Free
Immunology and Microbiology  |   April 2014
Characterization of Vitamin D Production by Human Ocular Barrier Cells
Author Affiliations & Notes
  • Jawaher A. Alsalem
    Centre for Translational Inflammation, School of Immunity and Infection, University of Birmingham, Birmingham, United Kingdom
  • Deepali Patel
    Centre for Translational Inflammation, School of Immunity and Infection, University of Birmingham, Birmingham, United Kingdom
  • Radhika Susarla
    Centre for Translational Inflammation, School of Immunity and Infection, University of Birmingham, Birmingham, United Kingdom
  • Miguel Coca-Prados
    Department of Ophthalmology and Visual Science, Yale University, New Haven, Connecticut, United States
  • Rosemary Bland
    Warwick Medical School, University of Warwick, Coventry, United Kingdom
  • Elizabeth A. Walker
    Center for Endocrinology, Diabetes and Metabolism, School of Immunity and Infection, University of Birmingham, Birmingham, United Kingdom
  • Saaeha Rauz
    Centre for Translational Inflammation, School of Immunity and Infection, University of Birmingham, Birmingham, United Kingdom
  • Graham R. Wallace
    Centre for Translational Inflammation, School of Immunity and Infection, University of Birmingham, Birmingham, United Kingdom
  • Correspondence: Graham R. Wallace, Centre for Translational Inflammation, School of Immunity and Infection, University of Birmingham, Mindlesohn Way, Birmingham B15 2WD, UK; g.r.wallace@bham.ac.uk
Investigative Ophthalmology & Visual Science April 2014, Vol.55, 2140-2147. doi:10.1167/iovs.13-13019
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to Subscribers Only
      Sign In or Create an Account ×
    • Get Citation

      Jawaher A. Alsalem, Deepali Patel, Radhika Susarla, Miguel Coca-Prados, Rosemary Bland, Elizabeth A. Walker, Saaeha Rauz, Graham R. Wallace; Characterization of Vitamin D Production by Human Ocular Barrier Cells. Invest. Ophthalmol. Vis. Sci. 2014;55(4):2140-2147. doi: 10.1167/iovs.13-13019.

      Download citation file:


      © 2016 Association for Research in Vision and Ophthalmology.

      ×
  • Supplements
Abstract

Purpose.: Vitamin D3 is a secosteroid mainly synthesized from the conversion of the skin precursor 7-dehydrocholesterol (7DHC) to vitamin D3 by ultraviolet (UV) B sunlight. Extrarenal synthesis of vitamin D3 has been reported in many tissues and cells, including barrier sites. This study characterizes the expression of components of vitamin D3 signaling in human ocular barrier cells.

Methods.: Primary human scleral fibroblasts (HSF), human corneal endothelial (HCEC-12), nonpigmented ciliary body epithelial (ODM-2), and adult retinal pigment epithelial (ARPE-19) cell lines were analyzed for the expression of vitamin D receptor (VDR), the vitamin D3 activating enzymes 1α-hydroxylase (CYP27B1), 25-hydroxylases (CYP27A1 and CYP2R1), the vitamin D3 inactivating enzyme 24-hydroxylase (CYP24A1), and the endocytic receptors cubilin and megalin using a combination of RT-PCR, immunocytochemistry, and enzyme immunoassay (EIA).

Results.: The HSF, HCEC-12, ODM-2, and ARPE-19 express mRNA and protein for all vitamin D3 synthesizing and metabolizing components. The cell types tested, except HSF, are able to convert inactive 25-hydroxyvitamin D3 (25[OH]D3) into active 1,25-hydroxyviatmin D3 (1,25[OH]2D3).

Conclusions.: This novel study demonstrated that ocular barrier epithelial cells express the machinery for vitamin D3 and can produce 1,25(OH)2D3. We suggest that vitamin D3 might have a role in immune regulation and barrier function in ocular barrier epithelial cells.

Introduction
Vitamin D3 is a secosteroid synthesized from the conversion of the precursor 7-dehydrocholesterol (7DHC) in the skin to vitamin D3 by ultraviolet (UV) B sunlight. To a lesser extent, vitamin D3 can be obtained from the diet. Sufficient levels of vitamin D3 are required for calcium absorption and maintenance of healthy bones. 1 In the circulation, vitamin D3 is activated by two successive hydroxylation steps. The first occurs in the liver by a cytochrome P (CYP) 450 enzyme, 25-hydroxylase (mitochondrial CYP27A1 and microsomal CYP2R1) to produce the major circulating form 25-hydroxyvitamin D3 (25[OH]D3). The second hydroxylation step occurs in the kidney, where 25-hydroxyviatmin D 1α-hydroxylase (CYP27B1) catalyzes the conversion of 25(OH)D3 to its active form 1,25-dihydroxyvitamin D3 (1,25[OH]2D3). As a feedback mechanism, 24-hydroxylase (CYP24A1), which is induced by 1,25(OH)2D3, inactivates both forms of vitamin D3. The 1,25(OH)2D3 action is mediated via the vitamin D receptor (VDR) that heterodimerizes with retinoid X receptor (RXR), a complex that regulates gene transcription through binding to vitamin D response elements (VDRE) in the promoter region of target genes. 2  
Extrarenal synthesis of vitamin D3 has been reported in many tissues and cells, including barrier sites. The VDR and CYP27B1 have been described in epithelial cells of skin, lung, intestine, prostate, endometrium, and breast, as well as cells of the immune system, such as macrophages and dendritic cells. 39 In the circulation, 25(OH)D3 is bound to vitamin D binding protein (DBP), which facilitates its cellular uptake by multi-ligand endocytic receptors megalin/cubilin expressed on the apical surface of polarized epithelial cells in many tissues. 10  
Local production of 1,25(OH)2D3 has been shown in respiratory, bladder, and colonic epithelial cells; osteoclasts; and macrophages. 4,1114 Of note, VDR is critical for barrier formation in human skin and the integrity of mucosal barrier in mouse intestine. 15,16 Recently, vitamin D3 has been recognized as an immunomodulatory hormone that regulates innate and acquired immune responses. 17 One regulatory role of 1,25(OH)2D3 in the immune system (in vitro) involves the inhibition of proinflammatory cytokine production from CD4+ T cells and the induction of a regulatory T cell phenotype. 18 Endogenous conversion of 25(OH)D3 has been shown to inhibit dendritic cell antigen presentation and chemotaxis. 19 The ability to induce the production of host defense peptides (HDPs) in blood monocytes also supports an interaction between 1,25(OH)2D3 and the immune system. The HDP LL-37 (cathelicidin) and human beta defensins (hBD1-4) can kill a wide range of Gram-negative and Gram-positive bacteria, as well as viruses. Moreover, HDPs are immunomodulatory molecules. 20 They can act as chemotactic agents for T and dendritic cells, as well as their ability to induce T-helper 1 and 2 cytokines. 21  
Ocular immune privilege is maintained by a cluster of anatomic and physiological processes that protect the eye from sight-threatening infections and inflammatory responses. 22 The sclera is the white, opaque, fibrous support to the global structure of the eye composed of a rich extracellular matrix (ECM) of collagen and elastic fibers, together with fibroblasts that are responsible for tissue remodeling and the regeneration of the ECM. 23 On the posterior surface of the cornea, endothelial cells contribute to barrier function by mediating sodium transport, which maintains the cornea in a relatively dehydrated state, thereby preserving corneal transparency. 24 The eye consists of two key vascular barriers that afford protection: the blood–aqueous barrier and the blood–retinal barrier. The blood–aqueous barrier consists of tight junctions between vascular endothelial cells of iridociliary body blood vessels, the nonpigmented ciliary epithelial cells complexed apically with the pigmented ciliary epithelium, and the posterior iris epithelium, whereas the blood–retinal barrier is composed of tight junctions of endothelial cells in retinal vasculature and those between the retinal pigment epithelial cells. 25  
To date, very few studies have examined the presence of vitamin D3 synthesizing and metabolizing pathways in the eye, and whether these have a role in ocular barrier cell function by the autocrine production of vitamin D3. This study shows the expression and functionality of vitamin D3 system in several human ocular barriers, intimating that vitamin D3 may be important to the ocular barrier function and ocular immune privilege. 
Materials and Methods
Cell Culture
All cells were grown in a humidified chamber at 37°C and 5% CO2, and passaged by trypsinization. Penicillin (100 units/mL) and streptomycin (100 μg/mL) solution was added to all growth media (PAA Laboratories, Yeovil, UK). All cells were grown in 10% heat inactivated fetal calf serum (HIFCS) except human corneal endothelial cells, which were grown in 5% HIFCS (Biosera Ltd., Ringmer, UK). 
Primary Human Scleral Fibroblasts (HSF).
Primary human scleral fibroblasts were generated from redundant donated corneal scleral tissue following corneal transplant surgery. Acquisition of tissue was after approval from the local research ethics committee and adhered to the Declaration of Helsinki. The sclera was cut into 3- to 5-mm sections and layered in a T-25 cm2 tissue culture flask (Sarstedt, Leicester, UK) for 3 to 5 days in fibro-medium (RPMI 1640 containing 1% MEM nonessential amino acid and 1% sodium pyruvate) until the fibroblasts grew out from the explant and maintained in fibro-medium (all Sigma-Aldrich, Dorset, UK). 
Corneal Endothelial (HCEC-12) Cells.
The HCEC-12 cell line (the German Resource Centre for Biological Material, DSMZ, Braunschweig, Germany) was grown in tissue culture flasks (Sarstedt, Leicester, UK) precoated with a mixture of laminin and chondroitin sulfate (Sigma-Aldrich) in F99 basal medium (Gibco, Invitrogen, Paisley, UK) supplemented with 20 μg/mL ascorbic acid, 20 μg/mL human recombinant insulin, and 10 ng/mL basic fibroblast growth factor (bFBF; all Sigma-Aldrich). 
Adult Retinal Pigment Epithelial (ARPE-19).
The ARPE-19 line, an SV40 transformed cells line, obtained from American Type Culture Collection (ATCC number: CRL-2302; American Type Culture Collection, Middlesex, UK) was cultured in Dulbecco's modified Eagle's medium: Nutrient Mixture F-12 (DMEM/F12), with glutamax (Gibco, Invitrogen). 
Nonpigmented Ciliary Body Epithelial (ODM-2).
The ODM-2 cell line was a kind gift from Dr Coca Prados (Department of Ophthalmology and Visual Sciences, Yale University, New Haven, CT, USA). Cells were cultured in high glucose (4 g/L) DMEM (PAA Laboratories) as described previously. 26  
Reverse Transcription and PCR
Total RNA was isolated using RNeasy Mini Kit (Qiagen, Crawley, UK) according to manufacturer's instructions. The RNA concentration and purity were determined using Nanodrop spectrophotometer (Thermo Fisher Scientific, Loughborough, UK). Total RNA (1 μg) was reverse transcribed to cDNA using Taqman reverse transcription kit (Applied Biosystems, Warrington, UK) following manufacturer's instructions. The PCR was performed using GoTaq Flexi DNA polymerase system (Promega, Southampton, UK) in a total volume of 20 μL containing cDNA (1 μL for 18S and 2 μL for all other primers), 2 mM MgCl2, ×1 GoTaq green Flexi Buffer, 0.5 U Gotaq DNA polymerase, 0.25 mM dNTP mix (Promega), 2.5 μM 18S, and 5 μM other forward and reverse primers (Alta Bioscience, Birmingham, UK). The PCR was performed using Gene Amp, PCR System 2700 (Applied Biosystems) as follows: 5 minutes at 94°C, followed by three temperature cycles of 1 minute at 94°C, annealing for 60 seconds, and 1 minute at 72°C. For cubilin and megalin, preamplification was carried out at 95°C for 5 minutes followed by cycles of denaturation at 94°C for 45 seconds, annealing for 45 seconds, and extension at 72°C for 45 seconds. All PCR reactions ended with a final extension step at 72°C for 7 minutes. Primer sequences, taken from previous publications and cycling condition were as shown in Table 1
Table 1
 
Polymerase Chain Reaction Primer Sequence and Cycle Conditions
Table 1
 
Polymerase Chain Reaction Primer Sequence and Cycle Conditions
Gene Forward Primer 5′–3′ Reverse Primer 5′–3′ Cycles Annealing Temperature, °C Product, bp
VDR CGCTCCAATGAGTCCTTCACC GCTTCATGCTGCACTCAGGC 33 61 421
CYP27B1 CACCTGACCCACTTCCTGTT TCTGGGACACGAGAATTTCC 35 58 302
CYP24A1 CCCACTAGCCACCTCGTACCAAC CGTAGCCCTTCTTTGCGGTAGTC 35 60 485
CYP2R1 AGAGACCCAGAAGTGTTCCAT GTCTTTCAGCACAGATGAGGTA 40 62 259
CYP27A1 GGCAAGTACCCAGTACGG AGCAAATAGCTTCCAAGG 40 62 292
18S GTTGGTGGAGCGATTTGTCT GGCCTCACTAAACCATCCAA 20 55 400
Cubilin GCGGCTTCACTGCTTCCTA GAGTGATGGTGTGCCCTTGT 35 53 518
Megalin TAAGTCAGTGCCCAACCTTT GCGGTTGTTCCTGGAG 35 53 290
1,25(OH)2D3 Enzyme Immunoassay (EIA)
Cells were grown to confluence in 12-well culture plates. Cells were placed in serum-free medium and were either left untreated or treated with 25(OH)D3 (10−7 M) with or without pretreatment with ketoconazole (10−5 M), an inhibitor of CYP27B1 (both Sigma-Aldrich) for 2 hours. After 24 hours, cell culture supernatants were collected for the measurement of 1,25(OH)2D3, and cells were processed for protein extraction and quantification. The 1,25(OH)2D3 concentration was measured by EIA (Immunodiagnostics Systems Limited, Tyne & Wear, UK) according to the manufacturer's instructions. 
Immunofluorescence
Ocular barrier cells were cultured in 8-well glass chamber slides (BD Biosciences, Oxford, UK), fixed for 20 minutes with cold methanol at 4°C, and rinsed with PBS. Cells were blocked with 5% BSA in PBS for 1 hour, then treated with mouse anti-human VDR clone H4537 (R&D Systems, Abingdon, UK), sheep anti-human CYP27B1 clone H210 (The Binding Site Ltd., Birmingham, UK), mouse anti-human CYP24A1 clone 1E1 (Novus Biologicals, Cambridge, UK), mouse anti-human mannose-6-phosphate receptors (M6P) clone 2G11 (Abcam, Cambridge, UK), or mouse anti-human trans-Golgi network 38 (TGN38) clone 2F7.1 (Novus Biologicals), respectively (1:100 in PBS blocking solution) for 1 hour at room temperature. Cells were washed several times with PBS, then incubated with FITC conjugated anti-mouse or FITC conjugated anti-sheep secondary antibody (The Binding Site Ltd.), or Texas Red (TR) conjugated anti-mouse antibody (Abcam) diluted 1:250 in blocking solution for 1 hour at room temperature. Cells were counterstained briefly with DNA-specific stain DAPI (Gibco, Invitrogen) and mounted (Vectashield; Vector Laboratories, Peterborough, UK). Staining was detected using a fluorescent microscope (AxioPlan2 Imaging; Zeiss, Cambridge, UK). 
Statistical Analysis
Statistical analyses were performed using GraphPad Prism 5 (GraphPad Software, Inc., La Jolla, CA, USA). The Kruskal-Wallis test was used, followed by Dunn's multiple comparison test to compare differences between groups. Data are expressed as mean ± SD and a P value < 0.05 was considered as statistically significant. 
Results
Ocular Barrier Cells Constitutively Express mRNA for Vitamin D3 Metabolism
Extrarenal expression of vitamin D3 synthesizing and metabolizing components has been described in many organs. To examine the presence of these elements in ocular barriers, mRNA expression was examined by RT-PCR. The VDR was expressed strongly in all ocular cells tested (Fig. 1A). The CYP27B1 was expressed markedly by HCEC-12, ODM-2, and ARPE-19 compared to a weak expression in HSF. In contrast, CYP24A1 was expressed strongly by HSF and weakly by all other cell types. The CYP27A1 was expressed weakly in HCEC-12, ARPE-19, and ODM-2, but was undetected in HSF. The HSF, HCEC-12, and ARPE-19 highly expressed CYP2R1, whereas ODM-2 showed a weak expression. The mRNA expression of cubilin and megalin, the receptors required for the internalization of 25(OH)D3 through DBP, also was investigated. Cubilin was expressed strongly in all cells, while megalin was only weakly expressed in HSF (Fig. 1B). To summarize, ocular barrier cells constitutively express mRNA for vitamin D3 metabolism. 
Figure 1
 
Ocular barrier cells express mRNA for vitamin D3 elements. Conventional RT-PCR was carried out using total RNA extracted from ocular barrier epithelial cell lines and two primary HSF samples (1 and 2), and primers for (A) VDR, CYP27B1, CYP24A1, CYP27A1, CYP2R1, and for (B) cubilin, and megalin. Ribosomal 18S was used as an internal PCR control and water was used a negative PCR control. The HKC-8 cells were used as a positive control for vitamin D machinery, and primary thyroid cells were used as a positive control for cubilin and megalin. Results are representative of at least three independent experiments. Molecular sizes (base pairs [bp]): 18S (400), VDR (421), CYP27B1 (302), CYP24A1 (485), CYP27A1 (292), CYP2R1 (259), cubilin (518), and megalin (290), and these show the constitutive expression of vitamin D3 synthesizing components in ocular barrier cells.
Figure 1
 
Ocular barrier cells express mRNA for vitamin D3 elements. Conventional RT-PCR was carried out using total RNA extracted from ocular barrier epithelial cell lines and two primary HSF samples (1 and 2), and primers for (A) VDR, CYP27B1, CYP24A1, CYP27A1, CYP2R1, and for (B) cubilin, and megalin. Ribosomal 18S was used as an internal PCR control and water was used a negative PCR control. The HKC-8 cells were used as a positive control for vitamin D machinery, and primary thyroid cells were used as a positive control for cubilin and megalin. Results are representative of at least three independent experiments. Molecular sizes (base pairs [bp]): 18S (400), VDR (421), CYP27B1 (302), CYP24A1 (485), CYP27A1 (292), CYP2R1 (259), cubilin (518), and megalin (290), and these show the constitutive expression of vitamin D3 synthesizing components in ocular barrier cells.
Ocular Barrier Cells Express Proteins for Vitamin D3 Metabolism
Immunofluorescent staining of all cell types for the different vitamin D3 elements was performed (Fig. 2, Supplementary Figs. S1A–D). The intensity of staining varied between cell types, but all cells were positive for all vitamin D3 proteins. The VDR showed a diffuse mild cytoplasmic and abundant speckled nuclear staining. The expression was the strongest in ODM-2 and HCEC-12, and weaker in ARPE-19 and HSF, respectively. The CYP24A1 also was present in the cytoplasm, where the signal was strong in HCEC-12 and ODM-2, and weak in HSF and ARPE-19. The CYP27B1 showed an intense cytoplasmic pattern in ODM-2 and ARPE-19, while HSF showed moderate staining. Interestingly, in HCEC-12 cells, diffuse cytoplasmic staining was present, but most of the enzyme appeared within a perinuclear vesicle. 
Figure 2
 
Ocular barrier cells express proteins for vitamin D3 elements. Ocular epithelial cell lines and primary HSF cells were grown to 40% to 50% confluency in 8-well chamber slides, then fixed and processed for immunofluorescence. Cells were stained with primary mouse monoclonal anti-human VDR antibody, mouse anti-human CYP24A1, and sheep polyclonal anti-human CYP27B1 antibodies, respectively. Staining was visualized with secondary FITC (green) conjugated anti-mouse and anti-sheep antibodies, respectively, using fluorescence microscopy. Nuclei were stained with DAPI (blue). This figure shows merged images with magnification: ×20 for HSF and ×40 for the others, and these show the expression patterns of vitamin D 3 synthesizing proteins in ocular barrier cells. Scale bars: 20 μm.
Figure 2
 
Ocular barrier cells express proteins for vitamin D3 elements. Ocular epithelial cell lines and primary HSF cells were grown to 40% to 50% confluency in 8-well chamber slides, then fixed and processed for immunofluorescence. Cells were stained with primary mouse monoclonal anti-human VDR antibody, mouse anti-human CYP24A1, and sheep polyclonal anti-human CYP27B1 antibodies, respectively. Staining was visualized with secondary FITC (green) conjugated anti-mouse and anti-sheep antibodies, respectively, using fluorescence microscopy. Nuclei were stained with DAPI (blue). This figure shows merged images with magnification: ×20 for HSF and ×40 for the others, and these show the expression patterns of vitamin D 3 synthesizing proteins in ocular barrier cells. Scale bars: 20 μm.
CYP27B1 Colocalizes With MPRs and TGN38 in HCEC-12 Cells
The YP27B1 normally is located in the inner membrane of the mitochondria. 3 All the ocular cells demonstrated a staining pattern consistent with this expression, that is, cytoplasmic. The exception was HCEC-12 cells, which not only expressed CYP27B1 in the cytoplasm, but the majority of the enzyme appeared as a vesicle adjacent to the nucleus. To further identify the nature of this vesicle-like structure, HCEC-12 were stained for Mannose 6 phosphate (M6P) receptors that are known to have a role in the transport of enzymes from the trans-Golgi network (TGN) to lysosomes 27 and typically shows perinuclear localization. In addition, TGN38 protein, part of the trans-Golgi network that directs proteins to secretory vesicles, lysosomes, or plasma membrane, also was examined. 28 The CYP27B1 colocalized to M6P receptors and TGN38 in HCEC-12 (Fig. 3A). The cytoplasmic staining, together with the perinuclear punctated presence (Fig. 3B) confirm CYP27B1 presence in the TGN in HCEC-12 cells. 
Figure 3
 
CYP27B1 co-localizes with M6P receptor and TGN38 in HCEC-12 . (A) Fluorescence microscopy images showing HCEC-12 cells grown to 40% to 50% confluency in 8-well chamber slides, then fixed and processed for immunofluorescence. Cells were stained with sheep polyclonal anti-human CYP27B1 and mouse monoclonal anti-human M6P and TGN38, respectively. Staining was visualized with FITC (green) and TR (red) conjugated anti-sheep and anti-mouse antibodies, respectively. Nuclei were stained with DAPI (blue). Results show colocalization of CYP27B1 with M6P (top) and TGN38 (middle). Negative control (bottom): cells with primary antibody omitted (bottom). Magnification: ×100 for M6P and TGN38 and ×40 for negative control. Scale bars: 5 μm for M6P and TGN38, and 20 μm for negative control. (B) Confocal microscopy images showing HCEC-12 cells prepared as above and were stained with primary sheep polyclonal anti-human CYP27B1 antibodies. Staining was visualized with secondary FITC (green) conjugated anti-sheep antibodies. Nuclei were stained with DAPI (gray). Magnification: ×40. Results show the perinuclear localization of CYP27B1 in HCEC-12 cells.
Figure 3
 
CYP27B1 co-localizes with M6P receptor and TGN38 in HCEC-12 . (A) Fluorescence microscopy images showing HCEC-12 cells grown to 40% to 50% confluency in 8-well chamber slides, then fixed and processed for immunofluorescence. Cells were stained with sheep polyclonal anti-human CYP27B1 and mouse monoclonal anti-human M6P and TGN38, respectively. Staining was visualized with FITC (green) and TR (red) conjugated anti-sheep and anti-mouse antibodies, respectively. Nuclei were stained with DAPI (blue). Results show colocalization of CYP27B1 with M6P (top) and TGN38 (middle). Negative control (bottom): cells with primary antibody omitted (bottom). Magnification: ×100 for M6P and TGN38 and ×40 for negative control. Scale bars: 5 μm for M6P and TGN38, and 20 μm for negative control. (B) Confocal microscopy images showing HCEC-12 cells prepared as above and were stained with primary sheep polyclonal anti-human CYP27B1 antibodies. Staining was visualized with secondary FITC (green) conjugated anti-sheep antibodies. Nuclei were stained with DAPI (gray). Magnification: ×40. Results show the perinuclear localization of CYP27B1 in HCEC-12 cells.
Ocular Barrier Cells Can Convert Inactive Vitamin D3 to the Active Form 1,25(OH)2D3
Ocular barrier cells have the molecular components necessary to produce 1,25(OH)2D3 locally. We next examined the functional capacity of CYP27B1 and its ability to convert inactive 25(OH)D3 (10−7 M) into active 1,25(OH)2D3. The rate of conversion was variable among the different cells, where the highest levels were produced by HCEC-12 followed by HKC8 then ODM2, while the lowest levels were seen in ARPE-19 and none was detected in HSF (Fig. 4). 
Figure 4
 
Ocular barrier cells can convert 25(OH)D3 into active 1,25(OH)2D3. Ocular epithelial cells lines grown to 80% confluency in 12-well plates were either left untreated or treated with 25(OH)D3 (10−7 M) for 24 hours with or without pretreatment with CYP450 inhibitor (10−5 M) ketoconazole (KC) for 2 hours. Cell culture supernatants were collected and 1,25(OH)2D3 was determined by enzyme immunoassay. Results were obtained from a standard curve as pmol/L, then corrected per mg of protein. The HKC-8 cells were used as a positive conversion control. Results are representative for at least three independent experiments. Graph shows mean ± SD 1,25(OH)2D3 per mg protein for each treatment. Bottom right graph shows conversion rates in all ocular barrier epithelial cells compared to HKC-8. Kruskal-Wallis test with Dunn's posttest were performed (*P < 0.05, **P < 0.01; ns, not significant). Results show that all ocular barrier cells except HSF convert inactive to active 1,25(OH)2D3.
Figure 4
 
Ocular barrier cells can convert 25(OH)D3 into active 1,25(OH)2D3. Ocular epithelial cells lines grown to 80% confluency in 12-well plates were either left untreated or treated with 25(OH)D3 (10−7 M) for 24 hours with or without pretreatment with CYP450 inhibitor (10−5 M) ketoconazole (KC) for 2 hours. Cell culture supernatants were collected and 1,25(OH)2D3 was determined by enzyme immunoassay. Results were obtained from a standard curve as pmol/L, then corrected per mg of protein. The HKC-8 cells were used as a positive conversion control. Results are representative for at least three independent experiments. Graph shows mean ± SD 1,25(OH)2D3 per mg protein for each treatment. Bottom right graph shows conversion rates in all ocular barrier epithelial cells compared to HKC-8. Kruskal-Wallis test with Dunn's posttest were performed (*P < 0.05, **P < 0.01; ns, not significant). Results show that all ocular barrier cells except HSF convert inactive to active 1,25(OH)2D3.
The HKC-8–positive control cells produce significant amounts of 1,25(OH)2D3 (195.4 pmol/L/mg protein, P < 0.05). By comparison, primary HSF did not show any conversion and ARPE-19 cells showed minimal levels (8.0 and 25.0 pmol/L/mg protein, respectively). Interestingly, HCEC-12 were the most efficient of all cell types at converting the substrate into the active form of 1,25(OH)2D3 (2068.1 pmol/L/mg protein, P < 0.01), that is, 10 times higher than HKC-8, while ODM-2 cells produced levels as high as 640.1 pmol/L/mg protein. 
Substrate conversion in each cell type was inhibited by pretreatment with 10−5 M ketoconazole and the inhibition is statistically significant in cells that produced more than 200 pmol/L/mg protein of 1,25(OH)2D3 (HCEC-12, and ODM-2). 
Discussion
This study showed that human ocular barrier epithelial cells and scleral fibroblasts constitutively express the receptor and the metabolic enzymes required in the vitamin D3 pathway, and for the first time to our knowledge that all these cell types can endogenously produce 1,25(OH)2D3 when treated with physiological concentrations of its precursor 25(OH)D3 (Table 2). These findings supported a recent report describing CYP27B1 and VDR mRNA in primary human corneal epithelium (PHCEC), while treatment with 25(OH)D3 or 1,25(OH)2D3 enhanced barrier function as shown by decreased inulin permeability and increased transepithelial resistance in vitro. 29 In a separate study, a human corneal limbal epithelial cell line treated with UVB and 7DHC showed an increase in 1,25(OH)2D3 production. 30 Previous studies also have shown that corneal epithelial cells and RPE-choroid express the molecular elements for vitamin D3, but there were no data on 25(OH)D3 conversion. 31  
Table 2
 
A Summary of Gene and Protein Expression for Vitamin D3 Elements by Ocular Barrier Cells as Well as the Rate of 25D3 Conversion
Table 2
 
A Summary of Gene and Protein Expression for Vitamin D3 Elements by Ocular Barrier Cells as Well as the Rate of 25D3 Conversion
Cell Line Gene Expression Immunofluorescence Rate of 25D3 Conversion
VDR CYP27B1 CYP24A1 CYP27A1 CYP2R1 Cubilin Megalin VDR CYP27B1 CYP24A1
Ocular barrier cells
 HSF ++ ++ +++ +++ + ++ ++ +++
 HCEC-12 +++ +++ + ++ +++ +++ +++ +++ + +++
 ODM-2 +++ +++ + + ++ +++ +++ +++ + ++
 ARPE-19 +++ +++ ++ + +++ +++ ++ +++ ++ +
Control cells
 HKC-8 +++ +++ +++ + +++ +++ + ND ND ND ++
 Thyroid ND ND ND ND ND +++ +++ ND ND ND ND
As stated, vitamin D3 synthesizing components (VDR, CYP27B1, and CYP24A1) are expressed widely in many human epithelial cells. In agreement with the speckled cytoplasmic and nuclear VDR staining in ocular barrier cells and sclera fibroblasts, VDR has been described in cytoplasm and nucleus of bladder epithelium as well as skin fibroblasts. 11,32 The cytoplasmic expression of CYP27B1 in most of the ocular barrier cells is in accordance with similar expression in bladder epithelium. Conversely, the punctate perinuclear staining of CYP27B1 in HCEC-12 can be compared to the cytoplasmic localization of internalized Alexa-DBP in the perinuclear space of human breast cancer epithelial cells T-47D, where it colocalized with lysosomes, which suggested that DBP traffics through endosomes and lysosomes. 33 The expression of CYP27B1 in TGN could be part of this enzyme's trafficking in these cells. Membrane-bound CYP450 proteins can recycle through Golgi before reaching their destined locations. 34  
Although ocular barrier cells show constitutive expression of mRNA and protein for CYP24A1, this mitochondrial enzyme is not constitutively expressed in all peripheral organs and tissues. Some cells, such as skin keratinocytes, primary respiratory epithelial cells, and colonic epithelial cell line, only express CYP24A1 in response to 25(OH)D3 or 1,25(OH)2D3. Keratinocytes demonstrate a strong up-regulation following exposure to UVB light in the presence of 7DHC. 4,13,35 The CYP24A1 also is induced after treatment with 25(OH)D3 sufficient serum in macrophages. 20  
Our study showed that ocular barrier epithelial cells can convert inactive vitamin D3 to its active form. With the exception of ARPE-19, ocular barrier cells, are able to produce significant levels of active 1,25(OH)2D3 (>0.4 × 10−9 M) at 24 hours. This rate of conversion is comparable to that of primary respiratory epithelial cells, bladder, and mammary epithelial cell lines. 4,11,36 These rates are much higher than those produced by human kidney cortical collecting duct (HCD) cell line. 37 As depicted in Figure 5, ocular barrier conversion is high in PHCEC (Susarla R, Wallace GR, Oswal K, et al., unpublished data, 2013), reaches a peak in corneal endothelium (HCEC-12), and starts to decrease in nonpigmented ciliary body epithelium (ODM-2), reaching the lowest levels at retinal pigmented epithelium (ARPE-19). The HSF failed to convert 25(OH)D3 into 1,25(OH)2D3 and likewise dermal fibroblasts do not express CYP27B1, which may indicate that fibroblasts generally do not have the ability to convert 25(OH)D3. 38  
Figure 5
 
The rate of 25(OH)D3 conversion by ocular barrier cells according to their location from the outside to the inside. A schematic diagram showing 1,25(OH)2D3 concentration in the different ocular barrier cells from the exterior to the interior following their anatomic location. While no conversion was seen in HSF, 25(OH)D3 conversion is high in the corneal epithelium (PHCEC), reaches the maximal levels in the corneal endothelium (HCEC-12), decreases in the ciliary body (ODM-2), and further in the retina (ARPE-19).
Figure 5
 
The rate of 25(OH)D3 conversion by ocular barrier cells according to their location from the outside to the inside. A schematic diagram showing 1,25(OH)2D3 concentration in the different ocular barrier cells from the exterior to the interior following their anatomic location. While no conversion was seen in HSF, 25(OH)D3 conversion is high in the corneal epithelium (PHCEC), reaches the maximal levels in the corneal endothelium (HCEC-12), decreases in the ciliary body (ODM-2), and further in the retina (ARPE-19).
Ocular barrier epithelial cells appear to be efficient in producing 1,25(OH)2D3 provided they have the substrate available. Despite the requirement of 25(OH)D3 for CYP27B1 to convert it to 1,25(OH)2D3, ocular barrier cells potentially can initiate the vitamin D3 pathway as early as the first 25-hydroxylation step via CYP27A1 and CY2R1. Extrahepatic expression of CYP27A1 and CY2R1 also has been reported previously in other tissues. 39,40 With its broad substrate specificity, CYP27A1 also is involved in cholesterol metabolism. The CYP27A1 is expressed in the retinal pigment epithelium and protects the retina from the toxic 7-ketocholesterol, a metabolite of 7-DHC as a result of photooxidation. Although CYP27A1 was expressed weakly by ocular barrier cells, the expression of microsomal CYP2R1 was considerably stronger. Moreover, the 25-hydroxylation activity of CYP2R1 is 26-fold higher than that of CYP27A1. 41 This means ocular cells may be able to synthesize vitamin D3 directly on exposure to sunlight. However, it should be noted that the American Academy of Ophthalmology recommends protection of the eye from long hours of direct sunlight, which may contribute to cataract and cancer formation. 
The expression of megalin and cubilin in ocular barrier cells indicated the importance of these receptors in vitamin D3 metabolism. Although megalin is expressed more widely in different tissues, the expression of cubilin is more pronounced in ocular barrier cells. 10,42  
An immune privileged organ, such as the eye, requires efficient strategies that can protect it from sight-threatening infections and damaging inflammatory responses. A recent study has shown that mice injected with vitamin D3 had reduced retinal inflammation and this was associated with a reduction of retinal macrophage activation. More importantly, these mice showed decreased levels of amyloid-beta (Aβ), a risk factor for age-related macular degeneration (AMD). 43 Decreased serum levels in humans of 25(OH)D3 have been correlated with increased early AMD and low visual acuity in the elderly. 44 This was investigated further by calculating UVB exposure index, which correlated with reduced neovascular AMD. Moreover, single nucleotide polymorphisms of human CYP24A1 have been shown to be linked to neovascular AMD. 31  
The ability of ocular barrier cells to locally produce large amounts of 1,25(OH)2D3 may be important for their barrier function. For example, corneal endothelial cells are highly metabolic and represent an important barrier at the anterior segment of the eye, and producing large amounts of 1,25(OH)2D3 may help maintain this function. More than 200 genes were significantly upregulated or downregulated in response to stimulation with 1,25(OH)2D3, including several involved in the immune response. 45  
The main caveat in this work is the use of cell lines rather than primary cells. However the lines used are well-established and regarded as good correlates for freshly-isolated ocular cells in multiple experiments. 
In conclusion, this study has demonstrated for the first time to our knowledge the expression of vitamin D3 synthesizing components in ocular barrier cells, and that these cells can convert inactive 25(OH)D3 into active 1,25(OH)2D3. Further work will show if these cells can create an environment rich in 1,25(OH)2D3 and if this has an effect on ocular immune protection and immune privilege. 
Supplementary Materials
Acknowledgments
We thank Monica Valtink and Katrin Engelmann, University Hospital Carl Gustav Carus, Dresden, Germany, for help in growing the HCEC-12 line, and Vicki Smith, University of Birmingham, for thyroid RNA. 
Supported by Action Medical Research (UK Registered Charity in England and Wales [208701] and Scotland [SC039284]), Guide Dogs for the Blind (UK registered Charity in England and Wales [209617] and Scotland [SC038979]), Henry Smith Charity (UK Registered Charity 230102), and University of Dammam, Dammam, Saudi Arabia. 
Disclosure: J.A. Alsalem, None; D. Patel, None; R. Susarla, None; M. Coca-Prados, None; R. Bland, None; E.A. Walker, None; S. Rauz, None; G.R. Wallace, None 
References
Holick MF. Sunlight and vitamin D for bone health and prevention of autoimmune diseases, cancers, and cardiovascular disease. Am J Clin Nutr . 2004; 80: 1678S–1688S. [PubMed]
Baeke F Takiishi T Korf H Gysemans C Mathieu C. Vitamin D: modulator of the immune system. Curr Opin Pharmacol . 2010; 10: 482–496. [CrossRef] [PubMed]
Brozyna AA Jozwicki W Janjetovic Z Slominski AT. Expression of vitamin D receptor decreases during progression of pigmented skin lesions. Hum Pathol . 2011; 42: 618–631. [CrossRef] [PubMed]
Hansdottir S Monick MM Hinde SL Lovan N Look DC Hunninghake GW. Respiratory epithelial cells convert inactive vitamin D to its active form: potential effects on host defense. J Immunol . 2008; 181: 7090–7099. [CrossRef] [PubMed]
Larriba MJ Ordonez-Moran P Chicote I Vitamin D receptor deficiency enhances Wnt/beta-catenin signaling and tumor burden in colon cancer. PLoS One . 2011; 6: e23524. [CrossRef] [PubMed]
Flanagan JN Young MV Persons KS Vitamin D metabolism in human prostate cells: implications for prostate cancer chemoprevention by vitamin D. Anticancer Res . 2006; 26: 2567–2572. [PubMed]
Agic A Xu H Altgassen C Relative expression of 1,25-dihydroxyvitamin D3 receptor, vitamin D 1 alpha-hydroxylase, vitamin D 24-hydroxylase, and vitamin D 25-hydroxylase in endometriosis and gynecologic cancers. Reprod Sci . 2007; 14: 486–497. [CrossRef] [PubMed]
Hewison M Freeman L Hughes SV Differential regulation of vitamin D receptor and its ligand in human monocyte-derived dendritic cells. J Immunol . 2003; 170: 5382–5390. [CrossRef] [PubMed]
Zhu J DeLuca HF. Vitamin D 25-hydroxylase - four decades of searching, are we there yet? Arch Biochem Biophys . 2012; 523: 30–36. [CrossRef] [PubMed]
Christensen EI Birn H. Megalin and cubilin: multifunctional endocytic receptors. Nat Rev Mol Cell Biol . 2002; 3: 256–266. [CrossRef] [PubMed]
Hertting O Holm A Luthje P Vitamin D induction of the human antimicrobial peptide cathelicidin in the urinary bladder. PLoS One . 2010; 5: e15580. [CrossRef] [PubMed]
Kogawa M Findlay DM Anderson PH Osteoclastic metabolism of 25(OH)-vitamin D3: a potential mechanism for optimization of bone resorption. Endocrinology . 2010; 151: 4613–4625. [CrossRef] [PubMed]
Lagishetty V Chun RF Liu NQ Lisse TS Adams JS Hewison M. 1alpha-hydroxylase and innate immune responses to 25-hydroxyvitamin D in colonic cell lines. J Steroid Biochem Mol Biol . 2010; 121: 228–233. [CrossRef] [PubMed]
Gottfried E Rehli M Hahn J Holler E Andreesen R Kreutz M. Monocyte-derived cells express CYP27A1 and convert vitamin D3 into its active metabolite. Biochem Biophys Res Commun . 2006; 349: 209–213. [CrossRef] [PubMed]
Oda Y Uchida Y Moradian S Crumrine D Elias PM Bikle DD. Vitamin D receptor and coactivators SRC2 and 3 regulate epidermis-specific sphingolipid production and permeability barrier formation. J Invest Dermatol . 2009; 129: 1367–1378. [CrossRef] [PubMed]
Kong J Zhang Z Musch MW Novel role of the vitamin D receptor in maintaining the integrity of the intestinal mucosal barrier. Am J Physiol Gastrointest Liver Physiol . 2008; 294: G208–G216. [CrossRef] [PubMed]
Hewison M. An update on vitamin D and human immunity. Clin Endocrinol (Oxf) . 2012; 76: 315–325. [CrossRef] [PubMed]
Jeffery LE Burke F Mura M 1,25-Dihydroxyvitamin D3 and IL-2 combine to inhibit T cell production of inflammatory cytokines and promote development of regulatory T cells expressing CTLA-4 and FoxP3. J Immunol . 2009; 183: 5458–5467. [CrossRef] [PubMed]
Bartels LE Hvas CL Agnholt J Dahlerup JF Agger R. Human dendritic cell antigen presentation and chemotaxis are inhibited by intrinsic 25-hydroxy vitamin D activation. Int Immunopharmacol . 2010; 10: 922–928. [CrossRef] [PubMed]
Liu PT Stenger S Li H Toll-like receptor triggering of a vitamin D-mediated human antimicrobial response. Science . 2006; 311: 1770–1773. [CrossRef] [PubMed]
Oppenheim JJ Biragyn A Kwak LW Yang D. Roles of antimicrobial peptides such as defensins in innate and adaptive immunity. Ann Rheum Dis . 2003; 62 (suppl 2): ii17–ii21. [PubMed]
Streilein JW. Ocular immune privilege: therapeutic opportunities from an experiment of nature. Nat Rev Immunol . 2003; 3: 879–889. [CrossRef] [PubMed]
Rada JA Shelton S Norton TT. The sclera and myopia. Exp Eye Res . 2006; 82: 185–200. [CrossRef] [PubMed]
Mergler S Pleyer U. The human corneal endothelium: new insights into electrophysiology and ion channels. Prog Retin Eye Res . 2007; 26: 359–378. [CrossRef] [PubMed]
Hornof M Toropainen E Urtti A. Cell culture models of the ocular barriers. Eur J Pharm Biopharm . 2005; 60: 207–225. [CrossRef] [PubMed]
Rauz S Walker EA Shackleton CH Hewison M Murray PI Stewart PM. Expression and putative role of 11 beta-hydroxysteroid dehydrogenase isozymes within the human eye. Invest Ophthalmol Vis Sci . 2001; 42: 2037–2042. [PubMed]
Ghosh P Dahms NM Kornfeld S. Mannose 6-phosphate receptors: new twists in the tale. Nat Rev Mol Cell Biol . 2003; 4: 202–212. [CrossRef] [PubMed]
Gu F Crump CM Thomas G. Trans-Golgi network sorting. Cell Mol Life Sci . 2001; 58: 1067–1084. [CrossRef] [PubMed]
Yin Z Pintea V Lin Y Hammock BD Watsky MA. Vitamin D enhances corneal epithelial barrier function. Invest Ophthalmol Vis Sci . 2011; 52: 7359–7364. [CrossRef] [PubMed]
Lin Y Ubels JL Schotonus MP Enhancement of vitamin D metabolites in the eye following vitamin D3 supplementation and UV-B irradiation. Curr Eye Res . 2012; 37: 871–878. [CrossRef] [PubMed]
Morrison MA Silveira AC Huynh N Systems biology-based analysis implicates a novel role for vitamin D metabolism in the pathogenesis of age-related macular degeneration. Hum Genomics . 2011; 5: 538–568. [CrossRef] [PubMed]
Midorikawa K Sayama K Shirakata Y Hanakawa Y Sun L Hashimoto K. Expression of vitamin D receptor in cultured human keratinocytes and fibroblasts is not altered by corticosteroids. J Dermatol Sci . 1999; 21: 8–12. [CrossRef] [PubMed]
Rowling MJ Kemmis CM Taffany DA Welsh J. Megalin-mediated endocytosis of vitamin D binding protein correlates with 25-hydroxycholecalciferol actions in human mammary cells. J Nutr . 2006; 136: 2754–2759. [PubMed]
Seliskar M Rozman D. Mammalian cytochromes P450--importance of tissue specificity. Biochim Biophys Acta . 2007; 1770: 458–466. [CrossRef] [PubMed]
Bar M Domaschke D Meye A Lehmann B Meurer M. Wavelength-dependent induction of CYP24A1-mRNA after UVB-triggered calcitriol synthesis in cultured human keratinocytes. J Invest Dermatol . 2007; 127: 206–213. [CrossRef] [PubMed]
Kemmis CM Welsh J. Mammary epithelial cell transformation is associated with deregulation of the vitamin D pathway. J Cell Biochem . 2008; 105: 980–988. [CrossRef] [PubMed]
Bland R Zehnder D Hughes SV Ronco PM Stewart PM Hewison M. Regulation of vitamin D-1alpha-hydroxylase in a human cortical collecting duct cell line. Kidney Int . 2001; 60: 1277–1286. [CrossRef] [PubMed]
Vantieghem K De HP Bouillon R Segaert S. Dermal fibroblasts pretreated with a sterol delta7-reductase inhibitor produce 25-hydroxyvitamin D3 upon UVB irradiation. J Photochem Photobiol B . 2006; 85: 72–78. [CrossRef] [PubMed]
Blomberg JM Andersen CB Nielsen JE Expression of the vitamin D receptor, 25-hydroxylases, 1alpha-hydroxylase and 24-hydroxylase in the human kidney and renal clear cell cancer. J Steroid Biochem Mol Biol . 2010; 121: 376–382. [CrossRef] [PubMed]
Shinkyo R Sakaki T Kamakura M Ohta M Inouye K. Metabolism of vitamin D by human microsomal CYP2R1. Biochem Biophys Res Commun . 2004; 324: 451–457. [CrossRef] [PubMed]
Heo GY Liao WL Turko IV Pikuleva IA. Features of the retinal environment which affect the activities and product profile of cholesterol-metabolizing cytochromes P450 CYP27A1 and CYP11A1. Arch Biochem Biophys . 2012; 518: 119–126. [CrossRef] [PubMed]
Chlon TM Taffany DA Welsh J Rowling MJ. Retinoids modulate expression of the endocytic partners megalin, cubilin, and disabled-2 and uptake of vitamin D-binding protein in human mammary cells. J Nutr . 2008; 138: 1323–1328. [PubMed]
Lee V Rekhi E Kam JH Jeffery G. Vitamin D rejuvenates aging eyes by reducing inflammation, clearing amyloid beta and improving visual function. Neurobiol Aging . 2012; 33: 2382–2389. [CrossRef] [PubMed]
Millen AE Voland R Sondel SA Vitamin D status and early age-related macular degeneration in postmenopausal women. Arch Ophthalmol . 2011; 129: 481–489. [CrossRef] [PubMed]
Ramagopalan SV Heger A Berlanga AJ A ChIP-seq defined genome-wide map of vitamin D receptor binding: associations with disease and evolution. Genome Res . 2010; 20: 1352–1360. [CrossRef] [PubMed]
Figure 1
 
Ocular barrier cells express mRNA for vitamin D3 elements. Conventional RT-PCR was carried out using total RNA extracted from ocular barrier epithelial cell lines and two primary HSF samples (1 and 2), and primers for (A) VDR, CYP27B1, CYP24A1, CYP27A1, CYP2R1, and for (B) cubilin, and megalin. Ribosomal 18S was used as an internal PCR control and water was used a negative PCR control. The HKC-8 cells were used as a positive control for vitamin D machinery, and primary thyroid cells were used as a positive control for cubilin and megalin. Results are representative of at least three independent experiments. Molecular sizes (base pairs [bp]): 18S (400), VDR (421), CYP27B1 (302), CYP24A1 (485), CYP27A1 (292), CYP2R1 (259), cubilin (518), and megalin (290), and these show the constitutive expression of vitamin D3 synthesizing components in ocular barrier cells.
Figure 1
 
Ocular barrier cells express mRNA for vitamin D3 elements. Conventional RT-PCR was carried out using total RNA extracted from ocular barrier epithelial cell lines and two primary HSF samples (1 and 2), and primers for (A) VDR, CYP27B1, CYP24A1, CYP27A1, CYP2R1, and for (B) cubilin, and megalin. Ribosomal 18S was used as an internal PCR control and water was used a negative PCR control. The HKC-8 cells were used as a positive control for vitamin D machinery, and primary thyroid cells were used as a positive control for cubilin and megalin. Results are representative of at least three independent experiments. Molecular sizes (base pairs [bp]): 18S (400), VDR (421), CYP27B1 (302), CYP24A1 (485), CYP27A1 (292), CYP2R1 (259), cubilin (518), and megalin (290), and these show the constitutive expression of vitamin D3 synthesizing components in ocular barrier cells.
Figure 2
 
Ocular barrier cells express proteins for vitamin D3 elements. Ocular epithelial cell lines and primary HSF cells were grown to 40% to 50% confluency in 8-well chamber slides, then fixed and processed for immunofluorescence. Cells were stained with primary mouse monoclonal anti-human VDR antibody, mouse anti-human CYP24A1, and sheep polyclonal anti-human CYP27B1 antibodies, respectively. Staining was visualized with secondary FITC (green) conjugated anti-mouse and anti-sheep antibodies, respectively, using fluorescence microscopy. Nuclei were stained with DAPI (blue). This figure shows merged images with magnification: ×20 for HSF and ×40 for the others, and these show the expression patterns of vitamin D 3 synthesizing proteins in ocular barrier cells. Scale bars: 20 μm.
Figure 2
 
Ocular barrier cells express proteins for vitamin D3 elements. Ocular epithelial cell lines and primary HSF cells were grown to 40% to 50% confluency in 8-well chamber slides, then fixed and processed for immunofluorescence. Cells were stained with primary mouse monoclonal anti-human VDR antibody, mouse anti-human CYP24A1, and sheep polyclonal anti-human CYP27B1 antibodies, respectively. Staining was visualized with secondary FITC (green) conjugated anti-mouse and anti-sheep antibodies, respectively, using fluorescence microscopy. Nuclei were stained with DAPI (blue). This figure shows merged images with magnification: ×20 for HSF and ×40 for the others, and these show the expression patterns of vitamin D 3 synthesizing proteins in ocular barrier cells. Scale bars: 20 μm.
Figure 3
 
CYP27B1 co-localizes with M6P receptor and TGN38 in HCEC-12 . (A) Fluorescence microscopy images showing HCEC-12 cells grown to 40% to 50% confluency in 8-well chamber slides, then fixed and processed for immunofluorescence. Cells were stained with sheep polyclonal anti-human CYP27B1 and mouse monoclonal anti-human M6P and TGN38, respectively. Staining was visualized with FITC (green) and TR (red) conjugated anti-sheep and anti-mouse antibodies, respectively. Nuclei were stained with DAPI (blue). Results show colocalization of CYP27B1 with M6P (top) and TGN38 (middle). Negative control (bottom): cells with primary antibody omitted (bottom). Magnification: ×100 for M6P and TGN38 and ×40 for negative control. Scale bars: 5 μm for M6P and TGN38, and 20 μm for negative control. (B) Confocal microscopy images showing HCEC-12 cells prepared as above and were stained with primary sheep polyclonal anti-human CYP27B1 antibodies. Staining was visualized with secondary FITC (green) conjugated anti-sheep antibodies. Nuclei were stained with DAPI (gray). Magnification: ×40. Results show the perinuclear localization of CYP27B1 in HCEC-12 cells.
Figure 3
 
CYP27B1 co-localizes with M6P receptor and TGN38 in HCEC-12 . (A) Fluorescence microscopy images showing HCEC-12 cells grown to 40% to 50% confluency in 8-well chamber slides, then fixed and processed for immunofluorescence. Cells were stained with sheep polyclonal anti-human CYP27B1 and mouse monoclonal anti-human M6P and TGN38, respectively. Staining was visualized with FITC (green) and TR (red) conjugated anti-sheep and anti-mouse antibodies, respectively. Nuclei were stained with DAPI (blue). Results show colocalization of CYP27B1 with M6P (top) and TGN38 (middle). Negative control (bottom): cells with primary antibody omitted (bottom). Magnification: ×100 for M6P and TGN38 and ×40 for negative control. Scale bars: 5 μm for M6P and TGN38, and 20 μm for negative control. (B) Confocal microscopy images showing HCEC-12 cells prepared as above and were stained with primary sheep polyclonal anti-human CYP27B1 antibodies. Staining was visualized with secondary FITC (green) conjugated anti-sheep antibodies. Nuclei were stained with DAPI (gray). Magnification: ×40. Results show the perinuclear localization of CYP27B1 in HCEC-12 cells.
Figure 4
 
Ocular barrier cells can convert 25(OH)D3 into active 1,25(OH)2D3. Ocular epithelial cells lines grown to 80% confluency in 12-well plates were either left untreated or treated with 25(OH)D3 (10−7 M) for 24 hours with or without pretreatment with CYP450 inhibitor (10−5 M) ketoconazole (KC) for 2 hours. Cell culture supernatants were collected and 1,25(OH)2D3 was determined by enzyme immunoassay. Results were obtained from a standard curve as pmol/L, then corrected per mg of protein. The HKC-8 cells were used as a positive conversion control. Results are representative for at least three independent experiments. Graph shows mean ± SD 1,25(OH)2D3 per mg protein for each treatment. Bottom right graph shows conversion rates in all ocular barrier epithelial cells compared to HKC-8. Kruskal-Wallis test with Dunn's posttest were performed (*P < 0.05, **P < 0.01; ns, not significant). Results show that all ocular barrier cells except HSF convert inactive to active 1,25(OH)2D3.
Figure 4
 
Ocular barrier cells can convert 25(OH)D3 into active 1,25(OH)2D3. Ocular epithelial cells lines grown to 80% confluency in 12-well plates were either left untreated or treated with 25(OH)D3 (10−7 M) for 24 hours with or without pretreatment with CYP450 inhibitor (10−5 M) ketoconazole (KC) for 2 hours. Cell culture supernatants were collected and 1,25(OH)2D3 was determined by enzyme immunoassay. Results were obtained from a standard curve as pmol/L, then corrected per mg of protein. The HKC-8 cells were used as a positive conversion control. Results are representative for at least three independent experiments. Graph shows mean ± SD 1,25(OH)2D3 per mg protein for each treatment. Bottom right graph shows conversion rates in all ocular barrier epithelial cells compared to HKC-8. Kruskal-Wallis test with Dunn's posttest were performed (*P < 0.05, **P < 0.01; ns, not significant). Results show that all ocular barrier cells except HSF convert inactive to active 1,25(OH)2D3.
Figure 5
 
The rate of 25(OH)D3 conversion by ocular barrier cells according to their location from the outside to the inside. A schematic diagram showing 1,25(OH)2D3 concentration in the different ocular barrier cells from the exterior to the interior following their anatomic location. While no conversion was seen in HSF, 25(OH)D3 conversion is high in the corneal epithelium (PHCEC), reaches the maximal levels in the corneal endothelium (HCEC-12), decreases in the ciliary body (ODM-2), and further in the retina (ARPE-19).
Figure 5
 
The rate of 25(OH)D3 conversion by ocular barrier cells according to their location from the outside to the inside. A schematic diagram showing 1,25(OH)2D3 concentration in the different ocular barrier cells from the exterior to the interior following their anatomic location. While no conversion was seen in HSF, 25(OH)D3 conversion is high in the corneal epithelium (PHCEC), reaches the maximal levels in the corneal endothelium (HCEC-12), decreases in the ciliary body (ODM-2), and further in the retina (ARPE-19).
Table 1
 
Polymerase Chain Reaction Primer Sequence and Cycle Conditions
Table 1
 
Polymerase Chain Reaction Primer Sequence and Cycle Conditions
Gene Forward Primer 5′–3′ Reverse Primer 5′–3′ Cycles Annealing Temperature, °C Product, bp
VDR CGCTCCAATGAGTCCTTCACC GCTTCATGCTGCACTCAGGC 33 61 421
CYP27B1 CACCTGACCCACTTCCTGTT TCTGGGACACGAGAATTTCC 35 58 302
CYP24A1 CCCACTAGCCACCTCGTACCAAC CGTAGCCCTTCTTTGCGGTAGTC 35 60 485
CYP2R1 AGAGACCCAGAAGTGTTCCAT GTCTTTCAGCACAGATGAGGTA 40 62 259
CYP27A1 GGCAAGTACCCAGTACGG AGCAAATAGCTTCCAAGG 40 62 292
18S GTTGGTGGAGCGATTTGTCT GGCCTCACTAAACCATCCAA 20 55 400
Cubilin GCGGCTTCACTGCTTCCTA GAGTGATGGTGTGCCCTTGT 35 53 518
Megalin TAAGTCAGTGCCCAACCTTT GCGGTTGTTCCTGGAG 35 53 290
Table 2
 
A Summary of Gene and Protein Expression for Vitamin D3 Elements by Ocular Barrier Cells as Well as the Rate of 25D3 Conversion
Table 2
 
A Summary of Gene and Protein Expression for Vitamin D3 Elements by Ocular Barrier Cells as Well as the Rate of 25D3 Conversion
Cell Line Gene Expression Immunofluorescence Rate of 25D3 Conversion
VDR CYP27B1 CYP24A1 CYP27A1 CYP2R1 Cubilin Megalin VDR CYP27B1 CYP24A1
Ocular barrier cells
 HSF ++ ++ +++ +++ + ++ ++ +++
 HCEC-12 +++ +++ + ++ +++ +++ +++ +++ + +++
 ODM-2 +++ +++ + + ++ +++ +++ +++ + ++
 ARPE-19 +++ +++ ++ + +++ +++ ++ +++ ++ +
Control cells
 HKC-8 +++ +++ +++ + +++ +++ + ND ND ND ++
 Thyroid ND ND ND ND ND +++ +++ ND ND ND ND
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×