Free
Glaucoma  |   October 2013
Dexamethasone Induces Cross-Linked Actin Networks in Trabecular Meshwork Cells Through Noncanonical Wnt Signaling
Author Affiliations & Notes
  • Yong Yuan
    Crawley Vision Research Laboratory, Department of Ophthalmology, College of Medicine, University of Cincinnati, Cincinnati, Ohio
  • Mindy K. Call
    Crawley Vision Research Laboratory, Department of Ophthalmology, College of Medicine, University of Cincinnati, Cincinnati, Ohio
  • Yan Yuan
    Undergraduate Program, The Ohio State University, Columbus, Ohio
  • Yujin Zhang
    Crawley Vision Research Laboratory, Department of Ophthalmology, College of Medicine, University of Cincinnati, Cincinnati, Ohio
  • Katy Fischesser
    Crawley Vision Research Laboratory, Department of Ophthalmology, College of Medicine, University of Cincinnati, Cincinnati, Ohio
  • Chia-Yang Liu
    Crawley Vision Research Laboratory, Department of Ophthalmology, College of Medicine, University of Cincinnati, Cincinnati, Ohio
  • Winston W.-Y. Kao
    Crawley Vision Research Laboratory, Department of Ophthalmology, College of Medicine, University of Cincinnati, Cincinnati, Ohio
  • Correspondence: Yong Yuan, Department of Ophthalmology, University of Cincinnati, 3230 Eden Avenue, Cincinnati, OH 45267; yuany@ucmail.uc.edu
  • Winston W.-Y. Kao, Department of Ophthalmology, University of Cincinnati, 3230 Eden Avenue, Cincinnati, OH 45267; kaoww@ucmail.uc.edu
Investigative Ophthalmology & Visual Science October 2013, Vol.54, 6502-6509. doi:10.1167/iovs.13-12447
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to Subscribers Only
      Sign In or Create an Account ×
    • Get Citation

      Yong Yuan, Mindy K. Call, Yan Yuan, Yujin Zhang, Katy Fischesser, Chia-Yang Liu, Winston W.-Y. Kao; Dexamethasone Induces Cross-Linked Actin Networks in Trabecular Meshwork Cells Through Noncanonical Wnt Signaling. Invest. Ophthalmol. Vis. Sci. 2013;54(10):6502-6509. doi: 10.1167/iovs.13-12447.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

Purpose.: Dexamethasone (DEX) regulates aqueous humor outflow by inducing a reorganization of the cytoskeleton to form cross-linked actin networks (CLANs) in trabecular meshwork (TM) cells. Rho-associated protein kinase (ROCK) has been demonstrated to have an important role in this process, but the upstream components leading to its activation remain elusive. The purpose of the study is to demonstrate that noncanonical Wnt signaling mediates the DEX-induced CLAN formation in TM cells.

Methods.: The TM cells were treated with 100 nM DEX in low serum medium for over 7 days. The medium was changed every 3 days. The cells were harvested and subjected to molecular analysis for the expression of Wnt ligands. Stress fiber structures were revealed by Phalloidin staining. Lentivirus-based shRNA against noncanonical Wnt receptor (Ror2) was used to determine the role of noncanonical Wnt signaling in DEX-induced CLAN formation.

Results.: The DEX induced stress fiber rearrangement in TM cells. A noncanonical Wnt ligand (Wnt5a) was upregulated by DEX as demonstrated by Wnt ligand degenerate PCR, real-time quantitative PCR (qRT-PCR), and Western blotting. Knocking-down Ror2, the receptor of noncanonical Wnt signaling, abolished the effects of DEX on the TM cells.

Conclusions.: Our data suggest that DEX induces the upregulation of noncanonical Wnt ligand Wnt5a. Recombinant WNT5a protein induces CLAN formation through the noncanonical Wnt receptor ROR2/RhoA/ROCK signaling axis. Given the similarities between DEX-induced ocular hypertension and primary open-angle glaucoma, our results provide a mechanism of action for applying ROCK inhibitor to treat primary open-angle glaucoma.

Introduction
Administration of steroids, such as dexamethasone (DEX), results in IOP elevation in a subset of the population. Primary open-angle glaucoma (POAG) patients and glaucoma suspects have a greater risk for elevated IOP after DEX treatment. 1 Prolonged DEX-induced ocular hypertension can lead to secondary open-angle glaucoma, which shares many aspects with POAG. 2 Therefore, a better understanding of the mechanisms underlying DEX-induced glaucoma will also shed light on the pathogenesis of POAG. 
In 1994, Clark et al. 3 first reported an unusual actin structure induced by DEX in cultured trabecular meshwork (TM) cells. Unlike normal TM cells, which displayed actin microfilament stress fibers running along the longitudinal axis of the cell, DEX-treated TM cells formed a polygonal network of actin microfilaments referred to as cross-linked actin networks (CLANs). They further demonstrated that similar structures also exist in human TM tissues. 4 The CLAN structure may compromise the function of TM cells by changing the cell contractile property. The F-actin structure is associated with myosin light chain phosphorylation, 5 but the upstream components are still not clearly defined in DEX-treated TM cells. In 2011, Filla et al. 6 reported that the Rac1 inhibitor NSC23766 decreased the percentage of CLAN-positive cells by 80% in DEX-treated TM cells. However, Rac1 is unlikely the only small GTPase transducing the signal from DEX to the microfilaments, because several other inhibitors can also relax the TM cells and increase aqueous humor outflow. Rosenthal et al. 7 reported that the Rho-associated protein kinase (ROCK) inhibitor Y-27632 can reduce cell contraction induced by carbachol and endothelin-1. Khurana et al. 8 reported that the protein kinase C (PKC) inhibitor GF109203X increased outflow by 46% in a porcine whole eye perfusion model. They suggested that PKC might have an important role in the modulation of aqueous outflow facility by regulating myosin light chain (MLC) phosphorylation, and, thereby, the morphologic and cytoskeletal characteristics of the TM cells. 8 Recently, Fujimoto et al. 9 reported that a ROCK inhibitor prevents the decrease in aqueous outflow induced by DEX. Taken together, RhoA, Rac1, and PKC all are potential transducers of the signaling cascade leading to MLC phosphorylation. Even though ROCK inhibitors are being investigated in several phase 2a clinical studies, the upstream agonists for the activation of small GTPase are not clearly defined. TGF-β 10,11 and endothelin-1 12 have been reported to be associated with glaucoma, but to our knowledge, have not yet been defined as components in DEX-induced ocular hypertension. 
Recently, we found the activation of noncanonical Wnt signaling and an increase in myosin light chain phosphorylation in our new mouse model of glaucoma. 13 In this model, targeted overexpression of TGF-α in corneal epithelium causes secondary angle-closure glaucoma. Noncanonical Wnt signaling is well known for modulating the cytoskeleton through RhoA, Rac1, and PKC. 14 We, therefore, hypothesize that the noncanonical Wnt signaling pathway is one of the potential mechanisms mediating DEX-induced CLAN formation in TM cells. Here, we report that noncanonical Wnt ligand (Wnt5a) was upregulated by DEX as demonstrated by Wnt ligand degenerate PCR, real-time quantitative PCR (qRT-PCR), and Western blotting. We also found that recombinant WNT5a protein induced CLAN formation in TM cells, while knocking-down receptor tyrosine kinase-like orphan receptor 2 (Ror2), the receptor of noncanonical Wnt signaling, abolished the CLAN formation in DEX-treated TM cells. These observations demonstrated that dexamethasone induces CLAN formation through noncanonical Wnt signaling in TM cells. 
Materials and Methods
Cell Culture and DEX Treatment
A primary TM cell line was obtained from ScienCell Research Labs (Carlsbad, CA) and cultured to 100% confluence in Fibroblast Medium (catalog No. 2301; ScienCell Research Labs) before being placed in 1% charcoal-stripped serum medium containing 100 nM DEX or solvent (ethanol). Charcoal-stripped serum was used in the assay, because it can reduce background CLAN formation by removing the trace amount of steroids in the calf serum. 3 The medium was changed every 3 days. After 7 to 8 days, the cells were subjected to immunostaining, Western blotting, and qRT-PCR assays. In some experiments, recombinant proteins were used to treat confluent TM cells. The source and dosage of the proteins are: WNT5a (catalog No. 645-WN-010, 50 ng/mL; R&D Systems, Minneapolis, MN), BMP4 (catalog No. 314-BP-010, 10 ng/mL; R&D Systems), and TGF-β2 (catalog No. 302-B2-002, 2 ng/mL; R&D Systems). 
Immunostaining
Cells were cultured in 12-well chamber slides (catalog No. 81201; Ibidi GmbH, Martinsreid, Germany) and fixed for 20 minutes in 1% glutaraldehyde. Cells were permeabilized with 0.2% Triton X-100 in PBS. Alexa Fluor 555 phalloidin (Invitrogen, Carlsbad, CA) was used to visualize stress fiber structure. All incubations were performed at room temperature. Slides for immunofluorescence analysis were mounted (SlowFade Light Antifade Kit; Molecular Probes, Eugene, OR) in the presence of 4-,6-diamidino-2-phenylindole (DAPI), and observed with the EVOS fluorescence microscope (Advanced Microscopy Group, Mill Creek, WA). The percentage of cells that developed CLANs was determined by examining four random fields using EVOS microscope's counting function. Only cells with at least five hubs and three triangulated arrangements of spokes were labeled as CLAN-formation cells. 
Western Blotting
The WNT5a was enriched according to published methods 15 using Blue Sepharose beads. Briefly, cells were lysed in RIPA buffer (50 mm HEPES pH 7.4, 150 mM NaCl, 1% Triton X-100) with protease inhibitors. The cleared lysate was incubated with Cibacron Blue 3GA Sepharose beads in the cold room for 2 hours. Beads were washed with RIPA buffer three times before loading onto SDS-PAGE gel. Anti-WNT5a antibody (ab72583; Abcam, Cambridge, UK) was used to reveal the protein band. 
Degenerate PCR and qRT-PCR
Total RNA was isolated from cultured cells with the RNeasy Mini Kit (Qiagen, Venlo, The Netherlands). Then, 5 μg total RNA were reverse transcribed with Maxima First Strand cDNA Synthesis Kit for qRT-PCR (Fermentas, Pittsburgh, PA). The Wnt ligand degenerate PCR was performed according to published methods, 16 and the PCR products were cloned into the pCR4-TA sequencing plasmid (Invitrogen). Plasmids from a total of 18 colonies were sent for sequencing and the inserts were identified by BLAST database search. The qRT-PCR reactions were performed using the CFX96 real-time PCR system (Bio-Rad Laboratories, Inc., Hercules, CA) operated by CFX Manager software. Primer sequences used in the study are listed in the Table. A panel of 8 housekeeping genes (catalog No. HKK1; Real Time Primers, Elkins Park, PA) was used to normalize the expression levels. 
Table
 
Oligonucleotide Sequences Used in the Study
Table
 
Oligonucleotide Sequences Used in the Study
Gene Name Accession Number Forward Primer Reverse Primer Start End
Wnt ligands NNNGTCGACGCTTGYAARTGYCAYGG NNNGTTAACTACGTRRCARCACCARTG
Wnt2 NM_003391.2 TGGTGGTACATGAGAGCTACA AATACAACTCCAGCTGAGGAG 379 664
Wnt3 NM_030753.3 GACTATCCTGGACCACATGC GGACTCACGGTGCTTCTCTA 707 875
Wnt5a NM_001256105 AGAAGAAACTGTGCCACTTGTATCAG CCTTCGATGTCGGAATTGATACT 298 398
Wnt5aPtA NM_003392.4 TCGGGTGGCGACTTCCT CAACTCCTGGGCTTAATATTCCAAT 618 694
Wnt5aPtB NM_001256105 CCTCTCGCCCATGGAATT GGGCTTAATATTCCAATGGACTTC 21 92
Bmp2 NM_001200 GCTAGACCTGTATCGCAGGC TTTTCCCACTCGTTTCTGGT 40 185
Bmp4 NM_001202.3 CTGACCACCTCAACTCAACC CCCACATCCCTCTACTACCA 1456 1637
Tgf-β1 NM_000660 CCCTGGACACCAACTATTGC AAGTTGGCATGGTAGCCCTT 125 251
Tgf-β2 NM_001135599.2 AACAAGAGCAGAAGGCGAAT TGCCATCAATACCTGCAAAT 2025 2218
Tgf-β3 NM_003239 AAATTCGACATGATCCAGGG CTGCTCGGAATAGGTTGGTT 116 245
Foxc1 NM_001453.2 CTCCCCTCTCTTGCCTTCTT CGTCAGGTTTTGGGAACACT 2022 2233
Feline Immunodeficiency Virus (FIV)–Based shRNA Lentivirus
The FIV–based shRNA lentivirus expression system was obtained from System Biosciences (Mountain View, CA). The pSIF-H1 vectors are designed to express a single-stranded shRNA sequence with a fold-back stem-loop structure (also known as a “hairpin”) from an RNA polymerase III H1 promoter. The hairpin-type siRNA (shRNA) template oligonucleotides against human Ror2 (CGACAAGCTGAACGTGAAGAT) were cloned into the unique BamHI/EcoRI site of pSIF-H1 according to the manufacturer's protocol. The resulting plasmid (pSIF-H1-siRor2) and its control (pSIF-H1-siLuc) were packaged into viral particles. TM cells were transduced by the virus and positive cells were labeled by green fluorescent protein copGFP. 
Results
Noncanonical Wnt Ligand Is Upregulated by DEX in TM Cells
To delineate the signaling pathway leading to CLAN formation in DEX-treated TM cells, we adopted the protocol from the pioneer work of Clark et al. 3 Confluent TM cells were treated with 100 nM DEX or an equal volume of ethanol in 1% charcoal-stripped serum medium for 7 days. Stress fiber structures were visualized by phalloidin staining. In control cells, most of the F-actin fibers were parallel to each other running along the axis of the cell (Figs. 1A, 1C). In DEX-treated cells, a dramatic increase in F-actin fiber density and the formation of CLANs (Figs. 1B, 1D) was observed. DEX-treated cells apparently were larger than control cells. All of these observations are in agreement with the initial report of Clark et al. 3 on DEX-induced CLAN formation in TM cells. Approximately 34% of the cells from the DEX-treated culture had CLAN structure, while no CLANs can be found in the control-treated culture. 
Figure 1
 
Dexamethasone induces cross-linked actin networks formation in TM cells. Confluent TM cells were treated with 100 nM DEX or an equal volume of ethanol in 1% charcoal-stripped serum medium for 7 days. The medium was changed every 3 days. Stress fiber structure was visualized by phalloidin staining. (A) TM cells treated with solvent for 7 days, ×20 objective lens revealed most cells had actin microfilament stress fibers running along the longitudinal axis of the cell. (B) TM cells treated with DEX for 7 days, ×20 objective lens revealed most cells had polygonal networks of actin microfilaments referred to as CLANs. The dashed boxes indicate the region shown at higher magnification in (C, D). (C) Digital zoom revealed detailed actin structure in individual cells. (D) Digital zoom had a close-up view of the CLAN structure. The CLAN structures were indicated by the arrows. The region containing CLAN structure is encircled by a broken green line. The minimal CLAN structure (at least five hubs and three triangulated arrangements of spokes) is also labeled with yellow lines.
Figure 1
 
Dexamethasone induces cross-linked actin networks formation in TM cells. Confluent TM cells were treated with 100 nM DEX or an equal volume of ethanol in 1% charcoal-stripped serum medium for 7 days. The medium was changed every 3 days. Stress fiber structure was visualized by phalloidin staining. (A) TM cells treated with solvent for 7 days, ×20 objective lens revealed most cells had actin microfilament stress fibers running along the longitudinal axis of the cell. (B) TM cells treated with DEX for 7 days, ×20 objective lens revealed most cells had polygonal networks of actin microfilaments referred to as CLANs. The dashed boxes indicate the region shown at higher magnification in (C, D). (C) Digital zoom revealed detailed actin structure in individual cells. (D) Digital zoom had a close-up view of the CLAN structure. The CLAN structures were indicated by the arrows. The region containing CLAN structure is encircled by a broken green line. The minimal CLAN structure (at least five hubs and three triangulated arrangements of spokes) is also labeled with yellow lines.
We reported that several noncanonical Wnt ligands are upregulated in our mouse model of glaucoma. 13 An unbiased approach was taken to profile the Wnt ligand expression in DEX-treated TM cells. Confluent TM cells were treated with 100 nM DEX or an equal volume of ethanol in 1% charcoal-stripped serum medium for 8 days, and total RNA was extracted and reverse transcribed into cDNA. Then, PCR was performed using a published degenerate primer pair that can amplify all known Wnt ligands. 16 The DNA bands (Fig. 2A) were cut from the gel and purified before cloning into the pCR4 vector. A total of 18 individual colonies were picked and the plasmids were sent for sequencing. Sequencing data revealed that only three members of the Wnt gene family were found in both samples, but their relative abundance was very different. Wnt2 was the most abundant ligand in the control sample (5 of 9 clones), while Wnt5a was the most abundant in the DEX-treated sample (6 of 9 clones). The dramatic shift in the expression of Wnt ligands from Wnt2 to Wnt5a after DEX treatment was verified by qRT-PCR (Fig. 2B). Wnt2 mRNA level was reduced approximately 3-fold, while Wnt5a mRNA level was increased more than 4-fold after DEX treatment. We also observed an increase in WNT5a protein level in DEX-treated TM cells by Western blotting (Fig. 2C). 
Figure 2
 
Noncanonical Wnt ligand is upregulated by DEX treatment in TM cells. (A) Wnt ligand degenerate PCR. The primers used to amplify Wnt ligands are shown in the open arrows. DNA electrophoresis gel revealed the 450 base pair (bp) bands of amplified PCR product from control and DEX-treated TM cells. The bands were gel purified and cloned into pCR4 plasmid, and nine positive clones were sequenced from each sample. The identities of the PCR inserts are shown in the table. Wnt2 was the most abundant in the control sample (5 of 9 clones), while Wnt5a was the most abundant in the DEX-treated sample (6 of 9 clones). (B) qRT-PCR verified the finding by degenerate PCR. Wnt2 was downregulated 3-fold after DEX treatment, while Wnt5 was upregulated 4-fold. (C) WNT5a Western blotting demonstrated that there was more WNT5a protein in DEX-treated cells. TM cells were treated with control (ethanol) or 100 nM DEX for 7 days. Cells were lysed in RIPA buffer and incubated with Cibacron Blue 3GA Sepharose beads to enrich WNT proteins. The proteins were eluted from the beads by SDS-PAGE sample buffer. The results clearly showed there was an increase in WNT5a protein level after DEX treatment.
Figure 2
 
Noncanonical Wnt ligand is upregulated by DEX treatment in TM cells. (A) Wnt ligand degenerate PCR. The primers used to amplify Wnt ligands are shown in the open arrows. DNA electrophoresis gel revealed the 450 base pair (bp) bands of amplified PCR product from control and DEX-treated TM cells. The bands were gel purified and cloned into pCR4 plasmid, and nine positive clones were sequenced from each sample. The identities of the PCR inserts are shown in the table. Wnt2 was the most abundant in the control sample (5 of 9 clones), while Wnt5a was the most abundant in the DEX-treated sample (6 of 9 clones). (B) qRT-PCR verified the finding by degenerate PCR. Wnt2 was downregulated 3-fold after DEX treatment, while Wnt5 was upregulated 4-fold. (C) WNT5a Western blotting demonstrated that there was more WNT5a protein in DEX-treated cells. TM cells were treated with control (ethanol) or 100 nM DEX for 7 days. Cells were lysed in RIPA buffer and incubated with Cibacron Blue 3GA Sepharose beads to enrich WNT proteins. The proteins were eluted from the beads by SDS-PAGE sample buffer. The results clearly showed there was an increase in WNT5a protein level after DEX treatment.
Recombinant WNT5a Protein Induces the Formation of Cross-Linked Actin Networks in TM Cells
Next, we wanted to determine if recombinant WNT5a protein could also induce CLAN formation in TM cells. The TM cells were treated the same way as described previously (Figs. 3A, 3B), except 50 ng/mL recombinant WNT5a was added to the culture medium. After 7 days of culture, cells were stained with Alexa Fluor 555 phalloidin. As shown in Figure 3C, WNT5a induced widespread CLAN formation in TM cells. Cell size and CLAN structures were very similar to those of DEX-treated cells (Figs. 3E, 3F). Approximately 15% of cells in WNT5a-treated TM cells had CLAN structure. There were some subtle differences between DEX and WNT5a-treated cultures in terms of CLAN structure. CLANs in WNT5a-treated cells had a higher density of vertices and the size of the triangle was smaller comparing to those of DEX-treated cells. 
Figure 3
 
Recombinant WNT5a induces cross-linked actin networks formation in TM cells. Confluent TM cells were treated with 100 nM DEX, or an equal volume of ethanol or 50 ng/mL recombinant WNT5a in 1% charcoal-stripped serum medium for 7 days. The medium was changed every 3 days. Stress fiber structure was visualized by phalloidin staining. (A) The TM cells treated with solvent for 7 days, ×20 objective lens revealed most cells had actin microfilament stress fibers running along the longitudinal axis of the cell. (B) The TM cells treated with DEX for 7 days, ×20 objective lens revealed most cells had polygonal network of actin microfilaments referred to as CLANs. (C) The TM cells treated with 50 ng/mL WNT5a recombinant protein for 7 days, ×20 objective lens revealed most cells had polygonal CLANs. The dashed boxes indicate the region shown at higher magnification in (DF). (D) Digital zoom revealed detailed actin structure in individual cells. (E) Digital zoom had a close-up view of the CLAN structure. (F) Digital zoom had a close up view of the CLAN structure. The CLAN structures were indicated by the arrows. The CLAN structures are very similar between DEX and WNT5a-treated cells. The CLAN structure in WNT5a-treated cells may have higher local vertex density.
Figure 3
 
Recombinant WNT5a induces cross-linked actin networks formation in TM cells. Confluent TM cells were treated with 100 nM DEX, or an equal volume of ethanol or 50 ng/mL recombinant WNT5a in 1% charcoal-stripped serum medium for 7 days. The medium was changed every 3 days. Stress fiber structure was visualized by phalloidin staining. (A) The TM cells treated with solvent for 7 days, ×20 objective lens revealed most cells had actin microfilament stress fibers running along the longitudinal axis of the cell. (B) The TM cells treated with DEX for 7 days, ×20 objective lens revealed most cells had polygonal network of actin microfilaments referred to as CLANs. (C) The TM cells treated with 50 ng/mL WNT5a recombinant protein for 7 days, ×20 objective lens revealed most cells had polygonal CLANs. The dashed boxes indicate the region shown at higher magnification in (DF). (D) Digital zoom revealed detailed actin structure in individual cells. (E) Digital zoom had a close-up view of the CLAN structure. (F) Digital zoom had a close up view of the CLAN structure. The CLAN structures were indicated by the arrows. The CLAN structures are very similar between DEX and WNT5a-treated cells. The CLAN structure in WNT5a-treated cells may have higher local vertex density.
Knocking-Down Wnt5a Receptor (Ror2) Prevents the Formation of DEX-Induced Cross-Linked Actin Networks in TM Cells
If DEX induces CLAN formation through Wnt5a, knocking-down its receptor (Ror2, receptor tyrosine kinase-like orphan receptor 2) should abolish the effects of DEX on TM cells. The TM cells were transduced with FIV lentivirus encoding shRNA against luciferase (control) or human Ror2. At 3 days after transduction, the media were switched to DEX-containing media as described previously. At 7 days after treatment, stress fibers were visualized by Alexa Fluor 555 phalloidin staining. Expression of green fluorescent protein revealed shRNA-expressing cells. As expected, after DEX treatment, control cells exhibited widespread CLAN formation whether or not they expressed copGFP (Figs. 4A, 4C). In Ror2 shRNA-transduced culture, 6% of cells still had CLAN structure (Figs. 4B, 4D); however, these cells did not express Ror2 shRNA (GFP-negative) and the GFP-positive cells, which constituted approximately 80% of the total culture, did not have any CLAN formation. The Ror2 shRNA also seemed to affect normal stress fiber arrangement. In normal TM cells, actin microfilament stress fibers had an even distribution of parallel filaments running along the longitudinal axis of the cell (Fig. 3D). In Ror2 shRNA-transduced cells, the density of stress fibers in the center of the cell decreased dramatically (Fig. 4D). Similar observations were reported by Totsukawa et al. 17 that ROCK inhibitor blocked the stress fiber formation in the center of the cells, while cortical actin bundles were not affected. Because ROR2 situates upstream of RhoA/ROCK in the signaling pathway, the two observations agree with each other. 
Figure 4
 
Knocking-down Wnt5a receptor (Ror2) prevents DEX-induced cross-linked actin networks formation in TM cells. The TM cells were transduced with lentivirus encoding shRNA against luciferase (served as control) or human Ror2. At 3 days after transduction, the cells were treated with 100 nM DEX for 7 days. (A) In the control transduced culture, green fluorescence represents transduced cells expressing copGFP, ×20 objective lens revealed CLAN structure in transduced and untransduced cells. (B) In Ror2 shRNA transduced culture, few cells have CLAN structure and none of them has green fluorescence. The dashed boxes indicate the region shown at higher magnification in (C, D). (C) Digital zoom revealed detailed actin structure in individual cells. The CLAN structures were indicated by the arrow. (D) Digital zoom demonstrated unique stress fiber distribution pattern in transduced cells. Central stress fiber density significantly decreased in Ror2 shRNA expressing cells.
Figure 4
 
Knocking-down Wnt5a receptor (Ror2) prevents DEX-induced cross-linked actin networks formation in TM cells. The TM cells were transduced with lentivirus encoding shRNA against luciferase (served as control) or human Ror2. At 3 days after transduction, the cells were treated with 100 nM DEX for 7 days. (A) In the control transduced culture, green fluorescence represents transduced cells expressing copGFP, ×20 objective lens revealed CLAN structure in transduced and untransduced cells. (B) In Ror2 shRNA transduced culture, few cells have CLAN structure and none of them has green fluorescence. The dashed boxes indicate the region shown at higher magnification in (C, D). (C) Digital zoom revealed detailed actin structure in individual cells. The CLAN structures were indicated by the arrow. (D) Digital zoom demonstrated unique stress fiber distribution pattern in transduced cells. Central stress fiber density significantly decreased in Ror2 shRNA expressing cells.
Promoter B of Wnt5a Is Activated and the SMAD Agonist BMP4 Induces CLAN Formation in TM Cells
To figure out how DEX regulates Wnt5a expression, we focused on the transcription elements within the Wnt5a promoter. Wnt5a has two promoters: promoter A and promoter B. Neither has the glucocorticoid response element (GRE), suggesting an indirect effect of DEX on Wnt5a. 18 We first determined which promoter was active in TM cells by qRT-PCR amplification of promoter-specific transcripts. 19 Promoter A-specific primers did not amplify any PCR products from the samples, and only promoter B was active and responded to DEX stimulation in TM cells (Fig. 5A). Katoh and Katoh 18 suggested there are several potential transcription binding sites in promoter B: CUX1 (cut-like homeobox 1), SBEs (Smad-binding elements), NFκB, and FOX. NFκB is repressed by glucocorticoid receptors, 20 and, therefore, is unlikely the mechanism for DEX-induced Wnt5a expression. Both CUX1 and SBEs are related to TGF-β signaling 21 and Foxc1 is a crucial transcription factor for anterior chamber development. 22 Based on these findings, we analyzed the expression of several SMAD agonists and Foxc1 in DEX-treated TM cells. As shown in Figure 5A, Bmp4 was upregulated more than 2-fold, while Foxc1 was downregulated by 2-fold, and none of the Tgf-βs was upregulated. Next, we examined if recombinant BMP4 protein could induce CLAN formation in TM cells. Low serum medium with BMP4 (10 ng/mL) or TGF-β2 (2 ng/mL) was added to confluent TM cells for 7 days. BMP4 induced CLAN formation (Figs. 5B, 5D), just as the DEX or WNT5a did, while TGF-β2 forced actin fibers to coalesce into large bundles (Figs. 5C, 5E). Approximately 10% of cells in BMP4-treated TM had CLAN structure and the overall CLAN structure was similar to that of WNT5a-treated cells. 
Figure 5
 
Promoter B of Wnt5a is activated in TM cells and SMAD agonist BMP4 induces CLAN formation in TM cells. (A) The qRT-PCR analysis of DEX-treated TM cells. Promoter B specific transcript is upregulated by DEX treatment. Bmp4 also is upregulated, while Foxc1 is downregulated. (B) Recombinant BMP4 protein induces CLAN formation in TM cells. Confluent TM cells were treated with 10 ng/mL recombinant BMP4 or 2 ng/mL TGF-β in 1% charcoal-stripped serum medium for 7 days. The medium was changed every 3 days. Stress fiber structure was visualized by phalloidin staining, ×20 objective lens revealed CLAN structure in BMP4-treated TM cells. (C) TGF-β–treated TM cells have a massive induction of large thickened parallel stress fiber bundles, but no visible CLAN structure. The dashed boxes indicate the region shown at higher magnification in (D, E). (D) Digital zoom revealed detailed CLAN structure in individual cells. The CLAN structures were indicated by the arrow. (E) Digital zoom revealed detailed stress fiber structure in individual cells.
Figure 5
 
Promoter B of Wnt5a is activated in TM cells and SMAD agonist BMP4 induces CLAN formation in TM cells. (A) The qRT-PCR analysis of DEX-treated TM cells. Promoter B specific transcript is upregulated by DEX treatment. Bmp4 also is upregulated, while Foxc1 is downregulated. (B) Recombinant BMP4 protein induces CLAN formation in TM cells. Confluent TM cells were treated with 10 ng/mL recombinant BMP4 or 2 ng/mL TGF-β in 1% charcoal-stripped serum medium for 7 days. The medium was changed every 3 days. Stress fiber structure was visualized by phalloidin staining, ×20 objective lens revealed CLAN structure in BMP4-treated TM cells. (C) TGF-β–treated TM cells have a massive induction of large thickened parallel stress fiber bundles, but no visible CLAN structure. The dashed boxes indicate the region shown at higher magnification in (D, E). (D) Digital zoom revealed detailed CLAN structure in individual cells. The CLAN structures were indicated by the arrow. (E) Digital zoom revealed detailed stress fiber structure in individual cells.
Discussion
Primary open-angle glaucoma (POAG), the most common form of glaucoma, is usually accompanied by elevated IOP due to failure of the TM to maintain normal levels of aqueous humor outflow. Steroid-induced ocular hypertension and glaucoma are clinically similar to POAG. Glucocorticoids, such as dexamethasone, induce CLAN formation in TM cells and tissues, making them excellent reagents to dissect the underlying mechanism. Rho-associated protein kinase (ROCK) and TM contractility have already been established as important regulators of IOP, and several ROCK inhibitors currently are being evaluated in phase 2a clinical studies in patients with glaucoma or ocular hypertension, but the upstream agonists of RhoA/ROCK in POAG still remain elusive. Here, we attempted to establish that noncanonical Wnt signaling has an important role in DEX-induced CLAN formation through ROR2/RhoA/ROCK pathway in TM cells with the implication of having a similar role in POAG. 
Wnt ligand degenerate PCR is a powerful method that enabled us to determine Wnt ligand expression upon DEX treatment. Our result showed that two of the most abundant Wnt ligands in TM cells were Wnt2 and Wnt5a. After DEX treatment, the Wnt2 level decreased 3-fold, while the Wnt5a level increased 4-fold. This dramatic change in Wnt ligand expression indicated that the balance between canonical and noncanonical Wnt signaling is tipped toward the noncanonical Wnt pathway. Reduced expression of Wnt2 in DEX-treated TM cells suggested a reduction in canonical Wnt signaling. The association between reduced canonical Wnt signaling and glaucoma has been well established. The Wnt inhibitor Sfrp1 has been reported to be expressed preferentially in glaucomatous tissues, and has been found to reduce the aqueous outflow and elevate IOP in a perfusion model. 23 Others have reported that myocilin, a DEX-induced glaucoma-associated protein, 24 represses canonical Wnt signaling and activates Rac1/JNK. 25 It still is unclear how reduced canonical Wnt signaling leads to glaucoma, because there is no direct link between canonical Wnt and CLAN formation. We hypothesized that the missing link is noncanonical Wnt signaling. Specifically, reduced canonical Wnt signaling may cause the activation of noncanonical Wnt, which, in turn, affects the stress fiber organization. We found the activation of noncanonical Wnt signaling in our new mouse model of glaucoma 13 and applied that concept to DEX-induced CLAN formation. As expected, we verified the upregulation of noncanonical Wnt ligand (Wnt5a) in DEX-treated TM cells. We also demonstrated that DEX induces CLAN formation through noncanonical Wnt receptor (Ror2). We hypothesized that reduced canonical Wnt signaling is the initiator and increased noncanonical Wnt signaling is the executor in DEX-induced CLAN formation. It is known that noncanonical Wnt can suppress canonical Wnt signaling, 26 but it is not clear if canonical Wnt signaling can control the expression of noncanonical Wnt ligand (Wnt5a). Even though we observed downregulation of canonical Wnt ligand and upregulation of noncanonical Wnt ligand, we still do not know which occurs first. 
In an attempt to find the potential mechanisms for how canonical Wnt controls the expression of Wnt5a, we examined the transcription factor binding elements on promoter B of Wnt5a. Among them, SBEs (Smad-binding elements) and Fox-binding sites were chosen for their association with glaucoma. Gene expression assay revealed that Bmp4 was upregulated, while Foxc1 was downregulated by DEX treatment. Foxc1 also is downregulated in our new mouse model of glaucoma, 13 and Bmp4 and Foxc1 are well known for their association with congenital glaucoma. 27 29 Foxc1 is also related to canonical Wnt signaling 30 and potentially can bind to the FOX binding site on promoter B of Wnt5a. 18 At this point, it still is not clear if knocking-down Foxc1 expression in TM cells alone is enough to induce CLAN formation and we will explore the function of Foxc1 in DEX-induced CLAN formation in the future. Two other observations led us to test the effect of BMP4 on TM cells: first, BMP4 activates SMADs, and Wnt5a promoter has several SBEs (Smad-binding elements). Secondly, corneal stroma-specific ablation of β-catenin or Lrp5/Lrp6, which blocks canonical Wnt signaling, leads to upregulation of Bmp4 (Zhang Y, oral communication, 2012). We reported here that BMP4 protein induced CLAN formation just as the DEX or WNT5a did in TM cells. So, BMP4 is a promising link between canonical and noncanonical Wnt signaling, but more studies are required to verify this hypothesis. Finally, it is worthwhile to test a model proposed by Grumolato et al. 31 that canonical and noncanonical Wnt pathway reciprocally inhibit each other by competition of ligands for cell surface binding of Fzd. According to this model, reduced Wnt2 expression will make more Fzd available to transducing WNT5a signaling, activation of ROR2 by WNT5a may trigger a positive feedback loop to stimulate the expression of Wnt5a. So, we proposed the following model: DEX suppresses the expression of Wnt2, 32 which leads to reduced canonical Wnt signaling; reduced canonical Wnt signaling leads to the upregulation of Wnt5a through as yet undefined mechanisms; and WNT5a promotes CLAN formation through the ROR2/RhoA/ROCK pathway. Extensive loss-of-function and rescue studies in cell culture, organ culture, and experimental animals will be required to prove this model. 
It is worthwhile to note that all of our observations were made in a cell culture system. We do not exclude the possibility that DEX may stimulate other RhoA/ROCK agonists, such as endothelin 33 and TGF-β, in the surrounding tissues of TM in vivo. These soluble factors can then modulate stress fiber rearrangement in TM in a paracrine fashion. We also observed different effects of TGF-β2 on TM cells. In our hands, TGF-β2 failed to promote CLAN formation in TM cells; instead, it induced the formation of massive thickened, parallel stress fiber bundles. O'Reilly et al. 34 reported CLAN formation in TGF-β2–treated bovine TM cells. One apparent difference between the two systems is the species of the cell. Bovine TM cells seem more sensitive to CLAN induction by various reagents. 34  
Several companies are conducting phase 2 clinical studies to test the efficacy of ROCK inhibitors, including ATS907 (Altheos, Inc., San Francisco, CA), AR-12286 (Aerie Pharmaceuticals, Inc., Bedminster, NJ), and K-115 (Kowa Optimed, Inc., Torrance, CA), to treat POAG. The upstream agonists of ROCK still are elusive in POAG and DEX-induced ocular hypertension. Our study indicated that noncanonical Wnt signaling is the potential mechanism for ROCK activation in steroid-induced glaucoma. We demonstrated that DEX induces the upregulation of noncanonical Wnt ligand Wnt5a. WNT5a induces CLAN formation through the noncanonical Wnt receptor ROR2/RhoA/ROCK signaling axis. Based on our observations, the relationship between canonical and noncanonical Wnt signaling warrants more attention in searching for the pathogenic mechanism of POAG. 
Acknowledgments
The authors thank Peter Reinach from the State University of New York, for insightful discussion and proofreading the manuscript. 
Supported in part by grants from National Institutes of Health/National Eye Institute EY 21501 (C-YL), EY013755 (WW-YK), Research to Prevent Blindness, and Ohio Lions Eye Research Foundation. 
Disclosure: Y. Yuan, None; M.K. Call, None; Y. Yuan, None; Y. Zhang, None; K. Fischesser, None; C.-Y. Liu, None; W.W.-Y. Kao, None 
References
Armaly MF. Effect of corticosteroids on intraocular pressure and fluid dynamics. II. The effect of dexamethasone in the glaucomatous eye. Arch Ophthalmol . 1963; 70: 492– 499. [CrossRef] [PubMed]
Cubey RB. Glaucoma following the application of corticosteroid to the skin of the eyelids. Br J Dermatol . 1976; 95: 207– 208. [CrossRef] [PubMed]
Clark AF Wilson K McCartney MD Miggans ST Kunkle M Howe W. Glucocorticoid-induced formation of cross-linked actin networks in cultured human trabecular meshwork cells. Invest Ophthalmol Vis Sci . 1994; 35: 281– 294. [PubMed]
Clark AF Brotchie D Read AT Dexamethasone alters F-actin architecture and promotes cross-linked actin network formation in human trabecular meshwork tissue. Cell Motil Cytoskeleton . 2005; 60: 83– 95. [CrossRef] [PubMed]
Goeckeler ZM Wysolmerski RB. Myosin light chain kinase-regulated endothelial cell contraction: the relationship between isometric tension, actin polymerization, and myosin phosphorylation. J Cell Biol . 1995; 130: 613– 627. [CrossRef] [PubMed]
Filla MS Schwinn MK Nosie AK Clark RW Peters DM. Dexamethasone-associated cross-linked actin network formation in human trabecular meshwork cells involves beta3 integrin signaling. Invest Ophthalmol Vis Sci . 2011; 52: 2952– 2959. [CrossRef] [PubMed]
Rosenthal R Choritz L Schlott S Effects of ML-7 and Y-27632 on carbachol- and endothelin-1-induced contraction of bovine trabecular meshwork. Exp Eye Res . 2005; 80: 837– 845. [CrossRef] [PubMed]
Khurana RN Deng PF Epstein DL Vasantha RP. The role of protein kinase C in modulation of aqueous humor outflow facility. Exp Eye Res . 2003; 76: 39– 47. [CrossRef] [PubMed]
Fujimoto T Inoue T Kameda T Involvement of RhoA/Rho-associated kinase signal transduction pathway in dexamethasone-induced alterations in aqueous outflow. Invest Ophthalmol Vis Sci . 2012; 53: 7097– 7108. [CrossRef] [PubMed]
Inatani M Tanihara H Katsuta H Honjo M Kido N Honda Y. Transforming growth factor-beta 2 levels in aqueous humor of glaucomatous eyes. Graefes Arch Clin Exp Ophthalmol . 2001; 239: 109– 113. [CrossRef] [PubMed]
Tripathi RC Li J Chan WF Tripathi BJ. Aqueous humor in glaucomatous eyes contains an increased level of TGF-beta 2. Exp Eye Res . 1994; 59: 723– 727. [CrossRef] [PubMed]
Kallberg ME Brooks DE Garcia-Sanchez GA Komàromy AM Szabo NJ Tian L. Endothelin 1 levels in the aqueous humor of dogs with glaucoma. J Glaucoma . 2002; 11: 105– 109. [CrossRef] [PubMed]
Yuan Y Yeh LK Liu H Targeted overexpression of TGF-alpha in the corneal epithelium of adult transgenic mice induces changes in anterior segment morphology and activates noncanonical Wnt signaling. Invest Ophthalmol Vis Sci . 2013; 54: 1829– 1837. [CrossRef] [PubMed]
Zhu S Liu L Korzh V Gong Z Low BC. RhoA acts downstream of Wnt5 and Wnt11 to regulate convergence and extension movements by involving effectors Rho kinase and Diaphanous: use of zebrafish as an in vivo model for GTPase signaling. Cell Signal . 2006; 18: 359– 372. [CrossRef] [PubMed]
Willert K Brown JD Danenberg E Wnt proteins are lipid-modified and can act as stem cell growth factors. Nature . 2003; 423: 448– 452. [CrossRef] [PubMed]
Van Den Berg DJ Sharma AK Bruno E Hoffman R. Role of members of the Wnt gene family in human hematopoiesis. Blood . 1998; 92: 3189– 3202. [PubMed]
Totsukawa G Yamakita Y Yamashiro S Hartshorne DJ Sasaki Y Matsumura F. Distinct roles of ROCK (Rho-kinase) and MLCK in spatial regulation of MLC phosphorylation for assembly of stress fibers and focal adhesions in 3T3 fibroblasts. J Cell Biol . 2000; 150: 797– 806. [CrossRef] [PubMed]
Katoh M Katoh M. Transcriptional mechanisms of WNT5A based on NF-kappaB, Hedgehog, TGFbeta, and Notch signaling cascades. Int J Mol Med . 2009; 23: 763– 769. [PubMed]
Katula KS Joyner-Powell NB Hsu CC Kuk A. Differential regulation of the mouse and human Wnt5a alternative promoters A and B. DNA Cell Biol . 2012; 31: 1585– 1597. [CrossRef] [PubMed]
Scheinman RI Gualbert A Jewel CM Cidlowsk JA Baldwi A Jr. Characterization of mechanisms involved in transrepression of NF-kappa B by activated glucocorticoid receptors. Mol Cell Biol . 1995; 15: 943– 953. [PubMed]
Michl P Ramjaun AR Pardo OE CUTL1 is a target of TGF(beta) signaling that enhances cancer cell motility and invasiveness. Cancer Cell . 2005; 7: 521– 532. [CrossRef] [PubMed]
Kidson SH Kume T Deng K Winfrey V Hogan BL. The forkhead/winged-helix gene, Mf1, is necessary for the normal development of the cornea and formation of the anterior chamber in the mouse eye. Dev Biol . 1999; 211: 306– 322. [CrossRef] [PubMed]
Wang WH McNatt LG Pang IH Increased expression of the WNT antagonist sFRP-1 in glaucoma elevates intraocular pressure. J Clin Invest . 2008; 118: 1056– 1064. [PubMed]
Stone EM Fingert JT Alward WL Identification of a gene that causes primary open angle glaucoma. Science . 1997; 275: 668– 670. [CrossRef] [PubMed]
Kwon HS Lee HS Ji Y Rubin JS Tomarev SI. Myocilin is a modulator of Wnt signaling. Mol Cell Biol . 2009; 29: 2139– 2154. [CrossRef] [PubMed]
Topol L Juang X Choi H Garrett-Beal L Carolan PJ Yang Y. Wnt-5a inhibits the canonical Wnt pathway by promoting GSK-3-independent beta-catenin degradation. J Cell Biol . 2003; 162: 899– 908. [CrossRef] [PubMed]
Chang B Smith RS Peters M Haploinsufficient Bmp4 ocular phenotypes include anterior segment dysgenesis with elevated intraocular pressure. BMC Genet . 2001; 2: 18. [CrossRef] [PubMed]
Nishimura DY Swiderski RE Alward WL The forkhead transcription factor gene FKHL7 is responsible for glaucoma phenotypes which map to 6p25. Nat Genet . 1998; 19: 140– 147. [CrossRef] [PubMed]
Kume T Deng KY Winfrey W Gould DB Walter MA Hogan BL. The forkhead/winged helix gene Mf1 is disrupted in the pleiotropic mouse mutation congenital hydrocephalus. Cell . 1998; 93: 985– 996. [CrossRef] [PubMed]
Savage J Voronova A Mehta V Sendi-Mukasa F Skerjanc IS. Canonical Wnt signaling regulates Foxc1/2 expression in P19 cells. Differentiation . 2010; 79: 31– 40. [CrossRef] [PubMed]
Grumolato L Liu G Mong P Canonical and noncanonical Wnts use a common mechanism to activate completely unrelated coreceptors. Genes Dev . 2010; 24: 2517– 2530. [CrossRef] [PubMed]
Hardy R Juarez M Naylor A Synovial DKK1 expression is regulated by local glucocorticoid metabolism in inflammatory arthritis. Arthritis Res Ther . 2012; 14: R226. [CrossRef] [PubMed]
Zhang X Krishnamoorthy RR Prasanna G Narayan S Clark A Yorio T. Dexamethasone regulates endothelin-1 and endothelin receptors in human non-pigmented ciliary epithelial (HNPE) cells. Exp Eye Res . 2003; 76: 261– 272. [CrossRef] [PubMed]
O'Reilly S Pollock N Currie L Paraoan L Clark AF Grierson I. Inducers of cross-linked actin networks in trabecular meshwork cells. Invest Ophthalmol Vis Sci . 2011; 52: 7316– 7324. [CrossRef] [PubMed]
Figure 1
 
Dexamethasone induces cross-linked actin networks formation in TM cells. Confluent TM cells were treated with 100 nM DEX or an equal volume of ethanol in 1% charcoal-stripped serum medium for 7 days. The medium was changed every 3 days. Stress fiber structure was visualized by phalloidin staining. (A) TM cells treated with solvent for 7 days, ×20 objective lens revealed most cells had actin microfilament stress fibers running along the longitudinal axis of the cell. (B) TM cells treated with DEX for 7 days, ×20 objective lens revealed most cells had polygonal networks of actin microfilaments referred to as CLANs. The dashed boxes indicate the region shown at higher magnification in (C, D). (C) Digital zoom revealed detailed actin structure in individual cells. (D) Digital zoom had a close-up view of the CLAN structure. The CLAN structures were indicated by the arrows. The region containing CLAN structure is encircled by a broken green line. The minimal CLAN structure (at least five hubs and three triangulated arrangements of spokes) is also labeled with yellow lines.
Figure 1
 
Dexamethasone induces cross-linked actin networks formation in TM cells. Confluent TM cells were treated with 100 nM DEX or an equal volume of ethanol in 1% charcoal-stripped serum medium for 7 days. The medium was changed every 3 days. Stress fiber structure was visualized by phalloidin staining. (A) TM cells treated with solvent for 7 days, ×20 objective lens revealed most cells had actin microfilament stress fibers running along the longitudinal axis of the cell. (B) TM cells treated with DEX for 7 days, ×20 objective lens revealed most cells had polygonal networks of actin microfilaments referred to as CLANs. The dashed boxes indicate the region shown at higher magnification in (C, D). (C) Digital zoom revealed detailed actin structure in individual cells. (D) Digital zoom had a close-up view of the CLAN structure. The CLAN structures were indicated by the arrows. The region containing CLAN structure is encircled by a broken green line. The minimal CLAN structure (at least five hubs and three triangulated arrangements of spokes) is also labeled with yellow lines.
Figure 2
 
Noncanonical Wnt ligand is upregulated by DEX treatment in TM cells. (A) Wnt ligand degenerate PCR. The primers used to amplify Wnt ligands are shown in the open arrows. DNA electrophoresis gel revealed the 450 base pair (bp) bands of amplified PCR product from control and DEX-treated TM cells. The bands were gel purified and cloned into pCR4 plasmid, and nine positive clones were sequenced from each sample. The identities of the PCR inserts are shown in the table. Wnt2 was the most abundant in the control sample (5 of 9 clones), while Wnt5a was the most abundant in the DEX-treated sample (6 of 9 clones). (B) qRT-PCR verified the finding by degenerate PCR. Wnt2 was downregulated 3-fold after DEX treatment, while Wnt5 was upregulated 4-fold. (C) WNT5a Western blotting demonstrated that there was more WNT5a protein in DEX-treated cells. TM cells were treated with control (ethanol) or 100 nM DEX for 7 days. Cells were lysed in RIPA buffer and incubated with Cibacron Blue 3GA Sepharose beads to enrich WNT proteins. The proteins were eluted from the beads by SDS-PAGE sample buffer. The results clearly showed there was an increase in WNT5a protein level after DEX treatment.
Figure 2
 
Noncanonical Wnt ligand is upregulated by DEX treatment in TM cells. (A) Wnt ligand degenerate PCR. The primers used to amplify Wnt ligands are shown in the open arrows. DNA electrophoresis gel revealed the 450 base pair (bp) bands of amplified PCR product from control and DEX-treated TM cells. The bands were gel purified and cloned into pCR4 plasmid, and nine positive clones were sequenced from each sample. The identities of the PCR inserts are shown in the table. Wnt2 was the most abundant in the control sample (5 of 9 clones), while Wnt5a was the most abundant in the DEX-treated sample (6 of 9 clones). (B) qRT-PCR verified the finding by degenerate PCR. Wnt2 was downregulated 3-fold after DEX treatment, while Wnt5 was upregulated 4-fold. (C) WNT5a Western blotting demonstrated that there was more WNT5a protein in DEX-treated cells. TM cells were treated with control (ethanol) or 100 nM DEX for 7 days. Cells were lysed in RIPA buffer and incubated with Cibacron Blue 3GA Sepharose beads to enrich WNT proteins. The proteins were eluted from the beads by SDS-PAGE sample buffer. The results clearly showed there was an increase in WNT5a protein level after DEX treatment.
Figure 3
 
Recombinant WNT5a induces cross-linked actin networks formation in TM cells. Confluent TM cells were treated with 100 nM DEX, or an equal volume of ethanol or 50 ng/mL recombinant WNT5a in 1% charcoal-stripped serum medium for 7 days. The medium was changed every 3 days. Stress fiber structure was visualized by phalloidin staining. (A) The TM cells treated with solvent for 7 days, ×20 objective lens revealed most cells had actin microfilament stress fibers running along the longitudinal axis of the cell. (B) The TM cells treated with DEX for 7 days, ×20 objective lens revealed most cells had polygonal network of actin microfilaments referred to as CLANs. (C) The TM cells treated with 50 ng/mL WNT5a recombinant protein for 7 days, ×20 objective lens revealed most cells had polygonal CLANs. The dashed boxes indicate the region shown at higher magnification in (DF). (D) Digital zoom revealed detailed actin structure in individual cells. (E) Digital zoom had a close-up view of the CLAN structure. (F) Digital zoom had a close up view of the CLAN structure. The CLAN structures were indicated by the arrows. The CLAN structures are very similar between DEX and WNT5a-treated cells. The CLAN structure in WNT5a-treated cells may have higher local vertex density.
Figure 3
 
Recombinant WNT5a induces cross-linked actin networks formation in TM cells. Confluent TM cells were treated with 100 nM DEX, or an equal volume of ethanol or 50 ng/mL recombinant WNT5a in 1% charcoal-stripped serum medium for 7 days. The medium was changed every 3 days. Stress fiber structure was visualized by phalloidin staining. (A) The TM cells treated with solvent for 7 days, ×20 objective lens revealed most cells had actin microfilament stress fibers running along the longitudinal axis of the cell. (B) The TM cells treated with DEX for 7 days, ×20 objective lens revealed most cells had polygonal network of actin microfilaments referred to as CLANs. (C) The TM cells treated with 50 ng/mL WNT5a recombinant protein for 7 days, ×20 objective lens revealed most cells had polygonal CLANs. The dashed boxes indicate the region shown at higher magnification in (DF). (D) Digital zoom revealed detailed actin structure in individual cells. (E) Digital zoom had a close-up view of the CLAN structure. (F) Digital zoom had a close up view of the CLAN structure. The CLAN structures were indicated by the arrows. The CLAN structures are very similar between DEX and WNT5a-treated cells. The CLAN structure in WNT5a-treated cells may have higher local vertex density.
Figure 4
 
Knocking-down Wnt5a receptor (Ror2) prevents DEX-induced cross-linked actin networks formation in TM cells. The TM cells were transduced with lentivirus encoding shRNA against luciferase (served as control) or human Ror2. At 3 days after transduction, the cells were treated with 100 nM DEX for 7 days. (A) In the control transduced culture, green fluorescence represents transduced cells expressing copGFP, ×20 objective lens revealed CLAN structure in transduced and untransduced cells. (B) In Ror2 shRNA transduced culture, few cells have CLAN structure and none of them has green fluorescence. The dashed boxes indicate the region shown at higher magnification in (C, D). (C) Digital zoom revealed detailed actin structure in individual cells. The CLAN structures were indicated by the arrow. (D) Digital zoom demonstrated unique stress fiber distribution pattern in transduced cells. Central stress fiber density significantly decreased in Ror2 shRNA expressing cells.
Figure 4
 
Knocking-down Wnt5a receptor (Ror2) prevents DEX-induced cross-linked actin networks formation in TM cells. The TM cells were transduced with lentivirus encoding shRNA against luciferase (served as control) or human Ror2. At 3 days after transduction, the cells were treated with 100 nM DEX for 7 days. (A) In the control transduced culture, green fluorescence represents transduced cells expressing copGFP, ×20 objective lens revealed CLAN structure in transduced and untransduced cells. (B) In Ror2 shRNA transduced culture, few cells have CLAN structure and none of them has green fluorescence. The dashed boxes indicate the region shown at higher magnification in (C, D). (C) Digital zoom revealed detailed actin structure in individual cells. The CLAN structures were indicated by the arrow. (D) Digital zoom demonstrated unique stress fiber distribution pattern in transduced cells. Central stress fiber density significantly decreased in Ror2 shRNA expressing cells.
Figure 5
 
Promoter B of Wnt5a is activated in TM cells and SMAD agonist BMP4 induces CLAN formation in TM cells. (A) The qRT-PCR analysis of DEX-treated TM cells. Promoter B specific transcript is upregulated by DEX treatment. Bmp4 also is upregulated, while Foxc1 is downregulated. (B) Recombinant BMP4 protein induces CLAN formation in TM cells. Confluent TM cells were treated with 10 ng/mL recombinant BMP4 or 2 ng/mL TGF-β in 1% charcoal-stripped serum medium for 7 days. The medium was changed every 3 days. Stress fiber structure was visualized by phalloidin staining, ×20 objective lens revealed CLAN structure in BMP4-treated TM cells. (C) TGF-β–treated TM cells have a massive induction of large thickened parallel stress fiber bundles, but no visible CLAN structure. The dashed boxes indicate the region shown at higher magnification in (D, E). (D) Digital zoom revealed detailed CLAN structure in individual cells. The CLAN structures were indicated by the arrow. (E) Digital zoom revealed detailed stress fiber structure in individual cells.
Figure 5
 
Promoter B of Wnt5a is activated in TM cells and SMAD agonist BMP4 induces CLAN formation in TM cells. (A) The qRT-PCR analysis of DEX-treated TM cells. Promoter B specific transcript is upregulated by DEX treatment. Bmp4 also is upregulated, while Foxc1 is downregulated. (B) Recombinant BMP4 protein induces CLAN formation in TM cells. Confluent TM cells were treated with 10 ng/mL recombinant BMP4 or 2 ng/mL TGF-β in 1% charcoal-stripped serum medium for 7 days. The medium was changed every 3 days. Stress fiber structure was visualized by phalloidin staining, ×20 objective lens revealed CLAN structure in BMP4-treated TM cells. (C) TGF-β–treated TM cells have a massive induction of large thickened parallel stress fiber bundles, but no visible CLAN structure. The dashed boxes indicate the region shown at higher magnification in (D, E). (D) Digital zoom revealed detailed CLAN structure in individual cells. The CLAN structures were indicated by the arrow. (E) Digital zoom revealed detailed stress fiber structure in individual cells.
Table
 
Oligonucleotide Sequences Used in the Study
Table
 
Oligonucleotide Sequences Used in the Study
Gene Name Accession Number Forward Primer Reverse Primer Start End
Wnt ligands NNNGTCGACGCTTGYAARTGYCAYGG NNNGTTAACTACGTRRCARCACCARTG
Wnt2 NM_003391.2 TGGTGGTACATGAGAGCTACA AATACAACTCCAGCTGAGGAG 379 664
Wnt3 NM_030753.3 GACTATCCTGGACCACATGC GGACTCACGGTGCTTCTCTA 707 875
Wnt5a NM_001256105 AGAAGAAACTGTGCCACTTGTATCAG CCTTCGATGTCGGAATTGATACT 298 398
Wnt5aPtA NM_003392.4 TCGGGTGGCGACTTCCT CAACTCCTGGGCTTAATATTCCAAT 618 694
Wnt5aPtB NM_001256105 CCTCTCGCCCATGGAATT GGGCTTAATATTCCAATGGACTTC 21 92
Bmp2 NM_001200 GCTAGACCTGTATCGCAGGC TTTTCCCACTCGTTTCTGGT 40 185
Bmp4 NM_001202.3 CTGACCACCTCAACTCAACC CCCACATCCCTCTACTACCA 1456 1637
Tgf-β1 NM_000660 CCCTGGACACCAACTATTGC AAGTTGGCATGGTAGCCCTT 125 251
Tgf-β2 NM_001135599.2 AACAAGAGCAGAAGGCGAAT TGCCATCAATACCTGCAAAT 2025 2218
Tgf-β3 NM_003239 AAATTCGACATGATCCAGGG CTGCTCGGAATAGGTTGGTT 116 245
Foxc1 NM_001453.2 CTCCCCTCTCTTGCCTTCTT CGTCAGGTTTTGGGAACACT 2022 2233
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×