of human ephrin-A4 encodes a soluble molecule that is secreted by activated human B lymphocytes. Blood. 2000;95:221–230. [PubMed]
Abdou AG Abd EM Asaad NY Samaka RM Abdallaha R . Immunohistochemical profile of ephrin A4 expression in human osteosarcoma. APMIS. 2009;117:277–285. [CrossRef] [PubMed]
Abdou AG Abd EM Asaad NY Samaka RM Abdallaha R . Ephrin A4 expression in osteosarcoma, impact on prognosis, and patient outcome. Indian J Cancer. 2010;47:46–52. [CrossRef] [PubMed]
Gariano RF Gardner TW . Retinal angiogenesis in development and disease. Nature. 2005;438:960–966. [CrossRef] [PubMed]
Lohela M Bry M Tammela T Alitalo K . VEGFs and receptors involved in angiogenesis versus lymphangiogenesis. Curr Opin Cell Biol. 2009;21:154–165. [CrossRef] [PubMed]
Olsson AK Dimberg A Kreuger J Claesson-Welsh L . VEGF receptor signallingin control of vascular function. Nat Rev Mol Cell Biol. 2006;7:359–371. [CrossRef] [PubMed]
Sakurai Y Ohgimoto K Kataoka Y Yoshida N Shibuya M . Essential role of Flk-1 (VEGF receptor 2) tyrosine residue 1173 in vasculogenesis in mice. Proc Natl Acad Sci U S A. 2005;102:1076–1081. [CrossRef] [PubMed]
Holmqvist K Cross MJ Rolny C The adaptor protein shb binds to tyrosine 1175 in vascular endothelial growth factor (VEGF) receptor-2 and regulates VEGF-dependent cellular migration. J Biol Chem. 2004;279:22267–22275. [CrossRef] [PubMed]
Gerber HP McMurtrey A Kowalski J Vascular endothelial growth factor regulates endothelial cell survival through the phosphatidylinositol 3′-kinase/Akt signal transduction pathway. Requirement for Flk-1/KDR activation. J Biol Chem. 1998;273:30336–30343. [CrossRef] [PubMed]
Wang Y Nakayama M Pitulescu ME Ephrin-B2 controls VEGF-induced angiogenesis and lymphangiogenesis. Nature. 2010;465:483–486. [CrossRef] [PubMed]
Sawamiphak S Seidel S Essmann CL Ephrin-B2 regulates VEGFR2 function in developmental and tumour angiogenesis. Nature. 2010;465:487–491. [CrossRef] [PubMed]
Lutty GA Chan-Ling T Phelps DL Proceedings of the Third International Symposium on Retinopathy of Prematurity: an update on ROP from the lab to the nursery (November 2003, Anaheim, California). Mol Vis. 2006;12:532–580. [PubMed]
Ishida S Usui T Yamashiro K VEGF164-mediated inflammation is required for pathological, but not physiological, ischemia-induced retinal neovascularization. J Exp Med. 2003;198:483–489. [CrossRef] [PubMed]
Stahl A Connor KM Sapieha P The mouse retina as an angiogenesis model. Invest Ophthalmol Vis Sci. 2010;51:2813–2826. [CrossRef] [PubMed]
Rashid T Upton AL Blentic A Opposing gradients of ephrin-As and EphA7 in the superior colliculus are essential for topographic mapping in the mammalian visual system. Neuron. 2005;47:57–69. [CrossRef] [PubMed]
Hornberger MR Dutting D Ciossek T Modulation of EphA receptor function by coexpressed ephrinA ligands on retinal ganglion cell axons. Neuron. 1999;22:731–742. [CrossRef] [PubMed]
Brantley-Sieders DM Fang WB Hwang Y Hicks D Chen J . Ephrin-A1 facilitates mammary tumor metastasis through an angiogenesis-dependent mechanism mediated by EphA receptor and vascular endothelial growth factor in mice. Cancer Res. 2006;66:10315–10324. [CrossRef] [PubMed]
Cheng N Brantley DM Liu H Blockade of EphA receptor tyrosine kinase activation inhibits vascular endothelial cell growth factor-induced angiogenesis. Mol Cancer Res. 2002;1:2–11. [CrossRef] [PubMed]
Hainaud P Contreres JO Villemain A The role of the vascular endothelial growth factor-Delta-like 4 ligand/Notch4-ephrin B2 cascade in tumor vessel remodeling and endothelial cell functions. Cancer Res. 2006;66:8501–8510. [CrossRef] [PubMed]
Footnotes
 Disclosure: W. Du, None; W. Yu, None; L. Huang, None; M. Zhao, None; X. Li, None
Footnotes
 Supported in part by the National Basic Research Program of China (973 Program) Grant 2011CB510200, Peking University People's Hospital Research and Development Fund Grants 65288 and RDB2010-26 65289, and National Natural Science Foundation of China Grant 81170854.
Figure 1.
 
Ephrin-A4 levels were increased in OIR mouse retinas and positively correlated with retinal NV. (A) qRT-PCR analysis of the ephrin-A4 mRNA levels in control mouse retinas (75% O2 ) and OIR mouse retinas (75% O2 +). ***P < 0.001; NS, not significant. (B) IHC analysis of ephrin-A4 protein levels in control mice (21% O2) and the OIR mice. Black arrows indicate positive staining. Retinal layers are labeled as follows: neurofiber layer/retinal ganglion cell layer (NFL/GCL), inner plexiform layer (IPL), inner nuclear layer (INL), outer plexiform layer (OPL), and outer nuclear layer (ONL).
Figure 1.
 
Ephrin-A4 levels were increased in OIR mouse retinas and positively correlated with retinal NV. (A) qRT-PCR analysis of the ephrin-A4 mRNA levels in control mouse retinas (75% O2 ) and OIR mouse retinas (75% O2 +). ***P < 0.001; NS, not significant. (B) IHC analysis of ephrin-A4 protein levels in control mice (21% O2) and the OIR mice. Black arrows indicate positive staining. Retinal layers are labeled as follows: neurofiber layer/retinal ganglion cell layer (NFL/GCL), inner plexiform layer (IPL), inner nuclear layer (INL), outer plexiform layer (OPL), and outer nuclear layer (ONL).
Figure 2.
 
Hypoxia can upregulate ephrin-A4 expression in RF/6A and RPE cells. (A) Ephrin-A4 expression in RF/6A cells after treatment with 200 μM CoCl2. (B) Ephrin-A4 expression in RPE cells after treatment with 200 μM CoCl2. Each bar represents the mean of three independent experiments. *P < 0.05 compared with baseline.
Figure 2.
 
Hypoxia can upregulate ephrin-A4 expression in RF/6A and RPE cells. (A) Ephrin-A4 expression in RF/6A cells after treatment with 200 μM CoCl2. (B) Ephrin-A4 expression in RPE cells after treatment with 200 μM CoCl2. Each bar represents the mean of three independent experiments. *P < 0.05 compared with baseline.
Figure 3.
 
Ephrin-A4/Fc promoted tube formation in vitro. (A, B) Representative micrographs showing RF/6A tube formation (measured 10 hours after plating) mediated by IgG and the recombinant human ephrin-A4/Fc chimera. Each bar represents the average tube number from 10 random fields (×100 magnification), and experiments were repeated three times. *P < 0.05 and **P < 0.01 compared with control values.
Figure 3.
 
Ephrin-A4/Fc promoted tube formation in vitro. (A, B) Representative micrographs showing RF/6A tube formation (measured 10 hours after plating) mediated by IgG and the recombinant human ephrin-A4/Fc chimera. Each bar represents the average tube number from 10 random fields (×100 magnification), and experiments were repeated three times. *P < 0.05 and **P < 0.01 compared with control values.
Figure 4.
 
Silencing ephrin-A4 inhibited pathological neovascularization in the OIR mice. (A) Ephrin-A4 mRNA expression determined by qRT-PCR in OIR mouse retinas after injections of an enhancing solution, LV-NS, Efna4-sh1, or Efna4-sh3. (B) The OIR mice, after receiving intravitreal injections, were perfused with fluorescein isothiocyanate (FITC)-dextran (green) at P17. Retinal flat mounts were prepared for each condition and analyzed by fluorescence microscopy. (C) Quantification of avascular areas in the retinas of OIR mice. (D) At P17, the OIR mice with different treatments were perfused with an azo dye (Evans blue). Retinal flat mounts were prepared for each condition and analyzed by fluorescence microscopy. (E) Quantification of the neovascular area (white arrow) in the retinas of OIR mice. **P < 0.01 and ***P < 0.001 compared with LV-NS values. A minimum of 10 mice were tested for each treatment.
Figure 4.
 
Silencing ephrin-A4 inhibited pathological neovascularization in the OIR mice. (A) Ephrin-A4 mRNA expression determined by qRT-PCR in OIR mouse retinas after injections of an enhancing solution, LV-NS, Efna4-sh1, or Efna4-sh3. (B) The OIR mice, after receiving intravitreal injections, were perfused with fluorescein isothiocyanate (FITC)-dextran (green) at P17. Retinal flat mounts were prepared for each condition and analyzed by fluorescence microscopy. (C) Quantification of avascular areas in the retinas of OIR mice. (D) At P17, the OIR mice with different treatments were perfused with an azo dye (Evans blue). Retinal flat mounts were prepared for each condition and analyzed by fluorescence microscopy. (E) Quantification of the neovascular area (white arrow) in the retinas of OIR mice. **P < 0.01 and ***P < 0.001 compared with LV-NS values. A minimum of 10 mice were tested for each treatment.
Figure 5.
 
Ephrin-A4 regulated the angiogenesis capacity of RF/6A cells through the VEGF pathway. (A) RF/6A cells were stimulated with ephrin-A4/Fc, lysed, and subjected to western blot analysis with antibodies to phospho-VEGFR2 (Tyr1175), phospho-Akt1, and phospho-ERK1/2. (B) mRNA expression (by real-time RT-PCR) of ephrin-A4 in RF/6A, RF/6A-miNS, and RF/6A-miEFNA4. (C, D) Representative micrographs showing RF/6A, RF/6A-miNS, and RF/6A-miEFNA4 tube formation (measured at 10 hours after plating) mediated by IgG and VEGF165. (E) MTS assays of RF/6A, RF/6A-miNS, and RF/6A-miEFNA4. *P < 0.05 and ***P < 0.001 represent RF/6A-miEFNA4 compared with RF/6A-miNS. (F) Western blot analysis of ephrin-A4, VEGFR2 (Tyr1175), ERK1/2, Akt, and p54 in RF/6A cell line. (G) Western blot analysis of ephrin-A4, VEGFR2 (Tyr1175), ERK1/2, Akt, and >p54 in the retina of OIR mice after administration of the viral construct. *P < 0.05, **P < 0.01, and ***P < 0.001 compared with control values; †P < 0.01 compared with the RF/6A control value.
Figure 5.
 
Ephrin-A4 regulated the angiogenesis capacity of RF/6A cells through the VEGF pathway. (A) RF/6A cells were stimulated with ephrin-A4/Fc, lysed, and subjected to western blot analysis with antibodies to phospho-VEGFR2 (Tyr1175), phospho-Akt1, and phospho-ERK1/2. (B) mRNA expression (by real-time RT-PCR) of ephrin-A4 in RF/6A, RF/6A-miNS, and RF/6A-miEFNA4. (C, D) Representative micrographs showing RF/6A, RF/6A-miNS, and RF/6A-miEFNA4 tube formation (measured at 10 hours after plating) mediated by IgG and VEGF165. (E) MTS assays of RF/6A, RF/6A-miNS, and RF/6A-miEFNA4. *P < 0.05 and ***P < 0.001 represent RF/6A-miEFNA4 compared with RF/6A-miNS. (F) Western blot analysis of ephrin-A4, VEGFR2 (Tyr1175), ERK1/2, Akt, and p54 in RF/6A cell line. (G) Western blot analysis of ephrin-A4, VEGFR2 (Tyr1175), ERK1/2, Akt, and >p54 in the retina of OIR mice after administration of the viral construct. *P < 0.05, **P < 0.01, and ***P < 0.001 compared with control values; †P < 0.01 compared with the RF/6A control value.
Table I.
 
Primers for Ephrin-A and GAPDH Amplification
Table I.
 
Primers for Ephrin-A and GAPDH Amplification
Genes Primer Sequence Product Size Tm
Human ephrin-A4 CTCGGCTTTGAGTTCTTACC 106 59
CCTTGCAGCAGACAGACACC
Rhesus ephrin-A4 GTGTCCGCCACGTCGTCTA 167 57
CCAGTCCACCATGTATAAAGCA
Human and rhesus GAPDH GAGTCCACTGGCGTCTTCAC 120 57
GTTCACACCCATGACGAACA
Mouse ephrin-A4 CAGCGCTACACACCCTTCCC 142 61
GTGATGACCCGCTCTCCTTG
Mouse GAPDH CCTTCCGTGTTCCTACCC 150 53
CAACCTGGTCCTCAGTGTAG
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×