Free
Genetics  |   January 2015
Detection of Mutations in LRPAP1, CTSH, LEPREL1, ZNF644, SLC39A5, and SCO2 in 298 Families With Early-Onset High Myopia by Exome Sequencing
Author Notes
  • State Key Laboratory of Ophthalmology, Zhongshan Ophthalmic Center, Sun Yat-sen University, Guangzhou, China 
  • Correspondence: Qingjiong Zhang, State Key Laboratory of Ophthalmology, Zhongshan Ophthalmic Center, Sun Yat-sen University, 54 Xianlie Road, Guangzhou 510060, China; zhangqji@mail.sysu.edu.cn, qingjiongzhang@yahoo.com
Investigative Ophthalmology & Visual Science January 2015, Vol.56, 339-345. doi:10.1167/iovs.14-14850
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Dan Jiang, Jiali Li, Xueshan Xiao, Shiqiang Li, Xiaoyun Jia, Wenmin Sun, Xiangming Guo, Qingjiong Zhang; Detection of Mutations in LRPAP1, CTSH, LEPREL1, ZNF644, SLC39A5, and SCO2 in 298 Families With Early-Onset High Myopia by Exome Sequencing. Invest. Ophthalmol. Vis. Sci. 2015;56(1):339-345. doi: 10.1167/iovs.14-14850.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

Purpose.: To evaluate variants in the LRPAP1, CTSH, LEPREL1, ZNF644, SLC39A5, and SCO2 genes in 298 unrelated patients with early-onset high myopia (eoHM).

Methods.: Genomic DNA from 298 patients with eoHM was analyzed by whole exome sequencing. Variants in LRPAP1, CTSH, LEPREL1, ZNF644, SLC39A5, and SCO2 genes were selected and analyzed with bioinformatics. Potential candidate variants were confirmed by Sanger sequencing and then validated in available family members and 192 healthy controls.

Results.: A total of nine variants predicted to affect the functional residues were detected. The LRPAP1 gene showed a homozygous frameshift mutation (c.199delC, p.Q67Sfs*8) in a consanguineous family. The ZNF644 gene showed five heterozygous missense mutations (c.1106A>T, p.K369M; c.1648G>A, p.A550T; c.2014A>G, p.S672G; c.2048G>C, p.R683T, and c.2551G>C, p.D851H) in five families, but the c.1106A>T, (p.K369M) and c.1648G>A, (p.A550T) in ZNF644 did not co-segregated with high myopia in the families and should be excluded as causative mutations. The SLC39A5 gene showed a heterozygous missense variant (c.1238G>C, p.G413A) in a sporadic individual. The SCO2 gene showed two heterozygous missense variants (c.334C>T, p.R112W and c.358C>T, p.R120W) in two families. None of the variants was detected in 192 healthy controls and all were predicted to be damaging by both Polyphen-2 and SIFT, except for the previously reported p.S672G mutation in ZNF644, which was predicted to be damaging by SIFT but benign by Polyphen-2. No homozygous or compound heterozygous variants were found in CTSH and LEPREL1.

Conclusions.: Our results provide additional evidence to support the idea that mutation in LRPAP1 is associated with high myopia. Further studies are expected to evaluate the pathogenicity of the variants in CTSH, LEPREL1, ZNF644, SLC39A5, and SCO2.

Introduction
High myopia, defined as refractive errors greater than −6 diopters (D)1 or an ocular axial length (AL) longer than 26 mm,2 is a leading cause of impaired vision due to its associated complications,3 such as macular degeneration,4,5 retinal detachment,6,7 and glaucoma.8,9 Most high myopia is a complex trait, with both genetic and environmental factors involved.1,10 Genome-wide association studies have identified a number of significant single nucleotide polymorphisms (SNPs) in several loci associated with high myopia, such as 11q24.1,11 5p15,12 21q22.3,13 15q14,14 and 4q25,15 but the responsible genes have not been determined. On the other hand, transmission of high myopia has been reported as autosomal dominant,16,17 autosomal recessive,18,19 and X-linked traits20,21 in a number of families. Linkage analysis has identified at least 13 loci for high myopia (MYP1-3, MYP5-6, MYP11-13, MYP15-17, MYP18-19).1618,2130 Many candidate genes in these loci have been studied extensively, including TGF-β1,3133 IGF,3437 LUM,33,3840 COL1A1,25,4143 and PAX6.4448 However, no causative mutation in these genes has been found for high myopia, nor have any SNPs been consistently reported to associate with high myopia. 
High myopia can be classified according to age of onset, as early-onset high myopia (eoHM, high myopia was observed before school age) and late-onset high myopia (loHM, high myopia developed during or after school age).49 The loHM is much more common and is frequently associated with extensive near-work.50 Compared with loHM, eoHM is more likely to be genetically determined with less environmental impact,49 and therefore might represent an ideal source for a search for monogenic defects. 
Recent whole exome sequencing has revealed variations in a few genes reported to associate with high myopia. For example, Shi et al.51 reported a mutation A672G in ZNF644 that co-segregated with high myopia in a large Chinese family with autosomal dominant high myopia. Other mutations in ZNF644 were also detected in individuals (Chinese, Caucasian, and African American) with sporadic high myopia.51,52 Co-segregation of two heterozygous mutations (Y47* and M304T) in SLC39A5 with autosomal dominant high myopia was identified in two Chinese families.53 Tran-Viet et al.54 reported that a heterozygous nonsense mutation in the SCO2 gene (c.157C>T, p. Gln53*) co-segregated with high myopia in a large European family with autosomal dominant extreme high myopia, and three other rare variants were detected in sporadic high myopia. Mutations in some genes also have been reported for autosomal recessive high myopia. Aldahmesh et al.19 identified two homozygous frameshift mutations (Asn202Thrfs*8 and Ile288Argfs∗118) in LRPAP1 and one homozygous mutation in CTSH in four Arabic consanguineous families with eoHM. Homozygous mutations (Gln5X and Gly508Val) in LEPREL1 also have been reported in families with autosomal recessive high myopia.55,56 Variants in these genes were detected in a limited number of cases, and were expected to be extended to additional families. In the present study, we report additional mutations in these genes, based on whole exome sequencing of 298 unrelated Chinese patients with eoHM. 
Materials and Methods
This is a part of our ongoing project on identification of genetic defects for Mendelian high myopia by exome sequencing. The current study focused on exome sequencing results for the LRPAP1, CTSH, LEPREL1, ZNF644, SLC39A5, and SCO2 genes from 298 unrelated patients with eoHM. The inclusion criteria for patients with eoHM included spherical refraction less than or equal to −6.00 D, high myopia observed before school age (<7 years), and no other ocular diseases or systemic diseases. Exome sequencing results of the four genes from patients with eoHM were filtered with following steps: (1) exclude noncoding variants without altering splicing sites predicted by the Berkeley Drosophila Genome Project (available in the public domain at http://www.fruitfly.org/seq_tools/splice.html); (2) exclude the synonymous variants without altering splicing sites in the genes; (3) exclude database SNPs with minor allele frequency (MAF) greater than or equal to 0.01 in the 1000Genome database; (4) exclude the variants with MAF greater than or equal to 0.01 observed in 316 patients with other conditions other than high myopia; (5) exclude missense variants predicted to be benign by both Polyphen-2 (available in the public domain at http://genetics.bwh.harvard.edu/pph/) and SIFT (available in the public domain at http://sift.jcvi.org); (6) heterozygous variants for ZNF644, SLC39A5, and SCO2, whereas homozygous or compound heterozygous variants for LRPAP1, CTSH, and LEPREL1 were finally selected for confirmation, as mutations in the latter three genes were reported to associate with autosomal recessive high myopia. The remaining variants were confirmed by Sanger sequencing and then evaluated in192 healthy control individuals, who met the following criteria: −0.50 D ≤ spherical refraction ≤ +1.00 D, bilateral visual acuity greater than or equal to 1.0, no family history of myopia, and no other ocular diseases or systemic diseases. Written informed consent was obtained from all the participants or their guardians before the collection of their genomic DNA and clinical data. This study confirmed to the tenets of the Declaration of Helsinki and was approved by the institutional review board of Zhongshan Ophthalmic Center, Sun Yat-Sen University. 
Exome sequencing was completed as a commercial service. The DNA sample from each patient was sequenced with an Agilent (Santa Clara, CA, USA) SureSelect Human All Exon Enrichment Kit V4 (51189318 base pairs) array on the Illumina (San Diego, CA, USA) HiSequation 2000 101PE. The average sequencing depth was 125-fold. All sequencing reads were mapped against UCSC hg19 (available in the public domain at http://genome.ucsc.edu/). The SNPs and Indels were detected by SAMTOOLS (available in the public domain at http://samtools.sourceforge.net/), and annotated according to the dbSNP135 and 1000Genome databases. 
Sanger sequencing was used to confirm the candidate variants, using the primers listed in Table 1 to amplify the DNA fragments harboring the variants and a touch-down PCR program as previously described.57 The amplicons were sequenced with an ABI BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) and electrophoresed on an ABI 3130 Genetic Analyzer (Applied Biosystems). The sequencing results were compared with the consensus DNA sequences obtained from the UCSC genome browser hg19 (available in the public domain at http://genome.ucsc.edu/cgi-bin/hgGateway). The confirmed variants were further validated in the available family members and 192 healthy controls. 
Table 1
 
Primers Used to Amplify the Sequences Harboring the Variants in This Study
Table 1
 
Primers Used to Amplify the Sequences Harboring the Variants in This Study
Primer Name Primer Sequence (5′–3′)
Chr1:91404360-F AGACCCTCATAAGCCTGACG
Chr1:91404360-R AGCATTTTCTCCAGGCTCCT
Chr1:91404863-91405263-F TGTGGACGGACATTTCGAGA
Chr1:91404863-91405263-R TTTTGGTCAACGCTGCTTTT
Chr1:91405805-F ACCGAGGATTGCTTTAGTGAT
Chr1:91405805-R TGTGGAGGTGCTTCTTCTCC
Chr4:3533943-F TGGTTCTGTCCCTACGCTC
Chr4:3533943-R GGAGGGTCAGGTCGTTTCTG
Chr12:56630745-F CCATAGGTGTGAGGGGTGG
Chr12:56630745-R CAATCCCAGGGCTCCAGAC
Chr22:50962483-F GGGGTCCACAGTGATGAAGA
Chr22:50962483-R CTGAGGGCTGAGAAGGAGAG
Chr22:50962507-F AAACCAGGCTCTGCTTCCA
Chr22:50962507-R TCTGAGGTCCTGGCTTTTGT
Results
From the exome sequencing data of 298 individuals with high myopia, a total of 232 variants were detected in the six genes (Supplementary Table S1; 45 variants in LRPAP1, 60 variants in CTSH, 71 variants in LEPREL1, 21 variants in ZNF644, 20 variants in SLC39A5, and 15 variants in SCO2). After six filtering steps, nine variants remained. Sanger sequencing confirmed the nine variants (Fig.) and segregation analysis excluded two variants (c.1106A>T, p.K369M and c.1648G>A, p.A550T) in ZNF644. Segregation analysis could not be performed on the other seven variants because DNA samples were available from only one individual of each seven families. The seven potential causative variants included a homozygous frameshift mutation (c.199delC, p.Q67Sfs*8) in LRPAP1, three heterozygous mutations in ZNF644 (c.2014A>G, p.S672G; c.2048G>C, p.R683T; c.2551G>C, p.D851H), one heterozygous mutation (c.1238G>C, p.G413A) in SLC39A5, and two heterozygous mutations (c.334C>T, p.R112W and c.358C>T, p.R120W) in SCO2. Of the seven, p.Q67Sfs*8 in LRPAP1, p.D851H in ZNF644, and p.G413A in SLC39A5 were novel; p.S672G in ZNF644 was reported in one high myopia case; and the remaining three (p.R683 in ZNF644, p.R112W and p.R120W in SCO2) were known in a database (Table 2). Six of the seven were predicted to be damaging by both Polyphen-2 and SIFT, whereas the reported mutation p.S672G in ZNF644 was predicted as damaging by SIFT but benign in Polyphen-2 (Table 2). None of the seven variants was detected in 192 healthy control individuals. No homozygous or compound heterozygous variants were found in CTSH and LEPREL1
Figure
 
Nine variants confirmed in this study. From left to right: pedigrees with variants, the sequence traces harboring the variants, and the corresponding sequences in the healthy controls. Each pedigree was named with the ID of the proband, who is indicated by the black arrow. +, wild-type; M, mutation.
Figure
 
Nine variants confirmed in this study. From left to right: pedigrees with variants, the sequence traces harboring the variants, and the corresponding sequences in the healthy controls. Each pedigree was named with the ID of the proband, who is indicated by the black arrow. +, wild-type; M, mutation.
Table 2
 
Potential Pathogenic Variants in LRPAP1, CTSH, LEPREL1, ZNF644, SLC39A5, and SCO2
Table 2
 
Potential Pathogenic Variants in LRPAP1, CTSH, LEPREL1, ZNF644, SLC39A5, and SCO2
Chr. Position Gene Exon Variant Status Patient 1000G EVS Polyphen2 SIFT Note
Chr4:3533943 LRPAP1 1 NM_002337: c.199delC, p.Q67Sfs*8 Hom HM759 None None NA NA Novel
Chr1:91405805 ZNF644 3 NM_201269: c.1106A>T, p.K369M Het HM832 None None D (0.947) D (0.02) Novel*
Chr1:91405263 ZNF644 3 NM_201269:c.1648G>A, p.A550T Het HM877 None None D (0.996) D (0.37) Novel*
Chr1:91404897 ZNF644 3 NM_201269: c.2014A>G, p.S672G Het HM372 None None B (0.282) D (0.001) Shi et al., 2011
Chr1:91404863 ZNF644 3 NM_201269: c.2048G>C, p.R683T Het HM693 Yes None D (0.558) D (0.034) rs201546602
Chr1:91404360 ZNF644 3 NM_201269: c.2551G>C, p.D851H Het HM878 None None D (0.573) D (0.000) Novel
Chr12:56630745 SLC39A5 11 NM_173596:c.1238G>C, p.G413A Het HM382 None None D (1.000) D (0.000) Novel
Chr22:50962507 SCO2 2 NM_001169110: c.334C>T, p.R112W Het HM640 None 1/13006 D (0.567) D (0.003) rs370130010
Chr22:50962483 SCO2 2 NM_001169110: c.358C>T, p.R120W Het HM789 None 1/13006 D (0.881) D (0.040) rs375954523
The homozygous c.199delC (p.Q67Sfs*8) mutation in LRPAP1 was detected in a 5-year-old boy (HM759), who had bilateral high myopia of −8.00 D with an ocular AL of 32.59 mm for the right eye and 32.24 mm for the left eye. No other abnormalities were detected. No family history of high myopia was reported, but his parents had a consanguineous marriage (Fig.). The other five heterozygous mutations in ZNF644 and SCO2 were all identified in isolated cases. Clinical data of the six patients are summarized in Table 3
Table 3
 
Clinical Data of the Nine Patients With Mutations
Table 3
 
Clinical Data of the Nine Patients With Mutations
Case ID Gene Mutation Effect Age, y Sex BVA Refraction, D AL, mm
OD OS OD OS OD OS
HM759 LRPAP1 c.[197delC];[197delC] Frameshift 5 M 0.40 0.30 –8.00 –8.00 32.59 32.24
HM832 ZNF644 c.[1106A>T];[=] Missense 40 F 0.70 0.10 –14.50 –16.50 NA NA
HM877 ZNF644 c.[1648G>A];[=] Missense 4 M 0.50 0.60 –11.25 –10.75 26.70 26.42
HM372 ZNF644 c.[2014A>G];[=] Missense 27 F 1.00 1.00 –8.50 –9.00 NA NA
HM693 ZNF644 c.[2048G>C];[=] Missense 4 M 0.40 0.60 –8.00 –8.25 26.97 26.74
HM878 ZNF644 c.[2551G>C];[=] Missense 12 M 0.80 0.90 –7.00 –7.00 NA NA
HM382 SLC39A5 c.[1238G>C];[=] Missense 54 F NLP 0.02 NA –16.75 NA NA
HM640 SCO2 c.[334C>T];[=] Missense 32 F 0.50 0.60 –11.00 –9.25 NA NA
HM789 SCO2 c.[358C>T];[=] Missense 6 F 0.20 0.20 –10.25 –11.25 25.40 25.56
Discussion
This analysis of exome sequencing data from 298 patients with eoHM identified nine potential mutations in the LRPAP1, ZNF644, SLC39A5, and SCO2 genes in nine unrelated patients. These mutations are predicted to affect the function of coding residues and were absent in 2010 alleles of controls from the same region (813 individuals with other conditions and 192 healthy control individuals). 
Aldahmesh et al.19 previously identified two homozygous frameshift mutations (Asn202Thrfs*8 and Ile288Argfs∗118) in LRPAP1 in three Arabic consanguineous families with eoHM. In the current study, a novel homozygous frameshift mutation (Q67Sfs8*) in LRPAP1 was detected in a consanguineous Chinese family with eoHM. This novel mutation was located in the first exon of LRPAP1 and it would result in complete loss of the encoded protein if translated, but was more likely to undergo nonsense-mediated decay. This is the third homozygous truncation mutation in LRPAP1 associated with high myopia. Searching the Exome Variant Server (EVS) database (available in the public domain at http://evs.gs.washington.edu/EVS/), revealed two other rare heterozygous truncation variations (c.529delC (p.L177Cfs*17) in 1 of 12,519 alleles and c.202C>T (p.R68*) in 2 of 11,716 alleles). These findings all support homozygous truncation mutations in LRPAP1 as a likely cause of high myopia. 
As reported, LRPAP1 acted as a chaperone of LRP1 and inhibited ligand binding to LRP1, thereby inhibiting the degradation of LRP1.58,59 Mice with homozygous deficiency in LRPAP1 had a reduced expression of LRP in the liver and brain,60 which in turn activated TGF-β.61 Aldahmesh et al.19 also reported that the homozygous mutated LRPAP1 in the patients with high myopia resulted in downregulation of LRP but upregulation of TGF-β. Transforming growth factor-β has been proposed to regulate sclera metabolism in the development of myopia, through modulation of the extracellular matrix in the sclera.62 Thus, LRPAP1 may be associated with myopia through regulation of the expression of TGF-β. Further studies are expected to reveal the molecular pathway of LRPAP1 related to high myopia. 
The ZNF644 is a zinc finger transcription factor that is expressed in the retina and RPE,51 but its biological function has not been identified by any studies. The ZNF644 was proposed to have a role in the development of high myopia because mutations in ZNF644 were detected in the patients with high myopia.51 At present, eight heterozygous mutations in ZNF644 have been reported to associate with high myopia in Chinese and Caucasian subjects, including six missense variants (p.T242M, p.E274V, p.I587V, p.S672G, p.R680G, and p.C699Y) and two untranslated region variants (g.4138C>G, 3′UTR+12C>G; g.4718G>A, 3′UTR+592G>A).51,52 Six of these missense variants are located in exon 3. Of the three heterozygous variants (p.S672G, p.R683T, and p.D851H) detected in the current study, p.S672G has been reported in a previous study51 and p.R683T is present in the 1000Genome data (frequency unknown) but not in EVS (0 of 12,998 alleles). The p.D851H is novel. These three missense mutations also occur in exon 3. 
The SLC39A5 is expressed in the sclera and retina53 and interacts with the BMP/TGF-β pathway,53 which has been proposed to participate in the development of high myopia by modulating extracellular matrix in the sclera. Guo et al.53 reported a heterozygous nonsense mutation (Y47*) co-segregated with autosomal dominant high myopia in a Chinese family, and a heterozygous missense mutation (M304T) in a sporadic case. Our study detected another heterozygous missense variant (c.1238G>C, p.G413A) in a sporadic individual with high myopia. The possibility of a contribution of SLC39A5 to high myopia is expected to be confirmed in further studies. 
Previous exome sequencing and Sanger sequencing has identified four heterozygous mutations (p.Q53*, p.R114H, p.E140K, and p.A259V) in SCO2 in four families with high myopia.54 These four variants are also present in the 1000Genome or EVS databases with a frequency of 0.002, 2 of 13,006, 3 of 13,006, and 114 of 13,006, respectively. The p.R120W and p.R112W mutations detected in the current study also are present in the EVS with a frequency of 1 of 13,006 alleles; our findings are comparable with the previous report. The SCO2 encodes a copper chaperone and is essential for the formation of cytochrome c oxidase (COX),63 which is the terminal enzyme in the respiratory electron transport chain in the mitochondria and plays a critical role in producing aerobic ATP.64 An overlapped mutation E140K in SCO2 mutations has been reported to cause cardioencephalomyopathy with COX deficiency,65,66 as well as high myopia.54 Further studies are expected to identify the specific mechanism of myopia development associated with the COX deficiency. 
In summary, nine mutations were detected in nine families with eoHM by exome sequencing, including a homozygous truncation mutation in LRPAP1 in one family, five heterozygous mutations in ZNF644 in five families, one heterozygous mutation in SLC39A5 in one family, and two heterozygous mutations in SCO2 in two families. Our results provide additional evidence to support the possibility that mutation in LRPAP1 is associated with high myopia. Further studies are expected to evaluate the pathogenicity of the variants in CTSH, LEPREL1, ZNF644, SLC39A5, and SCO2
Acknowledgments
The authors thank all of the patients and controls for their participation in this study. 
Supported by the National Natural Science Foundation of China (U1201221), Natural Science Foundation of Guangdong (S2013030012978), Guangdong Department of Science and Technology Translational Medicine Center (2011A080300002), and the Fundamental Research Funds of State Key Laboratory of Ophthalmology. 
Disclosure: D. Jiang, None; J. Li, None; X. Xiao, None; S. Li, None; X. Jia, None; W. Sun, None; X. Guo, None; Q. Zhang, None 
References
Young TL Metlapally R Shay AE. Complex trait genetics of refractive error. Arch Ophthalmol. 2007; 125: 38–48. [CrossRef] [PubMed]
Percival SP. Redefinition of high myopia: the relationship of axial length measurement to myopic pathology and its relevance to cataract surgery. Dev Ophthalmol. 1987; 14: 42–46. [PubMed]
Saw SM Gazzard G Shih-Yen EC Chua WH. Myopia and associated pathological complications. Ophthalmic Physiol Opt. 2005; 25: 381–391. [CrossRef] [PubMed]
Chen H Wen F Li H The types and severity of high myopic maculopathy in Chinese patients. Ophthalmic Physiol Opt. 2012; 32: 60–67. [CrossRef] [PubMed]
Ripandelli G Rossi T Scarinci F Scassa C Parisi V Stirpe M. Macular vitreoretinal interface abnormalities in highly myopic eyes with posterior staphyloma: 5-year follow-up. Retina. 2012; 32: 1531–1538. [CrossRef] [PubMed]
Baba T Ohno-Matsui K Futagami S Prevalence and characteristics of foveal retinal detachment without macular hole in high myopia. Am J Ophthalmol. 2003; 135: 338–342. [CrossRef] [PubMed]
Benhamou N Massin P Haouchine B Erginay A Gaudric A. Macular retinoschisis in highly myopic eyes. Am J Ophthalmol. 2002; 133: 794–800. [CrossRef] [PubMed]
Ma F Dai J Sun X. Progress in understanding the association between high myopia and primary open-angle glaucoma. Clin Experiment Ophthalmol. 2014; 42: 190–197. [CrossRef] [PubMed]
Chang RT Singh K. Myopia and glaucoma: diagnostic and therapeutic challenges. Curr Opin Ophthalmol. 2013; 24: 96–101. [CrossRef] [PubMed]
Wojciechowski R. Nature and nurture: the complex genetics of myopia and refractive error. Clin Genet. 2011; 79: 301–320. [CrossRef] [PubMed]
Nakanishi H Yamada R Gotoh N A genome-wide association analysis identified a novel susceptible locus for pathological myopia at 11q24.1. PLoS Genet. 2009; 5: e1000660. [CrossRef] [PubMed]
Li YJ Goh L Khor CC Genome-wide association studies reveal genetic variants in CTNND2 for high myopia in Singapore Chinese. Ophthalmology. 2011; 118: 368–375. [CrossRef] [PubMed]
Nishizaki R Ota M Inoko H New susceptibility locus for high myopia is linked to the uromodulin-like 1 (UMODL1) gene region on chromosome 21q22.3. Eye (Lond). 2009; 23: 222–229. [CrossRef] [PubMed]
Solouki AM Verhoeven VJ van Duijn CM A genome-wide association study identifies a susceptibility locus for refractive errors and myopia at 15q14. Nat Genet. 2010; 42: 897–901. [CrossRef] [PubMed]
Li Z Qu J Xu X A genome-wide association study reveals association between common variants in an intergenic region of 4q25 and high-grade myopia in the Chinese Han population. Hum Mol Genet. 2011; 20: 2861–2868. [CrossRef] [PubMed]
Zhang Q Guo X Xiao X Jia X Li S Hejtmancik JF. A new locus for autosomal dominant high myopia maps to 4q22-q27 between D4S1578 and D4S1612. Mol Vis. 2005; 11: 554–560. [PubMed]
Paluru PC Nallasamy S Devoto M Rappaport EF Young TL. Identification of a novel locus on 2q for autosomal dominant high-grade myopia. Invest Ophthalmol Vis Sci. 2005; 46: 2300–2307. [CrossRef] [PubMed]
Yang Z Xiao X Li S Clinical Zhang Q. and linkage study on a consanguineous Chinese family with autosomal recessive high myopia. Mol Vis. 2009; 15: 312–318. [PubMed]
Aldahmesh MA Khan AO Alkuraya H Mutations in LRPAP1 are associated with severe myopia in humans. Am J Hum Genet. 2013; 93: 313–320. [CrossRef] [PubMed]
Guo X Xiao X Li S Wang P Jia X Zhang Q. Nonsyndromic high myopia in a Chinese family mapped to MYP1: linkage confirmation and phenotypic characterization. Arch Ophthalmol. 2010; 128: 1473–1479. [CrossRef] [PubMed]
Zhang Q Guo X Xiao X Jia X Li S Hejtmancik JF. Novel locus for X linked recessive high myopia maps to Xq23-q25 but outside MYP1. J Med Genet. 2006; 43: e20. [CrossRef] [PubMed]
Ratnamala U Lyle R Rawal R Refinement of the X-linked nonsyndromic high-grade myopia locus MYP1 on Xq28 and exclusion of 13 known positional candidate genes by direct sequencing. Invest Ophthalmol Vis Sci. 2011; 52: 6814–6819. [CrossRef] [PubMed]
Young TL Atwood LD Ronan SM Further refinement of the MYP2 locus for autosomal dominant high myopia by linkage disequilibrium analysis. Ophthalmic Genet. 2001; 22: 69–75. [CrossRef] [PubMed]
Young TL Ronan SM Alvear AB A second locus for familial high myopia maps to chromosome 12q. Am J Hum Genet. 1998; 63: 1419–1424. [CrossRef] [PubMed]
Paluru P Ronan SM Heon E New locus for autosomal dominant high myopia maps to the long arm of chromosome 17. Invest Ophthalmol Vis Sci. 2003; 44: 1830–1836. [CrossRef] [PubMed]
Li YJ Guggenheim JA Bulusu A An international collaborative family-based whole-genome linkage scan for high-grade myopia. Invest Ophthalmol Vis Sci. 2009; 50: 3116–3127. [CrossRef] [PubMed]
Nallasamy S Paluru PC Devoto M Wasserman NF Zhou J Young TL. Genetic linkage study of high-grade myopia in a Hutterite population from South Dakota. Mol Vis. 2007; 13: 229–236. [PubMed]
Lam CY Tam PO Fan DS A genome-wide scan maps a novel high myopia locus to 5p15. Invest Ophthalmol Vis Sci. 2008; 49: 3768–3778. [CrossRef] [PubMed]
Paget S Julia S Vitezica ZG Soler V Malecaze F Calvas P. Linkage analysis of high myopia susceptibility locus in 26 families. Mol Vis. 2008; 14: 2566–2574. [PubMed]
Ma JH Shen SH Zhang GW Identification of a locus for autosomal dominant high myopia on chromosome 5p13.3-p15.1 in a Chinese family. Mol Vis. 2010; 16: 2043–2054. [PubMed]
Lin HJ Wan L Tsai Y The TGFbeta1 gene codon 10 polymorphism contributes to the genetic predisposition to high myopia. Mol Vis. 2006; 12: 698–703. [PubMed]
Rasool S Ahmed I Dar R Contribution of TGFbeta1 codon 10 polymorphism to high myopia in an ethnic Kashmiri population from India. Biochem Genet. 2013; 51: 323–333. [CrossRef] [PubMed]
Wang P Li S Xiao X High myopia is not associated with the SNPs in the TGIF, lumican, TGFB1, and HGF genes. Invest Ophthalmol Vis Sci. 2009; 50: 1546–1551. [CrossRef] [PubMed]
Metlapally R Ki CS Li YJ Genetic association of insulin-like growth factor-1 polymorphisms with high-grade myopia in an international family cohort. Invest Ophthalmol Vis Sci. 2010; 51: 4476–4479. [CrossRef] [PubMed]
Mak JY Yap MK Fung WY Ng PW Yip SP. Association of IGF1 gene haplotypes with high myopia in Chinese adults. Arch Ophthalmol. 2012; 130: 209–216. [CrossRef] [PubMed]
Rydzanicz M Nowak DM Karolak JA IGF-1 gene polymorphisms in Polish families with high-grade myopia. Mol Vis. 2011; 17: 2428–2439. [PubMed]
Miyake MYK Nakanishi H Nakata I Insulin-like growth factor 1 is not associated with high myopia in a large Japanese cohort. Mol Vis. 2013; 19: 1074–1081. [PubMed]
Lin HJ Kung YJ Lin YJ Association of the lumican gene functional 3′-UTR polymorphism with high myopia. Invest Ophthalmol Vis Sci. 2010; 51: 96–102. [CrossRef] [PubMed]
Lin HJ Wan L Tsai Y Chen WC Tsai SW Tsai FJ. The association between lumican gene polymorphisms and high myopia. Eye (Lond). 2010; 24: 1093–1101. [CrossRef] [PubMed]
Park SHMJ Joo CK. Absence of an association between lumican promoter variants and high myopia in the Korean population. Ophthalmic Genet. 2013; 34: 43–47. [CrossRef] [PubMed]
Inamori YOM Inoko H Okada E The COL1A1 gene and high myopia susceptibility in Japanese. Hum Genet. 2007; 122: 151–157. [CrossRef] [PubMed]
Nakanishi H Yamada R Gotoh N Absence of association between COL1A1 polymorphisms and high myopia in the Japanese population. Invest Ophthalmol Vis Sci. 2009; 50: 544–550. [CrossRef] [PubMed]
Zhang D Shi Y Gong B An association study of the COL1A1 gene and high myopia in a Han Chinese population. Mol Vis. 2011; 17: 3379–3383. [PubMed]
Han W Leung KH Fung WY Association of PAX6 polymorphisms with high myopia in Han Chinese nuclear families. Invest Ophthalmol Vis Sci. 2009; 50: 47–56. [CrossRef] [PubMed]
Miyake M Yamashiro K Nakanishi H Association of paired box 6 with high myopia in Japanese. Mol Vis. 2012; 18: 2726–2735. [PubMed]
Dai L Li Y Du CY Ten SNPs of PAX6, Lumican, and MYOC genes are not associated with high myopia in Han Chinese. Ophthalmic Genet. 2012; 33: 171–178. [CrossRef] [PubMed]
Zayats T Guggenheim JA Hammond CJ Young TL. Comment on ‘A PAX6 gene polymorphism is associated with genetic predisposition to extreme myopia.' Eye (Lond). 2008; 22: 598–599. [CrossRef] [PubMed]
Simpson CL Hysi P Bhattacharya SS The Roles of PAX6 and SOX2 in myopia: lessons from the 1958 British Birth Cohort. Invest Ophthalmol Vis Sci. 2007; 48: 4421–4425. [CrossRef] [PubMed]
Wang P Xiao X Huang L Guo X Zhang Q. Cone-rod dysfunction is a sign of early-onset high myopia. Optom Vis Sci. 2013; 90: 1327–1330. [CrossRef] [PubMed]
Kinge B Midelfart A Jacobsen G Rystad J. The influence of near-work on development of myopia among university students. A three-year longitudinal study among engineering students in Norway. Acta Ophthalmol Scand. 2000; 78: 26–29. [CrossRef] [PubMed]
Shi Y Li Y Zhang D Exome sequencing identifies ZNF644 mutations in high myopia. PLoS Genet. 2011; 7: e1002084. [CrossRef] [PubMed]
Tran-Viet KN St Germain E Soler V Study of a US cohort supports the role of ZNF644 and high-grade myopia susceptibility. Mol Vis. 2012; 18: 937–944. [PubMed]
Guo H Jin X Zhu T SLC39A5 mutations interfering with the BMP/TGF-beta pathway in non-syndromic high myopia. J Med Genet. 2014; 51: 518–525. [CrossRef] [PubMed]
Tran-Viet KN Powell C Barathi VA Mutations in SCO2 are associated with autosomal-dominant high-grade myopia. Am J Hum Genet. 2013; 92: 820–826. [CrossRef] [PubMed]
Mordechai S Gradstein L Pasanen A High myopia caused by a mutation in LEPREL1, encoding prolyl 3-hydroxylase 2. Am J Hum Genet. 2011; 89: 438–445. [CrossRef] [PubMed]
Guo H Tong P Peng Y Homozygous loss-of-function mutation of the LEPREL1 gene causes severe non-syndromic high myopia with early-onset cataract. Clin Genet. 2014; 86: 575–579. [CrossRef] [PubMed]
Li L Xiao X Li S Detection of variants in 15 genes in 87 unrelated Chinese patients with Leber congenital amaurosis. PLoS One. 2011; 6: e19458. [CrossRef] [PubMed]
Willnow TE Rohlmann A Horton J RAP, a specialized chaperone, prevents ligand-induced ER retention and degradation of LDL receptor-related endocytic receptors. EMBO J. 1996; 15: 2632–2639. [PubMed]
Bu G. The roles of receptor-associated protein (RAP) as a molecular chaperone for members of the LDL receptor family. Int Rev Cytol. 2001; 209: 79–116. [PubMed]
Willnow TE Armstrong SA Hammer RE Herz J. Functional expression of low density lipoprotein receptor-related protein is controlled by receptor-associated protein in vivo. Proc Natl Acad Sci U S A. 1995; 92: 4537–4541. [CrossRef] [PubMed]
Boucher P Li WP Matz RL LRP1 functions as an atheroprotective integrator of TGFbeta and PDFG signals in the vascular wall: implications for Marfan syndrome. PLoS One. 2007; 2: e448. [CrossRef] [PubMed]
McBrien NA. Regulation of scleral metabolism in myopia and the role of transforming growth factor-beta. Exp Eye Res. 2013; 114: 128–140. [CrossRef] [PubMed]
Bourens M Boulet A Leary SC Barrientos A. Human COX20 cooperates with SCO1 and SCO2 to mature COX2 and promote the assembly of cytochrome c oxidase. Hum Mol Genet. 2014; 23: 2901–2913. [CrossRef] [PubMed]
Khalimonchuk O Rodel G. Biogenesis of cytochrome c oxidase. Mitochondrion. 2005; 5: 363–388. [CrossRef] [PubMed]
Jaksch M Ogilvie I Yao J Mutations in SCO2 are associated with a distinct form of hypertrophic cardiomyopathy and cytochrome c oxidase deficiency. Hum Mol Genet. 2000; 9: 795–801. [CrossRef] [PubMed]
Jaksch M Horvath R Horn N Homozygosity (E140K) in SCO2 causes delayed infantile onset of cardiomyopathy and neuropathy. Neurology. 2001; 57: 1440–1446. [CrossRef] [PubMed]
Figure
 
Nine variants confirmed in this study. From left to right: pedigrees with variants, the sequence traces harboring the variants, and the corresponding sequences in the healthy controls. Each pedigree was named with the ID of the proband, who is indicated by the black arrow. +, wild-type; M, mutation.
Figure
 
Nine variants confirmed in this study. From left to right: pedigrees with variants, the sequence traces harboring the variants, and the corresponding sequences in the healthy controls. Each pedigree was named with the ID of the proband, who is indicated by the black arrow. +, wild-type; M, mutation.
Table 1
 
Primers Used to Amplify the Sequences Harboring the Variants in This Study
Table 1
 
Primers Used to Amplify the Sequences Harboring the Variants in This Study
Primer Name Primer Sequence (5′–3′)
Chr1:91404360-F AGACCCTCATAAGCCTGACG
Chr1:91404360-R AGCATTTTCTCCAGGCTCCT
Chr1:91404863-91405263-F TGTGGACGGACATTTCGAGA
Chr1:91404863-91405263-R TTTTGGTCAACGCTGCTTTT
Chr1:91405805-F ACCGAGGATTGCTTTAGTGAT
Chr1:91405805-R TGTGGAGGTGCTTCTTCTCC
Chr4:3533943-F TGGTTCTGTCCCTACGCTC
Chr4:3533943-R GGAGGGTCAGGTCGTTTCTG
Chr12:56630745-F CCATAGGTGTGAGGGGTGG
Chr12:56630745-R CAATCCCAGGGCTCCAGAC
Chr22:50962483-F GGGGTCCACAGTGATGAAGA
Chr22:50962483-R CTGAGGGCTGAGAAGGAGAG
Chr22:50962507-F AAACCAGGCTCTGCTTCCA
Chr22:50962507-R TCTGAGGTCCTGGCTTTTGT
Table 2
 
Potential Pathogenic Variants in LRPAP1, CTSH, LEPREL1, ZNF644, SLC39A5, and SCO2
Table 2
 
Potential Pathogenic Variants in LRPAP1, CTSH, LEPREL1, ZNF644, SLC39A5, and SCO2
Chr. Position Gene Exon Variant Status Patient 1000G EVS Polyphen2 SIFT Note
Chr4:3533943 LRPAP1 1 NM_002337: c.199delC, p.Q67Sfs*8 Hom HM759 None None NA NA Novel
Chr1:91405805 ZNF644 3 NM_201269: c.1106A>T, p.K369M Het HM832 None None D (0.947) D (0.02) Novel*
Chr1:91405263 ZNF644 3 NM_201269:c.1648G>A, p.A550T Het HM877 None None D (0.996) D (0.37) Novel*
Chr1:91404897 ZNF644 3 NM_201269: c.2014A>G, p.S672G Het HM372 None None B (0.282) D (0.001) Shi et al., 2011
Chr1:91404863 ZNF644 3 NM_201269: c.2048G>C, p.R683T Het HM693 Yes None D (0.558) D (0.034) rs201546602
Chr1:91404360 ZNF644 3 NM_201269: c.2551G>C, p.D851H Het HM878 None None D (0.573) D (0.000) Novel
Chr12:56630745 SLC39A5 11 NM_173596:c.1238G>C, p.G413A Het HM382 None None D (1.000) D (0.000) Novel
Chr22:50962507 SCO2 2 NM_001169110: c.334C>T, p.R112W Het HM640 None 1/13006 D (0.567) D (0.003) rs370130010
Chr22:50962483 SCO2 2 NM_001169110: c.358C>T, p.R120W Het HM789 None 1/13006 D (0.881) D (0.040) rs375954523
Table 3
 
Clinical Data of the Nine Patients With Mutations
Table 3
 
Clinical Data of the Nine Patients With Mutations
Case ID Gene Mutation Effect Age, y Sex BVA Refraction, D AL, mm
OD OS OD OS OD OS
HM759 LRPAP1 c.[197delC];[197delC] Frameshift 5 M 0.40 0.30 –8.00 –8.00 32.59 32.24
HM832 ZNF644 c.[1106A>T];[=] Missense 40 F 0.70 0.10 –14.50 –16.50 NA NA
HM877 ZNF644 c.[1648G>A];[=] Missense 4 M 0.50 0.60 –11.25 –10.75 26.70 26.42
HM372 ZNF644 c.[2014A>G];[=] Missense 27 F 1.00 1.00 –8.50 –9.00 NA NA
HM693 ZNF644 c.[2048G>C];[=] Missense 4 M 0.40 0.60 –8.00 –8.25 26.97 26.74
HM878 ZNF644 c.[2551G>C];[=] Missense 12 M 0.80 0.90 –7.00 –7.00 NA NA
HM382 SLC39A5 c.[1238G>C];[=] Missense 54 F NLP 0.02 NA –16.75 NA NA
HM640 SCO2 c.[334C>T];[=] Missense 32 F 0.50 0.60 –11.00 –9.25 NA NA
HM789 SCO2 c.[358C>T];[=] Missense 6 F 0.20 0.20 –10.25 –11.25 25.40 25.56
Supplementary Table S1
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×