August 2003
Volume 44, Issue 8
Free
Retinal Cell Biology  |   August 2003
Cloning, Mapping, and Retinal Expression of the Canine Ciliary Neurotrophic Factor Receptor α (CNTFRα)
Author Affiliations
  • William A. Beltran
    From the James A. Baker Institute for Animal Health, College of Veterinary Medicine, Cornell University, Ithaca, New York; and the
  • Qi Zhang
    From the James A. Baker Institute for Animal Health, College of Veterinary Medicine, Cornell University, Ithaca, New York; and the
  • James W. Kijas
    From the James A. Baker Institute for Animal Health, College of Veterinary Medicine, Cornell University, Ithaca, New York; and the
  • Danian Gu
    From the James A. Baker Institute for Animal Health, College of Veterinary Medicine, Cornell University, Ithaca, New York; and the
  • Hermann Rohrer
    Max-Planck-Institut für Hirnforschung, Frankfurt, Germany.
  • Julie A. Jordan
    From the James A. Baker Institute for Animal Health, College of Veterinary Medicine, Cornell University, Ithaca, New York; and the
  • Gustavo D. Aguirre
    From the James A. Baker Institute for Animal Health, College of Veterinary Medicine, Cornell University, Ithaca, New York; and the
Investigative Ophthalmology & Visual Science August 2003, Vol.44, 3642-3649. doi:10.1167/iovs.02-0763
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      William A. Beltran, Qi Zhang, James W. Kijas, Danian Gu, Hermann Rohrer, Julie A. Jordan, Gustavo D. Aguirre; Cloning, Mapping, and Retinal Expression of the Canine Ciliary Neurotrophic Factor Receptor α (CNTFRα). Invest. Ophthalmol. Vis. Sci. 2003;44(8):3642-3649. doi: 10.1167/iovs.02-0763.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

purpose. To clone, map, and determine the site of expression (mRNA and protein) of the α subunit of the receptor for ciliary neurotrophic factor (CNTFRα) in the normal adult canine retina.

methods. The complete coding sequence of the canine CNTFRα cDNA was cloned, and radiation hybrid (RH) mapping was used to determine the chromosomal localization of the gene. CNTFRα mRNA expression in retina and other tissues was examined by reverse transcription–polymerase chain reaction. The cellular distribution of CNTFRα in the canine retina was studied by in situ hybridization and immunocytochemistry.

results. Canine CNTFRα shares a high degree of homology with the human, mouse, and rat coding sequences, both at the nucleotide and amino acid level, but has lower homology with the chicken. CNTFRα was RH mapped to CFA 11 (Canis familiaris autosome 11) in the dog, a region showing homology to the short arm of human chromosome 9 (9p13). The gene is transcribed in retina, brain, spleen, lung, liver, and kidney. In the retina, CNTFRα was highly expressed by photoreceptors, but both the transcript and protein were also found in the RPE, inner nuclear layer, and ganglion cells.

conclusions. These findings demonstrate that CNTFRα is expressed by rods and cones in the normal adult canine retina and suggest that ciliary neurotrophic factor (CNTF) could have a direct photoreceptor rescue effect by binding to CNTFRα in these cells. This could open novel pathways for the treatment of retinal degeneration in animal models and humans.

Retinal degenerations are a major cause of blindness for which no treatment is currently available. Different therapeutic approaches are being investigated—among these, the use of survival factors that may slow the rate of photoreceptor death and delay the onset of vision loss in various forms of retinal degeneration. Over the past decade, a variety of survival factors have been tested in several animal models of retinal degeneration. 1 2 3 4 Ciliary neurotrophic factor (CNTF), a survival factor originally isolated from the chick ciliary ganglion, has been shown to promote photoreceptor rescue when delivered intravitreally or subretinally to the rat (Song Y, et al. IOVS 2000;41:ARVO Abstract 964), mouse, or cat eye. 2 3 5 6 7 Our laboratory has shown a similar neuroprotective effect when CNTF is injected into the vitreous of rcd1 dogs, a canine model of early-onset and rapidly progressing retinal degeneration caused by a mutation in the PDE6B gene. Similar to observations made in the rd mouse, 3 5 a disease model also caused by a mutation in PDE6B, a neuroprotective effect was observed in 14-week-old rcd1 dogs when intravitreal injections of CNTF were performed at 7 and 10 weeks of age (Pearce-Kelling S, et al. IOVS 1998;39:ARVO Abstract 2645). However, side effects such as cataracts were present after intravitreal CNTF injections, but these complications were eliminated when CNTF was delivered by means of an encapsulated cell-based delivery system. In addition, this long-term delivery device allowed prolonged rescue of photoreceptors over a period of 7 to 14 weeks. 8  
CNTF is thought to trigger a survival signal by binding to the ciliary neurotrophic factor receptor (CNTFR). This receptor is a member of the cytokine receptor superfamily, and is composed of three subunits: an α subunit (CNTFRα), 9 which carries the specific CNTF binding site, and two different β subunits (gp-130 and leukemia inhibitory factor receptor [LIFR]) 10 that are preassociated with members of the Jak/Tyk family of cytoplasmic tyrosine kinases. The binding of CNTF to CNTFRα causes heterodimerization of gp-130 and LIFR, and activation of the Jak/Tyk kinases. This, in turn, recruits and activates a variety of downstream signaling molecules, turning on different signaling pathways, 11 that promote a cell-survival response. 
CNTFRα is an extracellular protein that is attached to the plasma membrane by a glycosyl-phosphatidylinositol link. Cleavage of this link by phosphatidylinositol-specific phospholipase C (PI-PLC) releases a soluble form of CNTFRα. 9 CNTFRα has been isolated from a variety of tissues, including the retina, central nervous system, peripheral nervous system, muscle, skin, lung, liver, kidney, and testes. 12 13 14 Although the neuroprotective effect of CNTF in the retina has been demonstrated in a variety of animal models of retinal degeneration, 2 3 5 6 7 the site of expression of its receptor and the mechanism of action by which it rescues photoreceptors is unknown in mammalian species. Several studies have suggested that CNTFRα is not expressed by photoreceptor cells and that the neuroprotective effect of CNTF is mediated by Müller cells. 15 16 17 Because of the dramatic rescue effect of CNTF on rcd1-affected photoreceptors and the lack of knowledge of its cellular targets in the retina, we decided to clone CNTFRα and study its expression in the normal adult canine retina. 
Methods
Primer Design
The human and mouse CNTFRα complete coding sequences (GenBank accession nos. M73238, NM016673, respectively; available by ftp at zippy.nimh.nih.gov/ or at http://rsb.info.nih.gov/nih-image; developed by Wayne Rasband, National Institutes of Health, Bethesda, MD) were aligned with commercial software (Sequencher, ver. 4.0.5; Gene Codes Corp., Ann Arbor, MI) to generate a consensus sequence. PCR primer pairs (Table 1) that amplify the complete coding sequence (exons 3–9) or only fragments of the canine gene were designed based on the consensus sequence. 
Reverse Transcription–Polymerase Chain Reaction and cDNA Cloning
Brain tissue from the frontal cerebral cortex of a 17-week-old male beagle was used as a source of total RNA. The tissue was homogenized in extraction reagent (TRIzol; Invitrogen, Carlsbad, CA) and total RNA extracted from the aqueous phase with chloroform. First-strand cDNA was synthesized with an RNA PCR kit (GeneAmp; Applied Biosystems, Inc., Foster City, CA). The 20-μL reaction volume contained 1 μg total RNA, 2.5 μM random hexamers, 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 5 mM MgCl2, 1 mM of each dNTP, 20 U RNase inhibitor, and 50 U murine leukemia virus (MuLV) reverse transcriptase. After 10 minutes at room temperature, the reaction mixture was incubated at 42°C for 15 minutes and terminated by incubation at 70°C for 15 minutes followed by 5 minutes on ice. The resultant cDNA was used as a template for a 20-μL PCR reaction containing 0.4 μM of primers CNTFR 1F and CNTFR 1R (Table 1) , 1.5 mM MgCl2, 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 200 μM dNTP, and 0.5 U Taq polymerase. PCR amplifications with primers CNTFR 1F and CNTFR 1R are expected to generate a 1272-bp DNA fragment that contains the complete canine CNTFRα coding sequence. Reactions were performed for 36 cycles at an annealing temperature of 53°C for 20 seconds, a polymerization temperature of 72°C for 40 seconds, and a heat-denaturation temperature of 94°C for 20 seconds in a thermal cycler (model PTC-200; MJ Research, Waltham, MA). The PCR-amplified DNA fragment was cloned in a commercial vector using a TA-cloning kit (pCR2.1; Invitrogen, San Diego, CA) according to the manufacturer’s recommendations. Sequencing was done by Taq cycle with terminators (DyeDeoxy) in an automated sequencer (Prism 3700; Applied Biosystems Inc., Foster City, CA) at the core sequencing facility of Cornell University. The MEGA program (Molecular Evolutionary Genetics Analysis, ver. 2.0, www.megasoftware.net; available in the public domain; developed by Kumar S et al.) was used to establish the degree of homology between the canine CNTFRα coding sequence (nucleotide and amino acid) and that of the human (M73238), mouse (NM016673), rat (S54212), and chicken (Z48168). 
The transcription of CNTFRα was examined by RT-PCR on 3 μg of total RNA extracted from the retina, brain, spleen, lung, liver, and kidney of a normal adult beagle. PCR amplification of a 369-bp product using primers CNTFR 6F and CNTFR 2R (Table 1) was performed for 30 cycles at an annealing temperature of 58°C. PCR products were analyzed by electrophoresis on an ethidium bromide–stained polyacrylamide gel (6%). 
Radiation Hybrid Mapping
For radiation hybrid (RH) mapping, DNA from the RH083000 canine-hamster radiation hybrid panel was purchased from Research Genetics (Huntsville, AL). The parental mongrel dog cell line was irradiated with 3000 rads, and fused with A23, a thymidine kinase–deficient (TK) hamster cell line with a retention estimate of 28%. CNTFRα maps to the short arm of human chromosome 9 (9p13). 18 We therefore selected six markers (REN142009, REN275M05, IFNA3, IFNA1, REN174D18, and REN147002) located on the canine homologous region on canine chromosome 11 (CFA 11) in the RHDF5000 map 19 to generate a framework map and establish the map position of this gene in the dog. Primers CNTFR 9F and CNTFR 9R (Table 1) were used to amplify a 112-bp fragment of canine-specific CNTFRα. The map was constructed using MultiMap software 20 based on best two-point analysis, placing markers at a lod score of 3.0 for overall order (http://www.mgc.har.mrc.ac.uk/ provided in the public domain by the UK Mouse Genome Centre and Mammalian Genetics Unit, Harwell, UK). Distances are referred to as centirays (cR3000), in reference to the 3000-rad value used to construct the panel. 
Animals and Histologic Procedures
Retinas from normal adult beagles were used for both the in situ hybridization and immunocytochemistry studies. Dogs were anesthetized with intravenous pentobarbital and the eyes rapidly enucleated in the light. After a 3-hour fixation of the entire globe at 4°C in 4% paraformaldehyde (PAF) in 0.1 M phosphate-buffered saline, the posterior segment was isolated and fixed for an additional 24 hours at 4°C in 2% PAF in 0.1 M phosphate-buffered saline. The tissue then was trimmed, cryoprotected in a solution of 30% sucrose in 0.1 M sodium phosphate and 0.15 M sodium chloride (pH 7.2; BupH phosphate buffered saline; Pierce, Rockford, IL; referred in the text as PBS) at 4°C for 48 hours, and embedded in optimal cutting temperature (OCT) compound. Cryosections were cut at a 7-, 10-, or 15-μm thickness. All research conducted was in full compliance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. 
In Situ Hybridization
A 369-bp fragment of canine CNTFRα cDNA encoding exons 7 and 8 was amplified with primers CNTFR 6F and CNTFR 2R (Table 1) and subcloned in a dual promoter vector (pCRII-TOPO; Invitrogen). After purification using a kit (QIAprep Miniprep; Qiagen, Valencia, CA), the plasmid was linearized using HindIII and EcoRV restriction enzymes, and single-strand sense and antisense digoxigenin (DIG)-labeled RNA probes were generated by T7 and Sp6 RNA polymerases, respectively, using a DIG RNA labeling kit (Roche Diagnostics, Inc., Mannheim, Germany). The slides were air dried overnight at 40°C, then washed twice for 5 minutes in PBS, 100 mM glycine in PBS, 0.3% Triton X-100 in PBS, and rinsed with PBS. The 15-μm-thick sections were then permeabilized with 500 ng/mL proteinase K in 100 mM Tris-HCl, and 50 mM EDTA, (pH 8.0), for 30 minutes at 37°C, and postfixed with 4% PAF in PBS. After two rinses in PBS, the sections were acetylated twice for 5 minutes with 0.25% acetic anhydride in 0.1 M triethanolamine (pH 8.0) and incubated for 10 minutes with deionized formamide in 2× SSC (1× SSC: 150 mM NaCl, 15 mM sodium citrate, pH 7.2). The sections were then hybridized with 100 ng of RNA probe in hybridization buffer (In Situ Hyb Buffer; Ambion, Austin, TX) for 16 hours at 50°C in a humid chamber. After hybridization, the slides were washed twice in 2× SSC and twice in 1× SSC at 37°C. They were then treated with RNase A (20 μg/mL in 500 mM NaCl, 10 mM Tris, 1 mM EDTA [pH 8.0]) for 30 minutes at 37°C and washed twice in 0.1× SSC for 30 minutes at 37°C. RNA hybrids were detected by incubation for 30 minutes with an alkaline-phosphatase–conjugated anti-DIG antibody (1:500) and then for 16 hours with the chromogenic substrates 4-nitroblue tetrazolium chloride (NBT) and 5-bromo-4-chloro-3-indoyl phosphate (BCIP; DIG Nucleic Acid Detection Kit, Roche Diagnostics). Slides were mounted with antifade mounting medium (Aqua Polymount; Polysciences, Warrington, PA) and examined by microscope (Axioplan; Carl Zeiss Meditech, Oberkochen, Germany), with or without differential interference contrast (DIC) optics. Images were digitally captured (Spot 3.3 camera; Diagnostic Instruments, Inc., Sterling Heights, MI) and imported into a graphics program for display (Photoshop; Adobe, Mountain View, CA). 
Immunoblot Analysis
For Western blot analysis, adult canine retina was homogenized in PBS containing a cocktail of protease inhibitors (Sigma-Aldrich, St. Louis, MO), and, after sonication, the protein level was determined by the Bradford method (Bio-Rad protein assay; Bio-Rad, Hercules, CA). Samples consisting of dog and chicken retinal protein lysates and recombinant rat CNTFRα (amino acid residues 1-346; R&D Systems, Minneapolis, MN) were placed in the sample buffer containing 4% glycerol, 0.4% sodium dodecyl sulfate, 1% β-mercaptoethanol, 0.005% bromophenol blue in 12.5 mM Tris-HCl buffer (pH 6.8), and heated at 100°C for 5 minutes. Samples and molecular weight standards were separated by SDS-PAGE (4% stacking gel, 10% separating gel). Transfer of proteins from gels to polyvinylidene difluoride (PVDF) membrane (Immobilon; Millipore, Bedford, MA) was performed in prechilled transfer buffer (25 mM Tris base, 192 mM glycine, and 15% methanol), and the membrane was then blocked with 10% skim milk in Tris-buffered saline containing 0.5% Tween-20 overnight at 4°C. The membrane was incubated for 1.5 hour with a protein A–purified rabbit anti chick CNTFRα antibody (1:100,000; developed by one of the authors [HR]), followed by goat anti-rabbit secondary antibody conjugated with horseradish peroxidase (1:10,000; Zymed, San Francisco, CA). The blots were developed with the enhanced chemiluminescence (ECL) method, according to the manufacturer’s recommendations (Amersham Biosciences, Piscataway, NJ). 
Immunocytochemistry
Tissue sections (7–10 μm thick) were washed three times in a 0.3% hydrogen peroxide solution in 50% ethanol to inhibit endogenous peroxidase. Sections were then treated with 0.25% Triton X-100 in PBS for 5 minutes, followed by 10% normal goat serum (NGS) with 0.25% Triton X-100 and 0.05% sodium azide in PBS for 20 minutes. They were then incubated with primary antibodies diluted in PBS with 1.5% NGS, 0.25% Triton X-100, and 0.05% sodium azide overnight at 4°C. Primary antibodies used in this study were: an affinity-purified polyclonal rabbit anti-chick CNTFRα (1:1000 dilution) and a protein A–purified polyclonal rabbit anti-chick CNTFRα (1:2000 dilution). These two antibodies were raised in the same rabbit after immunization with a large fragment of the chick CNTFRα recombinant protein, as reported previously. 21 Two commercial polyclonal antibodies raised against human CNTFRα and rat CNTFRα (respectively, sc-1913 and sc-1914; Santa Cruz Biotechnology, Santa Cruz, CA) were initially evaluated by immunocytochemistry and showed intense labeling at the level of the photoreceptor inner segments. Yet, because of significant background labeling on the sections and the impossibility of blocking the signal on both immunoblots and immunocytochemical sections with their respective blocking peptides (sc-1913 P, sc-1914 P), we did not pursue further investigations with these antibodies. 
After washing in PBS, secondary antibody (biotinylated goat anti-rabbit, 1:200 dilution; Vector Laboratories, Burlingame, CA) was applied for 30 minutes at room temperature. Antibodies were visualized using the avidin biotin complex (ABC Elite kit; Vector Laboratories) with diaminobenzidine as a substrate. To confirm the cone photoreceptor labeling observed with the CNTFRα antibody, we used serial sections and immunoreacted each sequential section with CNTFRα antibody, a rabbit affinity-purified antibody directed against human cone arrestin 22 (1:10,000 dilution), and a rabbit affinity-purified antibody directed against mouse phosphodiesterase γ (anti-PDEγ, 1:2000). 23 The antibodies were applied overnight and visualized with a biotinylated secondary antibody and the avidin-biotin complex kit. Control sections were treated in the same way with omission of primary antibodies, or replacement by rabbit serum from a nonimmunized animal. Slides were mounted with a medium composed of polyvinyl alcohol and DABCO (Sigma) and examined as described in the previous section. 
Results
Cloning of Canine CNTFRα cDNA
RT-PCR, using primers that hybridize in the 3′ and 5′ untranslated region (UTR) of the CNTFRα gene, amplified a single 1272-bp product from brain-derived mRNA. Sequence analysis revealed the CNTFRα coding sequence (1119 bp), 26 bp of 5′ UTR, and 86 bp of 3′ UTR (GenBank no. AF529215). Alignment of the nucleotide coding sequence (data not shown) showed a cDNA of identical length with that of human, mouse, and rat, and high sequence identity of 93%, 89.5%, and 88.7%, respectively. The alignment of the predicted amino acid sequence of canine CNTFRα with that of the human, mouse, and rat also showed a high degree of homology between these species (Fig. 1) . The canine CNTFRα amino acid sequence is longer than that of the chicken (372 vs. 362 amino acids), and the chicken sequence shares a lower degree of homology with the dog (69.1%) and other mammals. The amino acid identity was higher between the dog and human sequences and lower between the rat and the chicken sequences. Hallmarks of cytokine receptors, such as clusters of cysteine residues, putative N-glycosylation sites, and the cytokine receptor consensus motif (WSXWS box), 24 were conserved in the canine CNTFRα amino acid sequence (Fig. 1A)
RH Mapping
Radiation hybrid mapping using the RH083000 canine-hamster panel placed CNTFRα on canine chromosome 11 (CFA 11) in a position approximately 70.41 cR3000 telomeric to the microsatellite REN275MO5 and 56.19 cR3000 centromeric from the gene markers IFNA3/IFNA1 (Fig. 2) . Marker order was supported with a lod score of 3.5 and was similar to that obtained with a different radiation hybrid panel made with 5000 rad (RHDF5000 map). 19 CFA 11 exhibits conserved synteny with the cytogenetic p13 region of human chromosome 9 (HSA 9p13). 19 Thus our results are in agreement with human mapping data, which localizes CNTFRα to HSA 9p13. 
Transcription of CNTFRα in Different Tissues
RT-PCR was used to examine the expression of CNTFRα in various tissues. The transcript was detected in brain, retina, spleen, lung, liver, and kidney tissues (Fig. 3) . The specificity of the RT product was based on the product size that was obtained with control retina treated by DNase I digestion, as well as on the absence of any product amplification in tissues processed by omitting the reverse transcriptase enzyme (data not shown). 
Localization of CNTFRα Expression in the Adult Canine Retina
In situ hybridization was used to determine which retinal cells transcribe canine CNTFRα. With the antisense probe, the CNTFRα message was found in the retinal pigment epithelium (RPE), photoreceptors, inner nuclear layer (INL), and ganglion cells; no labeling was observed with the sense probe, although a very weak background was noticed in some sections (Fig. 4) . The labeling was most intense in the central retina and decreased toward the periphery. In the visual cells, labeling was present at the level of the external limiting membrane (ELM), and in the proximal region of the inner segments (IS; myoid region). Labeling was present throughout the INL but was most intense in the cells located in the vitreal and scleral borders. 
To complement the in situ hybridization results, we performed immunocytochemical studies using the polyclonal antibodies directed against chick CNTFRα. Both antibodies (affinity-purified, and protein A–purified) produced a similar and consistent pattern of labeling that was absent in control sections (Fig. 5C) . There was robust staining of all the inner segments in the photoreceptor layer (Figs. 5D 5E 5F) and also distinct labeling of the outer and inner plexiform layers (OPL, IPL, respectively), cells of the INL, and ganglion cells and their axons (nerve fiber layer, NFL; Figs. 5A 5D 5F ). With the affinity-purified antibody, different populations of cells, predominantly located at the scleral and vitreal borders of the INL, were identified, but they were not distinct with the protein A–purified antibody (compare Figs. 5A and 5D with 5F). Labeling of the RPE was present but variable in intensity (Figs. 5B 5F) . Staining of the photoreceptor inner segments was observed, and, in addition, distinct labeling was present throughout a subclass of photoreceptor cells with nuclei that were located at the outermost border of the ONL (Figs. 5E 5F) . The position and cytologic characteristics of these cells, as well as the similar pattern of cone labeling obtained with two antibodies that label only cones (anti-human cone arrestin) or cones and rods (anti-PDEγ; Figs. 5G 5H ), suggest that, in addition to its localization at the rod inner segment, CNTFRα is present throughout most of the cone photoreceptor cell. 
To verify the specificity of the protein A–purified anti-chick CNTFRα antibody, we performed immunoblot analysis. When recombinant rat CNTFRα (amino acid residues 1-346) was resolved by SDS-PAGE, the anti-chick CNTFRα antibody identified it at an apparent size of approximately 50 kDa, consistent with the molecular mass indicated by the manufacturer. In protein lysates from dog retina, the antibody recognized a single protein migrating with a molecular mass of approximately 62 kDa (Fig. 6) . A similar result was observed with protein lysates from retinas of a 2-week-old chick resolved by SDS-PAGE under reducing conditions (data not shown). This molecular mass was slightly smaller than that reported for the chick under nonreducing conditions, 25 and could be explained by differences in the electrophoresis conditions. Our immunoblot results with the chicken and dog retinal lysates are similar to those reported for rat central nervous system and retina using a different polyclonal antibody. 13 A band with a molecular mass of approximately 50 kDa could also be observed when the film was exposed to the blot for longer periods of time. Specificity of the anti-chick CNTFRα antibody has been previously demonstrated both on immunoblots and immunohistochemical sections of chick dorsal root ganglia. 21 The specific labeling was inhibited by preincubating the antibody with the recombinant chick CNTFRα used to generate the antibody. Because the source of the recombinant chick CNTFRα used to block the anti-chick CNTFRα antibody is no longer available, we could not repeat these experiments with the dog tissues. 
Discussion
In this study, we cloned the canine CNTFRα cDNA and showed that there was a high level of homology, both at the nucleotide and amino acid levels, when comparing it with that of the human, mouse, and rat. The degree of amino acid homology between dog and chicken was lower, but still sufficient to allow us to use in the dog retina polyclonal antibodies that were raised against chicken CNTFRα. Such a level of conservation, at least for some domains of the protein, suggests that the CNTFRα signaling pathway is conserved across evolution. 
In our results in the normal adult canine retina, the RPE, photoreceptors, and cells in the INL and ganglion cell layer (GCL) transcribed the CNTFRα gene. We observed a strict concordance between the retinal cells labeled by in situ hybridization and those stained by immunocytochemistry, particularly with the affinity-purified antibody. This suggests that all cells that transcribe the CNTFRα gene also express its protein. However, we cannot exclude the possibility that some of these cells also may bind the soluble form of CNTFRα. 26 Such a soluble form could be released by neighboring cells after cleavage of the glycosyl-phosphatidylinositol link by PI-PLC. 9 Labeling of the INL, both by in situ hybridization and immunocytochemistry, was more intense in cells located at the outer and innermost part of this layer, suggesting that horizontal, amacrine, and Müller cells express CNTFRα. This was consistent with the location of CNTFRα transcript in the rat INL. 27 However, the use of cell-specific markers, coupled with CNTFRα immunolocalization, is necessary for specific identification of the cells in the INL that express this neurotrophic receptor. 
The antibodies directed against CNTFRα that were used in our study showed an intense labeling pattern at the level of the RPE, photoreceptors, OPL, INL, IPL, GCL, and NFL. In addition to the photoreceptor IS labeling, the perinuclear cytoplasm, axon, and synaptic terminal of cones also were intensively labeled with the antibodies raised against chick CNTFR. Although we did not use any antibodies specific to rods, the labeling pattern of the entire IS layer was very different from that obtained with antibodies that solely stain cone photoreceptor cells (Fig. 5H) , confirming that CNTFRα is present in both cone and rod inner segments. 
Our results show that both rod and cone photoreceptor cells expressed CNTFRα. It is still to be determined, however, whether the two other subunits (gp-130 and LIFR) of the receptor complex are expressed in photoreceptors. If such were the case, as has been recently suggested by Schulz-Key et al., 28 our findings would imply that an effect of CNTF on photoreceptors is mediated through a direct rather than indirect mechanism of action. This is in contrast with studies in rodents that suggest that protection of photoreceptors occurs indirectly through the activation of Müller cells or other INL cells. 15 16 17 The results of those studies, however, are based on the absence of immunoreactivity for downstream signal transduction molecules, as well as a lack of expression of the immediate early gene c-fos in photoreceptors exposed to CNTF. Although species specificity may explain the discrepancy between these results and ours, it also is possible that binding of CNTF to its receptor in photoreceptors activates signaling pathways other than those examined. A number of in situ hybridization studies have examined the expression of CNTFRα mRNA in the retina of the normal adult rat and have shown labeling at the GCL and INL, but not in the photoreceptors. 27 29 However, after ischemia and reperfusion of the retina, labeling was observed at the outermost part of the ONL, 29 suggesting that rat photoreceptors express CNTFRα, at least after injury. 
In the chick, CNTFRα is expressed in several retinal layers and was shown by immunocytochemistry to be present in rod outer segments. 25 Although a recent study showed the expression of CNTFRα by immunoblot analysis on protein lysates of rat photoreceptor OS and IS, 28 to our knowledge there are no reports in the literature characterizing the expression and localization of CNTFRα by immunocytochemistry in mammalian photoreceptors. This lack of information may result from negative immunolocalization findings. In this regard, we caution that tissue fixation is critical in these procedures, at least in the canine retina. Our findings are based on using a very mild fixation protocol; however, we have observed (data not shown) a reduction or absence of labeling of the inner retina, but not of the photoreceptor IS, with more prolonged fixation (24 hours in 4% PAF). In an attempt to evaluate whether the expression of CNTFRα by photoreceptors is specific to the dog or is common to a wide variety of species, we are currently undertaking similar studies in several other mammalian species. 
Determining the localization of the expression of the receptor for CNTF is critical, because this survival factor is being considered as a potential treatment for retinal degenerations. Its sustained delivery is currently in late preclinical development and clinical trials are expected to begin in patients with retinitis pigmentosa (www.neurotech.fr/presse/index.htm). If CNTFRα is also found in human photoreceptors, then evaluating its level of expression during the course of retinal degeneration may be a valid approach for evaluating the potential therapeutic role of CNTF. 
In conclusion, we have shown the expression of CNTFRα in photoreceptor cells of the normal adult canine retina. These results suggest that, at least in the dog, CNTF may act through a direct mechanism to rescue photoreceptors in the rcd1 model of retinal degeneration. If such a site of action is also present in the human retina, it may lead to novel therapeutic approaches for RP. 
 
Table 1.
 
PCR Primers
Table 1.
 
PCR Primers
Primer ID Sequence (5′ → 3′) Position Fragment Size (bp) Annealing Temperature (°C)
CNTFR 1F GAGGAGGA(T/G)(A/G)A(T/C)ATTGATGTG 5′ UTR 1272 53
CNTFR 1R AAAGGTCCTCCTGCCCGTGTG 3′UTR
CNTFR 6F ATTGTGAAGCCTGATCCTCCAGA Exon 6-7 369 58
CNTFR 2R TGGTGGTGCTGGTCGTGGTCT Exon 9
CNTFR 9F CAGCACCCTTCTTGATCCATG Exon 9 112 58
CNTFR 9R GTGCGCTGGCATGTCCCTCAC 3′UTR
Figure 1.
 
Comparison of the dog CNTFRα amino acid sequence with that of the human, mouse, rat, and chicken. (A) Alignment of amino acid sequences. Underscored sequences: conserved cysteine residues and the conserved cytokine receptor motif (WSXSW box); shaded boxes: putative N-glycosylation sites (ArgXSer/Thr) in the dog sequence. (B) Levels of homology between amino acid sequences are indicated as a percentage.
Figure 1.
 
Comparison of the dog CNTFRα amino acid sequence with that of the human, mouse, rat, and chicken. (A) Alignment of amino acid sequences. Underscored sequences: conserved cysteine residues and the conserved cytokine receptor motif (WSXSW box); shaded boxes: putative N-glycosylation sites (ArgXSer/Thr) in the dog sequence. (B) Levels of homology between amino acid sequences are indicated as a percentage.
Figure 2.
 
RH mapping of CNTFRα. CNTFRα was located on CFA 11 at a lod score of 3.5 for order. Distances between markers are indicated in cR3000.
Figure 2.
 
RH mapping of CNTFRα. CNTFRα was located on CFA 11 at a lod score of 3.5 for order. Distances between markers are indicated in cR3000.
Figure 3.
 
Detection of CNTFRα in different canine tissues by RT-PCR. All PCR products contained the DNA fragment of expected size (369 bp). Lane M: DNA markers obtained by digestion of φX174 DNA with HaeIII.
Figure 3.
 
Detection of CNTFRα in different canine tissues by RT-PCR. All PCR products contained the DNA fragment of expected size (369 bp). Lane M: DNA markers obtained by digestion of φX174 DNA with HaeIII.
Figure 4.
 
Localization of CNTFRα mRNA in the normal adult canine retina (tapetal zone, RPE nonpigmented) by in situ hybridization. (A) Expression of CNTFRα mRNA was detected with the antisense probe at the level of the RPE (open arrowhead), photoreceptors (at the level of the ELM, arrowhead) and INL and in ganglion cells (arrow). Labeling was present at all levels of the INL but more intense on the scleral and vitreal sides. (B) No signal was observed with the sense probe (negative control). Scale bar, 25 μm.
Figure 4.
 
Localization of CNTFRα mRNA in the normal adult canine retina (tapetal zone, RPE nonpigmented) by in situ hybridization. (A) Expression of CNTFRα mRNA was detected with the antisense probe at the level of the RPE (open arrowhead), photoreceptors (at the level of the ELM, arrowhead) and INL and in ganglion cells (arrow). Labeling was present at all levels of the INL but more intense on the scleral and vitreal sides. (B) No signal was observed with the sense probe (negative control). Scale bar, 25 μm.
Figure 5.
 
Immunolocalization of CNTFRα in the normal adult canine retina. (A) Labeling pattern of central nontapetal retina (RPE pigmented) with the affinity-purified anti-chick CNTFRα antibody. (B) Labeling pattern of midperipheral tapetal retina (RPE nonpigmented) with the affinity-purified anti-chick CNTFRα antibody. (C) Negative control. (D) Labeling pattern of midperipheral nontapetal retina with the affinity-purified anti-chick CNTFRα antibody. (E) High-power view of (D). (FH) Serial sections of midperipheral tapetal retina labeled with the protein A–purified anti-chick CNTFRα antibody (F), the anti-human cone arrestin antibody (G), and the anti-PDE γ antibody (H). Intense labeling of the entire photoreceptor IS (A, B, DF) was observed with the two antibodies. Labeling of the OPL, INL, IPL, ganglion cells (arrowheads), and NFL (long arrows) was also present (A, D, F). (E, G, H) Labeling of cone perinuclear region (short arrows), axons (arrowheads), and synaptic terminals (open arrowheads) was observed with the anti-chick CNTFRα antibody (E) and resembled that obtained with the anti-PDEγ (G) and anti-human cone arrestin (H) antibodies. Scale bars: (AC) 50 μm; (D) 25 μm; (E) 15 μm; (FH) 20 μm.
Figure 5.
 
Immunolocalization of CNTFRα in the normal adult canine retina. (A) Labeling pattern of central nontapetal retina (RPE pigmented) with the affinity-purified anti-chick CNTFRα antibody. (B) Labeling pattern of midperipheral tapetal retina (RPE nonpigmented) with the affinity-purified anti-chick CNTFRα antibody. (C) Negative control. (D) Labeling pattern of midperipheral nontapetal retina with the affinity-purified anti-chick CNTFRα antibody. (E) High-power view of (D). (FH) Serial sections of midperipheral tapetal retina labeled with the protein A–purified anti-chick CNTFRα antibody (F), the anti-human cone arrestin antibody (G), and the anti-PDE γ antibody (H). Intense labeling of the entire photoreceptor IS (A, B, DF) was observed with the two antibodies. Labeling of the OPL, INL, IPL, ganglion cells (arrowheads), and NFL (long arrows) was also present (A, D, F). (E, G, H) Labeling of cone perinuclear region (short arrows), axons (arrowheads), and synaptic terminals (open arrowheads) was observed with the anti-chick CNTFRα antibody (E) and resembled that obtained with the anti-PDEγ (G) and anti-human cone arrestin (H) antibodies. Scale bars: (AC) 50 μm; (D) 25 μm; (E) 15 μm; (FH) 20 μm.
Figure 6.
 
Immunoblot analysis of CNTFRα protein expression in the normal adult canine retina. Total protein (14 μg) of adult canine retina and two amounts of recombinant rat CNTFRα were run on a reducing 10% SDS-PAGE gel and immunoblotted with a protein A–purified anti-chicken CNTFRα polyclonal antibody. Binding of the anti-CNTFRα antibody was visualized by ECL. Left: positions and molecular masses (in kilodaltons) of standard proteins.
Figure 6.
 
Immunoblot analysis of CNTFRα protein expression in the normal adult canine retina. Total protein (14 μg) of adult canine retina and two amounts of recombinant rat CNTFRα were run on a reducing 10% SDS-PAGE gel and immunoblotted with a protein A–purified anti-chicken CNTFRα polyclonal antibody. Binding of the anti-CNTFRα antibody was visualized by ECL. Left: positions and molecular masses (in kilodaltons) of standard proteins.
The authors thank Cheryl M. Craft and Xuemie Zhu (the Mary D. Allen Laboratory for Vision Research, Doheny Eye Institute and the Keck School of Medicine of the University of Southern California, Los Angeles, CA) and Debora B. Farber (Jules Stein Eye Institute, UCLA, Los Angeles, CA) for generously providing, respectively, the human cone arrestin and the PDEγ antibodies; Susan Pearce-Kelling and Barbara Zangerl for valuable discussions; Pamela DiDia for excellent technical assistance; and Keith Watamura for graphics support. 
Faktorovich, EG, Steinberg, RH, Yasumura, D, Matthes, MT, LaVail, MM. (1990) Photoreceptor degeneration in inherited retinal dystrophy delayed by basic fibroblast growth factor Nature 347,83-86 [CrossRef] [PubMed]
LaVail, MM, Unoki, K, Yasumura, D, Matthes, MT, Yancopoulos, GD, Steinberg, RH. (1992) Multiple growth factors, cytokines, and neurotrophins rescue photoreceptors from the damaging effects of constant light Proc Natl Acad Sci U S A 89,11249-11253 [CrossRef] [PubMed]
LaVail, MM, Yasumura, D, Matthes, MT, et al (1998) Protection of mouse photoreceptors by survival factors in retinal degenerations Invest Ophthalmol Vis Sci 39,592-602 [PubMed]
Frasson, M, Picaud, S, Leveillard, T, et al (1999) Glial cell line-derived neurotrophic factor induces histologic and functional protection of rod photoreceptors in the rd/rd mouse Invest Ophthalmol Vis Sci 40,2724-2734 [PubMed]
Cayouette, M, Gravel, C. (1997) Adenovirus-mediated gene transfer of ciliary neurotrophic factor can prevent photoreceptor degeneration in the retinal degeneration (rd) mouse Hum Gene Ther 8,423-430 [CrossRef] [PubMed]
Cayouette, M, Behn, D, Sendtner, M, Lachapelle, P, Gravel, C. (1998) Intraocular gene transfer of ciliary neurotrophic factor prevents death and increases responsiveness of rod photoreceptors in the retinal degeneration slow mouse J Neurosci 18,9282-9293 [PubMed]
Chong, NH, Alexander, RA, Waters, L, Barnett, KC, Bird, AC, Luthert, PJ. (1999) Repeated injections of a ciliary neurotrophic factor analogue leading to long-term photoreceptor survival in hereditary retinal degeneration Invest Ophthalmol Vis Sci 40,1298-1305 [PubMed]
Tao, W, Wen, R, Goddard, MB, et al (2002) Encapsulated cell based delivery of CNTF reduces photoreceptor degeneration in animal models of retinitis pigmentosa Invest Ophthalmol Vis Sci 43,3292-3298 [PubMed]
Davis, S, Aldrich, TH, Valenzuela, DM, et al (1991) The receptor for ciliary neurotrophic factor Science 253,59-63 [CrossRef] [PubMed]
Davis, S, Aldrich, TH, Stahl, N, et al (1993) LIFR beta and gp130 as heterodimerizing signal transducers of the tripartite CNTF receptor Science 260,1805-1808 [CrossRef] [PubMed]
Boulton, TG, Stahl, N, Yancopoulos, GD. (1994) Ciliary neurotrophic factor/leukemia inhibitory factor/interleukin 6/oncostatin M family of cytokines induces tyrosine phosphorylation of a common set of proteins overlapping those induced by other cytokines and growth factors J Biol Chem 269,11648-11655 [PubMed]
Ip, NY, McClain, J, Barrezueta, NX, et al (1993) The alpha component of the CNTF receptor is required for signaling and defines potential CNTF targets in the adult and during development Neuron 10,89-102 [CrossRef] [PubMed]
Kirsch, M, Hofmann, HD. (1994) Expression of ciliary neurotrophic factor receptor mRNA and protein in the early postnatal and adult rat nervous system Neurosci Lett 180,163-166 [CrossRef] [PubMed]
Kordower, JH, Yaping, C, Maclennan, AJ. (1997) Ciliary neurotrophic factor receptor alpha-immunoreactivity in the monkey central nervous system J Comp Neurol 377,365-380 [CrossRef] [PubMed]
Peterson, WM, Wang, Q, Tzekova, R, Wiegand, SJ. (2000) Ciliary neurotrophic factor and stress stimuli activate the Jak-STAT pathway in retinal neurons and glia J Neurosci 20,4081-4090 [PubMed]
Wahlin, KJ, Campochiaro, PA, Zack, DJ, Adler, R. (2000) Neurotrophic factors cause activation of intracellular signaling pathways in Müller cells and other cells of the inner retina, but not photoreceptors Invest Ophthalmol Vis Sci 41,927-936 [PubMed]
Wahlin, KJ, Adler, R, Zack, DJ, Campochiaro, PA. (2001) Neurotrophic signaling in normal and degenerating rodent retinas Exp Eye Res 73,693-701 [CrossRef] [PubMed]
Donaldson, DH, Britt, DE, Jones, C, Jackson, CL, Patterson, D. (1993) Localization of the gene for the ciliary neurotrophic factor receptor (CNTFR) to human chromosome 9 Genomics 17,782-784 [CrossRef] [PubMed]
Breen, M, Jouquand, S, Renier, C, et al (2001) Chromosome-specific single-locus FISH probes allow anchorage of an 1800-marker integrated radiation-hybrid/linkage map of the domestic dog genome to all chromosomes Genome Res 11,1784-1795 [CrossRef] [PubMed]
Matise, TC, Perlin, M, Chakravarti, A. (1994) Automated construction of genetic linkage maps using an expert system (MultiMap): a human genome linkage map Nat Genet 6,384-390 [CrossRef] [PubMed]
Holst, A, Heller, S, Junghans, D, Geissen, M, Ernsberger, U, Rohrer, H. (1997) Onset of CNTFRalpha expression and signal transduction during neurogenesis in chick sensory dorsal root ganglia Dev Biol 191,1-13 [CrossRef] [PubMed]
Zhang, Y, Li, A, Zhu, X, et al (2001) Cone arrestin expression and induction in retinoblastoma cells Proceedings of the Ninth International Symposium on Retinal Degeneration ,309-319 Kluwer Academic/Plenum Publishers New York.
Gropp, KE, Szel, A, Huang, JC, Acland, GM, Farber, DB, Aguirre, GD. (1996) Selective absence of cone outer segment beta 3-transducin immunoreactivity in hereditary cone degeneration (cd) Exp Eye Res 63,285-296 [CrossRef] [PubMed]
Bazan, JF. (1990) Structural design and molecular evolution of a cytokine receptor superfamily Proc Natl Acad Sci USA 87,6934-6938 [CrossRef] [PubMed]
Fuhrmann, S, Kirsch, M, Heller, S, Rohrer, H, Hofmann, HD. (1998) Differential regulation of ciliary neurotrophic factor receptor-alpha expression in all major neuronal cell classes during development of the chick retina J Comp Neurol 400,244-254 [CrossRef] [PubMed]
Davis, S, Aldrich, TH, Ip, NY, et al (1993) Released form of CNTF receptor alpha component as a soluble mediator of CNTF responses Science 259,1736-1739 [CrossRef] [PubMed]
Kirsch, M, Lee, MY, Meyer, V, Wiese, A, Hofmann, HD. (1997) Evidence for multiple, local functions of ciliary neurotrophic factor (CNTF) in retinal development: expression of CNTF and its receptors and in vitro effects on target cells J Neurochem 68,979-990 [PubMed]
Schulz-Key, S, Hofmann, HD, Beisenherz-Huss, C, Barbisch, C, Kirsch, M. (2002) Ciliary neurotrophic factor as a transient negative regulator of rod development in rat retina Invest Ophthalmol Vis Sci 43,3099-3108 [PubMed]
Ju, WK, Lee, MY, Hofmann, HD, et al (2000) Increased expression of ciliary neurotrophic factor receptor alpha mRNA in the ischemic rat retina Neurosci Lett 283,133-136 [CrossRef] [PubMed]
Figure 1.
 
Comparison of the dog CNTFRα amino acid sequence with that of the human, mouse, rat, and chicken. (A) Alignment of amino acid sequences. Underscored sequences: conserved cysteine residues and the conserved cytokine receptor motif (WSXSW box); shaded boxes: putative N-glycosylation sites (ArgXSer/Thr) in the dog sequence. (B) Levels of homology between amino acid sequences are indicated as a percentage.
Figure 1.
 
Comparison of the dog CNTFRα amino acid sequence with that of the human, mouse, rat, and chicken. (A) Alignment of amino acid sequences. Underscored sequences: conserved cysteine residues and the conserved cytokine receptor motif (WSXSW box); shaded boxes: putative N-glycosylation sites (ArgXSer/Thr) in the dog sequence. (B) Levels of homology between amino acid sequences are indicated as a percentage.
Figure 2.
 
RH mapping of CNTFRα. CNTFRα was located on CFA 11 at a lod score of 3.5 for order. Distances between markers are indicated in cR3000.
Figure 2.
 
RH mapping of CNTFRα. CNTFRα was located on CFA 11 at a lod score of 3.5 for order. Distances between markers are indicated in cR3000.
Figure 3.
 
Detection of CNTFRα in different canine tissues by RT-PCR. All PCR products contained the DNA fragment of expected size (369 bp). Lane M: DNA markers obtained by digestion of φX174 DNA with HaeIII.
Figure 3.
 
Detection of CNTFRα in different canine tissues by RT-PCR. All PCR products contained the DNA fragment of expected size (369 bp). Lane M: DNA markers obtained by digestion of φX174 DNA with HaeIII.
Figure 4.
 
Localization of CNTFRα mRNA in the normal adult canine retina (tapetal zone, RPE nonpigmented) by in situ hybridization. (A) Expression of CNTFRα mRNA was detected with the antisense probe at the level of the RPE (open arrowhead), photoreceptors (at the level of the ELM, arrowhead) and INL and in ganglion cells (arrow). Labeling was present at all levels of the INL but more intense on the scleral and vitreal sides. (B) No signal was observed with the sense probe (negative control). Scale bar, 25 μm.
Figure 4.
 
Localization of CNTFRα mRNA in the normal adult canine retina (tapetal zone, RPE nonpigmented) by in situ hybridization. (A) Expression of CNTFRα mRNA was detected with the antisense probe at the level of the RPE (open arrowhead), photoreceptors (at the level of the ELM, arrowhead) and INL and in ganglion cells (arrow). Labeling was present at all levels of the INL but more intense on the scleral and vitreal sides. (B) No signal was observed with the sense probe (negative control). Scale bar, 25 μm.
Figure 5.
 
Immunolocalization of CNTFRα in the normal adult canine retina. (A) Labeling pattern of central nontapetal retina (RPE pigmented) with the affinity-purified anti-chick CNTFRα antibody. (B) Labeling pattern of midperipheral tapetal retina (RPE nonpigmented) with the affinity-purified anti-chick CNTFRα antibody. (C) Negative control. (D) Labeling pattern of midperipheral nontapetal retina with the affinity-purified anti-chick CNTFRα antibody. (E) High-power view of (D). (FH) Serial sections of midperipheral tapetal retina labeled with the protein A–purified anti-chick CNTFRα antibody (F), the anti-human cone arrestin antibody (G), and the anti-PDE γ antibody (H). Intense labeling of the entire photoreceptor IS (A, B, DF) was observed with the two antibodies. Labeling of the OPL, INL, IPL, ganglion cells (arrowheads), and NFL (long arrows) was also present (A, D, F). (E, G, H) Labeling of cone perinuclear region (short arrows), axons (arrowheads), and synaptic terminals (open arrowheads) was observed with the anti-chick CNTFRα antibody (E) and resembled that obtained with the anti-PDEγ (G) and anti-human cone arrestin (H) antibodies. Scale bars: (AC) 50 μm; (D) 25 μm; (E) 15 μm; (FH) 20 μm.
Figure 5.
 
Immunolocalization of CNTFRα in the normal adult canine retina. (A) Labeling pattern of central nontapetal retina (RPE pigmented) with the affinity-purified anti-chick CNTFRα antibody. (B) Labeling pattern of midperipheral tapetal retina (RPE nonpigmented) with the affinity-purified anti-chick CNTFRα antibody. (C) Negative control. (D) Labeling pattern of midperipheral nontapetal retina with the affinity-purified anti-chick CNTFRα antibody. (E) High-power view of (D). (FH) Serial sections of midperipheral tapetal retina labeled with the protein A–purified anti-chick CNTFRα antibody (F), the anti-human cone arrestin antibody (G), and the anti-PDE γ antibody (H). Intense labeling of the entire photoreceptor IS (A, B, DF) was observed with the two antibodies. Labeling of the OPL, INL, IPL, ganglion cells (arrowheads), and NFL (long arrows) was also present (A, D, F). (E, G, H) Labeling of cone perinuclear region (short arrows), axons (arrowheads), and synaptic terminals (open arrowheads) was observed with the anti-chick CNTFRα antibody (E) and resembled that obtained with the anti-PDEγ (G) and anti-human cone arrestin (H) antibodies. Scale bars: (AC) 50 μm; (D) 25 μm; (E) 15 μm; (FH) 20 μm.
Figure 6.
 
Immunoblot analysis of CNTFRα protein expression in the normal adult canine retina. Total protein (14 μg) of adult canine retina and two amounts of recombinant rat CNTFRα were run on a reducing 10% SDS-PAGE gel and immunoblotted with a protein A–purified anti-chicken CNTFRα polyclonal antibody. Binding of the anti-CNTFRα antibody was visualized by ECL. Left: positions and molecular masses (in kilodaltons) of standard proteins.
Figure 6.
 
Immunoblot analysis of CNTFRα protein expression in the normal adult canine retina. Total protein (14 μg) of adult canine retina and two amounts of recombinant rat CNTFRα were run on a reducing 10% SDS-PAGE gel and immunoblotted with a protein A–purified anti-chicken CNTFRα polyclonal antibody. Binding of the anti-CNTFRα antibody was visualized by ECL. Left: positions and molecular masses (in kilodaltons) of standard proteins.
Table 1.
 
PCR Primers
Table 1.
 
PCR Primers
Primer ID Sequence (5′ → 3′) Position Fragment Size (bp) Annealing Temperature (°C)
CNTFR 1F GAGGAGGA(T/G)(A/G)A(T/C)ATTGATGTG 5′ UTR 1272 53
CNTFR 1R AAAGGTCCTCCTGCCCGTGTG 3′UTR
CNTFR 6F ATTGTGAAGCCTGATCCTCCAGA Exon 6-7 369 58
CNTFR 2R TGGTGGTGCTGGTCGTGGTCT Exon 9
CNTFR 9F CAGCACCCTTCTTGATCCATG Exon 9 112 58
CNTFR 9R GTGCGCTGGCATGTCCCTCAC 3′UTR
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×